Composition for antioxidant or antiobesity comprising enzyme treated fruit and method for manufacturing the same

Abstract

The present invention relates to an anti-obesity or antioxidant composition comprising enzyme-treated fruit and a method for preparing the same. A composition comprising enzyme-treated fruit, which is one aspect of the present invention, contains an excess amount of phenols such as chlorogenic acid, and thus exhibits excellent antioxidant effects. Furthermore, the composition according to the present invention has a high reducing sugar content and high transparency and color, resulting in excellent palatability. Additionally, the composition according to the present invention exhibits excellent ability to inhibit adipocyte differentiation, thereby providing excellent anti-obesity and weight loss effects. Moreover, a method for preparing an enzyme-treated fruit composition, which is one aspect of the present invention, is economical because it allows for the effective extraction of a large amount of physiologically active components from the fruit.

Description

Technology Field

[0001] The present invention relates to an anti-obesity or antioxidant composition comprising enzyme-treated fruit, and a method for preparing the same. Background Technology

[0002] Fruits are known as the best natural health food because they are rich in bioactive components such as various vitamins, minerals, organic acids, and amino acids.

[0003] However, recently, as awareness has grown that the sugar contained in fruits can cause adult diseases such as obesity, even the general public is increasingly reluctant to consume fruit.

[0004] In addition, fruits vary greatly in quality, such as taste and sweetness, from individual to individual and have poor shelf life, so they are often processed into and distributed as juice, jam, sauce, or tea. It has been pointed out that these processed foods destroy the bioactive components contained in the fruit during processing and that added artificial sweeteners have harmful effects on the human body.

[0005] Accordingly, research is actively underway on fruit processing methods that can fully deliver the bioactive components contained in fruits to consumers while remaining free from issues regarding the induction of lifestyle diseases; however, no satisfactory results have been reported to date. Prior art literature

[0006] (Patent Document 0001) KR 10-2015-0127726 A The problem to be solved

[0007] In one aspect, the objective of the present invention is to provide a processed fruit product that is harmless to the human body and has improved palatability, such as taste and appearance.

[0008] In one aspect, the objective of the present invention is to provide a fruit-containing composition having excellent antioxidant effects.

[0009] In one aspect, the object of the present invention is to provide a fruit-containing composition having excellent ability to inhibit adipocyte differentiation.

[0010] In one aspect, the objective of the present invention is to provide a fruit-containing composition that has excellent effects in preventing and improving obesity.

[0011] In one aspect, the objective of the present invention is to provide a fruit extract with excellent shelf life.

[0012] In one aspect, the object of the present invention is to provide a method for effectively extracting bioactive substances contained in fruits.

[0013] In one aspect, the objective of the present invention is to provide a fruit extraction method with excellent extraction yield.

[0014] In one aspect, the objective of the present invention is to provide a fruit extraction method with excellent chlorogenic acid extraction efficiency. means of solving the problem

[0015] To achieve the above objective, the present invention provides, in one aspect, a composition comprising enzyme-treated fruit, wherein the enzyme comprises Celluclast and Viscozyme, and the Viscozyme is included in an amount of 0.1 to 10 parts by weight when Celluclast is 100 parts by weight.

[0016] To achieve the above objective, in one aspect, the present invention provides a composition comprising the enzyme-treated fruit, wherein the composition comprises the fruit treated with viscozyme followed by treatment with celluclast.

[0017] To achieve the above objective, the present invention provides, in one aspect, a composition comprising an enzyme-treated fruit, wherein the fruit comprises an apple.

[0018] To achieve the above objective, in one aspect, the present invention provides a composition comprising the enzyme-treated fruit, wherein the composition comprises the enzyme-treated fruit, the composition comprising an antioxidant composition.

[0019] To achieve the above objective, in one aspect, the present invention provides a composition comprising the enzyme-treated fruit, wherein the composition comprises the enzyme-treated fruit, the composition comprises a composition for preventing or improving obesity.

[0020] To achieve the above objective, in one aspect, the present invention provides a composition comprising the enzyme-treated fruit, wherein the composition comprising the enzyme-treated fruit comprises a food composition, a pharmaceutical composition, or a cosmetic composition.

[0021] To achieve the above objective, the present invention, in one aspect, provides a method for preparing a composition comprising enzyme-treated fruit, wherein the method comprises the step of treating the fruit with Celluclast and Viscozyme.

[0022] To achieve the above objective, in one aspect, the present invention provides a method for preparing a composition comprising enzyme-treated fruit, wherein the method comprises treating the fruit with Viscozyme for 1 to 10 hours, and then treating the fruit treated with Viscozyme with Celluclast for 0.5 to 2 hours. Effects of the invention

[0023] A composition comprising enzyme-treated fruit, which is one aspect of the present invention, contains an excess amount of phenols such as chlorogenic acid, and thus exhibits excellent antioxidant effects. Furthermore, the composition according to the present invention has a high reducing sugar content and high transparency and color, resulting in excellent palatability. Additionally, the composition according to the present invention exhibits excellent ability to inhibit adipocyte differentiation, thereby providing excellent anti-obesity and weight loss effects. Moreover, the method for preparing the enzyme-treated fruit composition, which is one aspect of the present invention, is economical because it allows for the effective extraction of a large amount of physiologically active components from the fruit. Specific details for implementing the invention

[0024] The present invention will be described in detail below.

[0025] The following description is merely an example, and the scope of the present invention is not limited by the following.

[0026] Furthermore, terms or words used in the specification and claims of the present invention are not limited to their ordinary or dictionary meanings, and must be interpreted in a meaning and concept consistent with the technical spirit of the present invention, based on the principle that the inventor can appropriately define the concept of the terms to best describe his invention.

[0027] Throughout the specification of the present invention, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0028] In one aspect, the present invention is a composition comprising enzyme-treated fruit, wherein the enzyme comprises Celluclast and Viscozyme, and the Viscozyme is included in an amount of 0.1 to 10 parts by weight when Celluclast is 100 parts by weight.

[0029] Celluclast of the present invention TM , NOVOZYME) is a type of cellulase, and the above Viscozyme TM NOVOZYME may mean a complex of arabanase, cellulase, β-glucanase, hemicellulase, and xylanase.

[0030] In one aspect, the above-mentioned viscozyme may be included in an amount of 0.1 to 10 parts by weight, or 0.1 to 5 parts by weight, or 0.1 to 3 parts by weight, or 0.5 to 3 parts by weight, or 0.5 to 2 parts by weight, or 0.8 to 1.2 parts by weight, when the above-mentioned celluclast is 100 parts by weight.

[0031] In one aspect, the composition comprising the enzyme-treated fruit may include 0.1 to 10 parts by weight, or 0.1 to 5 parts by weight, or 0.1 to 3 parts by weight of enzyme, based on 100 parts by weight of fruit.

[0032] In addition, in one aspect, the composition comprising the enzyme-treated fruit may include fruit treated with viscozyme followed by celluclast.

[0033] In one aspect, the above-mentioned Viscozyme and Celluclast may be processed simultaneously, but it may be more preferable to process Viscozyme after processing Celluclast, and it may be most preferable to process Celluclast after processing Viscozyme.

[0034] In one aspect, the fruit may include pome fruits such as apples, pears, and loquats; semi-pome fruits such as persimmons and citrus fruits; stone fruits such as peaches, plums, and apricots; berries such as grapes, bananas, and pineapples; and nuts such as chestnuts, walnuts, and pine nuts, and preferably may include apples.

[0035] In one aspect, the composition comprising the enzyme-treated fruit is a composition comprising the enzyme-treated fruit, comprising an antioxidant composition.

[0036] The above composition may contain high amounts of various phenols such as chlorogenic acid, procyanidin, gallic acid, caffeic acid, epicatechin, p-coumaric acid, ferulic acid, and protocatechuic acid. For example, the chlorogenic acid contained in the composition according to the present invention may be about 3.06 mg / 100 g or more, and may contain at least 19 times more chlorogenic acid than the control group that was not enzyme-treated.

[0037] In one aspect, the composition of the present invention has excellent active radical scavenging ability and can exhibit an excellent antioxidant effect.

[0038] In addition, in one aspect, a composition comprising the enzyme-treated fruit may include a composition for preventing or improving obesity.

[0039] For example, the composition of the present invention has excellent inhibitory ability on the expression of factors known to induce adipocyte differentiation, namely PAPRγ, C / EBPα, and Prx2, and can effectively inhibit adipocyte differentiation.

[0040] In one aspect, the composition comprising the enzyme-treated fruit of the present invention may include a food composition, a pharmaceutical composition, or a cosmetic composition.

[0041] The above food composition may be a health functional food composition and may include teas, beverages, etc.

[0042] The formulation of a food composition according to one aspect of the present invention is not particularly limited, but may be formulated, for example, into tablets, granules, powders, liquids such as drinks, caramels, gels, bars, etc. For each formulation of the food composition, in addition to the active ingredient, ingredients commonly used in the field can be appropriately selected and combined by a person skilled in the art according to the formulation or purpose of use without difficulty, and a synergistic effect may occur when applied simultaneously with other raw materials.

[0043] In a food composition according to one aspect of the present invention, the determination of the dosage of the active ingredient is within the level of a person skilled in the art and may vary depending on various factors such as the age, health condition, and complications of the subject to be administered.

[0044] In addition to the above, in one aspect of the present invention, the food composition may include various nutritional agents, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and promoters (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, in one aspect of the present invention, the functional food compositions may include fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. Although the proportion of such additives is not particularly important, in one aspect of the present invention, they are generally included in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition.

[0045] A cosmetic composition according to one aspect of the present invention may contain a cosmetically acceptable medium or base. This may be provided in any formulation suitable for topical application, for example, in the form of a solution, gel, solid or paste anhydrous product, an emulsion obtained by dispersing an oil phase in an aqueous phase, a suspension, a microemulsion, a microcapsule, a microgranule, or an ionic (liposome) and / or non-ionic vesicular dispersant, or in the form of a cream, skin, lotion, powder, ointment, spray, or concealer stick. These compositions may be prepared according to conventional methods in the art.

[0046] When the formulation of the present invention is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan.

[0047] In the case where the formulation of the present invention is a suspension, liquid diluents such as water, ethanol, or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used as carrier components.

[0048] In the case where the formulation of the present invention is a paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as a carrier component.

[0049] In the case where the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.

[0050] The above composition may additionally contain a thickening agent. The thickening agent included in the composition of the present invention may be, for example, methyl cellulose, carboxymethyl cellulose, carboxymethyl hydroxy guanine, hydroxymethyl cellulose, hydroxyethyl cellulose, carboxyvinyl polymer, polyquaternium, cetearyl alcohol, stearic acid, carrageenan, etc.

[0051] In addition, the above composition may contain various appropriate bases and additives as needed, and the types and amounts of these components can be easily selected by the inventor. It may contain acceptable additives as needed, and may additionally include, for example, components such as preservatives and colorants conventional in the art.

[0052] In addition, the ingredients that may be added are not limited to those mentioned above, and any of the above ingredients may be incorporated within a range that does not impair the purpose and effects of the present invention.

[0053] In one aspect, the composition may be one or more selected from the group consisting of ampoules, skin softeners, toners, astringents, lotions, massage creams, nourishing creams, moisture creams, hand creams, foundations, essences, nourishing lotions, packs, soaps, cleansing foams, cleansing lotions, cleansing creams, body lotions, and body cleansers.

[0054] In one aspect, the formulation of the above composition may be W / S, W / O, P / W, W / O / W, or O / W / O, but is not limited thereto.

[0055] A pharmaceutical composition according to one aspect of the present invention may be in various oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid dosage forms for oral administration include tablets, pills, powders, granules, soft or hard capsules, and such solid dosage forms are prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with one or more compounds. In addition, lubricants such as magnesium stearate and talc are also used in addition to simple excipients. Liquid preparations for oral administration include suspensions, oral liquids, emulsions, and syrups; in addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients, such as humectants, sweeteners, flavorings, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspension solvents. Witepsol, Macrogol, Tween 61, cocoa paste, laurin paste, and glycerogelatin may be used as bases for suppositories.

[0056] In one aspect of the present invention, the pharmaceutical dosage form of the composition may be used in the form of a pharmaceutically acceptable salt thereof, and may also be used alone or in combination with other pharmaceutically active compounds as well as in a suitable combination. The salt is not particularly limited as long as it is pharmaceutically acceptable, and examples include hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrofluoric acid, hydrobromide, formic acid, acetic acid, tartaric acid, lactic acid, citric acid, fumaric acid, maleic acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, toluenesulfonic acid, naphthalenesulfonic acid, etc.

[0057] A composition according to one aspect of the present invention can be administered to mammals such as rats, mice, livestock, and humans via various routes, such as parenteral and oral.

[0058] In one aspect, the present invention is a method for preparing a composition comprising enzyme-treated fruit, comprising the step of treating the fruit with Celluclast and Viscozyme.

[0059] In addition, the present invention is a method for preparing a fruit extract, comprising the step of treating a fruit with Celluclast and Viscozyme in one aspect.

[0060] In one aspect, the method may include treating the fruit with Viscozyme for 1 to 10 hours, and then treating the fruit treated with Viscozyme with Celluclast for 1 to 10 hours.

[0061] In one aspect, the processing time of the above-mentioned viscozyme may be 2 to 8 hours, or 3 to 7 hours, or 4 to 6 hours, but is not limited thereto.

[0062] In addition, the treatment time of the celluclast may be 2 hours or more, 3 hours or more, 4 hours or more, 5 hours or more, or 6 hours or more, or 2 to 10 hours, or 3 to 10 hours, or 4 to 10 hours, or 5 to 10 hours, or 6 to 10 hours, but is not limited thereto.

[0064] The present invention will be described in detail below through manufacturing examples and embodiments. These examples are merely illustrative of the present invention, and therefore the scope of the present invention is not limited by these examples.

[0066] [Preparation Example] Preparation of enzyme-treated fruit extract

[0067] Enzyme-treated fruit extracts of apples were prepared by the following process. Specifically, apples were washed and sliced. Then, enzyme treatment was performed at approximately 18–22°C. For the enzyme treatment, 0.1 parts by weight of Viscozyme and 1 part by weight of Celluclast were applied to 100 parts by weight of fruit. At this time, Viscozyme was treated first for approximately 5 hours, followed by Celluclast for approximately 1 hour to prepare the enzyme-treated fruit extracts.

[0069] [Comparative Manufacturing Example]

[0070] As indicated in the table below, comparative preparation examples were prepared by changing the conditions. Except for the details indicated in the table below, extracts were prepared under the same conditions as the preparation examples.

[0072] [Comparative Preparation Example A] Preparation example with changed enzyme type

[0073] Group not treated with Viscozyme (Comparative Example 1), group not treated with Celluclast (Comparative Example 2), group treated with Shearzyme instead of Viscozyme (Comparative Example 3), Shearzyme instead of Celluclast (Shearzyme TM A group (Comparative Example 4) treated with NOVOZYME Co., Ltd. was manufactured.

[0075] [Comparative Preparation Example B] Preparation example with changed enzyme treatment order

[0076] A group treated with Celluclast and Viscozyme simultaneously for about 6 hours (comparison group 5), and a group treated with Celluclast followed by Viscozyme (comparison group 6) were prepared.

[0078] [Comparative Preparation Example C] Preparation example with changed enzyme treatment amount

[0079] Extracts were prepared by varying the enzyme treatment conditions as shown in the table below.

[0080] no. Celluclast Viscozyme Comparative Example 7 0.1 0.1 Comparative Example 8 0.5 Comparative Example 9 0.9 Comparative Example 10 1.2 Comparative Example 11 1.5 Comparative Example 12 1 0.01 Comparative Example 13 0.05 Comparative Example 14 0.09 Comparative Example 15 0.12 Comparative Example 16 0.15

[0081] ※ Content based on total fruit weight

[0083] [Comparative Preparation Example D] Preparation example with changed enzyme treatment time

[0084] Extracts were prepared by varying the enzyme time conditions as shown in the table below.

[0085] no. Celluclast Viscozyme Comparative Example 17 3 hours 5 hours Comparative Example 18 4 hours Comparative Example 19 6 hours Comparative Example 20 7 hours Comparative Example 21 60 minutes 3 hours Comparative Example 22 4 hours Comparative Example 23 6 hours Comparative Example 24 7 hours

[0087] [Experimental Example]

[0088] [Experimental Example 1] Apple extract yield

[0089] The apple extract yield was measured for the preparation examples and comparative examples. The results are shown in Table 3 below.

[0090] experimental group Extraction yield (%) Control group (group with no enzyme treatment) 6.85 Preparation Example 25.38 Comparative Example 1 7.23 Comparative Example 2 8.35 Comparative Example 3 9.85 Comparative Example 4 8.15 Comparative Example 5 11.28 Comparative Example 6 14.47 Comparative Example 7 8.42 Comparative Example 8 10.22 Comparative Example 9 15.74 Comparative Example 10 25.46 Comparative Example 11 25.87 Comparative Example 12 6.84 Comparative Example 13 8.73 Comparative Example 14 14.75 Comparative Example 15 25.94 Comparative Example 16 26.22 Comparative Example 17 12.43 Comparative Example 18 16.25 Comparative Example 19 25.44 Comparative Example 20 26.78 Comparative Example 21 11.73 Comparative Example 22 13.85 Comparative Example 23 26.85 Comparative Example 24 27.05

[0092] [Experimental Example 2] Reducing Sugar Content and Color

[0093] The reducing sugar content of the apple extracts of the preparation example and the comparative example was measured. The results are shown in Table 4 below. That is, it can be seen that the extract according to the present invention has a high reducing sugar content that imparts sweetness, and thus has excellent palatability.

[0094] experimental group Reducing sugar content (mg / g FW) Control group (group with no enzyme treatment) 36.85 Preparation Example 76.73 Comparative Example 1 40.20 Comparative Example 2 42.65 Comparative Example 3 48.75 Comparative Example 4 47.96 Comparative Example 5 52.23 Comparative Example 6 57.35 Comparative Example 7 46.80 Comparative Example 8 48.96 Comparative Example 9 58.38 Comparative Example 10 77.30 Comparative Example 11 77.92 Comparative Example 12 37.95 Comparative Example 13 41.23 Comparative Example 14 55.65 Comparative Example 15 78.02 Comparative Example 16 78.55 Comparative Example 17 50.32 Comparative Example 18 57.35 Comparative Example 19 77.98 Comparative Example 20 78.55 Comparative Example 21 43.38 Comparative Example 22 55.68 Comparative Example 23 77.75 Comparative Example 24 78.85

[0096] [Experimental Example 3] Measurement of extract stability

[0097] After leaving the extracts of the preparation example and the comparative example at room temperature for 24 hours, browning was visually checked.

[0098] As a result, it was confirmed that the extracts of Preparation Example, Comparative Example 10, Comparative Example 11, Comparative Example 15, Comparative Example 16, Comparative Example 19, Comparative Example 20, Comparative Example 23, and Comparative Example 24 showed almost no browning compared to immediately after extraction, but the rest showed severe browning.

[0100] [Experimental Example 4] Measurement of Total Polyphenol Content and Chlorogenic Acid Content

[0101] The total polyphenol content and chlorogenic acid content of the extracts of the preparation example and the comparative example were measured. The results are shown in Table 5 below. That is, it can be seen that the extract according to the present invention contains a large amount of phenolic compounds such as polyphenols and chlorogenic acid, and has an excellent antioxidant effect.

[0102] experimental group Total polyphenol content (mg GAE / 100g FW) Chlorogenic acid content (mg / 100g FW) Control group (group with no enzyme treatment) 11.08 0.15 Preparation Example 23.51 3.06 Comparative Example 1 12.33 0.20 Comparative Example 2 13.31 0.25 Comparative Example 3 13.35 0.33 Comparative Example 4 12.95 0.21 Comparative Example 5 14.43 0.77 Comparative Example 6 15.75 0.88 Comparative Example 7 12.32 0.26 Comparative Example 8 14.52 0.75 Comparative Example 9 17.33 1.02 Comparative Example 10 23.75 3.10 Comparative Example 11 23.88 3.15 Comparative Example 12 12.43 0.24 Comparative Example 13 13.66 0.25 Comparative Example 14 14.85 0.82 Comparative Example 15 24.02 3.12 Comparative Example 16 24.15 3.17 Comparative Example 17 14.56 0.87 Comparative Example 18 16.02 0.87 Comparative Example 19 23.78 3.13 Comparative Example 20 23.85 3.20 Comparative Example 21 14.82 0.88 Comparative Example 22 14.95 0.91 Comparative Example 23 23.78 3.15 Comparative Example 24 23.84 3.26

[0104] [Experimental Example 5] Active radical scavenging activity

[0105] DPPH radical scavenging activity was measured for the extracts of the Preparation Example and Comparative Example. The experiment was performed by treating the extracts at 8 mg / mL. The results are shown in Table 6 below. That is, it can be seen that the extract according to the present invention has excellent antioxidant effect due to its excellent active radical scavenging ability.

[0107] experimental group dpph radical scavenging activity (mg AAE / 100g FW) Control group (group with no enzyme treatment) 298.26 Preparation Example 550.70 Comparative Example 1 305.73 Comparative Example 2 330.65 Comparative Example 3 352.70 Comparative Example 4 342.46 Comparative Example 5 398.52 Comparative Example 6 405.53 Comparative Example 7 341.10 Comparative Example 8 375.64 Comparative Example 9 404.33 Comparative Example 10 551.13 Comparative Example 11 557.20 Comparative Example 12 300.10 Comparative Example 13 331.13 Comparative Example 14 411.56 Comparative Example 15 553.35 Comparative Example 16 554.74 Comparative Example 17 385.47 Comparative Example 18 410.31 Comparative Example 19 553.10 Comparative Example 20 557.02 Comparative Example 21 395.57 Comparative Example 22 390.25 Comparative Example 23 555.31 Comparative Example 24 558.05

[0108] ※AAE: ascorbic acid equivalent, FW: fresh weight

[0110] [Experimental Example 6] Anti-obesity efficacy test

[0111] The expression of factors associated with mast cell differentiation (PPARγ, C / EBPα, PRX2) was confirmed for the extracts of the preparation example and the comparative example.

[0112] Adipocytes were treated with each of the preparation example and comparative example at a concentration of 50 ng / ml and cultured for 4 days.

[0113] Mouse-derived 3T3-L1 preadipocytes were seeded in 100mm and 35mm culture dishes and 96-well multi-plasts, respectively, and cultured in growth medium (high glucose DMEM + 1% P / S + 10% FBS) until 100% confluence was achieved. Afterward, 2 days later, the preadipocytes were induced to differentiate into adipocytes using growth medium containing adipocyte differentiation inducing substances (1 µg / mL insulin, 1 µM Dex, 0.5 mM IBMX).

[0114] Cultured cells were washed with dPBS, and total RNA was extracted and isolated from 3T3-L1 cells using tri-solution. Complementary DNA (cDNA) was synthesized from 5 µg of RNA using TOP script™ RT DRY MIX. 30 polymerase chain reaction (PCR) cycles were performed using 9 µL of a mixture containing Ampi Gene™ qPCR Green Mix Hi-ROX and primers, and 1 µl of cDNA. The PCR reaction conditions consisted of a cycle repeated at 95°C for 10 minutes, 95°C for 30 seconds, an annealing temperature of 30 seconds, 72°C for 30 seconds, and then returning to 95°C for 30 seconds, followed by a 5-minute run at 72°C. The primer information used for the polymerase chain reaction is shown in Table 7.

[0115] Gene Forward primer Reverse primer β-actin TTCTACAATGAGCTGCGTGTG GGGGTGTTGAAGGTCTCAAA PPARγ CCAGAGTCTGCTGATCTGCG GCCACCTCTTTGCTCTGATC C / EBPα GCAGTGTGCACGTCTATGCT AGCCCACTTCATTTCATTGG PRX2 AGGACTTCCGAAAGCTAGGC TTGACTGTGATCTGGCGAAG

[0117] As a result, it was confirmed that the expression of PPARγ, C / EBPα, and PRX2 was inhibited in the groups treated with the extracts of Preparation Example, Comparative Example 10, Comparative Example 11, Comparative Example 15, Comparative Example 16, Comparative Example 19, Comparative Example 20, Comparative Example 23, and Comparative Example 24, while the genes were expressed in the remaining treatment groups.

[0119] [Experimental Example 7] Efficacy Test According to Fruit Type

[0120] For each of the pear, tangerine, grape, and strawberry, extracts were prepared using the same method as in the above preparation example and comparative example, and then experiments identical to those in Experimental Examples 1 to 6 were performed.

[0121] As a result, although the measured values ​​varied depending on the content of the components in each fruit, the overall trend was found to be similar to that of apple extract.

[0122] However, regarding extraction efficiency, the apple extract showed the most dramatic effect when treated with enzymes as in the preparation example, while in the case of pear, tangerine, grape, and strawberry, there was no significant improvement in efficiency compared to the control group that was not treated with enzymes even after enzyme treatment.

[0124] [Experimental Example 8] Toxicity Test

[0125] To confirm cytotoxicity according to the preparation example and comparative example, the MTT assay was performed on 3T3-L1 cells. As a result of investigating cytotoxicity at various concentrations (10 ng / ml, 50 ng / ml, 100 ng / ml) over 2 days, no toxicity was observed for any of the extracts.

Claims

Claim 1 A method for preparing a composition comprising enzyme-treated fruit, wherein the composition comprises an antioxidant composition or a composition for preventing or improving obesity, the method comprises treating the fruit with Viscozyme followed by treating it with Celluclast, wherein the treatment time for Viscozyme and Celluclast comprises treating Celluclast for 6 to 7 hours when Viscozyme is treated for 5 hours, and treating Viscozyme for 6 to 7 hours when Celluclast is treated for 1 hour, and wherein Viscozyme and Celluclast are included in an amount of 1,000 to 1,500 parts by weight of Celluclast based on 100 parts by weight of Viscozyme. Claim 2 delete Claim 3 A method for preparing a composition comprising enzyme-treated fruit, wherein the fruit includes apples, in accordance with claim 1. Claim 4 delete Claim 5 delete Claim 6 A method for preparing a composition comprising enzyme-treated fruit according to claim 1, wherein the composition comprising the enzyme-treated fruit comprises a food composition or a cosmetic composition. Claim 7 delete Claim 8 delete