Composition for inner beauty comprising Lactiplantibacillus plantarum MTY001

Abstract

The present invention relates to the use of Lactiplantibacillus plantarum MTY001 for inner beauty. It has been confirmed that Lactiplantibacillus plantarum MTY001 according to the present invention not only has no cytotoxicity but also exhibits excellent skin condition improvement activity (maintaining skin structure and elasticity, supplying moisture, antioxidant and anti-inflammatory effects). Therefore, Lactiplantibacillus plantarum MTY001 of the present invention can be utilized in various ways in the fields of cosmetics and food for inner beauty.

Description

Technology Field

[0001] The present invention relates to the use of Lactipiranti Bacillus plantarum MTY001 for inner beauty purposes. Background Technology

[0002] The skin is the largest organ protecting the human body from the external environment and has been exposed to various external factors, including ultraviolet rays, air pollution, chemical irritants, and microbial infections. These factors damage the skin barrier and trigger immune responses, leading to inflammation. Consequently, this has caused skin aging phenomena such as erythema, dryness, itching, wrinkles, and pigmentation. In particular, ultraviolet B (UVB) has been known as a major factor accelerating photoaging by increasing the production of reactive oxygen species within skin cells, thereby inducing DNA damage, degradation of the extracellular matrix, and inflammatory responses.

[0003] With the recent rapid growth of the inner beauty market, the demand for orally ingestible functional ingredients for improving skin health has increased. While Vitamin C, collagen, and hyaluronic acid have been commonly used, they have limitations such as low bioavailability or restricted effects with long-term consumption. Consequently, research on improving skin health using probiotics has been actively conducted, and some probiotic strains have been reported to exhibit antioxidant effects, immune-modulating effects, and skin improvement effects through the gut-skin axis. However, these existing probiotics have primarily focused on improving gut health, and cases directly demonstrating effects on specific skin aging indicators or wrinkle reduction have been limited. The problem to be solved

[0004] Accordingly, the inventors completed the present invention by confirming that Lactiplantibacillus plantarum MTY001 has excellent inner beauty activity (maintaining skin structure and elasticity, moisturizing, antioxidant and anti-inflammatory) at the cellular and animal levels.

[0005] Therefore, the object of the present invention is Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarum The present invention provides a composition for inner beauty comprising the strain MTY001 (Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the pulverized product thereof, the dried product thereof, or a combination thereof. means of solving the problem

[0006] To achieve the above objective, the present invention relates to Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarum The present invention provides a composition for inner beauty comprising the strain MTY001 (Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof.

[0007] In addition, the present invention relates to Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarum The present invention provides a food composition for inner beauty comprising the strain MTY001 (Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the pulverized product thereof, the dried product thereof, or a combination thereof.

[0008] In addition, the present invention relates to Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarum The present invention provides a health functional food composition for inner beauty comprising the strain MTY001 (Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the pulverized product thereof, the dried product thereof, or a combination thereof.

[0009] In addition, the present invention relates to Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarum The present invention provides a cosmetic composition for inner beauty comprising the strain MTY001 (Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof.

[0010] In addition, the present invention relates to Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarumThe present invention provides a cosmetic composition for improving skin condition comprising the strain MTY001 (Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof. Effects of the invention

[0011] It was confirmed that Lactiplantibacillus plantarum MTY001 according to the present invention not only has no cytotoxicity but also exhibits excellent skin condition improvement activity (maintaining skin structure and elasticity, supplying moisture, antioxidant and anti-inflammatory effects). Therefore, Lactiplantibacillus plantarum MTY001 of the present invention can be utilized in various ways in the fields of inner beauty cosmetics and food. Brief explanation of the drawing

[0012] Figure 1 shows the results of evaluating the inner beauty activity of Lactiplantibacillus plantarum MTY001 in skin cells stimulated by UVB (A: MMP1 and MMP2, B: Elastin and Col1a1, C: HAS, D: Filaggrin, E: SOD, F: TNF-α). Figure 2 shows the results of evaluating the anti-wrinkle activity of Lactiplantibacillus plantarum MTY001 in induced hairless mice exposed to UVB. Figure 3 shows the results of confirming the epidermal proliferation-mitigating effect of Lactiplantibacillus plantarum MTY001 in hairless mice exposed to UVB. Figure 4 shows the results of evaluating the expression of inner beauty biomarkers of Lactiplantibacillus plantarum MTY001 in dorsal skin tissue of hairless mice exposed to UVB (A: MMP9 and MMP3, B: Elastin and Col1a1, C: HAS, D: TNF-α and IL6). Specific details for implementing the invention

[0013] The present invention will be described in detail below.

[0014] According to an embodiment of the present invention, the present invention relates to Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarum The present invention provides a composition for inner beauty comprising the strain MTY001 (Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof.

[0015] Lactiplantibacillus plantarum MTY001 of the present invention is a strain isolated from kimchi and contains 16s rRNA represented by the nucleotide sequence of SEQ ID NO. 1. Lactiplantibacillus plantarum MTY001 was deposited with the Biological Resource Center (Jeongeup-si, Jeollabuk-do, Korea) on August 14, 2024, in accordance with the Treaty of Budapest, and was assigned accession number KCTC15788BP.

[0016] In the present invention, the culture medium refers to a medium containing by-products generated through the intake of nutrients and metabolism of a strain and the strain itself, obtained by culturing the strain in a medium; specifically, it may refer to a culture medium or culture product of the strain. Furthermore, a concentrated or diluted solution of the culture medium, a dried or freeze-dried product obtained by drying the culture medium, a modified or purified product of the culture medium, a crushed product obtained by crushing the culture medium, or a mixture thereof may also be included as an active ingredient in the composition of the present invention.

[0017] In a specific embodiment of the present invention, the strain may be included in the form of a live cell, a dead cell, or a combination thereof.

[0018] In the present invention, the cell refers to the strain of the present invention itself and includes the strain itself or a strain isolated from a culture medium by culturing said strain, and may be a live cell or a dead cell. The cell may be obtained by centrifuging the culture medium and taking the portion that settles to the bottom layer, or by letting it sit for a certain period of time and removing the liquid from the top, as it sinks to the bottom layer of the culture medium due to gravity.

[0019] In the present invention, “inner beauty” refers to a concept that exhibits an effect of improving external skin condition by inducing beneficial effects within the body through oral intake, such as improving skin health, inhibiting skin aging, reducing wrinkles, moisturizing the skin, antioxidant, anti-inflammatory, and strengthening the skin barrier. In the field, this term is generally widely used to refer to obtaining external health and beauty effects, including those for the skin, through internal intake.

[0020] In the present invention, the term “inner beauty composition” refers to a composition prepared in an orally ingestible formulation, such as a food, health functional food, beverage, or nutritional supplement, that provides an effect of improving skin condition. In the field, an inner beauty composition is understood to refer to a composition that exhibits cosmetic effects, such as skin moisturization, barrier strengthening, and anti-aging, through oral administration, and the term is used in the same sense in the present invention. However, the present invention includes the possibility that the above-mentioned strain and derivative may also be applied to external cosmetic compositions.

[0021] In a specific embodiment of the present invention, the composition is preferably for improving skin condition.

[0022] In the present invention, “improvement of skin condition” refers to the enhancement of the appearance and functional characteristics of the skin. Specifically, it includes effects such as reducing skin wrinkles, increasing skin elasticity, increasing skin moisturization, strengthening the skin barrier, inhibiting skin aging, whitening the skin, increasing antioxidant activity, inhibiting inflammation, and maintaining skin balance. These terms are understood in the art as concepts commonly used as indicators for evaluating skin health and beauty, and are used with the same meaning in the present invention.

[0023] In a preferred embodiment of the present invention, the improvement of the skin condition may be one or more selected from the group consisting of skin aging improvement, skin wrinkle improvement, skin whitening, skin moisturization, skin barrier strengthening, antioxidant and anti-inflammatory, but the scope of the present invention is not limited thereto.

[0024] In a more preferred embodiment of the present invention, the skin aging may be photoaging or natural aging.

[0025] In the present invention, “natural aging” refers to skin aging that occurs as physiological functions decline and cell division ability decreases over time. Specifically, it includes a decrease in collagen synthesis within the dermis, degeneration of elastic fibers, gradual thinning of the epidermis, and a decrease in water retention capacity. Natural aging is primarily driven by endogenous factors, which is a concept commonly used in the field.

[0026] In the present invention, “photoaging” refers to premature aging of the skin caused by repeated exposure to ultraviolet rays (UV), particularly ultraviolet A (UVA) and ultraviolet B (UVB) rays. Photoaging is characterized by increased production of reactive oxygen species (ROS), DNA damage, accelerated degradation of extracellular matrix proteins (e.g., collagen, elastin), and induction of inflammatory responses, and as a result, external signs of aging such as deepening of wrinkles, hyperpigmentation, skin roughness, and decreased elasticity appear prematurely.

[0027] In other words, natural aging is distinguished from photoaging in that it is a skin aging phenomenon that is accelerated or intensified by exposure to ultraviolet rays, an external factor, whereas natural aging occurs gradually due to intrinsic changes over time.

[0028] In addition to the Lactiplantibacillus plantarum MTY001 strain, the composition of the present invention may further include a preservative, a stabilizer, a carrier, a diluent, a filler, a buffer, a freeze-drying protective agent, or a combination thereof to preserve the viability and stability of the strain and enable long-term storage and distribution. These auxiliary components are those commonly used in the art and may include, for example, sugars, proteins, amino acids, polyols, inorganic salts, emulsifiers, etc., but are not limited thereto.

[0029] In the embodiments of the present invention, it was experimentally confirmed that Lactiplantibacillus plantarum MTY001 of the present invention positively regulates the expression of skin health-related biomarkers and improves histological pathology in skin cells and animal models with photoaging induced. Therefore, Lactiplantibacillus plantarum MTY001 of the present invention can be usefully utilized as an inner beauty material.

[0031] According to another aspect of the present invention, the present invention relates to Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarum A food composition for inner beauty comprising the strain MTY001)(Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the pulverized product thereof, the dried product thereof, or a combination thereof; or a health functional food composition; is provided.

[0032] Foods according to the present invention include, for example, various types of food, beverages, chewing gum, tea, vitamin complexes, functional foods, etc. In addition, foods include, but are not limited to, special nutritional foods (e.g., infant formula, baby food, etc.), processed meat products, fish products, tofu products, jelly products, noodles (e.g., ramen, noodles, etc.), bread products, health supplements, seasoning foods (e.g., soy sauce, soybean paste, red pepper paste, mixed sauce, etc.), sauces, confectionery products (e.g., snacks), candies, chocolates, chewing gum, ice cream, dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various types of kimchi, pickled vegetables, etc.), beverages (e.g., fruit beverages, vegetable beverages, soy milk, fermented beverages, etc.), natural seasonings (e.g., ramen soup, etc.), and food additives. The above foods, beverages, or food additives may be manufactured by conventional manufacturing methods.

[0033] In the present invention, a health functional food refers to a group of foods to which added value has been imparted by utilizing physical, biochemical, or biotechnological methods to enable the function of the food to act or manifest for a specific purpose, or to a food processed by designing it to sufficiently express in the body the in vivo regulatory functions regarding the regulation of biological defense rhythms, disease prevention, and recovery possessed by the food composition. For the purposes of the present invention, the health functional food refers to one intended to enhance inner beauty activity.

[0034] When the composition of the present invention is used as an additive to food or health functional food, the composition may be added as is or used together with other ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient can be appropriately determined according to the purpose of use. Generally, when manufacturing food or beverages, the composition of the present invention may be added to the raw material in an amount preferably 50 parts by weight or less, more preferably 25 parts by weight or less. However, in the case of long-term consumption for the purpose of health control and hygiene, the above amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount greater than the above range.

[0035] The food or health functional food composition of the present invention may contain various ordinary flavoring agents or natural carbohydrates, etc., as additional ingredients that are active ingredients. Examples of the above-mentioned natural carbohydrates are monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; polysaccharides, e.g., dextrin, cyclodextrin, etc., and ordinary sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. The above-mentioned flavoring agents may advantageously include natural flavoring agents (taumatin), stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.).

[0037] According to another aspect of the present invention, the present invention relates to Lactiplantibacillus plantarum MTY001 ( Lactiplantibacillus plantarum The present invention provides a cosmetic composition for inner beauty comprising the strain MTY001)(Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof. Furthermore, the present invention provides Lactiplantibacillus plantarum MTY001( Lactiplantibacillus plantarumThe present invention provides a cosmetic composition for improving skin condition comprising the strain MTY001 (Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof.

[0038] When the Lactibacillus plantarum MTY001 according to the present invention is used as a cosmetic, in addition to the compound, it may include conventional cosmetic base ingredients, such as conventional emulsifiers like stabilizers, solubilizers, pigments, and fragrances, and a carrier. Furthermore, it may be manufactured in any formulation conventionally produced in the cosmetic industry, and although not specifically limited, it may have a formulation such as a lotion, essence, lotion, paste, surfactant-containing cleansing, cream, pack, gel, ointment, powder, patch, or spray.

[0039] In the case where the formulation of the above cosmetic composition is a paste, cream, or gel, one or more selected from the group consisting of animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, and zinc oxide may be used as carrier components, and in the case where the formulation is a lotion or essence, a solvent, a solubilizing agent, or an emulsifying agent may be used as carrier components, for example, one or more selected from the group consisting of water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oil, glycerol aliphatic ester, polyethylene glycol, and fatty acid ester of sorbitan may be used.

[0040] In addition, if the formulation of the cosmetic composition is a powder or a spray, one or more selected from the group consisting of lactose, talc, silica, aluminum hydroxide, calcium silicate, and polyamide powder may be used as carrier components, and in particular, if it is a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether. In addition, if the formulation of the cosmetic composition is a surfactant-containing cleansing agent, one or more selected from the group consisting of aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, and ethoxylated glycerol fatty acid ester may be used as carrier components.

[0041] At this time, the above-mentioned Lactiplantibacillus plantarum MTY001 in the cosmetic product is preferably added in an amount of 0.01 to 50% by weight of the total weight, preferably 0.01 to 30% by weight.

[0043] Redundant content is omitted out of consideration for the complexity of this specification, and terms not otherwise defined in this specification have the meanings commonly used in the technical field to which this invention belongs.

[0045] The present invention will be described in more detail below through examples. These examples are solely for illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0047] [Experimental Example]

[0048] Experimental Example 1. Preparation of Lactipiribacillus plantarum MTY001 strain

[0049] Lactibacillus plantarum in kimchi ( Lactiplantibacillus plantarum ) Strain MTY001 was isolated and contains 16s rRNA represented by the nucleotide sequence of SEQ ID NO. 1. The inventors deposited the above Lactiplantibacillus plantarum MTY001 with the Biological Resource Center (Jeongeup-si, Jeollabuk-do, Korea) on August 14, 2024, in accordance with the Treaty of Budapest, and were assigned accession number KCTC15788BP.

[0051] The above Lactiplantibacillus plantarum MTY001 strain was cultured in MRS medium (Gibco) at 37°C. Culture was terminated when the optical density at 600 nm of the culture medium reached 0.8 to 1.0. Subsequently, the culture medium was centrifuged to separate the cell precipitate from the culture medium (CM). 1 × 10⁶ 8 Probiotic samples were prepared by resuspending CFU cell precipitates in 100 μL of DPBS and stored at 4°C until use. The probiotics were prepared fresh daily and administered to mice. The culture medium was stored at -20°C until use.

[0053] Experimental Example 2. Animal Experiment

[0054] Six-week-old female SKH-1 hairless mice (DOOYEOLBIOTECH, Korea) were purchased and acclimatized to a laboratory environment for one week. All animal experiments were conducted in accordance with the principles of the Institutional Animal Care and Use Committee (IACUC) (IACUC approval number: CNUH-2024-IA0063-00). Mice were randomly divided into the following four groups of seven: DPBS, UVB+DPBS, UVB+L-ascorbic acid (LA.A), and UVB+MTY001. Subsequently, 100 μL of DPBS and the test substance were administered orally daily for 14 weeks. The dosage of L-ascorbic acid or MTY001 was 100 mg / kg and 1 × 10⁶ per mouse, respectively. 8The study was conducted in CFUs. After an initial administration period of 4 weeks, the UVB group was irradiated with gradually increasing doses of UVB on their back skin three times a week starting from week 5. The irradiation schedule was applied as follows: 1 MED (60 mJ / cm²) in the first week (week 5), 2 MED (80 mJ / cm²) in the second week (week 6), 3 MED (100 mJ / cm²) in the third week (week 7), and 4 MED (120 mJ / cm²) from the fourth week (week 8) to week 10 (week 14). At the end of the experiment, at week 14, mice were euthanized by carbon dioxide inhalation, and back skin tissue was collected.

[0056] Experimental Example 3. Wrinkle Evaluation

[0057] Wrinkle formation was evaluated at week 9 (5 weeks after UVB treatment) and week 14 (10 weeks after UVB treatment). After creating back skin replicas using the SILFLO kit (CuDerm Corporation, Dallas, TX, USA), wrinkle parameters were analyzed by imaging with the Visioline VL650 (Courage & Khazaka, Cologne, Germany).

[0059] Experimental Example 4. Histological Analysis

[0060] The harvested dorsal skin tissues were immediately fixed in 4% paraformaldehyde at 4°C for 24 hours. After fixation, the tissues were embedded in paraffin. Hematoxylin-eosin staining was performed to evaluate tissue morphology. Stained images were captured using an EVOSTM M5000 microscope (Invitrogen) at 20x magnification, and six images per group were analyzed using ImageJ software.

[0062] Experimental Example 5. qPCR

[0063] Total RNA is Bioneer's AccuPrep ® Universal RNA Extraction Kit and AccuPower® It was isolated using RT PreMix and reverse transcribed into cDNA. RT-qPCR was performed on an Agilent AriaMx Real-Time PCR Instrument using Bioneer’s AccuPower ® The procedure was performed using 2X GreenStar™ qPCR MasterMix. Thermal cycling consisted of an initial denaturation phase at 95°C for 180 seconds, followed by 40 repeated cycles of 15 seconds at 95°C, 30 seconds at 60°C, and 30 seconds at 72°C. Relative gene expression was calculated using the standard curve method with GAPDH or 18S rRNA as an internal control. The primer sequences used for qPCR are shown in Table 1.

[0064] Gene Species Forward sequence (5' - 3') Reverse sequence (5' - 3') Col1a1 Human GATTCCCTGGACCTAAAGGTGC AGCCTCTCCATCTTTGCCAGCA Elastin Human GGTTGTGTCACCAGAAGCAGCT CCGTAAGTAGGAATGCCTCCAAC Filaggrin Human AGTGCACTCAGGGGGCTCACA CCGGCTTGGCCGTAATGTGT GAPDH Human GACAGTCAGCCGCATCTTCT GGGCCCAATACGACCAAATC HAS Human GCTACCAGTTTATCCAAACG GTGACTCATCTGTCTCACCG MMP1 Human ATGAAGCAGCCCAGATGTGGAG TGGTCCACATCTGCTCTTGGCA MMP2 Human AGCGAGTGGATGCCGCCTTTAA CATTCCAGGCATCTGCGATGAG SOD Human CGTCACCGAGGAGAAGTACC CTGATTTGGACAAGCAA TNFα Human CATTCTGGGAGGGGTCTTCC GGTTGAGGGTGTCTGAAGGA 18S Mouse GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG Col1a1 Mouse AAAAGGAAGCTTGGTCCACT GTGTGGAGAAAGGAGCAGAA Elastin Mouse GGCCATTCCTGGTGGAGTTCC AACTGGCTTAAGAGGTTTGCCTCCA HAS Mouse CCTTCAGAGCACTGGGACGA AGATGAGGCTGGGTCAAGCTAG IL6 Mouse CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG MMP3 Mouse CTCTGGAACCTGAGACATCACC AGGAGTCCTGAGAGATTTGCGC MMP9 Mouse GCTGACTACGATAAGGACGGCA TAGTGGTGCAGGCAGAGTAGGA TNFα Mouse CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG

[0066] Experimental Example 6. Statistical Analysis

[0067] All quantitative data were presented as mean ± standard deviation (SD). One-way analysis of variance was used to assess statistical significance, and Tukey's post-hoc test was applied for multiple comparisons. Statistical significance was determined based on a significance level of p < 0.05, where 'ns' indicated no significant difference. Statistical significance was represented as *, p < 0.05, **, p < 0.01, ***, and p < 0.001. All statistical analyses were performed using SPSS software (Version 10.0, SPSS Inc., Chicago, IL, USA).

[0069] [Example]

[0070] Example 1. Evaluation of the inner beauty activity of Lactiplantibacillus plantarum MTY001 in UVB-stimulated skin cells

[0071] In this example, the inner beauty activity of Lactiplantibacillus plantarum MTY001 was evaluated through the analysis of skin health-related biomarker expression. Specifically, human skin fibroblasts were irradiated with 40 mJ of UVB to induce cell damage (i.e., photoaging). Subsequently, the photoaged cells were treated with a culture medium of Lactiplantibacillus plantarum MTY001 (MTY001-CM) at a concentration of 2%. After extracting RNA and synthesizing cDNA from the cells treated with MTY001-CM, the mRNA expression levels of skin health-related biomarkers (MMP1, MMP2, Elastin, Col1a1, HAS, Filaggrin, SOD, TNF-α) were analyzed via qPCR. The results of the analysis of mRNA expression for each skin health-related biomarker are shown in Figure 1.

[0072] MMP1 and MMP2 are skin health-related biomarkers involved in the degradation of the extracellular matrix and wrinkle formation. As shown in Figure 1A, the mRNA expression of MMP1 and MMP2 in UVB-irradiated skin cells was significantly increased, and it was confirmed that their expression was significantly reduced to the level of the normal control group upon treatment with Lactiplantibacillus plantarum MTY001.

[0073] Elastin and Col1a1 are extracellular matrix proteins essential for maintaining skin structure and elasticity. As shown in Figure 1B, UVB-irradiated skin cells showed similar levels of Elastin mRNA expression, and it was confirmed that the expression was significantly increased compared to the normal control group upon treatment with Lactiplantibacillus plantarum MTY001. Additionally, UVB-irradiated skin cells showed a significant decrease in Col1a1 mRNA expression, and it was confirmed that the expression was significantly increased to the level of the normal control group upon treatment with Lactiplantibacillus plantarum MTY001.

[0074] HAS is a hyaluronic acid synthase (HAS) that is important for skin hydration and skin barrier protection. Filaggrin is a structural protein essential for the integrity of the skin barrier and moisture retention. As shown in Figures 1C and 1D, the mRNA expression of HAS and Filaggrin was significantly reduced in UVB-irradiated skin cells, and it was confirmed that their expression was significantly increased compared to the normal control group upon treatment with Lactiplantibacillus plantarum MTY001.

[0075] As shown in Figure 1E, it was confirmed that the mRNA expression of the reactive oxygen species neutralizing enzyme SOD was significantly reduced in UVB-irradiated skin cells, and that its expression was significantly increased to the level of the normal control group upon treatment with Lactiplantibacillus plantarum MTY001.

[0076] As shown in Figure 1F, the mRNA expression of TNF-α, an inflammatory cytokine contributing to skin inflammation and aging, was significantly increased in UVB-irradiated skin cells, and it was confirmed that its expression was significantly reduced to the level of the normal control group upon treatment with Lactiplantibacillus plantarum MTY001.

[0078] The above results confirmed that Lactiplantibacillus plantarum MTY001 regulates key biomarkers related to maintaining skin structure and elasticity, protecting the skin barrier, hydration, antioxidant effects, and inflammation by controlling the expression of skin health-related biomarkers. In other words, since Lactiplantibacillus plantarum MTY001 exerts broad protective effects against UVB-induced cellular stress, it implies that it can help promote skin health (i.e., inner beauty activity).

[0080] Example 2. Evaluation of the anti-wrinkle activity of Lactiplantibacillus plantarum MTY001 in hairless mice exposed to UVB

[0081] In this example, the probiotic MTY001 was analyzed for skin damage and wrinkle formation in an animal model. To this end, a 14-week study was conducted using a hairless mouse model in which skin damage was induced by UVB. Mice were randomly assigned to receive daily oral administration of DPBS (control group); L-ascorbic acid (LA.A., positive control); or Lactiplantibacillus plantarum MTY001 from week 1 to week 14. UVB irradiation was applied three times a week starting from week 5, with gradually increasing intensity. Wrinkle evaluation was performed twice during the study period: 5 weeks after UVB exposure (week 9, 1st test) and 10 weeks after (week 14, 2nd test), respectively. The results of observing the dorsal skin of the mouse models are shown in Figure 2.

[0082] As shown in Figure 2, mice exposed to UVB for 10 weeks developed distinct wrinkles on their dorsal skin. The UVB+DPBS group showed a significant increase in wrinkle parameters (number, length, and area of ​​wrinkles) at both 5 and 10 weeks after UVB treatment compared to the non-irradiated DPBS control group. However, the MTY001 administration group and the positive control (LA.A.) showed a significant decrease in wrinkle parameters increased by UVB induction at the same time point. These results indicate that oral administration of Lactiplantibacillus plantarum MTY001 provides excellent protection against the development and severity of wrinkles caused by UVB.

[0084] Example 3. Confirmation of the epidermal proliferation-mitigating effect of Lactiplantibacillus plantarum MTY001 in hairless mice exposed to UVB

[0085] In this embodiment, to investigate the effect of Lactiplantibacillus plantarum MTY001 on skin structure, an experiment was conducted using dorsal skin tissue from hairless mice collected after 14 weeks of oral administration. Dorsal skin was collected from the hairless mice, and tissue section slides were prepared. The tissue sections were stained with H&E, and the thickness of the skin epidermal layer was determined. Photographs of the H&E-stained tissue sections (20x magnification, scale bar = 125 μm) and the results of measuring the skin epidermal layer thickness are shown in Fig. 3.

[0086] As shown in Figure 3, when the skin epidermal layer thickness was measured, it was confirmed that the UVB+DPBS group showed a significant increase in skin epidermal layer thickness compared to the non-irradiated DPBS control group (i.e., confirmation of epidermal hypertrophy). However, it was confirmed that the skin epidermal layer thickness increased by UVB induction in the MTY001 administration group and the positive control group (LA.A.) decreased to the level of the non-irradiated DPBS control group at the same time point. The above results confirmed that Lactiplantibacillus plantarum MTY001 effectively alleviates the epidermal hypertrophy caused by UVB, which implies that it has protective potential against UVB-induced skin damage.

[0088] Example 4. Evaluation of Inner Beauty Biomarker Activity of Lactiplantibacillus plantarum MTY001 in Hairless Mice Exposed to UVB

[0089] In this example, the effect of Lactiplantibacillus plantarum MTY001 on the mRNA expression of skin health-related biomarkers in the dorsal skin tissue of hairless mice exposed to UVB was evaluated. The experiment was performed using the same items and methods as in Experimental Example 1 above.

[0090] As shown in Figure 4A, the mRNA expression of MMP9 and MMP3 in mice exposed to UVB was significantly increased compared to mice not exposed to UVB (normal control group), and it was confirmed that the expression was significantly decreased to the normal control group level upon treatment with Lactiplantibacillus plantarum MTY001 or LA.A.

[0091] As shown in Figure 4B, the mRNA expression of Elastin was decreased in UVB-irradiated mice, and it was confirmed that its expression was significantly increased compared to the normal control group upon treatment with Lactiplantibacillus plantarum MTY001 or LA.A. In addition, the mRNA expression of Col1a1 was significantly decreased in UVB-irradiated mice, and it was confirmed that its expression was significantly increased to the level of the normal control group upon treatment with Lactiplantibacillus plantarum MTY001 or LA.A.

[0092] As shown in Figure 4C, it was confirmed that the mRNA expression of HAS was significantly reduced in UVB-irradiated mice, and that its expression was significantly increased compared to the normal control group upon treatment with Lactiplantibacillus plantarum MTY001 or LA.A.

[0093] As shown in Figure 4D, it was confirmed that mRNA expression of TNF-α and IL-6 was significantly increased in UVB-irradiated mice, and that their expression was significantly decreased to normal control levels upon treatment with Lactiplantibacillus plantarum MTY001 or LA.A.

[0094] The above results indicate that Lactipirectabacillus plantarum MTY001 regulates key biomarkers related to skin structure and elasticity, hydration, antioxidant defense, and inflammation by regulating the expression of skin health-related biomarkers at both the cellular and animal levels.

[0096] Overall, the inventors have confirmed that Lactiplantibacillus plantarum MTY001 is not only non-cytotoxic but is also effective in improving skin condition (maintaining skin structure and elasticity, supplying moisture, and providing antioxidant and anti-inflammatory effects). In particular, it exhibited a significant level of activity in animal models orally administered with Lactiplantibacillus plantarum MTY001 of the present invention, demonstrating high utility for inner beauty. Therefore, Lactiplantibacillus plantarum MTY001 of the present invention can be utilized in various ways in the fields of cosmetics and food for inner beauty.

[0098] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

[0100] Depository Name: Korea Biological Resources Center Trustee Number: KCTC15788BP Date of Deposit: 2024-08-14

Claims

Claim 1 Lactibacillus plantarum MTY001( Lactiplantibacillus plantarum An inner beauty composition comprising the strain (MTY001)(Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof, wherein the composition is for improving one or more skin conditions selected from the group consisting of improving skin aging caused by ultraviolet rays, improving skin wrinkles, and moisturizing the skin. Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 Lactibacillus plantarum MTY001( Lactiplantibacillus plantarum A food composition for inner beauty comprising the strain (MTY001)(Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the pulverized product thereof, the dried product thereof, or a combination thereof, wherein the composition is for improving one or more skin conditions selected from the group consisting of improving skin aging caused by ultraviolet rays, improving skin wrinkles, and moisturizing the skin. Claim 6 Lactibacillus plantarum MTY001( Lactiplantibacillus plantarum A health functional food composition for inner beauty comprising the strain (MTY001)(Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the pulverized product thereof, the dried product thereof, or a combination thereof, wherein the composition is for improving one or more skin conditions selected from the group consisting of improving skin aging caused by ultraviolet rays, improving skin wrinkles, and moisturizing the skin. Claim 7 Lactibacillus plantarum MTY001( Lactiplantibacillus plantarum A cosmetic composition for inner beauty comprising the strain (MTY001)(Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof, wherein the composition is for improving one or more skin conditions selected from the group consisting of improving skin aging caused by ultraviolet rays, improving skin wrinkles, and moisturizing the skin. Claim 8 Lactibacillus plantarum MTY001( Lactiplantibacillus plantarum A cosmetic composition for improving skin condition comprising the strain (MTY001)(Deposit No.: KCTC15788BP), the culture medium thereof, the concentrate thereof, the lysate thereof, the dried product thereof, or a combination thereof, wherein the composition is one or more skin condition improving selected from the group consisting of improving skin aging caused by ultraviolet rays, improving skin wrinkles, and moisturizing the skin.

Images