A strain of Halomonas sp. JJY01 overexpressing acetyl-CoA acetyltransferase and Method for producing polyhydroxybutyl acid (PHB) from acetic acid using the same

Abstract

The present invention relates to a strain of the genus Halomonas that produces polyhydroxybutyric acid (PHB) with enhanced activity of acetyl-CoA acetyltransferase protein; a method for producing PHB comprising the step of culturing said strain in a medium; a composition for producing PHB comprising said strain, a culture of said strain, a fermented product of said strain, or a combination of two or more of these; and a method for producing said strain.

Description

Technology Field

[0001] The present invention relates to a strain of the genus Halomonas that produces polyhydroxybutyric acid (PHB) with enhanced activity of acetyl-CoA acetyltransferase protein; a method for producing PHB comprising the step of culturing said strain in a medium; a composition for producing PHB comprising said strain, a culture of said strain, a fermented product of said strain, or a combination of two or more of these; and a method for producing said strain. Background Technology

[0003] The production and demand for petrochemical plastics are increasing every year. In 2016, 23 million tons of plastic were released into marine ecosystems, and it is estimated that 53 million tons of plastic will be released by 2030 (Borrelle et al., 2020). Most petrochemical plastics are non-biodegradable and generate microplastics, and non-biodegradable waste plastics cause harm to the ecological environment, including top predators (Setδlδ et al., 2014; Shen et al., 2020). To address these problems, research related to the production of biodegradable plastics to replace petroleum-based synthetic plastics is active.

[0004] One of the most promising polymers for such biodegradable plastics is polyhydroxyalkanoate (PHA) (Muhammadi et al., 2015). PHA is a natural polyester material that microorganisms accumulate inside to store energy and reducing capacity when carbon sources are abundant while elements necessary for growth, such as nitrogen, oxygen, phosphorus, and magnesium, are scarce. PHA exhibits excellent biodegradability under both anaerobic and aerobic conditions (Muhammadi et al., 2015) and possesses physical properties capable of mimicking the strength and flexibility of synthetic polymers (Behera et al., 2022). PHA possesses not only biodegradability but also biocompatibility, allowing for a wide range of applications including medical fields such as wound care, drug delivery, and tissue engineering. Furthermore, as it is composed of chiral hydroxy acids, which have potential as synthetic materials for anti-human immunodeficiency virus treatments, anticancer agents, antibiotics, and vitamins, it can also be applied as a pharmaceutical.

[0005] PHA monomers can consist of short-chain monomers such as hydroxybutyrate (HB or C4) or hydroxyvalerate (HV or C5) or long-chain monomers such as hydroxydecanoate (HDD). Among PHA monomers, polyhydroxybutyrate (PHB) is considered the most realistic alternative to petrochemical plastics.

[0006] Biomass-derived volatile fatty acids (VFAs) are a promising carbon source that can reduce the cost of PHA production (Chang et al., 2010). Among these volatile fatty acids, acetic acid is considered the most abundant and is used as a direct metabolic precursor for short-chain PHA (Anjum et al., 2016). However, acetic acid is known to inhibit bacterial growth regardless of its own acidic properties (Chung et al., 1997).

[0007] Bacillus genus, Comamonas genus, Halomonas genus, Ralstonia eutropha( Ralstonia eutropha The genera *Halomonas* and *Pseudomonas* are known to be bacteria capable of producing PHA using organic acids (Armu et al., 2021; Chakraborty et al., 2009; Wang et al., 2019; Zakaria et al., 2010). Among these, *Halomonas* is a halophilic strain that grows under high salinity conditions of 2% to 10% and produces PHA by actively utilizing acetic acid as a carbon source; thus, it is evaluated as an economical strain for PHA production (Jeon et al., 2022; Park et al., 2020). Furthermore, since *Halomonas* can produce PHA under non-bactericidal and high salinity conditions, it is believed that PHA production using organic acids is possible in food wastewater (Kant et al., 2023).

[0008] However, because the expected yield is lower compared to other strains that produce PHA from organic acids, such as Ralstonia eutropha, current research on the genus Halomonas is focused on increasing PHA production (Huschner et al., 2015).

[0009] The synthesis pathway of PHB in halophilic bacteria consists of a three-step reaction (Wang et al., 2019). The first step involves the combination of two acetyl-CoA molecules to form acetoacetyl-CoA in a reaction catalyzed by 3-ketothiolase. Subsequently, acetoacetyl-CoA is converted to 3-hydroxybutyryl-CoA in a reaction catalyzed by NADPH-dependent acetoacetyl-CoA reductase. Finally, PHB is synthesized by the polymerization of 3-hydroxybutyryl-CoA in a reaction catalyzed by PHB synthase.

[0010] Accordingly, PHB accumulation depends significantly on the concentrations of acetyl-CoA, acetoacetyl-CoA, and 3-hydroxybutyl-CoA produced in the TCA cycle (Anderson and Dawes, 1990; Park et al., 2021).

[0011] Acetyl-CoA acetyltransferase (atoAD) is an enzyme involved in short-chain fatty acid metabolism in prokaryotes (Jeon et al., 2017; Jenkins and Nunn, 1987). This enzyme plays a key role in breaking down short-chain fatty acids, such as acetic acid or propionate, into two molecules of acetyl-CoA, and the resulting acetyl-CoA is a central molecule in cellular metabolism in the PHB synthesis pathway, as previously described.

[0012] Against this backdrop, the inventors sought to increase PHA productivity using microorganisms of the genus Halomonas, which are halophilic bacteria.

[0013] Therefore, the genus Halomonas ( Halomonas A novel strain capable of increasing the utilization of organic acids such as acetic acid and the production of PHB, a PHA monomer, by introducing the atoAD gene into the sp.) YLGW01 strain. Halomonas sp. JJY01 was developed. Prior art literature

[0015] Korean Registered Patent No. 10-2348818 The problem to be solved

[0016] One objective of the present invention is to provide a strain of the genus Halomonas that produces polyhydroxybutyric acid (PHB) with enhanced activity of the acetyl-CoA acetyltransferase protein.

[0017] Another objective of the present invention is to provide a method for producing PHB, comprising the step of culturing the above-mentioned Halomonas strain in a medium.

[0018] Another objective of the present invention is to provide a composition for producing PHB comprising the above-mentioned Halomonas strain, a culture of the strain, a fermented product of the strain, or a combination of two or more of these.

[0019] Another objective of the present invention is to provide a method for producing a strain of the genus Halomonas that produces PHB, comprising the step of enhancing the activity of an acetyl-CoA acetyltransferase protein in a microorganism of the genus Halomonas. means of solving the problem

[0021] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions provided below.

[0022] In addition, a person skilled in the art can recognize or identify a number of equivalents to the specific embodiments of the present application described herein by using only ordinary experiments. In addition, such equivalents are intended to be included in the present application.

[0024] One aspect of the present invention for achieving the above objective provides a strain of the genus Halomonas that produces polyhydroxybutyric acid (PHB) with enhanced activity of the acetyl-CoA acetyltransferase protein.

[0025] In the present invention, the term "acetyl-CoA acetyltransferase" refers to a type of enzyme that acts in the PHB synthesis pathway and synthesizes acetyl-CoA by participating in fatty acid metabolism in prokaryotes. Specifically, it acts during the oxidation of fatty acids such as acetic acid or propionate to synthesize two acetyl-CoA molecules.

[0026] For example, in the present invention, acetyl-CoA acetyltransferase is expressed from the atoAD gene and synthesizes acetyl-CoA using acetic acid among fatty acids.

[0027] The above acetyl-CoA acetyltransferase is a polypeptide composed of the amino acid sequence of SEQ ID NO. 1 or containing the amino acid sequence of SEQ ID NO. 1, and may be expressed from the atoAD gene composed of SEQ ID NO. 2, but is not limited thereto. In addition, the above acetyl-CoA acetyltransferase may be derived from the "Escherichia coli K12 strain," but is not limited to any microorganism that expresses acetyl-CoA acetyltransferase.

[0029] Specifically, the acetyl-CoA acetyltransferase may be composed of, or include, an amino acid sequence having homology or identity with the amino acid sequence of SEQ ID NO. 1 at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and less than 100%, or an amino acid sequence having such homology or identity. Furthermore, it is obvious that polypeptides having such homology or identity and exhibiting efficacy corresponding to the said amino acid sequence are also included within the scope of the present invention, provided that some sequences are deleted, modified, substituted, or added.

[0030] The above "homology and identity" refer to the degree of relationship between two given amino acid sequences or polynucleotide sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.

[0031] The sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can be hybridized under moderate or high stringent conditions, generally covering at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or total length. Hybridization also considers polynucleotides containing degenerate codons instead of codons.

[0032] Homology or identity regarding the above polypeptide or polynucleotide sequences can be determined, for example, using the BLAST algorithm according to the literature [Ref. Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson (Ref. Methods Enzymol., 183, 63, 1990). Based on this BLAST algorithm, programs called BLASTN or BLASTX have been developed (Ref. http: / / www.ncbi.nlm.nih.gov). In addition, whether any amino acid or polynucleotide sequence has homology, similarity, or identity can be determined by comparing the sequences by Southern hybridization experiments under defined strict conditions, and the defined appropriate hybridization conditions can be determined by methods within the scope of the art and well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology).

[0033] In the present invention, the term "increase" of protein activity means that the activity of a polypeptide is enhanced compared to its intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and enhancement.

[0034] The above enhancement may include exhibiting activity that was not originally possessed, or exhibiting activity that is enhanced compared to the intrinsic activity or activity prior to modification.

[0035] For example, the above "exhibiting activity that was not originally possessed" may be, but is not limited to, the "introduction of a protein." The introduction of the protein means that a gene that was not originally possessed by the Halomonas strain is expressed within the Halomonas strain, thereby exhibiting the activity of a specific protein, or exhibiting enhanced or improved activity compared to the intrinsic activity of the said protein or its activity prior to modification. For example, a polynucleotide encoding a specific protein may be introduced into the chromosome of the Halomonas strain, or a vector containing a polynucleotide encoding a specific protein may be introduced into the Halomonas strain, thereby exhibiting its activity.

[0036] Enhancement of the activity of the above protein can be achieved by introducing an exogenous polypeptide or by enhancing the activity of an intrinsic polypeptide. Whether the activity of the above polypeptide is enhanced can be confirmed by the enhancement of the activity level, expression amount, or amount of product released from the said polypeptide.

[0037] Enhancement of the activity of the above protein may be achieved by applying various methods well known in the field, and is not limited to those that can enhance the activity of the target protein.

[0039] In the present invention, the term "polyhydroxybutyrate (PHB)" refers to a compound belonging to polyester, which is a type of polyhydroxyalkanoate (PHA) that is a biodegradable plastic and a polymer of 3-hydroxybutyrate. PHB may be used interchangeably with poly-3-hydroxybutyrate (Poly(3-hydroxybutyrate, P(3HB)), poly-3-hydroxybutanoate (poly-3-hydroxybutanoate, P3HA), and 3-hydroxybutyrate homopolymer. Furthermore, PHB is a cellular storage material that is accumulated as a carbon source and energy source by various microorganisms, and is a material that is gaining attention as a biodegradable plastic to replace existing petrochemical plastics.

[0041] In the present invention, the term “production” means the ability to synthesize or / and accumulate polyhydroxybutyric acid (PHB). Specifically, it may mean the ability to synthesize PHB by the process of FIG. 1, but is not limited thereto. More specifically, the synthesis of PHB may be carried out by the following three sequential steps, but is not limited thereto.

[0042] i) A step in which two acetyl-CoA molecules are combined by 3-ketothiolase to form acetoacetyl-CoA.

[0043] ii) The step in which acetoacetyl-CoA is converted to 3-hydroxybutyryl-CoA by NADPH-dependent acetoacetyl-CoA reductase

[0044] iii) Step in which 3-hydroxybutyl-CoA is polymerized into PHB by PHB synthase

[0046] The production of the above PHB may increase due to reasons such as the activation of the PHB synthesis pathway and the supply of carbon sources. The activation of the above PHB synthesis pathway may be an increase in the concentration of acetyl-CoA, acetoacetyl-CoA, and 3-hydroxybutyl-CoA produced in the TCA cycle, or an enhancement in the activity of the enzyme used in the PHB synthesis pathway, but is not limited thereto.

[0047] For example, the genus Halomonas of the present application ( Halomonas The JJY01 strain increases PHB production by increasing the synthesis of acetyl-CoA through the enhancement of the activity of acetyl-CoA acetyltransferase protein.

[0049] In the present invention, the term "Halomonas genus ( Halomonas The strain *sp.") is a halophilic Gram-negative bacterium. Furthermore, the aforementioned strain is known to survive at NaCl concentrations of 5 to 25% and to be capable of producing PHA; however, it has the disadvantage of a lower expected yield compared to other strains that produce PHA from organic acids, such as *Ralstonia eutropha*. Additionally, the genus *Halomonas* includes H. alimentaria , H. alkaliphila , H. almeriensis , H. anticariensis, H. aquamarina , H. axialensis , H. boliviensis , H. campaniensis , H. campisalis , H. canadensis, H. cupida , H. denitrificans , H. desiderata , H. elongata , H. euryhalina , H. gomseomensis, H. halmophila , H. halocynthiae , H. halodenitrificans , H. halodurans , H. halophila , H. hamiltonii, H. hydrothermalis , H. indalinina , H. israelensis , H. janggokensis , H. johnsoniae , H. koreensis, H. magadiensis , H. marisflavi , H. maura , H. meridiana , H. muralis , H. neptunia , H. nitroreducens, H. organivorans , H. pacifica ​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​ , H. pantellerensis , H. salaria , H. salina , H. stevensii, H. subglaciescola , H. sulfidalis , H. taeanensis , H. titanicae , H. variabilis , H. ventosae, H. venusta It includes 48 species, most of which were found in seas or tidal flats, and among these, the species found in humans are H. hamiltonii , H. johnsoniae , H. stevensii There are three types, such as the above. The Halomonas species that can be used in the present invention are not limited to the above 48 species and various Halomonas strains known to those skilled in the art. Specifically, strains such as YLGW01 may be included, but are not limited to strains that are easily obtainable by those skilled in the art or are known strains.

[0050] For example, in the present invention, the Halomonas strain JJY01 was produced by improving the Halomonas strain YLGW01.

[0051] The term "strain" in this invention refers to a collection of individuals derived from a single cell that have proliferated through asexual reproduction and possess homogeneous genetic characteristics; within a single species, there exist multiple genetic variants with different genetic characteristics. In this invention, "strain" and "microorganism" may be used interchangeably without limitation as having the same meaning.

[0053] The term "accession number KFCC11972P" of the present invention refers to a novel strain of the genus Halomonas developed by the inventors, and "Halomonas ( Halomonas It corresponds to the strain named "sp.) JJY01 strain".

[0054] The above "Halomonas genus ( Halomonas ​​​​​​​​​​The strain "sp.) JJY01" is a novel strain belonging to the genus Halomonas developed by the inventors. The novel strain of the present invention may have enhanced acetyl-CoA acetyltransferase protein activity, thereby improving the production capacity of PHB compared to the wild-type strain. The inventors named the said strain JJU01 and deposited it under accession number KFCC 11972P. In the present invention, "genus Halomonas ( Halomonas "sp.) JJY01 strain," "new strain," and "improved strain" may be used interchangeably without restriction as having the same meaning.

[0055] Specifically, the novel Halomonas genus of the present invention ( Halomonas sp.) Strain JJY01 is a wild-type strain of the genus Halomonas ( Halomonas It is a strain improved from sp.) YLGW01, but of the genus Halomonas ( Halomonas sp.) As long as it has the same characteristics as the JJY01 strain, it is not limited thereto. Additionally, it may be obtained by methods such as distribution, cultivation, or manufacturing, but is not limited thereto.

[0056] The above "wild-type strain" is a Halomonas genus ( Halomonas It refers to sp.) YLGW01. Specifically, the above Halomonas genus ( Halomonas sp.) YLGW01 is a type of wild-type strain isolated from the Korean coast. It can be donated by the Biotransformation Laboratory at the Department of Biotechnology, Konkuk University, but there are no restrictions on the method of obtaining it, such as purchase, isolation, or culture.

[0058] In the present invention, the term “atoAD gene” refers to a gene encoding acetyl-CoA acetyltransferase, which may consist of the polynucleotide sequence of SEQ ID NO. 2 or include the polynucleotide sequence described as SEQ ID NO. 2, but is not limited thereto.

[0059] Specifically, the atoAD gene may have a polynucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO. 2 and / or SEQ ID NO. 2. Furthermore, it is obvious that an acetyl-CoA acetyltransferase having an amino acid sequence in which some sequences are deleted, modified, substituted, or added is included within the scope of the present invention, provided that it has such homology or identity and exhibits a function corresponding to the acetyl-CoA acetyltransferase.

[0060] The above "polynucleotide" refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, and is a DNA or RNA strand of a certain length or longer; more specifically, it refers to a polynucleotide fragment encoding the said variant. If the said polynucleotide is a functional aggregate of polynucleotides, it may be described as a gene. In the present invention, polynucleotide and gene, and polynucleotide sequence and base sequence may be used interchangeably.

[0061] The above "homology and identity" are as described above.

[0062] The expression of the above atoAD gene may be induced from the promoter of the gene and a promoter derivative, but the method of expression is not limited thereto.

[0063] The above promoter may be a known promoter, but specifically may be a trc promoter, and is not limited thereto.

[0064] The derivative of the above promoter includes known substances that cause the operation of the promoter, and may be substances synthesized within the microorganism or substances supplied from an external source, but are not limited thereto. Specifically, it may be IPTG (isopropyl-1-thio-β-D-galactopyranoside), but is not limited thereto.

[0066] Another aspect of the present invention provides a method for producing PHB, comprising the step of culturing a strain of the genus Halomonas in a medium.

[0067] The above Halomonas genus ( Halomonas As for sp.), PHB, etc., it is as described above.

[0068] In the present invention, the term "culture" means growing the strain of the present application under appropriately controlled environmental conditions. The culture process of the present application may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culture may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0069] In the present invention, the term "medium" refers to a substance mixed with nutrients as the main component required to culture a strain, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the strain of the present application may be any medium commonly used for culturing strains of the genus Halomonas without any particular limitations.

[0070] Specifically, the components of the culture medium may include marine broth (DIFCO, USA), soytone (DIFCO, USA), sodium acetate, NaCl, NaCl2·6H2O, Na2SO4, CaCl2·6H2O, KCl, KBr, SrCl2·6H2O, H3BO3, NaSiO3·9H2O, NaF, NH4NO3, and Fe3PO4·4H2O, and may be included in combination of one or more of the above components, but are not limited thereto. Any substance that is obvious to those skilled in the art as being used for culturing Halomonas strains may be included without special limitation.

[0071] For example, in fed-batch culture, the concentrations of each component were used as 5 g / L soytone (DIFCO, USA), 10 g / L sodium acetate, 24 g / L NaCl, 11 g / L NaCl2·6H2O, 4 g / L Na2SO4, 2 g / L CaCl2·6H2O, 0.7 g / L KCl, 0.1 g / L KBr, 0.04 g / L SrCl2·6H2O, 0.03 g / L H3BO3, 5 mg / L NaSiO3·9H2O, 3 mg / L NaF, 2 mg / L NH4NO3, and 1 mg / L Fe3PO4·4H2O, but are not limited thereto.

[0073] The method for producing PHB according to the present invention may include supplying acetic acid as a carbon source to the medium.

[0074] The term "carbon source" in the present invention refers to a substance that can be used as a substrate for the acetyl-CoA acetyltransferase, and may include volatile fatty acids such as acetate, propionate, butyrate, and valerate. Specifically, it may include acetate, but is not limited thereto. The "carbon source" may be used for acetyl-CoA synthesis, but is not limited thereto.

[0075] For example, the present invention HalomonasAcetic acid was supplied to the sp. JJY01 strain, and the acetic acid consumption rate and PHB production were confirmed. At this time Halomonas The sp. JJY01 strain is a wild-type strain. Halomonas It was confirmed that the acetic acid consumption rate increased and the amount of PHB synthesized increased compared to sp. YLGW01.

[0076] The term "acetate" in this invention has the chemical formula CH3COOH and is a type of volatile fatty acid also known as a short-chain fatty acid, and can be used as a precursor of acetyl-CoA. Specifically, it can be supplied as a substrate for acetyl-CoA acetyltransferase and can be supplied as acetate itself, but any substance capable of forming acetate ions, such as sodium acetate and acetoacetate, can be used without limitation.

[0078] The method for producing PHB according to the present invention may include supplying IPTG (isopropyl-1-thio-β-D-galactopyranoside) to the medium.

[0079] The term "IPTG (isopropyl-1-thio-β-D-galactopyranoside)" of the present invention is an analog of allolactose that triggers the transcription of the Lac operon and can be used to induce protein expression controlled by the Lac operon. Specifically, it acts to bind to the lac repressor (LacI), similar to allolactose. However, unlike allolactose, it cannot be hydrolyzed in cells, so when used in molecular biology experiments, it has the characteristic of maintaining a constant concentration. When IPTG is supplied to typical E. coli, at low concentrations it is transported into the body of the microorganism through the action of lactose permease, but at high concentrations it is transported into the cell independently of lactose permease.

[0080] For example, in the present invention, when producing an improved strain, LacIq-P together with the atoAD genetrc Since a polynucleotide sequence was introduced, the expression of the atoAD gene can be induced by supplying IPTG. The above LacIq-P trc The polynucleotide sequence was derived from the known plasmid pSEVA434 plasmid (Silva-Rocha et al., 2013).

[0081] The above LacIq is a gene encoding a lac repressor, and is characterized by being expressed more strongly than the wild-type lac repressor.

[0082] The above P trc (trc promoter) is a promoter created by combining a lac promoter and a trp promoter, and is one of the powerful promoters known to those skilled in the art.

[0083] The concentration of the above IPTG may be 0.1, 0.5, or 1 mM, but is not limited thereto.

[0084] For example, the PHB production of the new strain was measured by varying the concentration of IPTG to 0.1, 0.5, and 1 mM, but no significant difference was observed. However, when IPTG was supplied, it was confirmed that the PHB production increased by approximately 6.6 times compared to the wild-type strain regardless of the concentration.

[0086] The method for producing PHB according to the present invention may additionally include the step of recovering PHB from a strain of the genus Halomonas, a culture of said strain, a fermented product of said strain, or said culture medium.

[0087] In the present invention, the term "culture" refers to a product obtained by culturing a specific strain in a culture medium, and may include, but is not limited to, culture solution, concentrated culture solution, dried culture solution, culture filtrate, concentrated culture filtrate, or dried culture filtrate. For example, the culture of the present invention may include components remaining in the medium after harvesting the strain from a culture medium of a Halomonas strain, or components of the culture medium containing the strain.

[0088] The term "culture medium" in the present invention refers to the portion of the culture excluding the strain. For example, the culture medium of the present invention may include the culture supernatant excluding the strain after centrifugation from a culture medium of a Halomonas strain, or the portion of the culture supernatant excluding crushed material.

[0089] The above culture may be the above-mentioned Halomonas strain, the entire culture of the above-mentioned strain, a culture medium, fractions thereof, etc. The above-mentioned culture solution may be the culture supernatant of the above-mentioned Halomonas strain, etc. In this case, the culture supernatant may be obtained by centrifuging the culture of the above-mentioned strain, and the above-mentioned fraction may be obtained by applying the above-mentioned strain, the above-mentioned culture, the culture supernatant, etc. to methods such as centrifugation and chromatography.

[0090] The culture medium and other culture conditions used for culturing the strain of the present invention may be any medium used for culturing microorganisms of the genus Halomonas without any particular limitations, and specifically, the strain of the present invention may be cultured under aerobic or anaerobic conditions while controlling the temperature, pH, etc. in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and / or vitamin.

[0091] The term "fermented product" in the present invention may include a culture medium containing a strain obtained by culturing a microorganism in a medium for a certain period, its metabolites, and excess nutrients, a culture solution from which the strain has been removed from the medium, a diluted or concentrated product of the medium or culture solution, or a dried product thereof. The term "fermentation" refers to a process in which a microorganism decomposes organic matter using its own enzymes, excluding a putrefaction reaction. In the present invention, the method of obtaining the fermented product from the strain is not particularly limited and may be obtained according to methods commonly used in the relevant technical field or similar fields.

[0092] In the present invention, the method for obtaining the fermented product may be to obtain it by treating the isolated strain with sugar, which is the energy source of the strain, and fermenting it, but the temperature, fermentation time, etc. of the fermentation process are not particularly limited and can be selected in various ways depending on the fermentation precursor material, fermentation conditions, and the type of substance to be obtained from the fermented product.

[0093] In the present invention, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the strain of the genus Halomonas, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, any medium and other culture conditions used for culturing the strain of the present invention may be used without special limitations as long as they are media conventionally used for culturing strains of the genus Halomonas.

[0094] The term "recovery" in the present invention may refer to collecting the desired PHB using a suitable method known in the art according to a culture method of Halomonas strains, such as batch, continuous, or fed-batch culture methods. For example, various chromatographic methods such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting-out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography, HPLC, or a combination thereof may be used, and a culture medium or Halomonas ( Halomonas The target substance, specifically PHB, can be recovered from the sp.) JJY01 strain.

[0095] In addition, the method for producing PHB according to the present invention may additionally include a purification step. The purification may be performed using a suitable method known in the art.

[0097] Another aspect of the present invention provides a composition for producing PHB comprising a strain of the genus Halomonas, a culture of said strain, a fermented product of said strain, or a combination of two or more of these.

[0098] The composition of the present invention may further include any suitable excipients commonly used in compositions for producing PHB, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.

[0099] In one specific example, each component present in the composition of the present application may be included in a microbiologically effective amount or in an amount that can be appropriately present in a composition for production.

[0100] The above-mentioned Halomonas strains, PHB, etc. are as described above.

[0102] Another aspect of the present invention provides a method for producing a strain of the genus Halomonas that produces PHB, comprising the step of enhancing the activity of an acetyl-CoA acetyltransferase protein in a microorganism of the genus Halomonas.

[0103] The above-mentioned Halomonas genus, acetyl-CoA acetyltransferase protein, reinforcement, etc., are as described above. Effects of the invention

[0105] The present invention relates to a strain of the genus Halomonas with increased polyhydroxybutyric acid (PHB) production capacity by enhancing the activity of the acetyl-CoA acetyltransferase protein. The strain of the genus Halomonas produced by the manufacturing method of the present invention has superior PHB production capacity compared to the wild-type strain and can be used for the synthesis of biodegradable plastics, etc. In particular, since the genus Halomonas can synthesize PHB even under non-sterilizing and high-salinity conditions, it can synthesize PHB by consuming acetic acid even in food wastewater, etc., thus allowing for various industrial applications. Brief explanation of the drawing

[0107] Fig. 1 shows the genus Halomonas ( Halomonas This is a diagram regarding the process of acetic acid being synthesized into PHB in the JJY01 strain. Figure 2A is a wild-type strain ( Halomonas sp. YLGW01) and the genus Halomonas ( Halomonas This is a graph regarding the dry body weight (DCW) and PHB production of the sp.) JJY01 strain. Figures 2B and C are graphs regarding the acetic acid consumption rate, dry body weight, and PHB production of the wild-type strain and the improved strain according to IPTG concentration. Figure 3 is a comparison graph for cases using volatile fatty acids other than acetic acid. Fig. 4 shows the genus Halomonas ( HalomonasThis is a graph regarding the acetic acid consumption rate, dry body mass, and PHB production when acetic acid was supplied during the stationary phase of culture of the JJY01 strain. Figure 5 is a graph regarding the acetic acid consumption rate, dry cell weight, and PHB production amount according to continuous acetic acid supply. FIG. 6 is a schematic diagram regarding the method of supplying acetic acid and maintaining pH of a fermentation tank when culturing the strain in a 10L fermentation tank. Figure 7 is a graph regarding the acetic acid consumption rate, dry cell weight, and PHB production amount when the strain is cultured in a 10L fermentation tank. Specific details for implementing the invention

[0108] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of this application or a similar technical field.

[0110] Example 1. Through the introduction of the atoAD gene Halomonas sp. JJY01 production

[0111] Generally, acetic acid can be converted to acetyl-CoA and can be used as a precursor for the ATP and PHB synthesis pathways. The expression of acetyl-CoA acetyltransferase can increase the production of PHB, and among them, the atoAD gene is known to be involved in the degradation of acetic acid. Accordingly, an improved strain of Halomonas sp. JJY01 was constructed by introducing the atoAD gene to increase PHB production.

[0113] Example 1-1. Halomonas Culture of sp. YLGW01 strain

[0114] Among the Halomonas microorganisms confirmed to produce PHB, wild-type strains isolated from the Korean coast Halomonas sp. YLGW01 was cultured.

[0115] Specifically, for the storage of the above strain, it was cultured in a 5 mL volume in marine broth (DIFCO, USA) at 30°C for 24 hours, and then centrifuged at 3,500 rpm for 10 minutes at 4°C. After removing the supernatant from the pellet produced by centrifugation and washing it twice with sterile distilled water, the strain was stored in 15% glycerol at -80°C.

[0116] For pre-culture, a single colony of MB (marine broth) agar medium was cultured in 5 mL of MB medium at 30°C under shaking conditions of 200 rpm.

[0118] Example 1-2. Construction of a recombinant vector for atoAD gene introduction and overexpression

[0119] To overexpress the atoAD gene, a recombinant vector was constructed using pSEVA341, a plasmid with a high copy number and chloramphenicol resistance. The nucleotide sequence of the atoAD gene is shown in SEQ ID NO. 2.

[0120] To introduce the above gene, Escherichia coli sold by Thermo Fisher Scientific; E.coli The atoAD gene was amplified by performing PCR using the genomic DNA of the TOP10 strain as a template, utilizing 341-atoAD forward primers (SEQ No. 3) and 341-atoAD reverse primers (SEQ No. 4). After restriction enzyme treatment, the pSEVA341 plasmid and the amplified atoAD gene were ligated using a ligation kit (Enzynomics, South Korea). Subsequently, the plasmid was added to 100 µl of E. coli TOP10 strain (Invitrogen, USA), incubated briefly on ice, and then subjected to heat shock at 42°C for 90 seconds to... atoAD cast Escherichia coli Transformed into TOP10 strains.

[0121] The above-mentioned transformed TOP10 strain was cultured in LB medium containing 30 μg / mL of chloramphenicol (DIFCO, USA) at 37°C for 12 hours. To obtain the amplified plasmid, the plasmid was purified using the Plasmid Prep Kit (Enzynomics, Korea).

[0122] An inducible system for inducing gene expression was introduced so that the above-mentioned purified plasmid could express genes in a Halomonas strain.

[0123] Specifically, to induce gene expression in the Halomonas strain, a LacIq-Ptrc site containing RBS (ribosome binding site) was additionally introduced into the purified plasmid.

[0124] More specifically, using the pSEVA434 plasmid (Silva-Rocha et al., 2013) as a template, P trc / 341-atoAD Forward Primer (Sequence No. 5) and P trc It was amplified by PCR using the / 341-atoAD Reverse Primer (Sequence No. 6), and pSEVA341- was analyzed using the In-Fusion Cloning Kit (Takara, Japan). atoAD It was connected using the Gibson assembly method (Gibson et al., 2009).

[0125] Recombinant vector pSEVA341-LacI using the above method q -P trc - atoAD A primer was prepared. The sequences of the primers used are shown in Table 1 below.

[0127] Sequence number designation order 3 341- atoAD Forward Primer CGTCGTGTCGACATGAAAACAAAATTGATGAC 4 341- atoAD Reverse Primer ACGACGAAGCTTTCATAAATCACCCCG 5 P trc / 341- atoAD Forward Primer CGGGGATCCTCTAGAGTCGATTAATTAATTGACACCATCGAATGG 6 P trc / 341- atoAD Reverse Primer AATTTTGTTTTCATGTCGACTAGTATTTCTCCTCTTTCTCTAGTAACTAGTCGCCAGGGTTTTCCC

[0129] The above recombination vector through thermal shock E.coliThe TOP10 strain was transformed. Specifically, after a short incubation on ice, the plasmid was added to 100 µl of the TOP10 strain, and then heat shock was applied at 42°C for 90 seconds. After heat shock, E.coli The sample was transferred to a 1.5 ml conical tube containing 1 ml LB and incubated at 200 rpm for 1 hour. Subsequently, to select the transformed strain, it was cultured on LB agar medium containing 30 µg / mL of chloramphenicol. The strain selected as described above was cultured at 37°C for 24 hours to amplify the recombinant vector.

[0131] Example 1-3. Using electroporation Halomonas Production of sp. JJY01 strain

[0132] The above recombination vector Halomonas A novel strain introduced into the sp. YLGW01 strain that overexpresses acetyl-CoA acetyltransferase, an enzyme encoded by the atoAD gene. Halomonas sp. JJY01 was produced.

[0133] Specifically, the wild-type strain Halomonas After transforming the sp. YLGW01 strain with the above recombinant vector using electroporation, the transformed strains were selected through electrophoresis using a Gene Pulser Xcell (Bio-Rad, USA).

[0134] More specifically, cultured at an OD600 of 0.5 HalomonasElectrocompetent cells were prepared by treating sp. YLGW01 in 50 mM CaCl2 for 15 minutes and washing twice with 0.2 M sucrose. A recombinant vector was added to 100 µl of electrocompetent cells. 2 mm gap parallel electrode cuvettes (Bio-Rad, USA) were used for the electroporation method. Based on a previous study (Kotnik et al., 2015), cells were exposed to a single electrical pulse of 2.1 kV with a fixed capacitance of 36 μF and a fixed resistance of 250 ω.

[0135] Transformed microorganisms were selected and cultured on MB agar medium containing 30 μg / mL of chloramphenicol at 30°C for 24 hours.

[0136] Recombinant vector pSEVA341-LacI using the above method q -P trc - atoAD introduced Halomonas sp. YLGW01 strain Halomonas It was named sp. JJY01.

[0137] Halomonas The sp. JJY01 strain was deposited with the Korean Culture Collection Center (KCCM), an international depositary institution under the Treaty of Budapest, on August 17, 2023, and was assigned accession number KFCC11972P.

[0139] Example 2. Halomonas Evaluation of PHB production capacity of sp. JJY01 strain

[0141] Example 2-1. Method for analyzing PHB content in microorganisms

[0142] The analysis of PHB content in microorganisms was performed by gas chromatography (GC) according to the method of a previous study (Park et al., 2021). In each experiment, the weight of freeze-dried microorganisms was measured to determine the DCW (Dry Body Weight) and placed in a glass vial with a Teflon stopper. Then, 1 mL of chloroform and 1 mL of methanol / sulfuric acid (85:15 v / v) were added to the sample to induce a fatty acid methyl ester reaction, and the amount and composition of PHB were analyzed.

[0143] The sample was incubated at 100°C for 120 minutes and cooled to room temperature. After adding 1 mL of ice-cold water, the organic phase (bottom) was carefully extracted using a pipette and transferred to a borosilicate glass tube. 1 µl of the filtered sample was injected into a gas chromatograph (6090N, Agilent Technologies, USA) using a flame ionization detector (FID) and a 30 m x 250 µm DB-FFAP capillary column with hydrogen as the carrier gas.

[0144] The gas chromatograph inlet was maintained at 250°C, the oven was maintained at 80°C for 5 minutes, and 20°C min -1 After heating to 220°C, it was maintained for 5 minutes. Peak detection was performed using a flame ionization detector maintained at 300°C.

[0145] The concentration of the carbon source containing organic acids was measured using high-performance liquid chromatography (Agilent Technologies, USA) with a refractive index detector (RID) and an Aminex HPX-87H ion exclusion column (Bio-Rad, USA). The mobile phase was 5 mM H2SO4, the flow rate was 0.6 mL / min, and the column temperature was maintained at 60°C. Cell growth was confirmed by measuring the optical density (OD) using a spectrophotometer (Thermo Spectronics, USA). The PHB production yield confirmed in the following examples is based on the method of Example 2-1.

[0147] Example 2-2. Halomonas Evaluation of PHB production capacity of sp. JJY01 strain

[0148] Halomonas The sp. JJY01 strain was inoculated into 5 mL of MB medium and cultured on a rotary shaker at 200 rpm at 30°C for 12 hours. When the OD 600 reached 1.3–1.5, 5 mL of the cultured microorganisms were harvested by centrifugation at 4000 rpm for 25 minutes at 4°C; the supernatant was removed, and the culture was washed twice with sterile distilled water. Subsequently, 5 mL (5% v / v) of the washed strain was inoculated into 100 mL of MB medium containing sodium acetate in a 250 mL flask. Additionally, Halomonas In the case of the sp. JJY01 strain, 30 µg / mL chloramphenicol and P trc The culture was performed by adding IPTG (isopropyl-1-thio-β-D-galactopyranoside), a derivative of the promoter.

[0149] Wild-type strain as a control Halomonas sp. YLGW01 was cultured under identical conditions except for the addition of IPTG and antibiotics. All subsequent experiments were performed in duplicate.

[0150] After 48 hours of incubation, the PHB production was measured according to the analysis method of Example 2-1 above. As a result of the measurement, Halomonas It was confirmed that the PHB production of the sp. JJY01 strain was about 2.3 times higher than that of the wild type (Fig. 2A).

[0152] Example 2-3. Confirmation of PHB production capacity according to IPTG concentration

[0153] Halomonas PHB production capacity in sp. JJY01 strain P trc Optimization was achieved by adjusting the concentration of IPTG (isopropyl-1-thio-β-D-galactopyranoside), a derivative of the promoter. Halomonas As a result of culturing the sp. JJY01 strain and the wild-type strain with the addition of 0.1, 0.5, and 1 mM IPTG, respectively, Halomonas It was confirmed that sp. JJY01 has a higher PHB production than the wild-type strain (Fig. 2C).

[0154] Also, at IPTG concentrations of 0.1, 0.5, and 1 mM Halomonas sp. JJY01 all grew at similar levels without significant variation and consumed acetate at a faster rate than wild-type strains (Figs. 2B and C).

[0155] In the case of PHB production volume, Halomonas In the sp. JJY01 strain, it increased by about 6.6 times, but this was almost similar at IPTG concentrations of 0.1, 0.5, and 1 mM. Therefore, it was concluded that an IPTG induction concentration of 0.1 mM was sufficient, and subsequent experiments were conducted at an IPTG concentration of 0.1 mM.

[0156] In summary, when optimizing IPTG induction Halomonas sp. JJY01 consumed all of the acetic acid after 48 hours of culture, at which point the dry body weight (DCW) was up to 1.8 g / L and the PHB content was up to 0.75 g / L. It was confirmed that compared to the wild-type strain, acetic acid consumption increased by approximately 72% and PHB production increased by approximately 6.6 times.

[0158] Examples 2-4. Verification of the use of VFA precursors other than acetic acid

[0159] Halomonas We confirmed whether volatile fatty acids other than acetic acid in the sp. JJY01 strain could be used as precursors for PHB. We confirmed the PHB production capacity using acetic acid, propionate, butyrate, and valerate.

[0160] Experimental results showed that when volatile fatty acids other than acetic acid are used, Halomonas No significant improvement in dry cell mass and PHB production was observed between the sp. JJY01 strain and the wild-type strain (Fig. 3). It was confirmed that PHB production increased only when acetic acid was used as a precursor.

[0161] This is because the target substrate of acetyl-CoA acetyltransferase encoded by the atoAD gene is acetic acid or acetoacetate, and the result in Figure 3 suggests that the increase in PHB production is caused by the introduction of the atoAD gene.

[0163] Example 3. Effect of carbon source on PHB production

[0165] Example 3-1. Production of PHB with Acetic Acid Supply During the Stagnation Phase

[0166] It is known that high concentrations of acetic acid can hinder strain growth during the growth phase. Since microorganisms do not multiply during the stationary phase, after the stationary phase, an excess carbon source is utilized for the accumulation of PHB.

[0167] wild-type strains and Halomonassp. JJY01 was supplied with 10 g / L of fructose as a carbon source during the growth phase to exclude the growth inhibitory effect caused by high concentrations of acetic acid during the growth phase, and subsequently, the acetic acid consumption rate during the plateau phase was confirmed by supplying acetic acid. Specifically, the plateau phase was reached after 48 hours of culture, and at this time, 10 g / L of acetic acid was supplied to confirm the PHB production during the plateau phase.

[0168] The results were as shown in Fig. 4. After the first 48 hours of culture, both strains showed similar growth rates and fructose consumption rates (Fig. 4A). This suggests that atoAD gene expression is not involved in converting fructose to acetyl-CoA.

[0169] Subsequently, 20 mL of each fully grown strain during the stationary phase was transferred to a 50 mL flask, and 10 g / L of acetic acid (13.9 g / L sodium acetate) was supplied to each. After culturing for 72 hours, the wild-type strain was unable to consume all the acetic acid, but Halomonas It was confirmed that sp. JJY01 consumed almost all of the acetic acid after 72 hours (Fig. 4A).

[0170] When acetic acid was supplied during the plateau phase, compared to the wild-type strain Halomonas The rate of PHB biosynthesis by acetic acid in sp. JJY01 increased, leading to a significant increase in PHB accumulation. In contrast, when acetic acid was added as a carbon source after all fructose had been consumed, the PHB content of the wild-type strain decreased rapidly. This decrease indicates that the utilization of acetic acid as a carbon source in the wild-type strain is significantly lower than that of fructose (Fig. 4).

[0171] This causes the expression of the atoAD gene to convert acetic acid to acetyl-CoA at a level similar to fructose, and consequently during the plateau phase Halomonas This suggests that sp. JJY01 increases PHB production.

[0173] Example 3-2. Production of PHB by Continuous Supply of Acetic Acid

[0174] According to previous studies, supplying acetic acid as a carbon source is effective for PHB production in the genus Halomonas (Jeon et al., 2022). To confirm PHB production and other factors of each strain when acetic acid is continuously supplied, the strains were cultured with 10 g / L of acetic acid.

[0175] As shown in Fig. 5A, the wild-type strain was unable to consume all the acetic acid even after 36 hours, and Halomonas sp. JJY01 consumed only about 3 g / L of acetic acid while consuming all of the acetic acid.

[0176] In addition, compared to the PHB production of the wild-type strain being 0.25 g / L after 36 hours of culture, Halomonas sp. JJY01 rose sharply to 0.78 g / L. After 48 hours of culture, the carbon source became insufficient. Halomonas The PHB of sp. JJY01 decreased rapidly, but when acetic acid was added, the PHB content increased again (Fig. 5C). Halomonas In the case of sp. JJY01, the PHB content decreased as it rapidly consumed acetic acid, but it rapidly recovered the PHB content by supplying acetic acid again, and it was confirmed that it could produce PHB without negative effects from acidification caused by acetic acid consumption (Fig. 5).

[0178] Example 4. Production of PHB in a 10L fermenter

[0180] Halomonas To confirm the enhanced PHB production capacity of sp. JJY01, it was cultured in an environment where acetic acid was continuously supplied. A fed-batch culture experiment was conducted in a 10L fermenter, and a pre-culture was performed for this purpose.

[0181] Pre-culture was performed in 250 mL of medium prepared in the same manner as previously described. The synthetic medium required for culture consisted of 5 g / L soytone (DIFCO, USA), 10 g / L sodium acetate, 24 g / L NaCl, 11 g / L NaCl2·6H2O, 4 g / L Na2SO4, 2 g / L CaCl2·6H2O, 0.7 g / L KCl, 0.1 g / L KBr, 0.04 g / L SrCl2·6H2O, 0.03 g / L H3BO3, 5 mg / L NaSiO3·9H2O, 3 mg / L NaF, 2 mg / L NH4NO3, and 1 mg / L Fe3PO4·4H2O, and the pH was maintained at 7.8. In addition, 5% (v / v) of the pre-cultured strain (OD600 1.3–1.5) was directly transferred to a 10L fermenter (MARADO-05D-PS, Bio-CNS, South Korea) along with 4,750 mL of sterile synthetic medium. Halomonas For sp. JJY01, 0.1 mM IPTG and 30 mg / L chloramphenicol were also added. To maintain the dissolved oxygen (DO) level at an air saturation of 30%, the temperature was maintained at 30℃ and the stirring speed at 600 rpm, and 1 M NaOH and 1 M HCl were used to maintain the pH between 7.5 and 7.8.

[0182] After 28 hours of culture, when the strain consumed all the acetic acid, pH-stat feeding was automatically performed to supply acetic acid instead of hydrochloric acid, maintaining the pH below 7.8 (Fig. 6).

[0183] 10 mL of culture medium was collected and analyzed at 4-hour intervals up to 48 hours after the start of fermentation; thereafter, samples were collected at 8-hour intervals until 88 hours after the end of culture; and a final sample was collected at 112 hours after the end of fermentation. All experiments were conducted using wild-type strains. Halomonas The same procedure was performed on sp. YLGW01 under identical conditions, excluding the addition of IPTG and antibiotics.

[0184] Experimental results, HalomonasThe acetic acid consumption rate of sp. JJY01 was 58% higher than that of the wild-type strain. In addition, while the PHB titer of the wild-type strain did not increase further from 2.9 g / L after 56 hours, Halomonas sp. JJY01 continued to produce PHB for up to 112 hours, and it was confirmed to be 4.8 g / L, which is 65% higher than that of the wild-type strain (Fig. 7).

[0185] Looking at the results according to the above embodiment, Halomonas The PHB production ability of sp. JJY01 is that of the wild-type strain Halomonas It can be confirmed that it is superior to sp. YLGW01. Furthermore, Halomonas It can be seen that sp. JJY01 has superior PHB production ability compared to other PHB-producing microorganisms that use acetic acid as a carbon source and are known to the art (Table 2).

[0186] Bacteria Fermentation mode Carbon source DCW (g / L) PHB content (%) PHB titer (g / L) Pseudomonas oleovorans Flask Acetic acid 0.42 26 0.11 Comamonas sp. EB172 Flask Acetic acid 2.1 16 0.34 Bacillus cereus Flask Acetic acid 2.94 49.8 1.47 Ralstonia eutropha Flask Acetic acid 5.4 30.8 1.63 Halomonas sp. JJY01 Flask Acetic acid 4.85 30 1.47 Halomonas sp . JJY01 Fed-batch Acetic acid 7.7 62 4.8

[0188] Through the above embodiments, the present application Halomonas An improved strain with excellent PHB production ability produced by introducing the atoAD gene encoding acetyl-CoA acetyltransferase from sp. YLGW01 Halomonas It was confirmed that the acetic acid consumption rate and PHB production volume can be increased using sp. JJY01. In addition, it was confirmed that this can be utilized for the mass production of PHB.

[0190] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

[0191] Depository Name: Korean Culture Collection Center (KCCM) Trustee Number: KFCC11972P Date of Deposit: 2023-08-17

Claims

Claim 1 Halomonas genus producing polyhydroxybutyric acid (PHB) with enhanced activity of acetyl-CoA acetyltransferase protein derived from Escherichia coli K12 strain ( Halomonas A strain of sp.) wherein the protein comprises an amino acid sequence having SEQ ID NO.

1. Claim 2 A strain according to claim 1, characterized in that the protein is involved in decomposing acetic acid and converting it into acetyl-CoA. Claim 3 In claim 1, the strain is characterized by an increased acetic acid consumption rate or PHB production rate compared to a wild-type strain. Claim 4 A strain according to claim 1, wherein the protein is encoded by the atoAD gene sequence consisting of SEQ ID NO.

2. Claim 5 In paragraph 1, the strain is the strain deposited under accession number KFCC11972P. Claim 6 A method for producing PHB comprising the step of culturing a strain of the genus Halomonas according to any one of claims 1 to 5 in a medium. Claim 7 A method for producing PHB according to claim 6, wherein the medium comprises supplying acetic acid as a carbon source. Claim 8 A method for producing PHB according to claim 6, wherein the medium comprises supplying IPTG (isopropyl-1-thio-β-D-galactopyranoside). Claim 9 A method for producing PHB, additionally comprising the step of recovering PHB from a Halomonas strain of any one of claims 1 to 5, a culture of said strain, a fermented product of said strain, or a culture medium of said strain. Claim 10 A composition for producing PHB comprising a strain of the genus Halomonas according to any one of claims 1 to 5, a culture of said strain, a fermented product of said strain, or a combination of two or more of these. Claim 11 A method for producing a strain of the genus Halomonas that produces PHB, comprising the step of enhancing the activity of an acetyl-CoA acetyltransferase protein derived from the Escherichia coli K12 strain in a microorganism of the genus Halomonas, wherein the protein comprises an amino acid sequence having SEQ ID NO. 1.

Images