Biomarkers, and their use in the treatment of viral infections, inflammation, or cancer

Abstract

The present disclosure relates to specific biomarkers and their use in the monitoring, evaluation, and / or treatment of viral infections or inflammatory diseases, disorders or conditions, or cancer.

Description

Background Technology

[0001] The quinoline derivative, 8-chloro-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine (also known as "ABX464"), binds to the cap-binding complex (CBC), a complex at the 5'-terminus of pre-mRNA transcripts that facilitates early interactions with transcription and processing machinery. The CBC mediates processing events by recruiting various factors for the m7G variant transcript and is required for efficient cellular and viral pre-mRNA splicing. The interaction between the CBC and U1 snRNP at the 5' splicing site of the transcript's first intron, as well as the direct interaction between the CBC and proteins of U4 / U5 / U6 particles, enhance the formation of spliced ​​mRNA. Although the CBC is not essential for the viability of yeast or humans, its deletion reduces the recruitment of various splicing factors for the pre-transcriptional transcript, leading to the inhibition of co-transcriptional splicesome assembly. The CBC complex has also been shown to influence the biogenesis of microRNA (miRNA). miRNA is transcribed by RNA pol II as primary (pri)-miRNA, which retains an m7G cap. During nuclear and cytoplasmic processing events, pri-miRNA loses its m7G cap, and mature 21–23 nucleotide-long miRNA is incorporated into the RISC (RNA-induced silencing complex) to guide RNA silencing. Since many fractions of miRNA genes are located in introns, the CBC complex may be involved in the interaction between intronic pre-miRNA and pre-mRNA processing. While it inhibits viral replication by influencing the biogenesis of viral RNA, its effects on cellular and viral RNA biogenesis have not been analyzed in detail. ABX464 acts only on viral replication once proviral DNA is incorporated into cellular DNA. This is important because once the viral genome is incorporated into an infected cell, both the activation and inhibition of precursor mRNA splicing are required.The successful infection and production of novel infectious HIV particles require the balanced expression of seven viral proteins (Rev, Tat, Nef, Vif, Vpr, Vpu, and Env) generated by the splicing of the HIV-1 primary 9-kilobase (kb) transcript; among these, the factors Tat and Rev are essential for viral gene expression at both transcriptional and post-transcriptional levels in infected cells. The HIV-1 primary transcript serves not only as genomic RNA for progeny viruses but also as mRNA encoding viral Gag and Gag-Pol proteins. Most cellular unspliced ​​RNA is retained in the nucleus, where it is degraded, and the nuclear export of unspliced ​​viral RNA is facilitated by the Rev protein through binding to the Rev response element (RRE) and interaction with the CRM1-dependent export machinery. Therefore, inefficient alternative splicing is required to maintain a balance between HIV gene expression and viral production. This balance is thought to be mediated by the presence of HIV long terminal repeats (LTRs) and suboptimal viral 5' and 3' splice sites (5' and 3'ss), which are positively regulated by recognition by regulatory sequences and homologous transacting cellular factors. By binding to the CBC complex, ABX464 has been shown to interfere with Rev-mediated export of unspliced ​​RNA. However, the underlying mechanism behind the regulation of viral and cellular splicing and / or miRNA biogenesis by the binding of ABX464 and CBC is not currently known.

[0002] ABX464 demonstrated potent anti-inflammatory effects and anti-HIV replication effects in a DSS model of inflammatory bowel disease (IBD). ABX464 also demonstrated safety and efficacy in a Phase 2a proof-of-concept clinical trial in patients with ulcerative colitis. However, the effects of ABX464 on viral and cellular RNA biogenesis were not quantified. The problem to be solved

[0003] Now, it has been revealed that ABX464 induces the splicing of long non-coding RNA at the miR-124 locus without altering viral RNA splicing but not cellular splicing, which induces the upregulation of anti-inflammatory miR124. "miR-124 locus" means any one of the miR-124 loci, including the miR-124-1 locus, the miR-124-2 locus, and the miR-124-3 locus. Accordingly, the method and use comprising miR-124 or one of its loci as a biomarker disclosed herein may also be applied to any one of the specific loci known to those skilled in the art, or may be additionally applied. means of solving the problem

[0004] Accordingly, in one aspect, the present invention provides in vitro or ex vivo use of spliced ​​viral RNA variants as biomarkers for viral infection or therapeutic efficacy of said viral infection. In some embodiments, the present invention provides a method for using spliced ​​viral RNA variants as biomarkers for viral infection or therapeutic efficacy of said viral infection, comprising the step of measuring the presence or expression level of spliced ​​viral RNA variants in a biological sample. In some embodiments, treatment of viral infection comprises the step of administering a compound as described herein or a pharmaceutically acceptable salt thereof.

[0005] In another aspect, the present invention provides an in vitro or in vitro use of long non-coding RNA spliced ​​at the miR-124 locus as a biomarker for the efficacy of therapeutic treatment of an inflammatory disease, disorder or condition, or cancer, or said inflammatory disease, disorder or condition, or said cancer. In some embodiments, the present invention provides a method for using long non-coding RNA spliced ​​at the miR-124 locus as a biomarker for the efficacy of therapeutic treatment of an inflammatory disease, disorder or condition, or cancer, or said inflammatory disease, disorder or condition, or said cancer, comprising the step of measuring the presence or expression level of long non-coding RNA spliced ​​at the miR-124 locus in a biological sample. In some embodiments, treatment of an inflammatory disease, disorder or condition, or cancer comprises the step of administering a compound as described herein or a pharmaceutically acceptable salt thereof.

[0006] In one aspect, the present invention relates to the in vitro or in vitro use of the HIV splice variant of SEQ ID NO. 1 as a biomarker for HIV infection or the efficacy of therapeutic treatment of HIV infection.

[0007] In one aspect, the present invention relates to the in vitro or in vitro use of an HIV splice variant of SEQ ID NO. 1 as a biomarker for assessing the biological effect of a compound in treating HIV infection.

[0008] In one aspect, the present invention relates to the in vitro or in vitro use of an HIV splice variant of SEQ ID NO. 1 as a biomarker for screening compounds or vaccines in the prevention and / or treatment of HIV infection.

[0009] In one aspect, the present invention relates to the in vitro or in vitro use of the splicing variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the efficacy of therapeutic treatment of an inflammatory disease, disorder or condition or cancer.

[0010] In one aspect, the present invention relates to the in vitro or in vitro use of the splicing variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for evaluating the biological effects of a compound or medical device in treating inflammatory diseases, disorders or conditions, or cancer.

[0011] In one aspect, the present invention relates to the in vitro or in vitro use of the splicing variant lncRNA 0599-205 at the miR-124-1 locus as a biomarker for selecting patients for therapeutic treatment of inflammatory diseases, disorders or conditions, or cancer.

[0012] In one aspect, the present invention relates to the in vitro or in vitro use of miR-124 as a biomarker for inflammatory diseases, disorders or conditions, or cancer, or the efficacy of therapeutic treatments.

[0013] In one aspect, the present invention relates to the in vitro or in vitro use of miR-124 as a biomarker for selecting patients for the therapeutic treatment of inflammatory diseases, disorders or conditions, or cancer.

[0014] In one aspect of in vitro or in vitro use as defined above, therapeutic treatment comprises the administration of a compound of formulas I, Ia, Ib, Ib', Ic, Id, or IV, IVa, IVb, IVb', IVc, IVd, IV; e.g., ABX464, or a pharmaceutically acceptable salt thereof.

[0015] In one aspect of in vitro or in vitro use as defined above, the compound has a chemical formula I, Ia, Ib, Ib', Ic, Id or IV, IVa, IVb, IVb', IVc, IV ; For example, ABX464, or a pharmaceutically acceptable salt thereof.

[0016] In one aspect of in vitro or in vitro use as defined above, the measured expression level in an isolated biological sample of the HIV splice variant of SEQ ID NO. 1, or the splicing variant lncRNA 0599-205 at the miR-124-1 locus, or the miR-124 is compared to a control reference value. Brief explanation of the drawing

[0017] Fig. 1 This shows the analysis of HIV splicing after ABX464 treatment. a Organization of the HIV-1 genome and different mRNA splicing products. The 5' ss (D1-D4) and 3' ss (A1-A7) are shown. The ORFs of the coding exons of each mRNA product are indicated by different color codes representing the corresponding encoded proteins in the HIV genome. Non-coding exons are boxed in gray.b Suppression of HIV-1 replication measured by p24 production in PBMCs from 6 donors. c Quantification of HIV splicing events using RNA CaptureSeq in PBMCs from 6 different donors that were infected and untreated (DMSO) or treated with ABX464 for 6 days (464). Counts of spliced ​​and unspliced ​​contigs are presented. Different splicing products are colored as in a. d . Sequence of new viral RNA generated by splicing. Fig. 2 It shows that ABX464 does not have an overall effect on cell splicing. a The effects of ABX464 on infected and uninfected CD4+ T cells were tested using a high-throughput RNAseq approach. Sixteen libraries were constructed using four conditions corresponding to four donors: uninfected (DMSO_NI), uninfected and treated with ABX464 (ABX464_NI), infected (DMSO_I), and infected and treated with ABX464 (464_I). Approximately 38 million reads (more than 50% of the total raw reads) were aligned to the exons of the human genome sequence in each sample. b The main trends of the data were interpreted using Multidimensional Scaling Analysis (MDS). cAlternative splicing (AS) events in cellular genes were classified into five major groups (left panel): alternative 5' splice sites (A5SS, orange), alternative 3' splice sites (A3SS, blue), skipped exons (SE, gray), mutually exclusive exons (MXE, gray), and retained exons (RI, yellow). AS event coefficients comparing infected samples versus uninfected samples (DMSO_I vs. DMSO_NI), uninfected samples versus uninfected samples treated with ABX464 (DMSO_NI vs. 464_NI), infected samples versus infected samples treated with ABX464 (DMSO_I vs. 464_I), and CBC after 50% depletion in IPS (IPS depletion in CBC up to 50%) (right panel). d By comparing exon coverage readings of a common high-expression gene (B2M) between ABX464 and DMSO conditions in four donors, the inventors confirmed that ABX464 did not increase splicing events in B2M. e Volcanic plots of DMSO_I vs. DMSO_NI (top panel), DMSO_NI vs. 464_NI (middle panel), and DMSO_I vs. 464_I (bottom panel). Gene expression variations generated by ABX464 treatment were very low in infected (6 downregulated genes) and uninfected (6 downregulated genes) samples. Fig. 3 This shows that ABX464 upregulates a single microRNA, the anti-inflammatory miR-124. aMicroarray assay of small RNAs from PBMCs of 6 donors. PBMCs were infected with the YU-2 strain (I) or uninfected (NI), and treated with ABX464 or untreated (DMSO). The volcano plot shows that infection caused large changes in small non-coding RNAs (left panel), whereas ABX464 induced reproducible upregulation of a single microRNA, miR-124, in infected and uninfected cells (right and middle panels, respectively). b Quantification of miR-124 expression in CD4+ T cells using TaqMan low-density array technology under the same conditions as in A. c Expression of miR-124 measured by qPCR in PBMCs, purified CD4+ and CD8 T cells, and macrophages treated with ABX464 compared to untreated cells (DMSO, fold change). d Expression of miR-124 in PBMCs treated with antiretrovirals ABX464, ABX530, maraviroc, efavirenz, darunavir, and AZT compared to untreated cells (DMSO, fold change). E Quantification of miR-124 in rectal biopsies of healthy participants (n = 10) and HIV patients (n = 9) who received ART with ABX464 on days 1 and 28. Individual graphs show the results for each patient compared to the results of healthy participants. Fig. 4 This illustrates that the upregulation of miR-124 by ABX464 originates from the splicing of a long non-coding RNA at the miR-124-1 locus. a There are three genes encoding miR-124, miR-124-1, miR-124-2, and miR-124-3 located on chromosomes 8 and 20 in the human genome. bThe inventors used a targeted RNA capture and sequencing strategy to determine which gene was induced by ABX464. In both infected and uninfected cells, treatment with ABX464 induced upregulation of miR-124 at the miR.124.1 locus, while the control locus miR-429 was unaffected. c Locus miR-124-1 contains a long non-coding RNA (LncRNA 0599-205) whose splicing is stimulated by ABX464. d . Counts of readings in splice junctions (J1, J2, J3, and J4), exon-exon (J5 and J6), and miR-124 75 bp regions (miR-124) quantified by RNA CaptureSeq in PBMCs treated with ABX464. Fig. 5 It indicates that splicing of LncRNA 0599-205 is required for the production of miR-124. a Schematic diagram of LncRNA 0599-205 precursors and primers used to amplify RNAs of different origins. b . Quantification of spliced ​​and unspliced ​​LncRNA 0599-205 in the presence or absence of ABX464. c Quantification of miR-124 expression after transfection of wild-type and lncRNA0599-205 plasmid splicing mutants in HeLa cells in the presence or absence of ABX464. d Quantification of total wild-type and splicing mutant lncRNA0599-205 in the presence or absence of ABX464. Fig. 6 It illustrates the following: A . Processing steps and B RNA-seq processing pipeline. Fig. 7 Figure 1 shows a representative diagram of the contic assembled from two untreated samples (D5_DMSO and D8_DMSO) and three ABX464 treated samples (D4_464, D5_464 and D8_464). Fig. 8 This shows the FACS analysis using CD45, CCR7, CCR3, and CCR6 surface markers of untreated (red) and ABX464-treated (blue) PBMC (2 donors) and CD4 (4 donors). Fig. 9 This illustrates the analysis of the effect of ABX464 treatment on miRNA expression. a miRNA expression profiling of PBMCs from 6 donors using TaqMan low-density array (TLDA). The volcano plot shows differential miRNA expression in PBMCs treated with ABX464 versus untreated (left panel) and infected versus uninfected PBMCs (right panel). b Comparison of miR-124 expression in macrophages from 6 donors using TaqMan PCR. c Quantification of miR-124 in biopsies of healthy volunteers (normal tissue) and HIV-infected patients who received ART 28 days after ABX464 treatment (HIV + 1 day) and 28 days after (HIV + 28 days). d Quantification of miR-124 in biopsies of HIV patients who received ART on day 1 (D1) and day 28 (D28) of treatment and on day 28 after discontinuation of treatment (D56). Specific details for implementing the invention

[0018] Detailed description of a specific implementation

[0019] 1. Exemplary embodiment of a biomarker and its use:

[0020] It has now been revealed that the effects of ABX464 in treating HIV infection and IBD are mediated by the same mechanism, namely enhanced pre-mRNA splicing. ABX464 was found to not only enhance the pre-mRNA splicing of HIV viral RNA to block HIV replication but also increase the expression of the anti-inflammatory microRNA miR-124 by inducing the splicing of long non-coding RNA that accommodates one of the loci for the anti-inflammatory miR-124. Additionally, ABX464 was found not to affect the pre-mRNA splicing of cellular genes. Although ABX464 does not affect the pre-mRNA splicing of cellular genes, the depletion of the CBC complex by RNAi leads to the accumulation of intron-containing transcripts. These results imply that ABX464 does not inhibit the function of the CBC in splicing but rather enhances it under pathological conditions such as inflammation and HIV infection.

[0021] Viral infection

[0022] In some embodiments, the present invention provides a method for using a spliced ​​viral RNA variant as a biomarker for the efficacy of a viral infection or a therapeutic treatment of said viral infection, comprising the step of measuring the presence or expression level of the spliced ​​viral RNA variant in a biological sample.

[0023] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound on the treatment of a viral infection, comprising the step of measuring the presence or expression level of a spliced ​​viral RNA variant as a biomarker of a viral infection.

[0024] In some embodiments, the present invention provides a method for screening a compound or vaccine for the prevention and / or treatment of a viral infection, comprising the step of measuring the presence or expression level of a spliced ​​viral RNA variant as a biomarker of a viral infection.

[0025] In some embodiments, the present invention provides a method for treating a viral infection, comprising the step of measuring and / or monitoring the presence and / or expression level of a spliced ​​viral RNA variant as a biomarker of the viral infection.

[0026] In some embodiments, the viral infection is a viral infection requiring RNA splicing. In some embodiments, the viral infection requiring RNA splicing is a retroviral infection. In some embodiments, the retroviral infection is an infection of a tumor virus, lentivirus, and / or spumavirus.

[0027] As used herein, the term “oncovirus” is associated with cancer and malignant infection. In some embodiments, the oncovirus is selected from leukemia-inducing viruses (e.g., avian leukemia virus (ALV), murine leukemia virus (MULV) referred to as Moloney virus, feline leukemia virus (FELV), human leukemia viruses, e.g., HTLV1 and HTLV2, primate leukemia virus or STLV, bovine leukemia virus or BLV, primate oncovirus type D, oncovirus type B which is an inducer of mammary tumors, and oncoviruses that cause rapid cancer (e.g., Rous sarcoma virus or RSV).

[0028] The "spumavirus" as used herein exhibits significantly low specificity for certain cell types or certain species, and they are sometimes associated with immunosuppression. In some embodiments, the spumavirus is an primate vesicular virus (or SFV).

[0029] The "lentivirus" used herein is responsible for a slow-progressing pathological condition that very frequently involves immunosuppressive phenomena, including AIDS.

[0030] In some embodiments, the retroviral infection is an HIV and AIDS-related condition. In some embodiments, the HIV and AIDS-related condition is an AIDS-related or AIDS-associated inflammatory disorder or condition.

[0031] In some embodiments, the presence or expression level of spliced ​​viral RNA variants is measured using RNA and / or DNA amplification, sequencing, isotopes, fluorescence, chromogenic enzymes, spectroscopy, spectroscopic analysis, immunoassay, or immuno-enzyme assay.

[0032] As described herein, ABX464 was found to generate novel HIV splice variants in HIV-infected cells (Fig. 1d):

[0033]

[0034] Accordingly, in some embodiments, the spliced ​​viral RNA variant is an HIV splice variant as a biomarker for HIV infection. In some embodiments, the HIV splice variant is SEQ ID NO. 1.

[0035] In some embodiments, the present invention provides a method for using an HIV splice variant of SEQ ID NO. 1 as a biomarker of the efficacy of an HIV infection or a therapeutic treatment of an HIV infection, which comprises the step of measuring the presence or expression level of an HIV splice variant of SEQ ID NO. 1 in a biological sample.

[0036] In some embodiments, the presence of the HIV splice variant of SEQ ID NO. 1 in the isolated biological sample indicates the efficacy of therapeutic treatment for HIV infection.

[0037] In some embodiments, the measured expression level of the HIV splice variant of SEQ NO. 1 in the isolated biological sample is compared with the measured expression level of the HIV splice variant of SEQ NO. 1 in the previously isolated biological sample, wherein an increase in the expression level of the HIV splice variant of SEQ NO. 1 indicates the efficacy of the therapeutic treatment of HIV infection.

[0038] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound for treating HIV infection, which includes a method for measuring the presence or expression level of an HIV splice variant of SEQ ID NO. 1 as a biomarker of HIV infection.

[0039] In some embodiments, the present invention provides a method for screening a compound or vaccine for preventing and / or treating HIV infection, comprising the step of measuring the presence or expression level of an HIV splice variant of SEQ ID NO. 1 as a biomarker of HIV infection.

[0040] In some embodiments, the present invention provides an HIV splice variant comprising SEQ ID NO. 1. In some embodiments, the present invention provides a composition comprising an HIV splice variant comprising SEQ ID NO. 1. In some embodiments, the present invention provides a biological sample comprising an HIV splice variant comprising SEQ ID NO. 1.

[0041] In some embodiments, the present invention provides an HIV splice variant which is an HIV splice variant of SEQ ID NO. 1. In some embodiments, the present invention provides a composition comprising an HIV splice variant of SEQ ID NO. 1. In some embodiments, a biological sample comprising an HIV splice variant of SEQ ID NO. 1 is provided.

[0042] In some embodiments, the present invention provides a method for treating an HIV infection, comprising the step of measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ ID NO. 1 in a patient. In some embodiments, the presence and / or expression level of an HIV splice variant of SEQ ID NO. 1 is measured in a biological sample of the patient. In some embodiments, the biological sample of the patient is a blood sample. In some embodiments, the biological sample of the patient is a tissue sample. In some embodiments, the method of the present invention for treating an HIV infection further comprises the step of measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ ID NO. 1 in a patient before administering a compound as described herein or a pharmaceutically acceptable salt or composition thereof. In some embodiments, the method of the present invention for treating an HIV infection further comprises the step of measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ ID NO. 1 in a patient during a course of treatment with a compound as described herein or a pharmaceutically acceptable salt or composition thereof. In some embodiments, the method of the present invention for treating an HIV infection further comprises the step of selecting a patient to be treated with a compound or a pharmaceutically acceptable salt or composition as described herein by measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ ID NO. 1 in the patient. In some embodiments, the method of the present invention for treating an HIV infection further comprises the step of excluding a patient from treatment using a compound or a pharmaceutically acceptable salt or composition as described herein by measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ ID NO. 1 in the patient.In some embodiments, the method of the present invention for treating an HIV infection further comprises the step of adjusting (e.g., increasing or decreasing) the administration regimen (e.g., dosage and / or administration schedule) of the compound or pharmaceutically acceptable salt or composition as described herein to be administered to the patient by measuring and / or monitoring the presence and / or expression level of the HIV splice variant of SEQ ID NO. 1 in the patient. In some embodiments, the method of the present invention for treating an HIV infection further comprises the step of stopping and / or discontinuing the administration of the compound or pharmaceutically acceptable salt or composition as described herein after the measured presence and / or expression level of the HIV splice variant of SEQ ID NO. 1 reaches a level indicating that treatment may be stopped and / or discontinued (e.g., when the expression level of the HIV splice variant remains in a plateau state).

[0043] In some embodiments, the method of the present invention for treating HIV infection includes the step of comparing a measured expression level of an HIV splice variant of SEQ ID NO. 1 in a patient with a previously measured expression level of an HIV splice variant of SEQ ID NO. 1 in a patient.

[0044] In some embodiments, the method of the present invention for treating HIV infection includes the step of measuring and / or monitoring the presence and / or expression level of the HIV splice variant of SEQ ID NO. 1 in a patient to guide the dosage or monitor the response to treatment.

[0045] In some embodiments, the method of the present invention for treating HIV infection includes the step of guiding therapy by measuring and / or monitoring the HIV splice variant of SEQ ID NO. 1 in a patient.

[0046] In some embodiments, the method of the present invention further comprises the step of measuring the pre-mRNA splicing of cellular genes in a patient or biological sample, wherein the pre-mRNA splicing of cellular genes is not altered compared to a control sample. The control sample may be taken from various sources. In some embodiments, the control sample is taken from the patient prior to treatment or prior to the presence of disease (e.g., stored blood sample or tissue sample). In some embodiments, the control sample is taken from a set of normal, undiseased members of a population. In some embodiments, the control sample is taken from the patient prior to treatment with a compound as described herein or a pharmaceutically acceptable salt or composition thereof. In some embodiments, the cell assay may be performed on a biological sample.

[0047] Inflammatory diseases, disorders and conditions, and cancer

[0048] In some embodiments, the present invention provides a method for using the miR-124 locus as a biomarker for the efficacy of a therapeutic treatment of an inflammatory disease, disorder or condition or cancer, or said inflammatory disease, disorder or condition or other cancer, comprising the step of measuring the presence or expression level of miR-124 in a biological sample.

[0049] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound or medical device on an inflammatory disease, disorder or condition, or cancer treatment, comprising the step of measuring the presence or expression level of miR-124 as a biomarker of said inflammatory disease, disorder or condition, or said cancer.

[0050] In some embodiments, the present invention provides a method for screening a compound or medical device for treating an inflammatory disease, disorder or condition or cancer, comprising the step of measuring the presence or expression level of miR-124 as a biomarker of said inflammatory disease, disorder or condition or said cancer.

[0051] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder or condition, or cancer, comprising the step of measuring and / or monitoring the presence and / or expression level of miR-124 as a biomarker of said inflammatory disease, disorder or condition, or said cancer.

[0052] In some embodiments, the present invention provides a method for using a long non-coding RNA spliced ​​at the miR-124 locus as a biomarker for the efficacy of a therapeutic treatment of an inflammatory disease, disorder or condition or cancer, or said inflammatory disease, disorder or condition or said cancer, comprising the step of measuring the presence or expression level of the long non-coding RNA spliced ​​at the miR-124 locus in a biological sample.

[0053] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound or medical device on an inflammatory disease, disorder or condition, or on cancer treatment, comprising the step of measuring the presence or expression level of a long non-coding RNA spliced ​​at the miR-124 locus as a biomarker of said inflammatory disease, disorder or condition, or said cancer.

[0054] In some embodiments, the present invention provides a method for screening a compound or medical device for treating an inflammatory disease, disorder or condition or cancer, comprising the step of measuring the presence or expression level of a long non-coding RNA spliced ​​at the miR-124 locus as a biomarker of said inflammatory disease, disorder or condition or said cancer.

[0055] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder or condition, or cancer, comprising the step of measuring and / or monitoring the presence and / or expression level of a long non-coding RNA spliced ​​at the miR-124 locus as a biomarker of said inflammatory disease, disorder or condition, or said cancer.

[0056] In some embodiments, the long non-coding RNA spliced ​​at the miR-124 locus is at the miR-124-1 locus. In some embodiments, the long non-coding RNA spliced ​​at the miR-124 locus is at the miR-124-2 locus. In some embodiments, the long non-coding RNA spliced ​​at the miR-124 locus is at the miR-124-3 locus.

[0057] In some embodiments, the presence or expression level of long non-coding RNA spliced ​​at the miR-124 locus is measured using RNA and / or DNA amplification, sequencing, isotope analysis, fluorescence, chromogenic enzyme analysis, spectroscopy, spectroscopic analysis, immunoassay, or immunoenzyme assay.

[0058] As described herein, ABX464 was found to induce a long non-coding RNA (lncRNA 0599-205) at the miR-124-1 locus (Figs. 4a and c). The long non-coding RNA, referred to as ≪lncRNA0599-205≫ or ≪LINC00599-205≫ throughout this invention and specification, originates from a region of the miR-124-1 locus on chromosome 8 containing the miR-124-1 locus, specifically from position 9903000 to position 9904500, and in particular from position 9903107 to position 9904210 (Figs. 4a and c). For reference, a region of the sequence containing the transcript lncRNA 0599-205 is further referred to herein by SEQ ID NO. 15. The sequences of the three exons corresponding to the lncRNA0599-205 transcript from 5' to 3' are further referenced herein as SEQ ID NO. 16, SEQ ID NO. 17, and SEQ ID NO. 18, respectively. The sequence of the lncRNA 0599-205 transcript is further registered in the ENSEMBL database as ENST00000521863.1.

[0059] Accordingly, in some embodiments, the long non-coding RNA spliced ​​at the miR-124 locus is lncRNA 0599-205 at the miR-124-1 locus as a biomarker for inflammatory diseases, disorders or conditions, or cancer.

[0060] In some embodiments, the present invention provides a method for using lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the efficacy of a therapeutic treatment of an inflammatory disease, disorder or condition or cancer, or an inflammatory disease, disorder or condition or cancer, comprising the step of measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus in a biological sample.

[0061] In some embodiments, the presence of lncRNA 0599-205 at the miR-124-1 locus in isolated biological samples indicates the efficacy of therapeutic treatment for inflammatory diseases, disorders or conditions, or cancer.

[0062] In some embodiments, the expression level of lncRNA 0599-205 measured at the miR-124-1 locus of an isolated biological sample is compared with the expression level of lncRNA 0599-205 measured at the miR-124-1 locus of a previously isolated biological sample, wherein an increase in the expression level of lncRNA 0599-205 at the miR-124-1 locus indicates the efficacy of a therapeutic treatment for an inflammatory disease, disorder or condition, or cancer.

[0063] In some embodiments, the present invention provides a method for evaluating the biological effect of a compound for the treatment of an inflammatory disease, disorder or condition or cancer, comprising the step of measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker of an inflammatory disease, disorder or condition or cancer.

[0064] In some embodiments, the present invention provides a method for screening compounds for treating an inflammatory disease, disorder or condition or cancer, comprising the step of measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker of an inflammatory disease, disorder or condition or cancer.

[0065] In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises the step of measuring and / or monitoring the presence and / or level of lncRNA 0599-205 at the patient's miR-124-1 locus. In some embodiments, the presence and / or level of lncRNA 0599-205 at the patient's miR-124-1 locus is measured in a biological sample of the patient. In some embodiments, the patient's biological sample is a blood sample. In some embodiments, the patient's biological sample is a tissue sample. In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises the step of measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the patient's miR-124-1 locus before administering a compound or a pharmaceutically acceptable salt or composition thereof as described herein. In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises the step of measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at a patient's miR-124-1 locus during a course of treatment with a compound or a pharmaceutically acceptable salt or composition thereof as described herein. In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises the step of selecting a patient to be treated with a compound or a pharmaceutically acceptable salt or composition thereof as described herein by measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at a patient's miR-124-1 locus.In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises the step of excluding a patient from treatment using a compound or a pharmaceutically acceptable salt or composition as described herein by measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the patient's miR-124-1 locus. In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer further comprises the step of adjusting (e.g., increasing or decreasing) the dosage regimen (e.g., dosage and / or administration schedule) of the compound or a pharmaceutically acceptable salt or composition as described herein to be administered to the patient by measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the patient's miR-124-1 locus.

[0066] In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer comprises the step of comparing the measured expression level of lncRNA 0599-205 at the patient's miR-124-1 locus with a control reference value. The control reference value used to compare the expression level of lncRNA 0599-205 measured at the patient's miR-124-1 locus is obtained from a control sample. The control sample may be taken from various sources. In some embodiments, the control sample is taken from the patient before treatment or before the presence of the disease (e.g., stored blood sample or tissue sample). In some embodiments, the control sample is taken from a set of normal, disease-free members of a population. In some embodiments, the control sample is taken from the patient before treatment with a compound or a pharmaceutically acceptable salt or composition thereof as described herein. In some embodiments, cell assays may be performed on biological samples.

[0067] In some embodiments, the presence and / or expression level of lncRNA 0599-205 regulated at the patient's miR-124-1 locus compared to a control reference value indicates an inflammatory disease, disorder or condition, or cancer. In some embodiments, the presence and / or expression level of lncRNA 0599-205 regulated at the patient's miR-124-1 locus compared to a control reference value indicates the efficacy of a treatment using a compound or a pharmaceutically acceptable salt or composition thereof as described herein administered to the patient. The term "regulated" or "regulated presence and / or expression level" means that the presence or expression level of a biomarker, e.g., lncRNA 0599-205, at the miR-124-1 locus is induced, increased, or alternatively inhibited or decreased.

[0068] In some embodiments, a reduced or repressed presence or reduced expression level of lncRNA 0599-205 measured at the miR-124-1 locus relative to the control reference value indicates an inflammatory disease, disorder or condition, or cancer. In some embodiments, an induced or increased presence or increased expression level of lncRNA 0599-205 measured at the miR-124-1 locus relative to the control reference value indicates the efficacy of the compound or its pharmaceutically acceptable salt or composition as described herein. In some embodiments, the expression level of lncRNA 0599-205 measured at the miR-124-1 locus in patients treated with the compound or its pharmaceutically acceptable salt or composition as described herein is a 2-fold, 4-fold, 6-fold, 8-fold, or 10-fold increase relative to the control reference value.

[0069] In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer comprises the step of measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at a patient's miR-124-1 locus to guide the dosage or monitor the response to treatment.

[0070] In some embodiments, the method of the present invention for treating an inflammatory disease, disorder or condition, or cancer comprises the step of guiding therapy by measuring and / or monitoring lncRNA 0599-205 at the patient's miR-124-1 locus.

[0071] In some embodiments, the present invention provides an algorithm for combining levels of lncRNA 0599-205 at the miR-124-1 locus with levels of cytokines or other biomarkers for monitoring the severity of inflammatory diseases, disorders or conditions, or cancers, and / or monitoring the efficacy of a treatment, including but not limited to the treatments described herein. In some embodiments, a treatment method as described herein comprises the step of using an algorithm for combining levels of lncRNA 0599-205 at the miR-124-1 locus with levels of cytokines or other biomarkers for monitoring the severity of inflammatory diseases, disorders or conditions, or cancers, and / or monitoring the efficacy of a treatment.

[0072] 2. Definition:

[0073] The compounds of the present invention may exist in the form of addition salts with free bases or pharmaceutically acceptable acids. Suitable physiologically acceptable acid addition salts of the compounds of the present invention include sulfates, hydrobromides, citrates, trifluoroacetates, ascorbates, hydrochlorides, tartrates, triflates, maleates, mesylates, formates, acetates, fumarates, and sulfons, in particular alkylsulfonsates or arylsulfons, more particularly mesylates, triflates, edicilates, besylates, and tosylates.

[0074] The compounds of the present invention and / or salts thereof may form solvates or hydrates, and the present invention comprises both such solvates and hydrates. The terms "hydrate" and "solvate" simply mean that the compounds according to the present invention may be in the form of hydrates or solvates, that is, may be combined or bonded with one or more water or solvent molecules. This is merely a chemical characteristic of such compounds and may be applied to all organic compounds of this type.

[0075] The compounds of the present invention may comprise one or more asymmetric carbon atoms. Accordingly, they may exist in the form of enantiomers or diastereomers. Mixtures thereof, including such enantiomers, diastereomers, and racemic mixtures, are included within the scope of the present invention.

[0076] In the context of the present invention, terms:

[0077] - "Halogen" is understood to mean chlorine, fluorine, bromine, or iodine, specifically referring to chlorine, fluorine, or bromine,

[0078] - As used herein, "(C1-C5)alkyl" refers to C1-C5 normal, secondary, or tertiary saturated hydrocarbons, respectively. Examples include, but are not limited to, methyl, ethyl, 1-propyl, 2-propyl, butyl, and pentyl.

[0079] - As used herein, "(C3-C6)cycloalkyl" refers to each cyclic saturated hydrocarbon. Examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

[0080] - As used herein, "(C1-C4)alkoxy" refers to an O-(C1-C4)alkyl portion, wherein the alkyl is as defined above. Examples include, but are not limited to, methoxy, ethoxy, 1-propoxy, 2-propoxy, and butoxy.

[0081] - "Fluoroalkyl group" and "fluoroalkoxy group" refer to the alkyl group and alkoxy group as defined above, respectively, said group being substituted with at least one fluorine atom. Examples include perfluoroalkyl groups such as trifluoromethyl or perfluoropropyl, and

[0082] - As used herein, “saturated pentagonal or hexagonal heterocycle” refers to a saturated cycle containing at least one heteroatom. Examples include, but are not limited to, morpholine, piperazine, thiomorpholine, piperidine, and pyrrolidine.

[0083] As used herein, the term “pharmaceuticalally acceptable salt” refers to a salt that is suitable for use in contact with human and lower animal tissues without excessive toxicity, irritation, or allergic reactions within the scope of sound medical judgment, and is suitable for a reasonable benefit-risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in the literature cited herein by reference (cf. J. Pharmaceutical Sciences, 1977, 66, 1-19). Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases.

[0084] Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromide, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by other methods used in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphosulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, maleate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, Includes pectinate, persulfate, 3-phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, etc.

[0085] Salts derived from appropriate bases are alkali metals, alkaline earth metals, ammonium, and N + (C 1-4It includes alkyl)tetraphosphates. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Additional pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkyl sulfonates, and aryl sulfonates.

[0086] Unless otherwise noted, the structures described herein also mean all isomers of the structure (e.g., enantiomers, diastereomers, and geometric (or morphological) forms); for example, the R and S forms of each asymmetric center, Z and E double bond isomers, and Z and E form isomers. Thus, not only single stereochemical isomers but also enantiomers, diastereomers, and geometric (or morphological) mixtures of the compounds of the present invention are within the scope of the present invention. Unless otherwise noted, all tautomeric forms of the compounds of the present invention are within the scope of the present invention. Additionally, unless otherwise noted, the structures described herein also mean that the compounds differ only in the presence of one or more isotope-rich atoms. For example, replacing hydrogen with deuterium or tritium, or carbon 13 C- or 14 Compounds having the present structure, including substitution with a C-rich carbon, are within the scope of the present invention. Such compounds are useful, for example, as analytical tools, probes for biological assays, or therapeutic agents according to the present invention.

[0087] 3. Exemplary implementation of the treatment method:

[0088] In one aspect, the present invention provides a method for treating a viral infection or inflammatory disease, disorder or condition or cancer, comprising the step of administering a compound of the following formula I or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0089] [Chemical Formula I]

[0090]

[0091] In the above formula,

[0092] Z is C or N and;

[0093] V is C or N;

[0094] is where V is C or N, and when V is N, V ​​means an ortho, meta, or para aromatic ring with respect to Z;

[0095] Each R is independently hydrogen, halogen, -CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, -NO2, -NR1R2, (C1-C4)alkoxy, phenoxy, -NR1-SO2-NR1R2, -NR1-SO2-R1, -NR1-C(=O)-R1, -NR1-C(=O)-NR1R2, -SO2-NR1R2, -SO3H, -O-SO2-OR3, -OP(=O)-(OR3)(OR4), -O-CH2-COOR3, (C1-C3)alkyl, and said alkyl is a hydroxyl group or formula IIa The group of, or chemical formula IIIa Arbitrarily one- or two-substituted into a group of;

[0096] Q is N or O, provided that if Q is O, R" does not exist;

[0097] R1 and R2 are each independently hydrogen or (C1-C3)alkyl;

[0098] R3 and R4 are independently hydrogen, Li + , Na + , K + , N + (Ra)4 or benzyl;

[0099] n is 1, 2, or 3, and;

[0100] n' is 1, 2, or 3 and;

[0101] Each R' is independently hydrogen, (C1-C3)alkyl, hydroxyl, halogen, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3)fluoroalkyl, (C1-C4)alkoxy, -OP(=O)-(OR3)(OR4), -CN, chemical formula IIa The group of, or chemical formula IIIa It is a group of,

[0102] A is a covalent bond, oxygen, or NH;

[0103] B is a covalent bond or NH;

[0104] m is 1, 2, 3, 4, or 5;

[0105] p is 1, 2, or 3, and;

[0106] Ra and Rb are each independently hydrogen, (C1-C5)alkyl or (C3-C6)cycloalkyl, or

[0107] Ra and Rb form a saturated pentatonic or hexavalent heterocycle with the nitrogen atoms to which they are attached, said heterocycle being optionally substituted by one or more Ra, provided that if R' is a group of formula IIa or IIIa, n' can be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa;

[0108] R" is hydrogen, (C1-C4)alkyl, or a group of formula IIa as defined above.

[0109] As generally defined above, Z is C or N.

[0110] In some embodiments, Z is C. In some embodiments, Z is N.

[0111] In some embodiments, Z is as follows Table 1-3 It is selected from those described in.

[0112] As generally defined above, V is C or N.

[0113] In some embodiments, V is C. In some embodiments, V is N.

[0114] In some embodiments, V is as follows Table 1-3 It is selected from those described in.

[0115] As generally defined above, V is C or N, and if V is N, V ​​means an ortho, meta, or para aromatic ring with respect to Z.

[0116] In some implementations, represents an aromatic ring where V is C.

[0117] In some implementations, represents an aromatic ring where V is N and V is ortho, meta, or para with respect to Z. In some embodiments, V is N and V is ortho with respect to Z. In some embodiments, V is N and V is meta with respect to Z. In some embodiments, V is N and V is para with respect to Z.

[0118] In some implementations, is phenyl. In some embodiments, is pyridine. In some embodiments, is Piridazine. In some embodiments, is a pyrimidine. In some embodiments, is pyrazine.

[0119] In some implementations, is doing Table 1-3 It is selected from those described in.

[0120] As generally described above, each R is independently hydrogen, halogen, -CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, -NO2, -NR1R2, (C1-C4)alkoxy, phenoxy, -NR1-SO2-NR1R2, -NR1-SO2-R1, -NR1-C(=O)-R1, -NR1-C(=O)-NR1R2, -SO2-NR1R2, -SO3H, -O-SO2-OR3, -OP(=O)-(OR3)(OR4), -O-CH2-COOR3, or (C1-C3)alkyl, and the alkyl is optionally uni- or d-substituted by a hydroxyl group.

[0121] In some embodiments, R is hydrogen. In some embodiments, R is a halogen. In some embodiments, R is -CN. In some embodiments, R is a hydroxyl. In some embodiments, R is a (C1-C3)fluoroalkyl, said alkyl is uni- or d-substituted by a hydroxyl. In some embodiments, R is a (C1-C3)fluoroalkoxy. In some embodiments, R is a (C1-C3)cycloalkyl. In some embodiments, R is -NO2. In some embodiments, R is -NR1R2. In some embodiments, R is a (C1-C4)alkoxy. In some embodiments, R is a phenoxy. In some embodiments, R is -NR1-SO2-NR1R2. In some embodiments, R is -NR1-SO2-R1. In some embodiments, R is -NR1-C(=O)-R1. In some embodiments, R is -NR1-C(=O)-NR1R2. In some embodiments, R is -SO2-NR1R2. In some embodiments, R is -SO3H. In some embodiments, R is -O-SO2-OR3. In some embodiments, R is -OP(=O)-(OR3)(OR4). In some embodiments, R is -O-CH2-COOR3. In some embodiments, R is (C1-C3)alkyl, and the alkyl is optionally uni- or bi-substituted with a hydroxyl.

[0122] In some embodiments, each R is independently a halogen, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, -NR1R2, (C1-C4)alkoxy, or (C1-C3)alkyl.

[0123] In some embodiments, each R is independently hydrogen, methyl, methoxy, trifluoromethyl, trifluoromethoxy, amino, halogen, or -OP(=O)-(OR3)(OR4). In some embodiments, R is methyl. In some embodiments, R is methoxy. In some embodiments, R is trifluoromethyl. In some embodiments, R is trifluoromethoxy. In some embodiments, R is amino. In some embodiments, R is -OP(=O)-(OR3)(OR4).

[0124] In some embodiments, each R is independently methyl, methoxy, trifluoromethyl, halogen, trifluoromethoxy, or amino.

[0125] In some implementations, R is as follows Table 1-3 It is selected from those described in.

[0126] As generally stated above, Q is N or O, provided that when Q is O, R" does not exist.

[0127] In some implementations, Q is N. In some implementations, Q is O and R" does not exist.

[0128] In some embodiments, Q is as follows Table 1-3 It is selected from those described in.

[0129] As generally stated above, R1 and R2 are each independently hydrogen or (C1-C3)alkyl.

[0130] In some embodiments, R1 is hydrogen. In some embodiments, R1 is a (C1-C3)alkyl. In some embodiments, R2 is hydrogen. In some embodiments, R2 is a (C1-C3)alkyl.

[0131] In some embodiments, each R1 and R2 is as follows Table 1-3 It is selected independently from those described in.

[0132] As generally described above, R3 and R4 are each independently hydrogen, Li + , Na + , K + , N + (Ra)4 or benzyl.

[0133] In some embodiments, R3 is hydrogen. In some embodiments, R3 is Li + is. In some implementations, R3 is Na + is. In some implementations, R3 is K + is. In some implementations, R3 is N + (Ra)4. In some embodiments, R3 is benzyl. In some embodiments, R4 is hydrogen. In some embodiments, R4 is Li + is. In some implementations, R4 is Na + is. In some embodiments, R4 is K + is. In some implementations, R4 is N + (Ra)4. In some embodiments, R4 is benzyl.

[0134] In some embodiments, each R3 and R4 is as follows Table 1-3 It is selected independently from those described in.

[0135] As generally stated above, n is 1, 2, or 3.

[0136] In some embodiments, n is 1 or 2. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3.

[0137] In some implementations, n is as follows Table 1-3 It is selected from those described in.

[0138] As generally stated above, n' is 1, 2, or 3.

[0139] In some embodiments, n' is 1 or 2. In some embodiments, n' is 1. In some embodiments, n' is 2. In some embodiments, n' is 3.

[0140] In some implementations, n' is as follows Table 1-3 It is selected from those described in.

[0141] As generally described above, each R' is independently hydrogen, (C1-C3)alkyl, hydroxyl, halogen, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3)fluoroalkyl, (C1-C4)alkoxy, -OP(=O)-(OR3)(OR4), -CN, chemical formula IIa The group of, or chemical formula IIIa It is a group of.

[0142] In some embodiments, R' is hydrogen. In some embodiments, R' is (C1-C3)alkyl. In some embodiments, R' is hydroxyl. In some embodiments, R' is a halogen. In some embodiments, R' is -NO2. In some embodiments, R' is -NR1R2. In some embodiments, R' is morpholinyl. In some embodiments, R' is morpholino. In some embodiments, R' is N-methylpiperazinyl. In some embodiments, R' is (C1-C3)fluoroalkyl. In some embodiments, R' is (C1-C4)alkoxy. In some embodiments, R' is -OP(=O)-(OR3)(OR4). In some embodiments, R' is -CN. In some embodiments, R' is formula IIa It is a group of. In some embodiments, R' is formula IIIa It is a group of.

[0143] In some embodiments, R' is amino. In some embodiments, R' is methyl. In some embodiments, R' is a chemical formula It is a group of, where A is O or NH, m is 2 or 3, and X1 is O, CH 2　or N-CH3, provided that if R' is such a group, n' is 1 or 2, and if n' is 2, the other R' group is different from the above group.

[0144] In some embodiments, R' is a chemical formula It is a group of, where A is O or NH, m is 2, and X1 is O, CH 2　 or N-CH3, provided that if R' is such a group, n' is 1 or 2, and if n' is 2, the other R' group is different from the above group.

[0145] In some embodiments, R' is a chemical formula It is a group of, where A is O or NH, m is 3, and X1 is O, CH 2　 or N-CH3, provided that if R' is such a group, n' is 1 or 2, and if n' is 2, the other R' group is different from the above group.

[0146] In some embodiments, each R' is independently hydrogen, halogen, amino, methyl, -OP(=O)-(OR3)(OR4), or a chemical formula It is a group of, where A is O or NH, m is 2 or 3, and X1 is O, CH 2　 or N-CH3, provided that if R' is such a group, n' is 1 or 2, and if n' is 2, the other R' group is different from the above group.

[0147] In some embodiments, each R' is independently hydrogen, halogen, methyl, or a chemical formula It is a group of, where A is O or NH, m is 2, and X1 is O, CH 2　 or N-CH3, provided that if R' is such a group, n' is 1 or 2, and if n' is 2, the other R' group is different from the above group.

[0148] In some embodiments, each R' is independently a halogen, (C1-C3)alkyl, hydroxyl, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3)fluoroalkyl, (C1-C4)alkoxy, or a group of formula IIa or IIIa as described herein.

[0149] In some embodiments, R' is a halogen or methyl.

[0150] In some embodiments, each R' is as follows Table 1-3 It is selected independently from those described in.

[0151] As generally stated above, A is a covalent bond, oxygen, or NH.

[0152] In some embodiments, A is a covalent bond. In some embodiments, A is oxygen. In some embodiments, A is NH.

[0153] In some embodiments, A is as follows: Table 1-3 It is selected from those described in.

[0154] As generally stated above, B is a covalent bond or NH.

[0155] In some embodiments, B is a covalent bond. In some embodiments, B is NH.

[0156] In some embodiments, B is selected from those described in Table 1-3 below.

[0157] As generally stated above, m is 1, 2, 3, 4, or 5.

[0158] In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5.

[0159] In some embodiments, m is as follows Table 1-3 It is selected from those described in.

[0160] As generally stated above, p is 1, 2, or 3.

[0161] In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 4. In some embodiments, p is 5.

[0162] In some implementations, p is as follows Table 1-3 It is selected from those described in.

[0163] As generally described above, Ra and Rb are each independently hydrogen, (C1-C5)alkyl, or (C3-C6)cycloalkyl, or Ra and Rb form a saturated 5- or 6-membered heterocycle with the nitrogen atom to which they are attached, said heterocycle being optionally substituted by one or more Ra, provided that if R' is a group of formula IIa or IIIa, n' may be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa.

[0164] In some embodiments, Ra is hydrogen. In some embodiments, Ra is a (C1-C5)alkyl. In some embodiments, Ra is a (C3-C6)cycloalkyl. In some embodiments, Rb is hydrogen. In some embodiments, Rb is a (C1-C5)alkyl. In some embodiments, Rb is a (C3-C6)cycloalkyl.

[0165] In some embodiments, Ra and Rb form a saturated five- or six-membered heterocycle with the nitrogen atoms to which they are attached, said heterocycle being optionally substituted by one or more Ras, provided that if R' is a group of formula IIa or IIIa, n' may be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa. In some embodiments, as described above, the saturated five- or six-membered heterocycle formed with Ra and Rb and the nitrogen atoms to which they are attached has optionally an additional heteroatom selected from N, O, and S.

[0166] In some embodiments, Ra and Rb form a saturated pentatonic or hexacyclic heterocycle having additional heteroatoms selected from N, O and S together with the nitrogen atoms to which they are attached, said heterocycle being substituted by one or more Ra, provided that when R' is a group of formula IIa or IIIa, n' can be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa.

[0167] In some embodiments, Ra and Rb form a saturated five-membered heterocycle with the nitrogen atoms to which they are attached, provided that if R' is a group of formula IIa or IIIa, n' can be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa.

[0168] In some embodiments, Ra and Rb form a saturated six-membered heterocycle with the nitrogen atoms to which they are attached, provided that if R' is a group of formula IIa or IIIa, n' can be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa.

[0169] In some embodiments, Ra and Rb form a saturated pentatonic or hexacyclic heterocycle having optional additional heteroatoms selected from N, O and S together with the nitrogen atoms to which they are attached, said heterocycle being optionally substituted by one or more Ras, provided that if R' is a group of formula IIa or IIIa, n' can be 2 only if the other R' group is different from the group of formula IIa or IIIa.

[0170] In some embodiments, each Ra and Rb is as follows Table 1-3 It is selected independently from those described in.

[0171] As generally stated above, R" is hydrogen, (C1-C4)alkyl, or a group of formula IIa as defined above.

[0172] In some embodiments, R" is hydrogen or (C1-C4)alkyl. In some embodiments, R" is hydrogen. In some embodiments, R" is (C1-C4)alkyl. In some embodiments, R" is a group of Formula IIa as described herein.

[0173] In some embodiments, R" is a chemical formula It is a group of, where m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0174] In some implementations, R" is as follows Table 1-3 It is selected from those described in.

[0175] In some embodiments, n is 1; n' is 1 or 2; R" is H; R is selected from methyl, methoxy, trifluoromethyl, halogen, trifluoromethoxy, and amino; and each R' is independently halogen, methyl, or group And, where A is O or NH, m is 2 or 3, X1 is O, CH2 or N-CH3, except when n' is 2, other R' groups are different from the above groups.

[0176] In some embodiments, n is 1; n' is 1; R" is H; R is selected from methyl, methoxy, trifluoromethyl, halogen and trifluoromethoxy; and R' is halogen or methyl.

[0177] In some embodiments, the present invention provides a method for treating a viral infection or inflammatory disease, disorder or condition or cancer, comprising the step of administering a compound of formula Ia or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0178] [Chemical Formula Ia]

[0179]

[0180] In the above formula,

[0181] Variables R, R', R", n, and n' are each defined independently as above and described alone and in combination in embodiments of the present invention.

[0182] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula Ib or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0183] [Chemical Formula Ib]

[0184]

[0185] In the above formula,

[0186] Variables R, R', R", n, and n' are each defined independently as above and described alone and in combination in embodiments of the present invention.

[0187] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula Ic or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0188] [Chemical Formula Ic]

[0189]

[0190] In the above formula,

[0191] Variables R, R', R", n, and n' are each defined independently as above and described alone and in combination in embodiments of the present invention.

[0192] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula Ib' or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0193] [Chemical formula Ib']

[0194]

[0195] In the above formula,

[0196] Variables R, R', R", and n are each defined independently as described above and as alone and in combination in embodiments of the present invention.

[0197] In some embodiments, the present invention provides a method for treating a viral infection or inflammatory disease, disorder or condition or cancer, comprising the step of administering a compound of formula Ib or a pharmaceutically acceptable salt thereof to a patient in need thereof, wherein

[0198] Each R is independently a halogen, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, -NR1R2, (C1-C4)alkoxy, or (C1-C3)alkyl, said alkyl is optionally uni- or disubstituted by a hydroxyl group;

[0199] n is 1 or 2 and;

[0200] n' is 1 or 2 and;

[0201] R1 and R2 are each independently hydrogen or (C1-C3)alkyl;

[0202] Each R' is independently a halogen, (C1-C3)alkyl, hydroxyl, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3)fluoroalkyl, (C1-C3)alkoxy, or a group of formula IIa or IIIa as described herein;

[0203] A is a covalent bond, oxygen, or NH;

[0204] B is a covalent bond or NH;

[0205] m is 1, 2, 3, 4, or 5;

[0206] p is 1, 2, or 3, and;

[0207] Ra and Rb are each independently hydrogen, (C1-C5)alkyl or (C3-C6)cycloalkyl, or

[0208] Ra and Rb form a saturated pentatonic or hexacyclic heterocycle having optional additional heteroatoms selected from N, O, and S together with the nitrogen atoms to which they are attached, said heterocycle being optionally substituted with one or more Ra, provided that if R' is a group of formula IIa or IIIa, n' may be 2 only if the other R' group is different from the group of formula IIa or IIIa;

[0209] R" is hydrogen or (C1-C4)alkyl.

[0210] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula Ib or a pharmaceutically acceptable salt thereof to a patient in need thereof, wherein each R' is independently hydrogen, a halogen, a (C1-C3)alkyl or (C1-C4)alkoxy group, said alkyl is optionally uni- or disubstituted by a hydroxyl group; R" is hydrogen or (C1-C4)alkyl; n is 1 or 2; n' is 1 or 2; where n is 1, R is (C1-C3)fluoroalkoxy, NR1R2, or phenoxy, said R1 and R2 are each independently (C1-C3)alkyl; and where n is 2, one of the two R groups is (C1-C3)fluoroalkoxy and the other R group is (C1-C3)alkyl.

[0211] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula Ib or a pharmaceutically acceptable salt thereof to a patient in need thereof, wherein each R is independently a (C1-C3)fluoroalkoxy; each R' is independently hydrogen, a halogen, a (C1-C3)alkyl or a (C1-C4)alkoxy; R" is hydrogen or a (C1-C4)alkyl; n is 1; and n' is 1 or 2.

[0212] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula Ib' or a pharmaceutically acceptable salt thereof to a patient in need thereof, wherein each R is independently hydrogen, halogen, (C1-C3)alkyl, -NR1R2, (C1-C3)fluoroalkoxy, -NO2, phenoxy, or (C1-C4)alkoxy, said alkyl is optionally uni- or disubstituted by a hydroxyl group; R1 and R2 are each independently hydrogen or (C1-C3)alkyl; R' is hydrogen, halogen, (C1-C3)alkyl or (C1-C4)alkoxy, provided that R' is different from a methyl group at position 4 of a quinoline group; R" is hydrogen or (C1-C4)alkyl; n is 1, 2 or 3; and n' is 1 or 2.

[0213] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of the following formula Id or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0214] [Chemical Formula Id]

[0215]

[0216] In the above formula,

[0217] R and R' each are independently defined as above and described alone and in combination in embodiments of the present invention, and

[0218] R'" is hydrogen or group And, where A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0219] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula Id or a pharmaceutically acceptable salt thereof to a patient in need thereof, wherein R is methyl, methoxy, trifluoromethyl, halogen, trifluoromethoxy, or amino; R' is halogen or methyl, and R'" is hydrogen or a group And, where A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0220] In some embodiments, R'" is hydrogen. In some embodiments, R'" is a group and, where A is O or NH, m is 2 or 3, and X1 is O, CH2, or N-CH3. In some embodiments, R'" is a group and, where A is O, m is 2 or 3, and X1 is O, CH2, or N-CH3. In some embodiments, R'" is a group And, where A is NH, m is 2 or 3, and X1 is O, CH2 or N-CH3.

[0221] In some embodiments, the present invention provides a method for treating a viral infection or inflammatory disease, disorder or condition or cancer, comprising the step of administering a compound of the following formula ("ABX464") or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0222] .

[0223] In some embodiments, compound ABX464 or a pharmaceutically acceptable salt thereof is in an amorphous form. In some embodiments, compound ABX464 or a pharmaceutically acceptable salt thereof is in a crystallized form. In some embodiments, the crystallized form of compound ABX464 or a pharmaceutically acceptable salt thereof has a melting point at 120.5°C (± 2°C). In some embodiments, the crystallized form of compound ABX464 or a pharmaceutically acceptable salt thereof exhibits peaks in X-ray powder diffraction (XRPD) at angles 7.3, 14.6, 18.4, and 24.9. In some embodiments, the crystallized form of compound ABX464 or a pharmaceutically acceptable salt thereof exhibits one or more XRPD peaks at angles selected from 18.0, 24.2, 28.3, and 29.5. In some embodiments, the crystallized form of compound ABX464 or a pharmaceutically acceptable salt thereof exhibits one or more XRPD peaks at angles selected from 18.6, 22.3, 23.0, and 23.5.

[0224] In some embodiments, the present invention Table 1 A method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer is provided, comprising the step of administering a compound selected from or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0225] [Table 1]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235] In some embodiments, the present invention Table 2 A method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer is provided, comprising the step of administering a compound selected from or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0236] [Table 2]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252] In some embodiments, the present invention Table 3A method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer is provided, comprising the step of administering a compound selected from or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0253] [Table 3]

[0254]

[0255]

[0256] In some embodiments, the compounds described herein exist in the form of salts selected from sulfates, hydrobromides, citrates, trifluoroacetates, ascorbates, hydrochlorides, tartrates, triflates, maleates, mesylates, formates, acetates, fumarates, and sulfons. In some embodiments, the compounds described herein exist in the form of salts such as alkylsulfons or arylsulfons. In some embodiments, the compounds described herein exist in the form of salts such as mesylates, triflates, edicilates, besylates, and tosylates.

[0257] In one aspect, the present invention provides a method for treating a viral infection or inflammatory disease, disorder or condition, or cancer, comprising the step of administering a metabolite of the compound described herein to a patient in need thereof. In some embodiments, the metabolite of the compound described herein is an N-glucuronide metabolite.

[0258] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of Formula IV or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0259] [Chemical Formula IV]

[0260]

[0261] In the above formula,

[0262] Variables V, Z, R, R', n, and n' are each as defined above and described alone or in combination in embodiments of the present invention.

[0263] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula IVa or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0264] [Chemical Formula IVa]

[0265]

[0266] In the above formula,

[0267] Variables R, R', n, and n' are each defined independently as above and as defined alone and in combination in embodiments of the present invention.

[0268] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula IVb or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0269] [Chemical Formula IVb]

[0270]

[0271] In the above formula,

[0272] Variables R, R', n, and n' are each defined independently as described above and as alone and in combination in embodiments of the present invention.

[0273] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula IVc or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0274] [Chemical Formula IVc]

[0275]

[0276] In the above formula,

[0277] Variables R, R', n, and n' are each defined independently as described above and as alone and in combination in embodiments of the present invention.

[0278] In some embodiments, the present invention provides a method for treating a viral infection or inflammatory disease, disorder or condition or cancer, comprising the step of administering a compound of formula IVb' or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0279] [Chemical formula IVb']

[0280]

[0281] In the above formula,

[0282] Variables R, R', and n are each defined independently as described above and as alone and in combination in embodiments of the present invention.

[0283] In some embodiments, the present invention provides a method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer, comprising the step of administering a compound of formula IVd or a pharmaceutically acceptable salt thereof to a patient in need thereof:

[0284] [Chemical Formula IVd]

[0285]

[0286] In the above formula

[0287] Variables R, R', and R'" are each defined independently as described above and as alone and in combination in embodiments of the present invention.

[0288] In some embodiments, the present invention has a formula A method for treating a viral infection, or an inflammatory disease, disorder or condition, or cancer is provided, comprising the step of administering a compound or a pharmaceutically acceptable salt thereof to a patient in need thereof.

[0289] In some embodiments, the method of the present invention comprises the step of measuring the level of the compound described herein, or its pharmaceutically acceptable salt, or its metabolite, in a patient. In some embodiments, the level of the compound as described herein, or its pharmaceutically acceptable salt, or its metabolite, is measured in a biological sample of the patient. In some embodiments, the biological sample of the patient is a blood, plasma, and / or serum sample. In some embodiments, the method of the present invention comprises the step of measuring the level of the compound of formulas I, Ia, Ib, Ib', Ic, and Id, or its pharmaceutically acceptable salt, in a patient. In some embodiments, the method of the present invention comprises the step of measuring the level of the compound of formulas IV, IVa, IVb, IVb', IVc, and IVd, or its pharmaceutically acceptable salt, in a patient. In some embodiments, the method of the present invention comprises the step of measuring the total level of the compound of formulas I and IV, or its pharmaceutically acceptable salt, in a patient. In some embodiments, the method of the present invention comprises the step of measuring the total level of the compound of formulas I and IV, or its pharmaceutically acceptable salt, in a patient. In some embodiments, the method of the present invention comprises the step of measuring the total level of compounds of formulas Ia and IVa or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention comprises the step of measuring the total level of compounds of formulas Ib and IVb or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention comprises the step of measuring the total level of compounds of formulas Ib' and IVb' or pharmaceutically acceptable salts thereof in a patient. In some embodiments, the method of the present invention comprises the step of measuring the total level of compounds of formulas Ic and IVc or pharmaceutically acceptable salts thereof in a patient.In some embodiments, the method of the present invention includes the step of measuring the total level of compounds of formulas Id and IVd or pharmaceutically acceptable salts thereof in a patient.

[0290] 4. Uses, Formulation, and Administration

[0291] Pharmaceutically acceptable composition

[0292] According to another embodiment, the present invention provides a composition comprising a compound of the present invention or a pharmaceutically acceptable derivative thereof and a pharmaceutically acceptable carrier, adjuvant, or vehicle. In certain embodiments, the composition of the present invention is formulated for administration to a patient who requires such composition. In some embodiments, the composition of the present invention is formulated for oral administration to a patient.

[0293] As used herein, the term "patient" means an animal, preferably a mammal, most preferably a human.

[0294] The term "pharmaceutically acceptable carrier, adjuvant or vehicle" refers to a non-toxic carrier, adjuvant or vehicle that does not impair the pharmacological activity of the compound being formulated. Pharmaceutically acceptable carriers, adjuvants, or vehicles that may be used in the compositions of the present invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, e.g., human serum albumin, buffering materials, e.g., phosphates, glycine, sorbic acid, potassium sorbate, mixtures of partial glycerides of saturated vegetable fatty acids, water, salts, or electrolytes, e.g., protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salt, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based materials, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol, and wool fats.

[0295] "Pharmaceuticalally acceptable derivatives" means any non-toxic salt, ester, salt of ester, or other derivative of the compound of the present invention that can provide the compound of the present invention or its active metabolite or residue directly or indirectly when administered to a recipient.

[0296] "Biological samples" suitable for the present invention may be biological fluids, e.g., blood, plasma or serum, saliva, interstitial fluid or urine samples; cell samples, e.g., cell cultures, cell lines or PBMC samples; tissue biopsies, e.g., oral tissue, gastrointestinal tissue, skin, oral mucosa samples or multiple samples from clinical trials. Biological samples may be crude samples or may be purified to varying degrees before storage, processing or measurement. In some embodiments, biological samples are selected from the group consisting of biological tissue samples, whole blood samples, swab samples, plasma samples, serum samples, saliva samples, vaginal fluid samples, sperm samples, pharyngeal fluid samples, bronchial fluid samples, excretory samples, cerebrospinal fluid samples, tear fluid samples, and tissue culture supernatant samples.

[0297] The compositions of the present invention may be administered orally, parenterally, via inhaled spray, topically, rectally, nasally, buccally, vaginally, or via an implanted reservoir. As used herein, the term "parenterally" includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion techniques. Preferably, the compositions are administered orally, intraperitoneally, or intravenously. The sterile injectable form of the compositions of the present invention may be an aqueous or oily suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersants or wetting agents and suspending agents. The sterile injectable formulation may also be a sterile injectable solution or suspension in a non-toxic diluent or solvent that is acceptable for parenteral use, for example, a solution in 1,3-butanediol. Acceptable vehicles and solvents that may be used include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile non-volatile oils are typically used as solvents or suspension media.

[0298] For this purpose, any laxative fatty oil containing synthetic mono- or di-glycerides may be used. Fatty acids, e.g., oleic acid and its glyceride derivatives, are useful for the preparation of injectables, particularly pharmaceutically acceptable natural oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain long-chain alcohol diluents or dispersants, e.g., carboxymethyl cellulose, or similar dispersants commonly used in the formulation of pharmaceutically acceptable dosage forms, including emulsions and suspensions. Other commonly used surfactants, such as tweens, spans, and other emulsifiers or bioavailability enhancers commonly used in the preparation of pharmaceutically acceptable solid, liquid, or other dosage forms, may also be used for formulation purposes.

[0299] The pharmaceutically acceptable compositions of the present invention may be administered orally in any orally acceptable dosage form, including but not limited to capsules, tablets, aqueous suspensions, or solutions. For oral tablets, commonly used carriers include lactose and corn starch. Lubricants, for example, magnesium stearate, are also typically added. For oral administration in capsule form, useful diluents include lactose and dried corn starch. If an aqueous suspension is required for oral use, the active ingredient is combined with an emulsifier and a suspending agent. If desired, certain sweeteners, flavorings, or coloring agents may also be added.

[0300] Alternatively, the pharmaceutically acceptable compositions of the present invention may be administered in the form of suppositories for rectal administration. These may be prepared by mixing the formulation with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature and thus melts at the rectum to release the drug. Such materials include cocoa butter, beeswax, and polyethylene glycol.

[0301] The pharmaceutically acceptable compositions of the present invention may also be administered topically, particularly when the target of treatment includes areas or organs that are easily accessible by topical application, such as diseases of the eyes, skin, or lower gastrointestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.

[0302] Topical application to the lower intestine may be performed with rectal suppository formulations (see above) or suitable enema formulations. Topical transdermal patches may also be used.

[0303] For topical application, the provided pharmaceutically acceptable composition may be formulated into a suitable ointment containing an active ingredient suspended or dissolved in one or more carriers. Carriers for topical administration of the compounds of the present invention include, but are not limited to, mineral oil, liquid petroleum jelly, white petroleum jelly, propylene glycol, polyoxyethylene, polyoxypropylene compounds, emulsifying waxes, and water. Alternatively, the provided pharmaceutically acceptable composition may be formulated into a suitable lotion or cream containing an active ingredient suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl ester wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol, and water.

[0304] For ophthalmic use, the provided pharmaceutically acceptable composition may be formulated as a finely divided suspension in isotonic, pH-adjusted sterile saline, or preferably as a solution in isotonic, pH-adjusted sterile saline with or without a preservative such as benzyl alcoholnium chloride. Alternatively, for ophthalmic use, the pharmaceutically acceptable composition may be formulated as an ointment such as petroleum jelly.

[0305] The pharmaceutically acceptable compositions of the present invention may also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well known in the field of pharmaceutical formulation and may be prepared as solutions in saline solution using benzyl alcohol or other suitable preservatives, absorption promoters to improve bioavailability, fluorine carbide and / or other conventional solubilizers or dispersants.

[0306] Most preferably, the pharmaceutically acceptable composition of the present invention is formulated for oral administration. Such formulation may be administered with or without food. In some embodiments, the pharmaceutically acceptable composition of the present invention is administered without food. In other embodiments, the pharmaceutically acceptable composition of the present invention is administered with food.

[0307] The amount of the compound of the present invention that can be combined with a carrier material to produce a composition in a single-dose form will vary depending on the host being treated and the specific mode of administration. Preferably, the provided composition should be formulated so that a dose of inhibitor of 0.01 to 100 mg / kg body weight / day can be administered to patients receiving these compositions.

[0308] It should also be understood that specific dosages and therapeutic regimens for any specific patient depend on various factors including the activity of the specific compound used, age, body weight, general health, gender, diet, time of administration, rate of excretion, drug combination, the judgment of the treating physician, and the severity of the specific disease to be treated. The amount of the compound of the present invention in the composition will also vary depending on the specific compound in the composition.

[0309] Uses of compounds and pharmaceutically acceptable compositions

[0310] The compounds and compositions described herein are generally useful for the treatment of viral infections, or inflammatory diseases, disorders or conditions, or cancer.

[0311] As used herein, the terms “treatment,” “to treat,” and “treating” refer to reversing, alleviating, delaying the onset, or inhibiting the progression of a disease or disorder or one or more of its symptoms as described herein. In some embodiments, treatment may be administered after one or more symptoms have occurred. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be administered to a susceptible individual before symptoms begin (e.g., in light of a history of symptoms and / or genetic or other susceptibility factors). For example, treatment may continue even after symptoms have resolved in order to prevent or delay recurrence.

[0312] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder or condition, or cancer, comprising the step of administering the compound or composition described herein to a patient in need thereof.

[0313] Compounds and compositions according to the method of the present invention may be administered using any amount and any route of administration effective for treating or alleviating the severity of a disease or disorder or one or more symptoms thereof as described herein. The exact amount required will vary from subject to subject depending on the subject's species, age and general condition, severity of the disease or condition, specific formulation, mode of administration, etc. Compounds as described herein are preferably formulated in the form of dosing units for ease of administration and uniformity of dosage. As used herein, the term "dosing unit form" refers to a physically separated unit of formulation suitable for the patient to be treated. However, it is understood that the total daily use of the compounds and compositions of the present invention will be determined by the attending physician within the scope of sound medical judgment. Specific effective dosage levels for any specific patient or organism are determined by the disorder to be treated and the severity of the disorder; the activity of the specific compound used; the specific composition used; the patient's age, weight, general health condition, sex, and diet; the time of administration, route of administration, and elimination rate of the specific compound used; and the duration of treatment; It will vary depending on various factors, including drugs and similar factors well known in the medical field, used together with or simultaneously with the specific compound used. As used herein, the term "patient" means an animal, preferably a mammal, most preferably a human.

[0314] The pharmaceutically acceptable compositions of the present invention may be administered to humans and other animals orally, rectally, parenterally, intracervix, vaginally, intraperitoneally, topically (as in powders, ointments, or drops), buccally, or as an oral or nasal spray, depending on the severity of the infection to be treated. In certain embodiments, the compounds of the present invention may be administered orally or parenterally at least once a day at dose levels of about 0.01 mg / kg to about 50 mg / kg, preferably about 1 mg / kg to about 25 mg / kg of the subject's body weight per day, to obtain the desired therapeutic effect.

[0315] Liquid formulations for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compound, the liquid formulation may contain inert diluents commonly used in the art, e.g., water or other solvents; solubilizers and emulsifiers, e.g., ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide; oils (particularly cottonseed, peanut, corn, germ, olive, castor, and sesame oils); fatty acid esters of glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol, and sorbitan; and mixtures thereof. In addition to inert diluents, the oral composition may also include adjuvants, e.g., humectants, emulsifiers and suspending agents, sweeteners, flavorings, and fragrances.

[0316] Injectable preparations, e.g., sterile injectable aqueous or oily suspensions, may be formulated according to known techniques using suitable dispersants or wetting agents and suspending agents. Sterile injectable preparations may also be sterile injectable solutions, suspensions, or emulsions in parenterally acceptable non-toxic diluents or solvents, e.g., solutions in 1,3-butanediol. Acceptable vehicles and solvents that may be used include water, Ringer's solution, USP, and isotonic sodium chloride solution. Additionally, sterile non-volatile oils are typically used as solvents or suspension media. For this purpose, any laxative fatty oil containing synthetic mono- or diglycerides may be used. Furthermore, fatty acids such as oleic acid are used in the preparation of injectable preparations.

[0317] Injectable formulations can be sterilized, for example, by filtration through a bacteria-containing filter or by incorporating a sterile agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other sterile injectable media before use.

[0318] To prolong the effect of the compounds of the present invention, it is often desirable to slow down the absorption of the compounds from subcutaneous or intramuscular injection. This can be achieved by using liquid suspensions of crystalline or amorphous materials with poor water solubility. Subsequently, the absorption rate of the compounds also depends on the dissolution rate, which may vary depending on crystal size and crystal form. Alternatively, delayed absorption of parenterally administered compound forms is achieved by dissolving or suspending the compounds in oil vehicles. Injectable depot forms are prepared by forming a microcapsule matrix of the compounds in biodegradable polymers, for example, polylactide-polyglycolide. The release rate of the compounds can be controlled depending on the ratio of compounds to polymers and the characteristics of the specific polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by encapsulating the compounds in liposomes or microemulsions suitable for body tissues.

[0319] A composition for rectal or vaginal administration is preferably a suppository that can be prepared by mixing a compound as described herein with a suitable non-irritating excipient or carrier, such as cocoa butter, polyethylene glycol, or suppository wax, which is solid at ambient temperature but liquid at body temperature and thus melts in the rectal or vaginal cavity to release the active compound.

[0320] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound comprises at least one pharmaceutically acceptable inert excipient or carrier, e.g., sodium citrate or dicalcium phosphate and / or a) fillers or extenders, e.g., starch, lactose, sucrose, glucose, mannitol, and silicic acid; b) binders, e.g., carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidinone, sucrose, and acacia; c) humectants, e.g., glycerol; d) disintegrants, e.g., agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; e) solution retardants, e.g., paraffin; f) absorption promoters, e.g., quaternary ammonium compounds; g) wetting agents, e.g., cetyl alcohol and glycerol monostearate; h) absorbents, e.g., kaolin and bentonite clay; i) It is mixed with lubricants, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets, and pills, the dosing form may also contain a buffer.

[0321] Similar types of solid compositions may also be used as fillers in soft and hard filled gelatin capsules using excipients such as lactose or lactose and high molecular weight polyethylene glycol, etc. Solid dosage forms of tablets, coated tablets, capsules, pills, and granules may be manufactured with coatings and shells, for example, enteric coatings and other coatings well known in the field of pharmaceutical formulation. They may optionally contain opacifying agents and may also be compositions that release only the active ingredient(s) or preferentially in a specific part of the intestinal tract in an optionally delayed manner. Examples of filler compositions that may be used include polymeric materials and waxes. Similar types of solid compositions may also be used as fillers in soft and hard filled gelatin capsules using excipients such as lactose or lactose as well as high molecular weight polyethylene glycol, etc.

[0322] The active compound may also exist in a microencapsulated form with one or more excipients, as noted above. Solid dosage forms of tablets, coated tablets, capsules, pills, and granules may be manufactured with coatings and shells such as enteric coatings, controlled-release coatings, and other coatings well known in the field of pharmaceutical formulation. In these solid dosage forms, the active compound may be mixed with at least one inert diluent, such as sucrose, lactose, or starch. These dosage forms may also include additional substances other than the inert diluent, e.g., tableting lubricants and other tableting aids, e.g., magnesium stearate and microcrystalline cellulose, as is common practice. In the case of capsules, tablets, and pills, the dosage formulations may also include a buffer. They may optionally contain an opacifying agent, and they may also be compositions that release only the active ingredient(s) or preferentially in a specific part of the intestinal tract in an optionally delayed manner. Examples of embedding compositions that may be used include polymeric materials and waxes.

[0323] Dosage forms for topical or transdermal administration of the compounds of the present invention include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active ingredient is mixed with a pharmaceutically acceptable carrier and any necessary preservatives or buffers that may be required under sterile conditions. Ophthalmic formulations, ear drops, and ophthalmic solutions are also considered to be within the scope of the present invention. Additionally, the present invention considers the use of transdermal patches having the additional advantage of providing controlled delivery of the compounds into the body. Such dosage forms may be prepared by dissolving or dispensing the compounds in a suitable medium. Absorption enhancers may also be used to increase the flow of the compounds through the skin. The rate may be controlled by providing a rate-control membrane or by dispersing the compounds in a polymer matrix or gel.

[0324] Inflammatory disease, disorder, or condition

[0325] Compounds as described herein are useful for the treatment of inflammatory or obstructive airway diseases, for example, by reducing tissue damage, airway inflammation, bronchial hyperresponsiveness, remodeling, or disease progression. In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory or obstructive airway disease, including but not limited to asthma of all types or origins, including both endogenous (non-allergic) asthma and exogenous (allergic) asthma, mild asthma, moderate asthma, severe asthma, bronchial asthma, exercise-induced asthma, occupational asthma, and asthma induced after bacterial infection. Treatment of asthma should also be understood to include the treatment of subjects diagnosed or diagnosable as "wheezing infants," for example, subjects under 4 or 5 years of age, who exhibit wheezing symptoms, are an established patient category of major medical concern, and are currently often identified as having newly onset or early-stage asthma.

[0326] The compounds described herein are useful for the treatment of heterologous immune diseases. In some embodiments, the inflammatory disease, disorder or condition is a heterologous immune disease including, but not limited to, graft-versus-host disease, transplantation, blood transfusion, anaphylaxis, allergies (e.g., allergies to plant pollen, latex, drugs, food, insect venom, animal hair, animal dander, dust mites or cockroach sepals), type I hypersensitivity, allergic conjunctivitis, allergic rhinitis, and atopic dermatitis.

[0327] In asthma treatment, prophylactic efficacy will be demonstrated by a reduction in the frequency or severity of symptomatic attacks, e.g., acute asthma or bronchoconstriction attacks, or by improvements in lung function or reduced airway hyperresponsiveness. It may be further demonstrated by a reduction in the requirements for other symptomatic therapies, such as those intended to limit or stop symptomatic attacks when anti-inflammatory or bronchodilation occurs. The prophylactic benefits of asthma may be particularly evident in subjects prone to "morning dipping." "Morning dipping" is a recognized asthma syndrome characterized by an asthma attack, common to a significant proportion of asthma patients, e.g., between approximately 4 and 6 a.m.—a time generally substantially distant from any previously administered symptomatic asthma therapy.

[0328] In some embodiments, the inflammatory disease, disorder, or condition is selected from acute lung injury (ALI), adult / acute respiratory distress syndrome (ARDS), chronic obstructive lung, airway, or lung disease (COPD, COAD, or COLD), including dyspnea, emphysema, or other drug therapies, particularly exacerbation of airway hyperresponsiveness due to other inhaled drug therapies. In some embodiments, the inflammatory disease, disorder, or condition is bronchitis, wherein the bronchitis is any type or origin including, but not limited to, acute, arachidonic, catarrhal, croupus, chronic, or pthinoid bronchitis. In some embodiments, the inflammatory disease, disorder or condition is pneumoconiosis of any type or origin, including aluminosis, anthracosis, asbestosis, chalicosis, ptilosis, siderosis, silicosis, tabacosis, and byssinosis (an inflammatory lung, generally occupational disease, often accompanied by airway obstruction, whether occupational or caused by chronic or acute and repetitive inhalation of dust).

[0329] In some embodiments, the inflammatory disease, disorder, or condition is an eosinophil-related disorder, e.g., eosinophilia. In some embodiments, eosinophil-related disorders are hypereosinophilia affecting the airways and / or lungs, as well as eosinophil-related disorders of the airways following or accompanying, for example, Loeffler's syndrome, eosinophilic pneumonia, parasitic (particularly metazoan) infection (including tropical eosinophilia), bronchopulmonary aspergillosis, polyarteritis nodosa (Churg-Strauss syndrome), eosinophilic granuloma, and eosinophil-related disorders affecting the airways induced by drug reactions (e.g., including pathological eosinophilic infiltration of lung tissue).

[0330] The compounds described herein are also useful for treating inflammatory or allergic conditions of the skin. In some embodiments, inflammatory or allergic conditions of the skin include psoriasis, contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, lupus erythematosus, systemic lupus erythematosus, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, and acquired epidermolysis bullosa. It is selected from acquisita), acne vulgaris, and other inflammatory or allergic conditions of the skin.

[0331] In some embodiments, the inflammatory disease, disorder, or condition is a disease or condition having an inflammatory component, e.g., diseases and conditions of the eye, e.g., ocular allergy, conjunctivitis, keratoconjunctivitis sicca, uveitis and vernal conjunctivitis, diseases and conditions affecting the nose, including allergic rhinitis, and autoimmune hematological disorders (e.g., hemolytic anemia, aplastic anemia, pure red cell anemia, and idiopathic thrombocytopenia), inflammatory diseases involving autoimmune reactions or having autoimmune components or etiologies, systemic lupus erythematosus, rheumatoid arthritis, Polychondritis, scleroderma, Wegener granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, Stevens-Johnson syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (e.g., ulcerative colitis and Crohn's disease), irritable bowel syndrome, celiac disease, periodontitis, hyaline membrane disease,Kidney disease, glomerular disease, alcoholic liver disease, multiple sclerosis, endocrine opthalmopathy, Grave's disease, sarcoidosis, alveolitis, chronic hypersensitivity pneumonitis, multiple sclerosis, primary biliary cirrhosis, uveitis (anterior and posterior), Sjogren's syndrome, dry keratoconjunctivitis, uveitis and vernal keratoconjunctivitis, interstitial lung fibrosis, psoriatic arthritis, systemic juvenile idiopathic arthritis, cryopyrin-associated periodic syndrome. Muckle-Wells syndrome, nephritis, vasculitis, diverticulitis, interstitial cystitis, glomerulonephritis (presence or absence of nephrotic syndrome, e.g., including idiopathic nephrotic syndrome or minimal change nephrotic syndrome), chronic granulomatous disease, endometriosis, leptospirosis renal disease, glaucoma, retinal disease, aging, headache, pain,Complex regional pain syndrome, cardiac hypertrophy, muscle wasting, catabolic disorders, obesity, fetal growth retardation, intestinal failure, hyperchloresterolemia, heart disease, chronic heart failure, mesothelioma, anhidrotic ecodermal dysplasia, Behcet's disease, incontinentia pigmenti, Paget's disease, acute or chronic pancreatitis, hereditary periodic fever syndrome, asthma (allergic and non-allergic, mild, moderate, severe, bronchial, and exercise-induced), acute lung injury, acute respiratory distress syndrome respiratory distress syndrome), eosinophilia, hypersensitivities, anaphylaxis, nasal sinusitis, ocular allergy, silica-induced diseases, COPD (damage, airway inflammation, bronchial hyperresponsiveness, remodeling or reduction in disease progression), pulmonary disease, cystic fibrosis, acid-induced lung injury, pulmonary hypertension, polyneuropathy, cataracts,Muscle inflammation associated with systemic sclerosis, inclusion body myositis, myasthenia gravis, thyroiditis, Addison's disease, lichen planus, Type 1 or Type 2 diabetes, appendicitis, atopic dermatitis, asthma, allergy, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, chronic graft rejection, colitis, conjunctivitis, Crohn's disease, cystitis, dacryodenitis, dermatitis, dermatomyositis, encephalitis, Endocarditis, endometritis, enteritis, enterocolitis, epicondylitis, epididymitis, fasciitis, fibrositis, gastritis, gastroenteritis, Henoch-Schonlein purpura, hepatitis, hidradenitis suppurativa, immunoglobulin A nephropathy, interstitial lung disease, laryngitis, mastitis, meningitis, myelitis, myocarditis, myositis, nephritis, oophoritis, orchitis,Osteitis, otitis media, pancreatitis, parotitis, pericarditis, peritonitis, pharyngitis, pleuritis, phlebitis, pneumonitis, pneumonia, polymyositis, proctitis, prostatitis, pyelonephritis, rhinitis, salpingitis, sinusitis, stomatitis, synovitis, tendonitis, tonsillitis, ulcerative colitis, uveitis, vaginitis, vasculitis, or vulvitis.

[0332] In some embodiments, the inflammatory disease, disorder, or condition is acute or chronic graft rejection in kidney, liver, heart, or lung transplants, or graft-versus-host disease in bone marrow grafts.

[0333] In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory disease, disorder, or condition of the skin. In some embodiments, the inflammatory disease, disorder, or condition of the skin is selected from contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforme, herpetic dermatitis, scleroderma, vitiligo, hypersensitivity vasculitis, urticaria, bullous pemphigus, pemphigus vulgaris, pemphigus foliaceus, tumor-associated pemphigus, acquired bullous epidermolysis, and other inflammatory or allergic conditions of the skin.

[0334] In some embodiments, the inflammatory disease, disorder or condition is selected from acute and chronic gout, chronic gouty arthritis, psoriasis, psoriatic arthritis, rheumatoid arthritis, juvenile rheumatoid arthritis, systemic juvenile idiopathic arthritis (SJIA), cryopyrin-associated periodic syndrome (CAPS), Merkle-Wells syndrome, and osteoarthritis.

[0335] In some embodiments, the inflammatory disease, disorder, or condition is a TH17-mediated disease. In some embodiments, the TH17-mediated disease is selected from systemic lupus erythematosus, multiple sclerosis, and inflammatory bowel disease (including Crohn's disease or ulcerative colitis).

[0336] In some embodiments, inflammatory diseases, disorders or conditions are selected from Sjögren's syndrome, allergic disorders, osteoarthritis, eye conditions, e.g., ocular allergy, conjunctivitis, dry keratoconjunctivitis and vernal conjunctivitis, and diseases affecting the nose, e.g., allergic rhinitis.

[0337] In some embodiments, the inflammatory disease, disorder, or condition is related to transplantation. In some embodiments, the inflammatory disease, disorder, or condition is related to organ transplantation, organ transplant rejection, and / or graft-versus-host disease.

[0338] In some embodiments, the inflammatory disease, disorder, or condition is an autoimmune disorder. In some embodiments, the autoimmune disorder is type 1 diabetes, systemic lupus erythematosus, multiple sclerosis, psoriasis, Behcet's disease, POEMS syndrome, Crohn's disease, ulcerative colitis, ankylosing spondylitis, axial spondyloarthritis, primary biliary cirrhosis, autoimmune hepatitis, or inflammatory bowel disease.

[0339] In some embodiments, the inflammatory disease, disorder, or condition is an inflammatory disorder. In some embodiments, the inflammatory disorder is rheumatoid arthritis, asthma, chronic obstructive pulmonary disease, psoriasis, hepatomegaly, Crohn's disease, ulcerative colitis, ankylosing spondylitis, axial spondylitis, primary biliary cirrhosis, polymyalgia rheumatica, giant cell arteritis, or inflammatory bowel disease.

[0340] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the pancreas. In some embodiments, the inflammatory disease, disorder, or condition of the pancreas is selected from type 1 diabetes, type 2 diabetes, acute and chronic pancreatitis.

[0341] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the kidney. In some embodiments, the inflammatory disease, disorder, or condition of the kidney is selected from glomerulosclerosis, glomerulonephritis, nephritis, acute kidney injury, Berger's disease, Goodpasture's syndrome, Wegener's granulomatosis, and acute or chronic rejection of kidney transplant.

[0342] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the liver. In some embodiments, the inflammatory disease, disorder, or condition of the liver is selected from nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), cholestatic liver disease, sclerosing cholangitis, and acute or chronic rejection of liver transplant.

[0343] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the lung. In some embodiments, the inflammatory disease, disorder, or condition of the lung is selected from chronic obstructive pulmonary disease (COPD), asthma, pulmonary fibrosis, pulmonary hypertension, sarcoidosis, and acute or chronic rejection of lung transplant.

[0344] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the skin. In some embodiments, the inflammatory disease, disorder, or condition of the skin is selected from contact dermatitis, atopic dermatitis, psoriasis, alopecia areata, erythema multiforme, herpetic dermatitis, scleroderma, vitiligo, hypersensitivity vasculitis, urticaria, bullous pemphigus, pemphigus vulgaris, pemphigus foliaceus, tumor-associated pemphigus, acquired bullous epidermolysis, acne, keloid scar, and other inflammatory or allergic conditions of the skin.

[0345] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition in blood vessels / blood. In some embodiments, the inflammatory disease, disorder, or condition in blood vessels / blood is selected from Behcet's disease, vasculitis, sepsis, tumor angiogenesis, atherosclerosis, proliferative vascular disease, and restenosis.

[0346] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the eye. In some embodiments, the inflammatory disease, disorder, or condition of the eye is selected from conjunctivitis, scleritis, episcleritis, panuveitis, choroiditis, chorioretinitis, neuroretinitis, uveitis, orbital inflammatory disease, and optical neuritis.

[0347] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition in the central or peripheral nervous system. In some embodiments, the inflammatory disease, disorder, or condition of the central or peripheral nervous system is selected from non-viral and viral encephalitis and meningitis, depression, neuropathic pain including chronic pain, traumatic brain injury including stroke, Alzheimer's disease, Parkinson's disease, myelitis, Charcot-Marie-Tooth disease type 1 (including CMT1A and CMT1B), multiple sclerosis, amyotrophic lateral sclerosis (ALS), Creutzfeldt-Jakob disease, demyelinating polyneuropathy, and peripheral neuropathy.

[0348] In some embodiments, the present invention provides a method for treating an autoimmune disease, disorder, or condition. In some embodiments, the autoimmune disease, disorder, or condition is selected from Guillain-Barre syndrome, myasthenia gravis, Hashimoto's thyroiditis, idiopathic purpura, aplastic anemia, Graves' disease, and lupus, including myocarditis, in the skin and kidneys.

[0349] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition in the intestine. In some embodiments, the intestinal inflammatory disease, disorder, or condition is selected from intestinal failure, ulcerative colitis, and Crohn's disease.

[0350] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of the reproductive system. In some embodiments, the inflammatory disease, disorder, or condition of the reproductive system is selected from endometriosis, uterine fibroma, prostate dysplasia or growth, and cervix dysplasia.

[0351] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition of bone and / or joint. In some embodiments, the inflammatory disease, disorder, or condition of bone and / or joint is selected from juvenile idiopathic arthritis, psoriatic arthritis, periodontitis, and arthritis and / or decongestion of the hand, foot, ankle, knee, hip, shoulder, elbow, or spondyloarthritis.

[0352] In some embodiments, the present invention provides a method for treating an inflammatory disorder or condition related to or associated with AIDS.

[0353] Combination therapy for inflammatory diseases, disorders, or conditions

[0354] Depending on the specific condition or disease to be treated, additional therapeutic agents generally administered to treat such condition may be administered in combination with compounds and compositions as described herein. As used herein, additional therapeutic agents generally administered to treat a specific disease or condition are known to be "suitable for the disease or condition to be treated."

[0355] In a specific embodiment, the present invention provides a method for treating an inflammatory disease, disorder, or condition, comprising the step of administering the compound or composition described herein together with another therapeutic agent to a patient in need thereof.

[0356] These additional agents may be administered separately from the combination therapy provided as part of a multiple-dose regimen. Alternatively, these agents may be part of a single-dose form mixed with the compounds of the present invention as a single composition. When administered as part of a multiple-dose regimen, the two active agents may be administered simultaneously, sequentially, or generally within a certain period from each other within 5 hours.

[0357] As used herein, the terms “combination,” “combined,” and related terms refer to the simultaneous or sequential administration of therapeutic agents according to the present invention. For example, the combination of the present invention may be administered simultaneously or sequentially with another therapeutic agent in the form of separate unit doses or together in the form of a single unit dose.

[0358] The amount of additional therapeutic agent present in the composition of the present invention will be less than or equal to the amount generally administered in a composition comprising that therapeutic agent as the sole active agent. Preferably, in the composition disclosed herein, the amount of additional therapeutic agent will be in the range of about 50% to 100% of the amount generally present in a composition comprising that agent as the sole therapeutic active agent.

[0359] The combination may result in additive or synergistic effects, where similar efficacy may be obtained using lower doses of one or both of the compounds, or the same dose may result in significantly improved efficacy.

[0360] In some embodiments, the present invention provides a composition comprising the compound described herein and one or more additional therapeutic agents. The therapeutic agent may be administered together with the compound described herein, or before or after the administration of the compound described herein. Suitable therapeutic agents are described in more detail below. In certain embodiments, the compound described herein may be administered at a maximum of 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, or 18 hours before the therapeutic agent. In certain embodiments, a compound as described herein may be administered at up to 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, or 18 hours after the therapeutic agent.

[0361] In some embodiments, the present invention provides a method for treating an inflammatory disease, disorder, or condition by administering the compound described herein and one or more additional therapeutic agents to a patient in need thereof. These additional therapeutic agents may be small molecule or recombinant biological agents, e.g., acetaminophen; non-steroidal anti-inflammatory drugs (NSAIDs), e.g., aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, colchicine (Colcrys®); corticosteroids, e.g., prednisone, prednisolone, methylprednisolone, hydrocortisone, etc.; probenecid, allopurinol, febuxostat (Uloric®); sulfasalazine (Azulfidine®); antimalarial agents, e.g., hydroxychloroquine (Plaquenil®) and chloroquine (Aralen®); methotrexate (Rheumatrex®); gold salts, e.g., gold thioglucose (Solganal®), gold thiomaleate (Myochrysine®) and auranofin (Ridaura®). D-penicillamine (Depen® or Cuprimine®), azathioprine (Imuran®), cyclophosphamide (Cytoxan®), chlorambucil (Leukeran®), cyclosporine (Sandimmune®, Neoral®), tacrolimus, sirolimus, mycophenolate, leflunomide (Arava®), and "anti-TNF" agents, e.g., etanercept (Enbrel®), infliximab (Remicade®), golimumab (Simponi®), sertolizumab pegol (Cimzia®), and adalimumab (Humira®), "anti-IL-1" agents, e.g., anakinra (Kineret®) and rilonacept (Arcalyst®), anti-T cell antibodies, e.g., thymoglobulin, IV immunoglobulin (IVIg), canakinumab (Ilaris®), anti-Jak Inhibitors, e.g., tofacitinib, antibodies, e.g., rituximab (Rituxan®), "anti-T-cell" agents, e.g., abatacept (Orencia®), "anti-IL-6" agents, e.g.,Tocilizumab (Actemra®), diclofenac, cortisone, hyaluronic acid (Synvisc® or Hyalgan®), monoclonal antibodies, e.g., tanezumab, anticoagulants, e.g., heparin (Calcinparine® or Liquaemin®) and warfarin (Coumadin®), antidiarrheals, e.g., diphenoxylate (Lomotil®) and loperamide (Imodium®), bile acid binders, e.g., cholestyramine, alosetron (Lotronex®), rubiprostone (Amitiza®), laxatives, e.g., milk of magnesia, polyethylene glycol (MiraLax®), Dulcolax®, Correctol® and Senokot®, anticholinergics or antispasmodics, e.g., dicyclomine (Bentyl®), Singulair®, beta-2 agonists, e.g., albuterol (Ventolin® HFA, Proventil® HFA), levalbuterol (Xopenex®), metaproterenol (Alupent®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinapoate (Serevent®) and formoterol (Foradil®), anticholinergics, e.g., ipratropium bromide (Atrovent®) and tiotropium (Spiriva®), inhaled corticosteroids, e.g., beclomethasone dipropionate (Beclovent®, Qvar®, and Vanceril®), triamcinolone acetonide (Azmacort®), mometasone (Asthmanex®), budesonide (Pulmocort®), and flunisolide (Aerobid®), Afviar®, Symbicort®, Dulera®, cromolyn sodium (Intal®), methylxanthine, e.g., Theophylline (Theo-Dur®, Theolair®, Slo-bid®, Uniphyl®, Theo-24®) and aminophylline, IgE antibodies, e.g., omalizumab (Xolair®), nucleoside reverse transcription enzyme inhibitors, e.g., zidovudine (Retrovir®),Abacavir (Ziagen®), abacavir / lamivudine (Epzicom®), abacavir / lamivudine / zidovudine (Trizivir®), didanosine (Videx®), emtricitabine (Emtriva®), lamivudine (Epivir®), lamivudine / zidovudine (Combivir®), stavudine (Zerit®), and zalcitabine (Hivid®), non-nucleoside reverse transcriptase inhibitors, e.g., delavirdine (Rescriptor®), efavirentz (Sustiva®), nevirapine (Viramune®), and etravirine (Intelence®), nucleotide reverse transcriptase inhibitors, e.g., tenofovir (Viread®), protease inhibitors, e.g., amprenavir (Agenerase®), atazanavir (Reyataz®), darunavir (Prezista®), Fosamprenavir (Lexiva®), indinavir (Crixivan®), lopinavir and ritonavir (Kaletra®), nelfinavir (Viracept®), ritonavir (Norvir®), saquinavir (Fortovase® or Invirase®), and tipranavir (Aptivus®), entry inhibitors, e.g., enfuvirtide (Fuzeon®) and maravirox (Selzentry®), integrase inhibitors, e.g., raltegravir (Isentress®), doxorubicin (Hydrodaunorubicin®), vincristine (Oncovin®), bortezomib (Velcade®), and dexamethasone (Decadron®) combined with lenalidomide (Revlimid®), anti-IL36 agents, e.g., BI655130, dihydroorotate dehydrogenase inhibitors, e.g., IMU-838, anti-OX40 agents, e.g., KHK-4083, microbiome agents, e.g., RBX2660, SER-287, narrow-spectrum kinase inhibitors, e.g., TOP-1288, anti-CD40 agents, e.g., BI-655064 and FFP-104, guanylate cyclase agonists, e.g., dolcanatide, sphingosine kinase inhibitors, e.g., ofaganib,Anti-IL-12 / IL-23 agents, e.g., AK-101, ubiquitin protein ligase complex inhibitors, e.g., BBT-401, sphingosine receptor modulators, e.g., BMS-986166, P38MAPK / PDE4 inhibitors, e.g., CBS-3595, CCR9 antagonists, e.g., CCX-507, FimH antagonists, e.g., EB-8018, HIF-PH inhibitors, e.g., FG-6874, HIF-1α stabilizers, e.g., GB-004, MAP3K8 protein inhibitors, e.g., GS-4875, LAG-3 antibodies, e.g., GSK-2831781, RIP2 kinase inhibitors, e.g., GSK-2983559, farnesoid X receptor agonists, e.g., MET-409, CCK2 antagonists, e.g. For example, PNB-001, IL-23 receptor antagonists, e.g., PTG-200, purine P2X7 receptor antagonists, e.g., SGM-1019, PDE4 inhibitors, e.g., apremilast, ICAM-1 inhibitors, e.g., alicaporsen sodium, anti-IL23 agents, e.g., guselkumab, brazicumab, and mirkizumab, anti-IL-15 agents, e.g., AMG-714, TYK-2 inhibitors, e.g., BMS-986165, NK cell activators, e.g., CNDO-201, RIP-1 kinase inhibitors, e.g., GSK-2982772, anti-NKGD2 agents, e.g., JNJ-4500, CXCL-10 antibodies, e.g., JT-02, IL-22 receptor agonists, e.g., RG-7880, GATA-3 Includes antagonists, e.g., SB-012 and colony-stimulating factor-1 receptor inhibitors, e.g., edicotinib or any combination thereof.

[0362] In another embodiment, the present invention provides a method for treating gout comprising the step of administering to a patient in need one or more additional therapeutic agents selected from compounds as described herein and non-steroidal anti-inflammatory drugs (NSAIDs), e.g., aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, colchicine (Colcrys®), corticosteroids, e.g., prednisone, prednisolone, methylprodnisolone, hydrocortisone, etc., probenecid, allopurinol, and febuxostat (Uloric®).

[0363] In another embodiment, the present invention relates to compounds and non-steroidal anti-inflammatory drugs (NSAIDs) as described herein, e.g., aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, corticosteroids, e.g., prednisone, prednisolone, methylprednisolone, hydrocortisone, etc., sulfasalazine (Azulfidine®), antimalarial agents, e.g., hydroxychloroquine (Plaquenil®) and chloroquine (Aralen®), methotrexate (Rheumatrex®), gold salts, e.g., gold thioglucose (Solganal®), gold thiomaleate (Myochrysine®) and auranofin (Ridaura®), D-penicillamine (Depen® or Cuprimine®), azathioprine (Imuran®), cyclophosphamide (Cytoxan®), The present invention provides a method for treating rheumatoid arthritis comprising the step of administering one or more additional therapeutic agents selected from chlorambucil (Leukeran®), cyclosporine (Sandimmune®), leflunomide (Arava®), and "anti-TNF" agents, e.g., etanercept (Enbrel®), infliximab (Remicade®), golimumab (Simponi®), sertolizumab pegol (Cimzia®), and adalimumab (Humira®), "anti-IL-1" agents, e.g., anakinra (Kineret®) and rilonacept (Arcalyst®), antibodies, e.g., rituximab (Rituxan®), "anti-T-cell" agents, e.g., abatacept (Orencia®), and "anti-IL-6" agents, e.g., tocilizumab (Actemra®) to a patient who requires such treatment.

[0364] In some embodiments, the present invention provides a method for treating osteoarthritis comprising the step of administering to a patient in need one or more additional therapeutic agents selected from the compounds described herein and acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDS), e.g., aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, diclofenac, cortisone, hyaluronic acid (Synvisc® or Hyalgan®), and monoclonal antibodies, e.g., tanezumab.

[0365] In some embodiments, the present invention provides a method for treating lupus comprising the step of administering to a patient in need one or more additional therapeutic agents selected from the compounds described herein and acetaminophen, non-steroidal anti-inflammatory drugs (NSADS), e.g., aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, corticosteroids, e.g., prednisone, prednisolone, methylprednisolone, hydrocortisone, etc., antimalarial agents, e.g., hydroxychloroquine (Plaquenil®) and chloroquine® (Aralen®), cyclophosphamide (Cytoxan®), methotrexate (Rheumatrex®), azathioprine (Imuran®), and anticoagulants, e.g., heparin (Calcinparine® or Liquaemin®) and warfarin (Coumadin®).

[0366] In some embodiments, the present invention provides a method for treating Crohn's disease, ulcerative colitis, or inflammatory bowel disease, comprising the step of administering to a patient in need one or more additional therapeutic agents selected from the compounds described herein and mesalamine (Asacol®), sulfasalazine (Azulfidine®), antidiarrheal agents, e.g., diphenoxylate (Lomotil®) and loperamide (Imodium®), bile acid binders, e.g., cholestyramine, alosetron (Lotronex®), rubiprostone (Amitiza®), laxatives, e.g., magnesia oil, polyethylene glycol (MiraLax®), Dulcolax®, Correctol® and Senokot®, anticholinergics or antispasmodics, e.g., dicyclomine (Bentyl®), anti-TNF therapy, steroids, and antibiotics, e.g., Flagyl or ciprofloxacin.

[0367] In some embodiments, the present invention relates to the compounds described herein and Singulair®, beta-2 agonists, e.g., albuterol (Ventolin® HFA, Proventil® HFA), levalbuterol (Xopenex®), metaproterenol (Alupent®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinapoate (Serevent®) and formoterol (Foradil®), anticholinergics, e.g., ipratropium bromide (Atrovent®) and tiotropium (Spiriva®), inhaled corticosteroids, e.g., prednisone, prednisolone, beclomethasone dipropionate (Beclovent®, Qvar® and Vanceril®), triamcinolone acetonide (Azmacort®), mometasone (Asthmanex®), budesonide (Pulmocort®), The present invention provides a method for treating asthma comprising the step of administering one or more additional therapeutic agents selected from flunisolide (Aerobid®), Afviar®, Symbicort® and Dulera®, cromolin sodium (Intal®), methylxanthine, e.g., theophylline (Theo-Dur®, Theolair®, Slo-bid®, Uniphyl®, Theo-24®), aminophylline, and IgE antibodies, e.g., omalizumab (Xolair®) to a patient who requires it.

[0368] In some embodiments, the present invention relates to compounds and beta-2 agonists as described herein, e.g., albuterol (Ventolin® HFA, Proventil® HFA), levalbuterol (Xopenex®), metaproterenol (Alupent®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinapoate (Serevent®) and formoterol (Foradil®), anticholinergics, e.g., ipratropium bromide (Atrovent®) and tiotropium (Spiriva®), methylxanthines, e.g., theophylline (Theo-Dur®, Theolair®, Slo-bid®, Uniphyl®, Theo-24®) and aminophylline, inhaled corticosteroids, e.g., prednisone, prednisolone, beclomethasone dipropionate (Beclovent®, Qvar® and A method for treating COPD is provided, comprising the step of administering one or more additional therapeutic agents selected from Vanceril®, triamcinolone acetonide (Azmacort®), mometasone (Asthmanex®), budesonide (Pulmocort®), flunisolide (Aerobid®), Afviar®, Symbicort®, and Dulera® to a patient who requires it.

[0369] In some embodiments, the present invention relates to the compounds described herein and nucleoside reverse transcriptase inhibitors, e.g., zidavudine (Retrovir®), abacavir (Ziagen®), abacavir / lamivudine (Epzicom®), abacavir / lamivudine / zidovudine (Trizivir®), didanosine (Videx®), emtricitabine (Emtriva®), lamivudine (Epivir®), lamivudine / zidovudine (Combivir®), stavudine (Zerit®) and zalcitabine (Hivid®), non-nucleoside reverse transcriptase inhibitors, e.g., delavirdine (Rescriptor®), efavirentz (Sustiva®), nevirapine (Viramune®) and etravirine (Intelence®), nucleotide reverse transcriptase inhibitors, e.g., tenofovir (Viread®), protease inhibitors, e.g., The present invention provides a method for treating HIV comprising the step of administering one or more additional therapeutic agents selected from amprenavir (Agenerase®), atazanavir (Reyataz®), darunavir (Prezista®), fosamprenavir (Lexiva®), indinavir (Crixivan®), lopinavir and ritonavir (Kaletra®), nelfinavir (Viracept®), ritonavir (Norvir®), saquinavir (Fortovase® or Invirase®) and tipranavir (Aptivus®), entry inhibitors, e.g., enfuvirtide (Fuzeon®) and maraviroc (Selzentry®), integrase inhibitors, e.g., raltegravir (Isentress®), and combinations thereof to a patient who requires such treatment.

[0370] In some embodiments, the present invention provides a method for treating organ transplant rejection or graft-versus-host disease, comprising the step of administering one or more additional therapeutic agents selected from the compounds described herein and steroids, cyclosporine, FK506, rapamycin, hedgehog signaling inhibitors, BTK inhibitors, JAK / pan-JAK inhibitors, TYK2 inhibitors, PI3K inhibitors, and SYK inhibitors to a patient in need thereof.

[0371] The compounds of the present invention are also useful as co-therapeutic compounds for use in combination with other drug substances, such as anti-inflammatory, bronchodilating, or antihistamine drug substances, particularly in the treatment of obstructive or inflammatory airway diseases such as those mentioned above, for example, as enhancers of the therapeutic activity of such drugs or as means to reduce the required dosage or potential side effects of such drugs. The compounds of the present invention may be mixed with other drug substances in a non-volatile pharmaceutical composition, or may be administered individually, before, together with, or after other drug substances. Accordingly, the present invention comprises a combination of the compounds of the present invention as described above and anti-inflammatory, bronchodilating, antihistamine, or antitussive drug substances, wherein the compounds of the present invention and the drug substances are present in the same or different pharmaceutical compositions.

[0372] Suitable anti-inflammatory drugs include steroids, particularly glucocorticosteroids, e.g., budesonide, beclamethasone dipropionate, fluticasone propionate, ciclesonide, or mometasone furoate; non-steroidal glucocorticoid receptor agonists; LTB4 antagonists, e.g., LY293111, CGS025019C, CP-195543, SC-53228, BIIL 284, ONO 4057, SB 209247; LTD4 antagonists, e.g., montelucas and zafirlukast; PDE4 inhibitors, e.g., cilomilast (Ariflo® GlaxoSmithKline), roflumilast (Byk Gulden), V-11294A (Napp), BAY19-8004 (Bayer), SCH-351591 (Schering-Plough), arophylline (Almirall Prodesfarma), PD189659 / PD168787 (ParkeDavisfarma), AWD-12-281 (Asta Medica), CDC-801 (Celgene), SeICID™ CC-10004 (Celgene), VM554 / UM565 (Vernalis), T-440 (Tanabe), KW-4490 (Kyowa Hakko Kogyo); A2a agonists; A2b antagonists; and beta-2 adrenergic receptor agonists, e.g., albuterol (salbutamol), metaproterenol, terbutaline, salmeterol, fenoterol, procaterol, in particular, formoterol and pharmaceutically acceptable salts thereof. Suitable bronchodilator drugs include anticholinergic or antimuscarinic compounds, in particular ipratropium bromide, oxytropium bromide, tiotropium salts and CHF 4226 (Chiesi) and glycopyrrolate.

[0373] Suitable antihistamine drug substances include cetirizine hydrochloride, acetaminophen, clemastine fumarate, promethazine, loratidine, desloratidine, diphenhydramine and fexofenadine hydrochloride, activastin, astemizole, azelastine, ebastine, epinastine, mizolastine and tefenadine.

[0374] Other useful combinations of the compounds of the present invention with anti-inflammatory drugs are combinations with chemokine receptor antagonists, e.g., CCR-1, CCR-2, CCR-3, CCR-4, CCR-5, CCR-6, CCR-7, CCR-8, CCR-9 and CCR10, CXCR1, CXCR2, CXCR3, CXCR4 and CXCR5, particularly Schering-Plough antagonists SC-351125, SCH-55700 and SCH-D, and Takeda antagonists, e.g., N-[[4-[[[6,7-dihydro-2-(4-methylphenyl)-5H-benzo-cyclohepten-8-yl]carbonyl]amino]phenyl]-methyl]tetrahydro-N,N-dimethyl-2H-pyran-4-aminium chloride (TAK-770).

[0375] The structure of the active compound identified by code number, generic name, or trademark name may be taken from the actual edition of the standard summary “The Merck Index” or from a database, e.g., Patents International (e.g., IMS World Publications).

[0376] The compounds of the present invention may be administered alone or in combination with one or more other therapeutic compounds, and possible combination therapies consider the administration of the compounds of the present invention and one or more other therapeutic compounds provided in the form of a fixed combination or at different times or independently of each other, or the administration of a fixed combination and one or more other therapeutic compounds in combination.

[0377] These additional preparations may be administered separately from the compound-containing composition of the present invention as part of a multiple-dose regimen. Alternatively, these preparations may be part of a single-dose form mixed with the compound of the present invention in a single composition. When administered as part of a multiple-dose regimen, the two active agents may be administered simultaneously, sequentially, or generally within a certain period from each other within 5 hours.

[0378] As used herein, the terms “combination,” “combined,” and related terms refer to the simultaneous or sequential administration of a therapeutic agent according to the present invention. For example, a compound of the present invention may be administered simultaneously or sequentially with another therapeutic agent in a separate unit dosage form or together in a single unit dosage form. Accordingly, the present invention provides a single unit dosage form comprising a compound of the present invention, an additional therapeutic agent, and a pharmaceutically acceptable carrier, adjuvant, or vehicle.

[0379] The amounts of both the compound described herein and the additional therapeutic agent (in a composition containing the additional therapeutic agent as described above) that may be combined with a carrier material to create a single-dose form will vary depending on the host to be treated and the specific mode of administration. Preferably, the composition of the present invention should be formulated so that a dose of 0.01-100 mg / kg body weight / day of the compound of the present invention can be administered.

[0380] In a composition containing an additional therapeutic agent, the additional therapeutic agent and the compound of the present invention may act synergistically. Therefore, in such a composition, the amount of the additional therapeutic agent will be less than that required in a monotherapy using only that therapeutic agent. In such a composition, a dose of 0.01-1,000 μg / kg body weight / day of the additional therapeutic agent may be administered.

[0381] The amount of additional therapeutic agent present in the composition of the present invention will be less than or equal to the amount generally administered in a composition comprising that therapeutic agent as the sole active agent. Preferably, in the composition disclosed herein, the amount of additional therapeutic agent will be in the range of about 50% to 100% of the amount generally present in a composition comprising that agent as the sole therapeutic active agent.

[0382] The compounds of the present invention or pharmaceutical compositions thereof may also be included in compositions for coating implantable medical devices such as prostheses, artificial valves, vascular grafts, stents, and catheters. For example, vascular stents have been used to overcome restenosis (restenosis of the blood vessel wall after injury). However, patients using stents or other implantable devices are at risk of thrombosis or platelet activation. These unwanted effects can be prevented or mitigated by pre-coating the device with a pharmaceutically acceptable composition containing a kinase inhibitor. Implantable devices coated with the compounds of the present invention are another embodiment of the present invention.

[0383] cancer

[0384] Cancer, in one embodiment, without limitation, is leukemia (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease) or Non-Hodgkin's disease), Waldenstrom's macroglobulinemia, multiple myeloma, heavy chain disease, and solid tumors, e.g., sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma,Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, Choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, uterine cancer, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma,Includes ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neurofibrosarcoma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

[0385] In some embodiments, the cancer is a glioma, astrocytoma, glioblastoma pleomorphic (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pineal tumor, hemangioma, acoustic neuroma, oligodendroma, schwannoma, neurofibrosarcoma, meningioma, melanoma, neuroblastoma, or retinoblastoma.

[0386] In some embodiments, the cancer is an acoustic neuroma, an astrocytoma (e.g., grade I- pilocytic astrocytoma, grade II- low-grade astrocytoma, grade III- anaplastic astrocytoma, or grade IV- glioblastoma (GBM)), a chordoma, a CNS lymphoma, a craniopharyngioma, a brainstem glioma, an ependymoma, a mixed glioma, an optic nerve glioma, a subependymoma, a medulloblastoma, a meningioma, a metastatic brain tumor, a oligodendroma, a pituitary tumor, a primitive neuroectodermal (PNET) tumor, or a schwannoma. In some embodiments, the cancer is a type found more commonly in children than in adults, e.g., brainstem glioma, craniopharyngioma, ependymoma, juvenile pilaris astrocytoma (JPA), medulloblastoma, optic glioma, pineal tumor, primitive neuroectodermal tumor (PNET), or rhabdomyolysis. In some embodiments, the patient is an adult human. In some embodiments, the patient is a child or pediatric patient.

[0387] In another embodiment, cancer is, without limitation, mesothelioma, hepatobiliary (liver and bile duct), bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular melanoma, ovarian cancer, colon cancer, rectal cancer, cancer of the anal region, stomach cancer, gastric cancer (gastric cancer, colorectal cancer, duodenal cancer), uterine cancer, carcinoma of the fallopian tubes, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, carcinoma of the vulva, Hodgkin's disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, soft tissue sarcoma cancer of soft tissue), cancer of the urethra, cancer of the penis, prostate cancer, testicular cancer, chronic or acute leukemia, chronic myeloid leukemia, lymphocytic lymphoma, bladder cancer, kidney or ureteral cancer, renal cell carcinoma, carcinoma of the renal pelvis, non-Hodgkin lymphoma, vertebral axis tumor, brainstem glioma, pituitary adenoma, adrenocortical cancer, gall bladder cancer, multiple myeloma, cholangiocarcinoma, fibrosarcoma, neuroblastoma, retinoblastoma, or a combination of one or more of the above cancers.

[0388] In some embodiments, cancer is hepatocellular carcinoma, ovarian cancer, ovarian epithelial carcinoma or fallopian tube cancer; papillary serous cystadenocarcinoma or uterine papillary serous carcinoma (UPSC); prostate cancer; testicular cancer; gallbladder cancer; hepatocholangiocarcinoma; soft tissue and bone synovial sarcoma; rhabdomyosarcoma; osteosarcoma; chondrosarcoma; Ewing sarcoma; anaplastic thyroid cancer; adrenocortical adenoma; pancreatic cancer; pancreatic ductal carcinoma or pancreatic adenocarcinoma; gastrointestinal / gastric (GIST) cancer; lymphoma; head and neck squamous cell carcinoma (SCCHN); salivary gland cancer; glioma or brain cancer; It is selected from neurofibromatosis-1 related malignant peripheral nerve sheath tumor (MPNST); Waldenström macroglobulinemia; or medulloblastoma.

[0389] In some embodiments, the cancer is selected from hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, ovarian epithelial carcinoma, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatobiliary carcinoma, soft tissue and bone myxosarcoma, rhabdomyosarcoma, osteosarcoma, anaplastic thyroid cancer, adrenocortical adenoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis-1-associated malignant peripheral schwann tumor (MPNST), Waldenstrom macroglobulinemia, or medulloblastoma.

[0390] In some embodiments, cancer is a solid tumor, e.g., sarcoma, carcinoma, or lymphoma. A solid tumor typically comprises an abnormal mass of tissue that does not contain a cyst or fluid region. In some embodiments, cancer is renal cell carcinoma or renal cancer; hepatocellular carcinoma (HCC) or hepatoblastoma, or liver cancer; melanoma; breast cancer; colorectal carcinoma or colorectal cancer; colon cancer; rectal cancer; anal cancer; lung cancer, e.g., non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC); ovarian cancer, ovarian epithelial carcinoma, ovarian carcinoma, or fallopian tube cancer; papillary serous cystadenocarcinoma or uterine papillary serous carcinoma (UPSC); prostate cancer; testicular cancer; gallbladder cancer; hepatobiliary carcinoma; soft tissue and bone myxosarcoma; rhabdomyosarcoma; osteosarcoma; chondrosarcoma; Ewing sarcoma; anaplastic thyroid cancer; adrenocortical carcinoma; pancreatic cancer; Pancreatic ductal carcinoma or pancreatic adenocarcinoma; gastrointestinal (GIST) cancer; lymphoma; head and neck squamous cell carcinoma (SCCHN); salivary gland cancer; glioma or brain cancer; neurofibromatosis-1 related malignant peripheral schwann tumor (MPNST); Waldenström macroglobulinemia; or medulloblastoma are selected from.

[0391] In some embodiments, the cancer is selected from renal cell carcinoma, hepatocellular carcinoma (HCC), hepatoblastoma, colorectal carcinoma, colorectal cancer, colon cancer, rectal cancer, anal cancer, ovarian cancer, ovarian epithelial carcinoma, ovarian carcinoma, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatobiliary carcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, chondrosarcoma, anaplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, brain cancer, neurofibromatosis-1-associated malignant peripheral schwann tumor (MPNST), Waldenstrom macroglobulinemia, or medulloblastoma.

[0392] In some embodiments, the cancer is selected from hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, ovarian epithelial carcinoma, ovarian carcinoma, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatobiliary carcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, anaplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis-1-associated malignant peripheral schwann tumor (MPNST), Waldenstrom macroglobulinemia, or medulloblastoma.

[0393] In some embodiments, the cancer is hepatocellular carcinoma (HCC). In some embodiments, the cancer is hepatoblastoma. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is rectal cancer. In some embodiments, the cancer is ovarian cancer or ovarian carcinoma. In some embodiments, the cancer is ovarian epithelial carcinoma. In some embodiments, the cancer is fallopian tube cancer. In some embodiments, the cancer is papillary serous cystadenocarcinoma. In some embodiments, the cancer is uterine papillary serous carcinoma (UPSC). In some embodiments, the cancer is hepatobiliary carcinoma. In some embodiments, the cancer is soft tissue and bone synovial sarcoma. In some embodiments, the cancer is rhabdomyosarcoma. In some embodiments, the cancer is osteosarcoma. In some embodiments, the cancer is anaplastic thyroid cancer. In some embodiments, the cancer is adrenocortical carcinoma. In some embodiments, the cancer is pancreatic cancer or pancreatic ductal carcinoma. In some embodiments, the cancer is pancreatic adenocarcinoma. In some embodiments, the cancer is glioma. In some embodiments, the cancer is malignant peripheral nerve sheath tumor (MPNST). In some embodiments, the cancer is neurofibromatosis-1-associated MPNST. In some embodiments, the cancer is Waldenström macroglobulinemia. In some embodiments, the cancer is medulloblastoma.

[0394] In some embodiments, the cancer is a virus-associated cancer including human immunodeficiency virus (HIV)-associated solid tumor, human papillomavirus (HPV)-16-positive refractory solid tumor, and adult T-cell leukemia, a highly aggressive form of CD4+ T-cell leukemia caused by adult T-cell leukemia virus type I (HTLV-I) and characterized by clonal integration of HTLV-I in leukemia cells (see: https: / / clinicaltrials.gov / ct2 / show / study / NCT02631746); and virus-associated tumors of gastric cancer, nasopharyngeal carcinoma, cervical cancer, vaginal cancer, vulvar cancer, head and neck squamous cell carcinoma, and Merkel cell carcinoma. (Reference: https: / / clinicaltrials.gov / ct2 / show / study / NCT02488759; also, reference: https: / / clinicaltrials.gov / ct2 / show / study / NCT0240886; https: / / clinicaltrials.gov / ct2 / show / NCT02426892)

[0395] In some embodiments, the cancer is melanoma. In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is lung cancer. In some embodiments, the cancer is small cell lung cancer (SCLC). In some embodiments, the cancer is non-small cell lung cancer (NSCLC).

[0396] In some embodiments, cancer is treated by inhibiting further growth of the tumor. In some embodiments, cancer is treated by reducing the size of the tumor (e.g., volume or mass) by at least 5%, 10%, 25%, 50%, 75%, 90%, or 99% compared to the size of the tumor before treatment. In some embodiments, cancer is treated by reducing the amount of the tumor in the patient by at least 5%, 10%, 25%, 50%, 75%, 90%, or 99% compared to the amount of the tumor before treatment.

[0397] Combination therapy for cancer

[0398] In some embodiments, the present invention provides a method for treating a disclosed disease or condition, comprising the steps of administering an effective amount of the compound disclosed herein or a pharmaceutically acceptable salt thereof to a patient in need thereof, and co-administering an effective amount of one or more additional therapeutic agents, such as those described herein, simultaneously or sequentially. In some embodiments, the method comprises the step of co-administering one additional therapeutic agent. In some embodiments, the method comprises the step of co-administering two additional therapeutic agents. In some embodiments, the combination of the disclosed compound and the additional therapeutic agents or formulations acts synergistically.

[0399] The compounds of the present invention may also be used in combination with known therapeutic processes, e.g., hormone or radiation administration. In certain embodiments, the provided compounds are used as radiosensitizers for the treatment of tumors that exhibit poor sensitivity to radiation therapy.

[0400] The compounds of the present invention may be administered alone or in combination with one or more other therapeutic compounds, and possible combination therapies consider the administration of the compounds of the present invention and one or more other therapeutic compounds in the form of a fixed combination or at different times or independently of each other, or the combined administration of a fixed combination and one or more other therapeutic compounds. The compounds of the present invention may be administered in addition to or additionally for tumor therapy, particularly in conjunction with chemotherapy, radiation therapy, immunotherapy, phototherapy, surgical intervention, or combinations thereof. Long-term therapy is equally possible, as is adjuvant therapy in the context of other treatment strategies as described above. Other possible treatments are therapy to maintain the patient's condition after tumor regression, or even, for example, chemoprevention therapy for patients at risk.

[0401] One or more other therapeutic agents may be administered separately from the compound or composition of the present invention as part of a multiple-dose regimen. Alternatively, one or more other therapeutic agents may be part of a single-dose form mixed with the compound of the present invention in a single composition. When administered as a multiple-dose regimen, one or more other therapeutic agents and the compound or composition of the present invention may be administered simultaneously, sequentially, or within a certain period from each other, for example, within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20, 21, 22, 23, or 24 hours from each other. In some embodiments, one or more other therapeutic agents and the compound or composition of the present invention are administered as a multiple-dose regimen within an interval of more than 24 hours.

[0402] As used herein, the terms “combination,” “combined,” and related terms refer to the simultaneous or sequential administration of a therapeutic agent according to the present invention. For example, a compound of the present invention may be administered simultaneously or sequentially with one or more other therapeutic agents in a separate unit dosage form or together in a single unit dosage form. Accordingly, the present invention provides a single unit dosage form comprising a compound of the present invention, one or more other therapeutic agents, and a pharmaceutically acceptable carrier, adjuvant, or vehicle.

[0403] The amounts of the compound of the present invention and one or more other therapeutic agents that may be combined with a carrier material to create a single-dose form (in a composition containing additional therapeutic agents as described above) will vary depending on the treated host and the specific mode of administration. Preferably, the composition of the present invention should be formulated so that a dose of 0.01 to 100 mg / kg body weight / day of the compound of the present invention can be administered.

[0404] In a composition comprising one or more other therapeutic agents, the one or more other therapeutic agents and the compound of the present invention may act synergistically. Accordingly, in such a composition, the amount of one or more other therapeutic agents may be less than that required in a monotherapy using only those therapeutic agents. In such a composition, a dose of 0.01 to 1,000 μg / kg body weight / day of one or more other therapeutic agents may be administered.

[0405] The amount of one or more other therapeutic agents present in the composition of the present invention may be less than the amount typically administered to a composition containing that therapeutic agent as the sole active agent. Preferably, the amount of one or more other therapeutic agents in the composition disclosed herein will be in the range of about 50% to 100% of the amount typically present in a composition containing that agent as the sole therapeutic active agent. In some embodiments, one or more other therapeutic agents are administered at doses of about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, and about 95% of the amount typically administered to that agent. As used herein, the phrase “typically administered” means the amount of the FDA-approved therapeutic agent approved for administration per FDA label insert.

[0406] The compounds of the present invention or pharmaceutical compositions thereof may also be included in compositions for coating implantable medical devices such as prostheses, artificial valves, vascular grafts, stents, and catheters. For example, vascular stents have been used to overcome restenosis (restenosis of the blood vessel wall after injury). However, patients using stents or other implantable devices are at risk of thrombosis or platelet activation. These unwanted effects can be prevented or mitigated by pre-coating the device with a pharmaceutically acceptable composition containing a kinase inhibitor. An implantable device coated with a compound of the present invention is another embodiment of the present invention.

[0407] Exemplary other treatments

[0408] In some embodiments, one or more other therapeutic agents are poly ADP ribose polymerase (PARP) inhibitors. In some embodiments, the PARP inhibitors are selected from olaparib (Lynparza®, AstraZeneca); rucaparib (Rubraca®, Clovis Oncology); niraparib (Zejula®, Tesaro); talazoparib (MDV3800 / BMN 673 / LT00673, Medivation / Pfizer / Biomarin); beliparib (ABT-888, AbbVie); and BGB-290 (BeiGene, Inc.).

[0409] In some embodiments, one or more other therapeutic agents are histone deacetylase (HDAC) inhibitors. In some embodiments, the HDAC inhibitor is selected from vorinostat (Zolinza®, Merck); romidepsin (Istodax®, Celgene); panobinostat (Farydak®, Novartis); velinostat (Beleodaq®, Spectrum Pharmaceuticals); entinostat (SNDX-275, Syndax Pharmaceuticals) (NCT00866333); and kedamide (Epidaza®, HBI-8000, Chipscreen Biosciences, China).

[0410] In some embodiments, one or more other therapeutic agents are CDK inhibitors, e.g., CDK4 / CDK6 inhibitors. In some embodiments, CDK 4 / 6 inhibitors are selected from palbociclib (Ibrance®, Pfizer); ribociclib (Kisqali®, Novartis); abemaciclib (Ly2835219, Eli Lilly); and trilaciclib (G1T28, G1 Therapeutics).

[0411] In some embodiments, one or more other therapeutic agents are phosphatidylinositol 3-kinase (PI3K) inhibitors. In some embodiments, the PI3K inhibitors are selected from idelalisib (Zydelig®, Gilead), alpelisib (BYL719, Novartis), taselisib (GDC-0032, Genentech / Roche); pictilisib (GDC-0941, Genentech / Roche); copanlisib (BAY806946, Bayer); duvelisib (formerly IPI-145, Infinity Pharmaceuticals); PQR309 (Piqur Therapeutics, Switzerland); and TGR1202 (formerly RP5230, TG Therapeutics).

[0412] In some embodiments, one or more other therapeutic agents are platinum-based therapeutic agents also referred to as platin. Platins cause cross-linking of DNA, thereby inhibiting DNA repair and / or DNA synthesis in rapidly proliferating cells, such as cancer cells. In some embodiments, the platinum-based therapeutic agents are selected from cisplatin (Platinol®, Bristol-Myers Squibb); carboplatin (Paraplatin®, Bristol-Myers Squibb; also, Teva; Pfizer); oxaliplatin (Eloxitin® Sanofi-Aventis); nedaplatin (Aqupla®, Shionogi); picoplatin (Poniard Pharmaceuticals); and satraplatin (JM-216, Agennix).

[0413] In some embodiments, one or more other therapeutic agents are taxane compounds, which cause disruption of microtubules essential for cell division. In some embodiments, the taxane compound is selected from paclitaxel (Taxol®, Bristol-Myers Squibb), docetaxel (Taxotere®, Sanofi-Aventis; Docefrez®, Sun Pharmaceutical), albumin-bound paclitaxel (Abraxane®; Abraxis / Celgene), cabazitaxel (Jevtana®, Sanofi-Aventis), and SID530 (SK Chemicals, Co.) (NCT00931008).

[0414] In some embodiments, one or more other therapeutic agents are nucleoside inhibitors, or therapeutic agents that interfere with general DNA synthesis, protein synthesis, cell replication, or otherwise inhibit rapidly proliferating cells.

[0415] In some embodiments, the nucleoside inhibitors are travectedine (guanidine alkylating agent, Yondelis®, Janssen Oncology), mechloretamine (alkylating agent, Valchlor®, Aktelion Pharmaceuticals); vincristine (Oncovin®, Eli Lilly; Vincasar®, Teva Pharmaceuticals; Marqibo®, Talon Therapeutics); temozolomide (alkylating agent, prodrug for 5-(3-methyltriagen-1-yl)-imidazole-4-carboxamide (MTIC), Temodar®, Merck); cytarabine injection (ara-C, an antimetabolite cytidine analog, Pfizer); lomustine (alkylating agent, CeeNU®, Bristol-Myers Squibb; Gleostine®, NextSource Biotechnology); azacitidine (pyrimidine nucleoside analog of cytidine, Vidaza®, Celgene); Omasetaxin mefesuccinate (cephalotaxin ester) (protein synthesis inhibitor, Synribo®; Teva Pharmaceuticals); asparaginase erwinia chrysanthemi ( Erwinia chrysanthemi)(Asparagine depletion enzyme, Elspar®, Lundbeck; Erwinaze®, EUSA Pharma); Eribulin mesylate (microtubule inhibitor, tubulin-based mitotic inhibitor, Halaven®, Eisai); Cabazitaxel (microtubule inhibitor, tubulin-based mitotic inhibitor, Jevtana®, Sanofi-Aventis); Carpassetrin (thymidylate synthase inhibitor, Xeloda®, Genentech); Bendamustine (bifunctional mechlorethamine derivative, considered to form interstrand DNA cross-links, Treanda®, Cephalon / Teva); Ixabepilone (semisynthetic analog of Epotillon B, microtubule inhibitor, tubulin-based mitotic inhibitor, Ixempra®, Bristol-Myers Squibb); Nelarabine (prodrug of deoxyguanosine analog, nucleoside metabolism inhibitor, Arranon®, Novartis); It is selected from chlorapavin (prodrug of ribonucleotide reductase inhibitors, competitive inhibitor of deoxycytidine, Clolar®, Sanofi-Aventis); and trifluridine and tipiracil (thymidine-based nucleoside analogs and thymidine phosphorylase inhibitors, Lonsurf®, Taiho Oncology).

[0416] In some embodiments, one or more other therapeutic agents are kinase inhibitors or VEGF-R antagonists. Approved VEGF inhibitors and kinase inhibitors useful in the present invention include: bevacizumab (Avastin®, Genentech / Roche), an anti-VEGF monoclonal antibody; ramucirumab (Cyramza®, Eli Lilly), an anti-VEGFR-2 antibody; and ziv-aflivercept, also known as VEGF Trap (Zaltrap®; Regeneron / Sanofi). VEGFR inhibitors, e.g., regorafenib (Stivarga®, Bayer); vandetanib (Caprelsa®, AstraZeneca); axitinib (Inlyta®, Pfizer); and lenvatinib (Lenvima®, Eisai); Raf inhibitors, e.g., sorafenib (Nexavar®, Bayer AG and Onyx); dabrafenib (Tafinlar®, Novartis); and vemurafenib (Zelboraf®, Genentech / Roche); MEK inhibitors, e.g., cobimetanib (Cotellic®, Exelexis / Genentech / Roche); trametinib (Mekinist®, Novartis); Bcr-Abl tyrosine kinase inhibitors, e.g., imatinib (Gleevec®, Novartis); nilotinib (Tasigna®, Novartis); dasatinib (Sprycel®, BristolMyersSquibb); bosutinib (Bosulif®, Pfizer); and ponatinib (Inclusig®, Ariad Pharmaceuticals); Her2 and EGFR inhibitors, e.g., gefitinib (Iressa®, AstraZeneca); erlotinib (Tarceeva®, Genentech / Roche / Astellas); lapatinib (Tykerb®, Novartis); apatinib (Gilotrif®, Boehringer Ingelheim); Osimertinib (activated EGFR targeting, Tagrisso®, AstraZeneca); and brigatinib (Alunbrig®, Ariad Pharmaceuticals);c-Met and VEGFR2 inhibitors, e.g., carbozanitip (Cometriq®, Exelexis); and multikinase inhibitors, e.g., sunitinib (Sutent®, Pfizer); pazopanib (Votrient®, Novartis); ALK inhibitors, e.g., crizotinib (Xalkori®, Pfizer); ceritinib (Zykadia®, Novartis); and alectinib (Alecenza®, Genentech / Roche); Bruton’s tyrosine kinase inhibitor, e.g., ibrutinib (Imbruvica®, Pharmacyclics / Janssen); and Flt3 receptor inhibitors, e.g., midostaurine (Rydapt®, Novartis).;

[0417] Other kinase inhibitors and VEGF-R antagonists under development and usable in the present invention include tibozanib (Aveo Pharmaecuticals); bartalanib (Bayer / Novartis); lucitanib (Clovis Oncology); dobitinib (TKI258, Novartis); ciauanib (Chipscreen Biosciences); CEP-11981 (Cephalon); linifanib (Abbott Laboratories); neratinib (HKI-272, Puma Biotechnology); radotinib (Supect®, IY5511, Il-Yang Pharmaceuticals, S. Korea); luxolitinib (Jakafi®, Incyte Corporation); PTC299 (PTC Therapeutics); CP-547,632 (Pfizer); and foretinib (Exelexis, GlaxoSmithKline). Includes quizartinib (Daiichi Sankyo) and motesanib (Amgen / Takeda).

[0418] In some embodiments, one or more other therapeutic agents are mTOR inhibitors that inhibit cell proliferation, angiogenesis, and glucose uptake. In some embodiments, the mTOR inhibitors are everolimus (Afinitor®, Novartis); temsirolimus (Torisel®, Pfizer); and sirolimus (Rapamune®, Pfizer).

[0419] In some embodiments, one or more other therapeutic agents are proteasome inhibitors. Approved proteasome inhibitors useful in the present invention include bortezomib (Velcade®, Takeda); carfilzomib (Kyprolis®, Amgen); and ixazomib (Ninlaro®, Takeda).

[0420] In some embodiments, one or more other therapeutic agents are growth factor antagonists, e.g., platelet-derived growth factor (PDGF), or antagonists of epidermal growth factor (EGF) or its receptor (EGFR). Approved PDGF antagonists that may be used in the present invention include olaratumab (Lartruvo®; Eli Lilly). Approved EGFR antagonists that may be used in the present invention include cetuximab (Erbitux®, Eli Lilly); nexitumumab (Portrazza®, Eli Lilly); panitumumab (Vectibix®, Amgen); and osimertinib (targeting activated EGFR, Tagrisso®, AstraZeneca).

[0421] In some embodiments, one or more other therapeutic agents are aromatase inhibitors. In some embodiments, the aromatase inhibitor is selected from exemestane (Aromasin®, Pfizer); anastazol (Arimidex®, AstraZeneca) and letrozole (Femara®, Novartis).

[0422] In some embodiments, one or more other therapeutic agents are antagonists of the hedgehog pathway. Approved hedgehog pathway inhibitors that may be used in the present invention include sonidecib (Odomzo®, Sun Pharmaceuticals); and bismodegib (Erivedge®, Genentech), both of which are for the treatment of basal cell carcinoma.

[0423] In some embodiments, one or more other therapeutic agents are folic acid inhibitors. Approved folic acid inhibitors useful in the present invention include pemetrexed (Alimta®, Eli Lilly).

[0424] In some embodiments, one or more other therapeutic agents are CC chemokine receptor 4 (CCR4) inhibitors. CCR4 inhibitors under investigation that may be useful in the present invention include mogamulizumab (Poteligeo®, Kyowa Hakko Kirin, Japan).

[0425] In some embodiments, one or more other therapeutic agents are isocitrate dehydrogenase (IDH) inhibitors. IDH inhibitors under investigation that may be used in the present invention include AG120 (Celgene; NCT02677922); AG221 (Celgene, NCT02677922; NCT02577406); BAY1436032 (Bayer, NCT02746081); and IDH305 (Novartis, NCT02987010).

[0426] In some embodiments, one or more other therapeutic agents are arginase inhibitors. Arginase inhibitors under investigation that may be used in the present invention include acute myeloid leukemia and myelodysplastic syndrome (NCT02732184) and solid tumors (NCT02561234); and AEB1102 (pegylated recombinant arginase, Aeglea Biotherapeutics) under investigation in a Phase 1 clinical trial for CB-1158 (Calithera Biosciences).

[0427] In some embodiments, one or more other therapeutic agents are glutaminase inhibitors. Glutaminase inhibitors under investigation that may be used in the present invention include CB-839 (Calithera Biosciences).

[0428] In some embodiments, one or more other therapeutic agents are antibodies that bind to tumor antigens, i.e., proteins expressed on the cell surface of tumor cells. Approved antibodies that bind to tumor antigens that may be used in the present invention include rituximab (Rituxan®, Genentech / BiogenIdec); ofatumumab (anti-CD20, Arzerra®, GlaxoSmithKline); obinutuzumab (anti-CD20, Gazyva®, Genentech), ibritumomab (anti-CD20 and yttrium-90, Zevalin®, Spectrum Pharmaceuticals); daratumumab (anti-CD38, Darzalex®, Janssen Biotech), dinutuximab (anti-glycolipid GD2, Unituxin®, United Therapeutics); trastuzumab (anti-HER2, Herceptin®, Genentech); ado-trastuzumab emtansine (anti-HER2, fused to emtansine, Kadcyla®, Genentech); and pertuzumab (anti-HER2, Perjeta®, Genentech); and brentuximab vedotin (anti-CD30-drug conjugate, Adcetris®, Seattle Genetics).

[0429] In some embodiments, one or more other therapeutic agents are topoisomerase inhibitors. Approved topoisomerase inhibitors useful in the present invention include irinotecan (Onivyde®, Merrimack Pharmaceuticals); and topotecan (Hycamtin®, GlaxoSmithKline). Topoisomerase inhibitors under investigation that may be used in the present invention include Pixantrone (Pixuvri®, CTI Biopharma).

[0430] In some embodiments, one or more other therapeutic agents are inhibitors of anti-apoptotic proteins such as BCL-2. Approved anti-apoptotic agents that may be used in the present invention include venetoclax (Venclexta®, AbbVie / Genentech); and blinatumomab (Blincyto®, Amgen). Other therapeutic agents that have undergone clinical trials and may be used in the present invention targeting apoptotic proteins include nabitoclax (ABT-263, Abbott) and a BCL-2 inhibitor (NCT02079740).

[0431] In some embodiments, one or more other therapeutic agents are androgen receptor inhibitors. Approved androgen receptor inhibitors useful in the present invention include enzalutamide (Xtandi®, Astellas / Medivation); approved androgen synthesis inhibitors include abiraterone (Zytiga®, Centocor / Ortho); and approved antagonists of gonadotropin-releasing hormone (GnRH) receptors (Degaralix, Firmagon®, Ferring Pharmaceuticals).

[0432] In some embodiments, one or more other therapeutic agents are selective estrogen receptor modulators (SERMs) that interfere with the synthesis or activity of estrogen. Approved SERMs useful in the present invention include raloxifene (Evista®, Eli Lilly).

[0433] In some embodiments, one or more other therapeutic agents are bone resorption inhibitors. An approved therapeutic agent for inhibiting bone resorption is denosumab (Xgeva®, Amgen), an antibody that binds to RANKL and inhibits its binding to RANK receptors found on the surface of osteocytes, their precursors, and osteocytoplasmic giant cells that mediate bone pathology in solid tumors with bone metastasis. Other approved therapeutic agents for inhibiting bone resorption include bisphosphonates, for example, zoledronic acid (Zometa®, Novartis).

[0434] In some embodiments, one or more other therapeutic agents are inhibitors of the interaction between two primary p53 inhibitor proteins, MDMX and MDM2. Inhibitors of the p53 inhibitor proteins under investigation that may be used in the present invention include ALRN-6924 (Aileron), a stapled peptide that binds equidistantly to interfere with the interaction between MDMX and MDM2 and p53. ALRN-6924 is currently being evaluated in clinical trials for the treatment of AML, advanced myelodysplastic syndrome (MDS), and peripheral T-cell lymphoma (PTCL) (NCT02909972; NCT02264613).

[0435] In some embodiments, one or more other therapeutic agents are inhibitors of transforming growth factor-beta (TGF-beta or TGFß). Inhibitors of TGF-beta protein under investigation that may be used in the present invention include NIS793 (Novartis), an anti-TGF-beta antibody being tested in a clinic for the treatment of various cancers including breast cancer, lung cancer, hepatocellular carcinoma, colorectal cancer, pancreatic cancer, prostate cancer, and renal cancer (NCT 02947165). In some embodiments, inhibitors of TGF-beta protein are prezolimumab (GC1008; Sanofi-Genzyme) being studied for melanoma (NCT00923169); renal cell carcinoma (NCT00356460); and non-small cell lung cancer (NCT02581787). Additionally, in some embodiments, an additional therapeutic agent is a TGF-beta trap as described in the literature (cf. Connolly et al. (2012) Int'l J. Biological Sciences 8:964-978). One therapeutic compound currently in clinical trials for the treatment of solid tumors is M7824 (Merck KgaA- formerly MSB0011459X), which is a bispecific anti-PD-L1 / TGFß trap compound (NCT02699515) and (NCT02517398). M7824 consists of a fully human IgG1 antibody against PD-L1 fused to the extracellular domain of human TGF-beta receptor II, which functions as a TGFß "trap".

[0436] In some embodiments, one or more other therapeutic agents are selected from glembatumumab vedotin-monomethylauristatin E (MMAE) (Celldex), which is an anti-glycoprotein NMB (gpNMB) antibody (CR011) linked to cytotoxic MMAE. gpNMB is a protein overexpressed by several tumor types associated with the metastatic ability of cancer cells.

[0437] In some embodiments, one or more other therapeutic agents are antiproliferative compounds. These antiproliferative compounds include aromatase inhibitors; antiestrogens; topoisomerase I inhibitors; topoisomerase II inhibitors; microtubule-activating compounds; alkylating compounds; histone deacetylase inhibitors; compounds that induce cell differentiation processes; cyclooxygenase inhibitors; MMP inhibitors; mTOR inhibitors; antitumor anmetatars; platinum compounds; compounds that target / reduce protein or lipid kinase activity and additional anti-angiogenic compounds; compounds that target, reduce, or inhibit protein or lipid phosphatase activity; hypernadralin agonists; antiandrogens; methionine aminopeptidase inhibitors; matrix metalloproteinase inhibitors; bisphosphonates; biological response modifiers; antiproliferative antibodies; heparanase inhibitors; inhibitors of Ras oncogenic asoforms; telomerase inhibitors; proteasome inhibitors; compounds used in the treatment of hematological malignancies; Compounds that target, reduce, or inhibit the activity of Flt-3; Hsp90 inhibitors such as 17-AAG (17-allylaminogeldanamycin, NSC330507), 17-DMAG (17-dimethylaminoethylamino-17-demethoxy-geldanamycin, NSC707545), IPI-504, CNF1010, CNF2024, and CNF1010 (Conforma Therapeutics); temozolomide (Temodal®); kinesin spindle protein inhibitors, e.g., SB715992 or SB743921 (GlaxoSmithKline), or pentamidine / chlorpromazine (CombinatoRx); MEK inhibitors, such as ARRY142886 (Array BioPharma), AZd6244 (AstraZeneca), PD181461 (Pfizer) and leucovorin, are included but not limited thereto.

[0438] As used herein, the term “aromatase inhibitor” relates to compounds that inhibit the production of estrogen, for example, the conversion of substrate androstenedione and testosterone to estrone and estradiol, respectively. This term includes, but is not limited to, steroids, particularly atamestane, exemestane, and formestane; nonsteroids, particularly aminoglutethymide, logletimide, pyridoglutethymide, trilostan, testolactone, ketoconazole, borozol, padrozol, anastrozol, and letrozol. Exemestane is marketed under the trade name Aromasin™. Formestane is marketed under the trade name Lentaron™. Padrozol is marketed under the trade name Afema™. Anastrozol is marketed under the trade name Arimidex™. Letrozol is marketed under the trade names Femara™ or Femar™. Aminoglutethiamide is marketed under the trade name Orimeten™. The combination of the present invention, comprising a chemotherapy agent that is an aromatase inhibitor, is particularly useful for the treatment of hormone receptor-positive tumors, such as breast tumors.

[0439] As used herein, the term “anti-estrogen” relates to compounds that antagonize the effects of estrogen at the estrogen receptor level. This term includes, but is not limited to, tamoxifen, fulvestrant, raloxifene, and raloxifene hydrochloride. Tamoxifen is marketed under the trade name Nolvadex™. Raloxifene hydrochloride is marketed under the trade name Evista™. Fulvestrant may be administered under the trade name Faslodex™. The combination of the present invention comprising anti-estrogen chemotherapy agents is particularly useful for treating estrogen receptor-positive tumors, such as breast tumors.

[0440] As used herein, the term "anti-androgen" relates to any substance capable of inhibiting the biological effects of androgen hormones, including, but not limited to, bicalutamide (Casodex™). As used herein, the term "gonadorelin agonist" includes, but is not limited to, abarellix, goserelin, and goserelin acetate. Goserelin may be administered under the trade name Zoladex™.

[0441] As used herein, the term “topoisomerase I inhibitor” includes, but is not limited to, topotecan, zimatecan, irinotecan, camptothecyan and analogs thereof, 9-nitrocamptothecin and the macromolecular camptothecin conjugate PNU-166148. Irinotecan may be administered, for example, in a form marketed under the trademark Camptosar™. Topotecan is marketed under the trademark Hycamptin™.

[0442] As used herein, the term “topoisomerase II inhibitor” includes, but is not limited to, anthracyclines, e.g., doxorubicin (including liposomal formulations such as Caelyx™), daunorubicin, epirubicin, idarubicin, and nemolubicin; anthraquinones mitoxantrone and rosoxantrone; and podophyllotoxins etoposide and tenifoside. Etoposide is marketed under the trade name Etopophos™. Tenifoside is marketed under the trade name VM 26-Bristol. Doxorubicin is marketed under the trade names Acriblastin™ or Adriamycin™. Epirubicin is marketed under the trade name Farmorubicin™. Idarubicin is marketed under the trade name Zavedos™. Mithoxantrone is marketed under the trade name Novantron.

[0443] The term “microtubule activator” relates to microtubule stabilizing compounds, microtubule destabilizing compounds, and microtubule polymerization inhibitors, including but not limited to taxanes, e.g., paclitaxel and docetaxel; vinca alkaloids, e.g., vinblastine or vinblastine sulfate, vincristine or vincristine sulfate, and vinorelbine; discodermolid; coccissine and epotillone and derivatives thereof. Paclitaxel is marketed under the trade name Taxol™. Docetaxel is marketed under the trade name Taxotere™. Vinblastine sulfate is marketed as Vinblastin RP™. Vincristine sulfate is marketed under the trade name Farmistin™.

[0444] As used herein, the term "alkylating agent" includes, but is not limited to, cyclophosphamide, ifosfamide, melphalan, or nitrosourea (BCNU or Gliadel). Cyclophosphamide is marketed under the trade name Cyclostin™. Ifosfamide is marketed under the trade name Holoxan™.

[0445] The terms "histone deacetylase inhibitor" or "HDAC inhibitor" relate to compounds that inhibit histone deacetylase and possess antiproliferative activity. These include, but are not limited to, suberoylanilide hydroxamic acid (SAHA).

[0446] The term “antineoplastic anmetabolite” includes, but is not limited to, 5-fluorouracil or 5-FU, capecitabine, gemcitabine, DNA demethylating compounds, e.g., 5-azacitidine and dexitabine, methotrexate and edatrexate, and folic acid antagonists, e.g., pemetrexed. Capecitabine is marketed under the trade name Xeloda™. Gemcitabine is marketed under the trade name Gemzar™.

[0447] As used herein, the term “platin compound” includes, but is not limited to, carboplatin, cis-platin, cis-platinium, and oxaliplatin. Carboplatin may be administered, for example, in a form marketed under the trademark Carboplat™. Oxaliplatin may be administered, for example, in a form marketed under the trademark Eloxatin™.

[0448] As used herein, the terms “protein or lipid kinase activity; or compounds targeting / reducing protein or lipid phosphatase activity; or additional anti-angiogenic compounds” refer to protein tyrosine kinase and / or serine and / or threonine kinase inhibitors or lipid kinase inhibitors, e.g., a) compounds targeting, reducing, or inhibiting the activity of platelet-derived growth factor receptor (PDGFR), e.g., compounds targeting, reducing, or inhibiting the activity of PDGFR, particularly compounds inhibiting PDGF receptors, e.g., N-phenyl-2-pyrimidine-amine derivatives, e.g., imatinib, SU101, SU6668, and GFB-111; b) compounds targeting, reducing, or inhibiting the activity of fibroblast growth factor receptor (FGFR); c) a compound that targets, reduces, or inhibits the activity of insulin-like growth factor receptor I (IGF-IR), e.g., a compound that targets, reduces, or inhibits the activity of IGF-IR, particularly a compound that inhibits the kinase activity of the IGF-I receptor, or an antibody that targets the extracellular domain of the IGF-1 receptor or its growth factor; d) a compound that targets, reduces, or inhibits the activity of the Trk receptor tyrosine kinase family, or an ephrin B4 inhibitor; e) a compound that targets, reduces, or inhibits the activity of the AxI receptor tyrosine kinase family; f) a compound that targets, reduces, or inhibits the activity of the Ret receptor tyrosine kinase; g) a compound that targets, reduces, or inhibits the activity of the KIT / SCFR receptor tyrosine kinase, e.g., imatinib; h) Compounds that target, reduce, or inhibit the activity of C-Kit receptor tyrosine kinases that are part of the PDGFR family, e.g., compounds that target, reduce, or inhibit the activity of the C-Kit receptor tyrosine kinase family, particularly compounds that inhibit C-Kit receptors such as imatinib;i) Compounds that target, reduce, or inhibit the activity of c-Abl family members, their gene fusion products (e.g., BCR-Abl kinases), and mutants, e.g., compounds that target, reduce, or inhibit the activity of c-Abl family members and their gene fusion products, e.g., N-phenyl-2-pyrimidine-amine derivatives, e.g., imatinib or nilotinib (AMN107); PD180970; AG957; NSC 680410; PD173955 (ParkeDavis); or dasatinib (BMS-354825); j) Compounds that target, reduce, or inhibit the activity of members of the Raf family of protein kinase C (PKC) and serine / threonine kinases, members of the MEK, SRC, JAK / pan-JAK, FAK, PDK1, PKB / Akt, Ras / MAPK, PI3K, SYK, TYK2, BTK, and TEC families, and / or members of the cyclin-dependent kinase family (CDK), including staurosporine derivatives such as midostaurine; examples of additional compounds include UCN-01, Sapingol, BAY 43-9006, Bryostatin 1, Perifosin; Ilmofosin; RO 318220 and RO 320432; GO 6976; Isis 3521; LY333531 / LY379196; isoquinoline compounds; FTI; Comprising PD184352 or QAN697 (P13K inhibitor) or AT7519 (CDK inhibitor); k) a compound that targets, reduces, or inhibits the activity of a protein-tyrosine kinase inhibitor, e.g., a compound that targets, reduces, or inhibits the activity of a protein-tyrosine kinase inhibitor is imatinib mesylate (Gleevec™) or tirfostine, e.g., tirfostine A23 / RG-50810; AG 99; tirfostine AG 213; tirfostine AG 1748; tirfostine AG 490; tirfostine B44; tirfostine B44 (+) enantiomer; tirfostine AG 555; AG 494;Comprising tyrpostine AG 556, AG957 and adafostine (4-{[(2,5-dihydroxyphenyl)methyl]amino}-benzoic acid adamantyl ester; NSC 680410, adafostine); l) compounds that target, reduce, or inhibit the activity of the epidermal growth factor family of receptor tyrosine kinases (EGFR1, ErbB2, ErbB3, ErbB4 as homodimers or heterodimers) and their mutants, e.g., compounds that target, reduce, or inhibit the activity of the epidermal growth factor receptor family, particularly those that inhibit members of the EGF receptor tyrosine kinase family such as EGF receptors, ErbB2, ErbB3, and ErbB4, or EGF or EGF-related ligands, CP 358774, ZD 1839, ZM 105180; Compounds, proteins, or antibodies that bind to trastuzumab (Herceptin™), cetuximab (Erbitux™), Iressa, Tarceva, OSI-774, Cl-1033, EKB-569, GW-2016, E1.1, E2.4, E2.5, E6.2, E6.4, E2.11, E6.3, or E7.6.3, and 7H-pyrrolo-[2,3-d]pyrimidine derivatives; m) a compound that targets, reduces, or inhibits the activity of a c-Met receptor, e.g., a compound that targets, reduces, or inhibits the activity of c-Met, particularly a compound that inhibits the kinase activity of a c-Met receptor, or an antibody that targets the extracellular domain of c-Met or binds to HGF; n) a compound that targets, reduces, or inhibits the kinase activity of one or more JAK family members (JAK1 / JAK2 / JAK3 / TYK2 and / or pan-JAK), including but not limited to PRT-062070, SB-1578, baricitinib, pacitinib, momelotinib, VX-509, AZD-1480, TG-101348, tofacitinib, and ruxolitinib;o) compounds that target, reduce, or inhibit the kinase activity of PI3 kinase (PI3K), including but not limited to ATU-027, SF-1126, DS-7423, PBI-05204, GSK-2126458, ZSTK-474, buparisib, pictrelisib, PF-4691502, BYL-719, doctolisib, XL-147, XL-765, and idellarisib; and q) compounds that target, reduce, or inhibit the signaling effects of the hedgehog protein (Hh) or smoothed receptor (SMO) pathway, including but not limited to cyclopamine, bismodegib, itraconazole, erythmodegib, and IPI-926 (saridegib).;

[0449] The term “PI3K inhibitor” as used herein includes, but is not limited to, compounds having inhibitory activity against one or more enzymes in the phosphatidylinositol-3-kinase family, including, but not limited to, PI3Kα, PI3Kγ, PI3Kδ, PI3Kβ, PI3K-C2α, PI3K-C2β, PI3K-C2γ, Vps34, p110-α, p110-β, p110-γ, p110-δ, p85-α, p85-β, p55-γ, p150, p101, and p87. Examples of PI3K inhibitors useful for the present invention include, but are not limited to, ATU-027, SF-1126, DS-7423, PBI-05204, GSK-2126458, ZSTK-474, bupharlisib, pictrelisib, PF-4691502, BYL-719, doctolisib, XL-147, XL-765, and idelalisib.

[0450] As used herein, the term "Bcl-2 inhibitor" comprises compounds having inhibitory activity against B-cell lymphoma 2 protein (Bcl-2), including but not limited to ABT-199, ABT-731, ABT-737, apogosypol, Ascenta's pan-Bcl-2 inhibitor, curcumin (and its analogs), dual Bcl-2 / Bcl-xL inhibitor (Infinity Pharmaceuticals / Novartis Pharmaceuticals), Genasense (G3139), HA14-1 (and its analogs; see WO2008118802), nabitoclac (and its analogs, see US7390799), NH-1 (Shenayng Pharmaceutical University), obatoclac (and its analogs, see WO2004106328), S-001 (Gloria Pharmaceuticals), TW series compounds (Univ. of Michigan), and venetocclac, but including This is not limited to the above. In some embodiments, the Bcl-2 inhibitor is a small molecule therapeutic. In some embodiments, the Bcl-2 inhibitor is a peptidomimetic.

[0451] The term "BTK inhibitor" as used herein includes, but is not limited to, compounds having inhibitory activity against Bruton's tyrosine kinase (BTK), including but not limited to AVL-292 and ibrutinib.

[0452] The term "SYK inhibitor" as used herein includes, but is not limited to, compounds having inhibitory activity against splenic tyrosine kinase (SYK), including, but not limited to, PRT-062070, R-343, R-333, Excelier, PRT-062607, and fostamatinib.

[0453] Further examples of BTK inhibitory compounds combined with compounds of the present invention and conditions treatable by such compounds can be found in WO2008039218 and WO2011090760, the entirety of which is incorporated herein by reference.

[0454] Further examples of SYK inhibitory compounds combined with compounds of the present invention and conditions treatable by such compounds can be found in WO2003063794, WO2005007623 and WO2006078846, the entirety of which is incorporated herein by reference.

[0455] Further examples of PI3K inhibitory compounds combined with the compounds of the present invention and conditions treatable by such compounds can be found in WO2004019973, WO2004089925, WO2007016176, US8138347, WO2002088112, WO2007084786, WO2007129161, WO2006122806, WO2005113554 and WO2007044729, the whole of which is incorporated herein by reference.

[0456] Further examples of JAK inhibitory compounds combined with compounds of the present invention and conditions treatable by such compounds can be found in WO2009114512, WO2008109943, WO2007053452, WO2000142246 and WO2007070514, the whole of which is incorporated herein by reference.

[0457] Additional anti-angiogenic compounds include, for example, compounds having another mechanism of activity not related to protein or lipid kinase inhibition, e.g., Thalidomide™ and TNP-470.

[0458] Examples of proteasome inhibitors useful for use in combination with the compounds of the present invention include, but are not limited to, bortezomib, disulfiram, epigallocatechin-3-gallate (EGCG), salinosporamide A, carfilzomib, ONX-0912, CEP-18770, and MLN9708.

[0459] Compounds that target, reduce, or inhibit the activity of protein or lipid phosphatase are, for example, inhibitors of phosphatase 1, phosphatase 2A, or CDC25, for example, okadaic acid or derivatives thereof.

[0460] Compounds that induce the process of cell differentiation include, but are not limited to, retinoic acid, α-γ or δ-tocopherol or α-γ- or δ-tocotrienol.

[0461] As used herein, the term cyclooxygenase inhibitor includes, but is not limited to, Cox-2 inhibitors, 5-alkyl substituted 2-arylaminophenylacetic acid and derivatives, e.g., celecoxib (Celebrex™), rofecoxib (Vioxx™), etoricoxib, valdecoxib, or 5-alkyl-2-arylaminophenylacetic acid, e.g., 5-methyl-2-(2'-chloro-6'-fluoroanilino)phenylacetic acid, lumiracoxib.

[0462] As used herein, the term "bisphosphonate" includes, but is not limited to, etridonic acid, clodronic acid, tiludronic acid, pamidronic acid, alendronic acid, ibandronic acid, risedronic acid, and zoledronic acid. Ethridonic acid is marketed under the trade name Didronel™. Claudronic acid is marketed under the trade name Bonefos™. Tiludronic acid is marketed under the trade name Skelid™. Pamidronic acid is marketed under the trade name Aredia™. Alendronic acid is marketed under the trade name Fosamax™. Ibandronic acid is marketed under the trade name Bondranat™. Risedronic acid is marketed under the trade name Actonel™. Zoledronic acid is marketed under the trade name Zometa™. The term "mTOR inhibitor" relates to compounds that inhibit the mammalian target of rapamycin (mTOR) and have antiproliferative activity, e.g., sirolimus (Rapamune®), everolimus (Certican™), CCI-779 and ABT578.

[0463] As used herein, the term "heparanase inhibitor" refers to a compound that targets, reduces, or inhibits the degradation of heparin sulfate. The term includes, but is not limited to, PI-88. As used herein, the term "biological response modifier" refers to a lymphokine or interferon.

[0464] As used herein, the term “inhibitor of the carcinogenic isoform of Ras,” e.g., H-Ras, K-Ras, or N-Ras, refers to a compound that targets, reduces, or inhibits the carcinogenic activity of Ras; e.g., “farnesyl transferase inhibitor,” e.g., L-744832, DK8G557, or R115777 (Zarnestra™). As used herein, the term “telomerase inhibitor” refers to a compound that targets, reduces, or inhibits the activity of telomerase. A compound that targets, reduces, or inhibits the activity of telomerase is, in particular, a compound that inhibits telomerase receptors such as telomestatin.

[0465] As used herein, the term "methionine aminopeptidase inhibitor" refers to a compound that targets, reduces, or inhibits the activity of methionine aminopeptidase. Compounds that target, reduce, or inhibit the activity of methionine aminopeptidase include, but are not limited to, benzamide or derivatives thereof.

[0466] As used herein, the term “proteasome inhibitor” refers to a compound that targets, reduces, or inhibits the activity of a proteasome. Compounds that target, reduce, or inhibit the activity of a proteasome include, but are not limited to, bortezomib (Velcade™) and MLN 341.

[0467] As used herein, the term “matrix metalloproteinase inhibitor” or (“MMP” inhibitor) includes, but is not limited to, collagen peptidomimetic and non-peptidomimetic inhibitors, tetracycline derivatives, e.g., hydroxamate peptidomimetic inhibitor batimastat and its oral bioavailable analogues marimastat (BB-2516), pyrinomastat (AG3340), metastat (NSC 683551), BMS-279251, BAY 12-9566, TAA211, MMI270B, or AAJ996.

[0468] The term “compounds used for the treatment of hematological malignancies” as used herein includes, but is not limited to, FMS-like tyrosine kinase inhibitors, which are compounds that target, reduce, or inhibit the activity of FMS-like tyrosine kinase receptors (Flt-3R); interferon, 1-β-D-arabinofurancytosine (ara-c) and bisulfan; and ALK inhibitors, which are compounds that target, reduce, or inhibit anaplastic lymphoma kinase.

[0469] Compounds that target, reduce, or inhibit the activity of FMS-like tyrosine kinase receptors (Flt-3R) are, in particular, compounds, proteins, or antibodies that inhibit members of the Flt-3R receptor kinase family, e.g., PKC412, midostaurine, staurosporine derivatives, SU11248, and MLN518.

[0470] As used herein, the term “HSP90 inhibitor” includes, but is not limited to, compounds that target, reduce, or inhibit the intrinsic ATPase activity of HSP90; compounds that degrade, target, reduce, or inhibit HSP90 client proteins through the ubiquitin proteosome pathway. Compounds that target, reduce, or inhibit the intrinsic ATPase activity of HSP90 are, in particular, compounds, proteins, or antibodies that inhibit the ATPase activity of HSP90, e.g., 17-allylamino,17-demethoxygeldanamycin (17AAG), geldanamycin derivatives; other geldanamycin-related compounds; radicicol and HDAC inhibitors.

[0471] As used herein, the term "antiproliferative antibody" refers to trastuzumab (Herceptin™), trastuzumab-DM1, Erbitux, bevacizumab (Avastin™), and rituximab (Rituxan ® ), PRO64553 (anti-CD40) and 2C4 antibodies are included, but not limited to. Antibodies refer to intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies formed from at least two intact antibodies, and one antibody fragment exhibiting the desired biological activity.

[0472] For the treatment of acute myeloid leukemia (AML), the compounds of the present invention may be used in combination with standard leukemia therapy, particularly with therapies used for the treatment of AML. In particular, the compounds of the present invention may be administered, for example, with farnesyl transferase inhibitors and / or other drugs useful for the treatment of AML, e.g., daunorubicin, adriamycin, Ara-C, VP-16, tenifoside, mitoxantrone, idarubicin, carboplatinum, and PKC412.

[0473] Other anti-leukemia compounds include, for example, Ara-C, a pyrimidine analog that is a 2'-alpha-hydroxy ribose (arabinoside) derivative of deoxycytidine. Also included are purine analogs of hypoxanthine, 6-mercaptopurine (6-MP), and fludarabine phosphate. Compounds that target, reduce, or inhibit the activity of histone deacetylase (HDAC) inhibitors, for example, sodium butyrate and suberoylanilide hydroxylase (SAHA), inhibit the activity of the enzyme known as histone deacetylase. Certain HDAC inhibitors include MS275, SAHA, FK228 (formerly FR901228), tricostatin A and N-hydroxy-3-[4-[[[2-(2-methyl-1H-indole-3-yl)-ethyl]-amino]methyl]phenyl]-2E-2-propenamide, or pharmaceutically acceptable salts thereof, and compounds disclosed in US No. 6,552,065, including but not limited to N-hydroxy-3-[4-[(2-hydroxyethyl){2-(1H-indole-3-yl)ethyl]-amino]methyl]phenyl]-2E-2-propenamide, or pharmaceutically acceptable salts thereof, particularly lactate salts. Somatostatin receptor antagonists as used herein refer to compounds that target, treat, or inhibit somatostatin receptors, e.g., octreotide and SOM230. Tumor cell damage approaches refer to approaches such as ionizing radiation. The term "ionizing radiation" as used above and below refers to ionizing radiation generated as electromagnetic rays (e.g., X-rays and gamma rays) or particles (e.g., alpha and beta particles). Ionizing radiation is provided in, but is not limited to, radiation therapy and is known in the art. (Reference: Hellman, Principles of Radiation Therapy, Cancer, in Principles and Practice of Oncology, Devita et al., Eds., 4 th Refer to Edition, Vol. 1, pp. 248-275 (1993).

[0474] Additionally, EDG binders and ribonucleotide reductase inhibitors are included. As used herein, the term "EDG binder" refers to a class of immunosuppressants that regulate lymphocyte recirculation, e.g., FTY720. The term "ribonucleotide reductase inhibitor" refers to pyrimidine or purine nucleoside analogs including, but not limited to, fludarabine and / or cytosine arabinoside (ara-C), 6-thioguanine, 5-fluorouracil, cladribin, 6-mercaptopurine (particularly in combination with ara-C for ALL) and / or pentostatin. Ribonucleotide reductase inhibitors are particularly hydroxyurea or 2-hydroxy-1H-isoindole-1,3-dione derivatives.

[0475] In particular, compounds, proteins, or monoclonal antibodies of VEGF, e.g., 1-(4-chloroanilino)-4-(4-pyridylmethyl)phthalazine or pharmaceutically acceptable salts thereof, 1-(4-chloroanilino)-4-(4-pyridylmethyl)phthalazine succinate; Angiostatin™; Endostatin™; anthranilan amides; ZD4190; Zd6474; SU5416; SU6668; bevacizumab; or anti-VEGF antibodies or anti-VEGF receptor antibodies, e.g., rhuMAb and RHUFab, VEGF aptamers, e.g., Macugon; FLT-4 inhibitors, FLT-3 inhibitors, VEGFR-2 IgGI antibodies, Angiozyme (RPI 4610), and bevacizumab (Avastin™) are also included.

[0476] As used herein, photodynamic therapy refers to a therapy that uses certain chemicals known as photosensitive compounds to treat or prevent cancer. Examples of photodynamic therapy include treatment with compounds such as Visudyne™ and porfimer sodium.

[0477] The anti-angiogenic steroids used herein refer to compounds that block or inhibit blood circulation, for example, anecortabb, triamcinolone, hydrocortisone, 11-α-epihydrocortisol, cortexolone, 17α-hydroxyprogesterone, corticosterone, desoxycorticosterone, testosterone, estrone, and dexamethasone.

[0478] Implants containing corticosteroids refer to compounds, for example, fluosinolone and dexamethasone.

[0479] Other chemotherapy compounds include, but are not limited to, plant alkaloids, hormone compounds and antagonists; biological response modifiers, preferably lymphokines or interferons; antisense oligonucleotides or oligonucleotide derivatives; shRNA or siRNA; or various compounds or compounds having other or unknown mechanisms of action.

[0480] The structure of the active compound identified by code number, generic name, or trademark name may be taken from the actual edition of the standard summary “The Merck Index” or from a database, e.g., Patents International (e.g., IMS World Publications).

[0481] Exemplary immunotumor agent

[0482] In some embodiments, one or more other therapeutic agents are immuno-oncology agents. As used herein, the term "immuno-oncology agent" refers to a preparation effective in enhancing, stimulating, and / or upregulating the immune response in a subject. In some embodiments, administration of an immuno-oncology agent together with a compound of the present invention has a synergistic effect in treating cancer.

[0483] Immuno-oncology agents may be, for example, small molecule drugs, antibodies, or biological or small molecules. Examples of biological immuno-oncology agents include, but are not limited to, cancer vaccines, antibodies, and cytokines. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the monoclonal antibody is humanized or human.

[0484] In some embodiments, the immuno-oncology agent is (i) an agonist of a stimulating (including co-stimulating) receptor or (ii) an antagonist of an inhibitory (including co-inhibitory) signal on T cells, both of which amplify antigen-specific T cell responses.

[0485] Certain stimulant and inhibitory molecules are members of the immunoglobulin superfamily (IgSF). One of the important membrane-bound ligand families that bind to co-stimulant or co-inhibitory receptors is the B7 family, which includes B7-1, B7-2, B7-H1 (PD-L1), B7-DC (PD-L2), B7-H2 (ICOS-L), B7-H3, B7-H4, B7-H5 (VISTA), and B7-H6. Another family of membrane-bound ligands that binds to co-stimulatory or co-inhibitory receptors includes CD40 and CD40L, OX-40, OX-40L, CD70, CD27L, CD30, CD30L, 4-1BBL, CD137 (4-1BB), TRAIL / Apo2-L, TRAILR1 / DR4, TRAILR2 / DR5, TRAILR3, TRAILR4, OPG, RANK, RANKL, TWEAKR / Fn14, TWEAK, BAFFR, EDAR, XEDAR, TACI, APRIL, BCMA, LTβR, LIGHT, DcR3, HVEM, VEGI / TL1A, TRAMP / DR3, EDAR, EDA1, XEDAR, EDA2, TNFR1, Lymphotoxin α / TNFβ, TNFR2, TNFα, LTβR, It is a TNF family of molecules that bind to members of the homologous TNF receptor family, including lymphotoxin α1β2, FAS, FASL, RELT, DR6, TROY, and NGFR.

[0486] In some embodiments, the immuno-oncology agent is a cytokine that inhibits T cell activation (e.g., IL-6, IL-10, TGF-β, VEGF and other immunosuppressive cytokines) or a cytokine that stimulates T cell activation to stimulate an immune response.

[0487] In some embodiments, a combination of the compound of the present invention and an immuno-oncology agent may stimulate a T cell response. In some embodiments, the immuno-oncology agent is (i) an antagonist of a protein that inhibits T cell activation (e.g., an immune checkpoint inhibitor), e.g., CTLA-4, PD-1, PD-L1, PD-L2, LAG-3, TIM-3, Galectin 9, CEACAM-1, BTLA, CD69, Galectin-1, TIGIT, CD113, GPR56, VISTA, 2B4, CD48, GARP, PD1H, LAIR1, TIM-1, and TIM-4; or (ii) agonists of proteins that stimulate T cell activation, e.g., B7-1, B7-2, CD28, 4-1BB (CD137), 4-1BBL, ICOS, ICOS-L, OX40, OX40L, GITR, GITRL, CD70, CD27, CD40, DR3 and CD28H.

[0488] In some embodiments, the immunooncology agent is an antagonist of an inhibitory receptor on NK cells or an agonist of an activating receptor on NK cells. In some embodiments, the immunooncology agent is an antagonist of KIR, such as ririlumab.

[0489] In some embodiments, the immuno-oncology agent is a agent that inhibits or depletes macrophages or monocytes, including but not limited to CSF-1R antagonists such as CSF-1R antagonist antibodies including RG7155 (WO11 / 70024, WO11 / 107553, WO11 / 131407, WO13 / 87699, WO13 / 119716, WO13 / 132044) or FPA-008 (WO11 / 140249; WO13169264; WO14 / 036357).

[0490] In some embodiments, the immuno-oncology agent is selected from agents that ligate positive co-stimulatory receptors, blockers that attenuate signal transduction through inhibitory receptors, antagonists, and one or more agents that systemically increase the frequency of anti-tumor T cells, agents that overcome distinct immunosuppressive pathways within the tumor microenvironment (e.g., blocking inhibitory receptor binding (e.g., PD-L1 / PD-1 interaction), depleting or inhibiting Tregs (e.g., by using an anti-CD25 monoclonal antibody (e.g., daclizumab) or by in vitro anti-CD25 bead depletion), inhibiting metabolic enzymes such as IDO, or reversing or preventing T cell energy or depletion), and agents that induce innate immune activation and / or inflammation at the tumor site.

[0491] In some embodiments, the immuno-oncology agent is a CTLA-4 antagonist. In some embodiments, the CTLA-4 antagonist is an antagonistic CTLA-4 antibody. In some embodiments, the antagonistic CTLA-4 antibody is YERVOY (ipilimumab) or tremelimumab.

[0492] In some embodiments, the immuno-oncology agent is a PD-1 antagonist. In some embodiments, the PD-1 antagonist is administered by infusion. In some embodiments, the immuno-oncology agent is an antibody or its antigen-binding portion that specifically binds to a programmed death-1 (PD-1) receptor and inhibits PD-1 activity. In some embodiments, the PD-1 antagonist is an antagonistic PD-1 antibody. In some embodiments, the antagonistic PD-1 antibody is OPDIVO (nivolumab), KEYTRUDA (pembrolizumab), or MEDI-0680 (AMP-514; WO2012 / 145493). In some embodiments, the immuno-oncology agent may be pidilizumab (CT-011). In some embodiments, the immuno-oncology agent is a recombinant protein consisting of the extracellular domain of PD-L2 (B7-DC) fused to the Fc portion of IgG1, designated as AMP-224.

[0493] In some embodiments, the immuno-oncology agent is a PD-L1 antagonist. In some embodiments, the PD-L1 antagonist is an antagonistic PD-L1 antibody. In some embodiments, the PD-L1 antibodies are MPDL3280A (RG7446; WO2010 / 077634), durvalumab (MEDI4736), BMS-936559 (WO2007 / 005874), and MSB0010718C (WO2013 / 79174).

[0494] In some embodiments, the immuno-oncology agent is a LAG-3 antagonist. In some embodiments, the LAG-3 antagonist is an antagonistic LAG-3 antibody. In some embodiments, the LAG3 antibody is BMS-986016 (WO10 / 19570, WO14 / 08218), or IMP-731 or IMP-321 (WO08 / 132601, WO009 / 44273).

[0495] In some embodiments, the immuno-oncology agent is a CD137(4-1BB) agonist. In some embodiments, the CD137(4-1BB) agonist is an agonist CD137 antibody. In some embodiments, the CD137 antibody is urelumab or PF-05082566(WO12 / 32433).

[0496] In some embodiments, the immuno-oncology agent is a GITR agonist. In some embodiments, the GITR agonist is an agonist GITR antibody. In some embodiments, the GITR antibody is BMS-986153, BMS-986156, TRX-518 (WO006 / 105021, WO009 / 009116) or MK-4166 (WO11 / 028683).

[0497] In some embodiments, the immuno-oncology agent is an indoleamine (2,3)-deoxygenase (IDO) antagonist. In some embodiments, the IDO antagonist is epacadostat (INCB024360, Incyte); indoxymod (NLG-8189, NewLink Genetics Corporation); capmanitiv (INC280, Novartis); GDC-0919 (Genentech / Roche); PF-06840003 (Pfizer); BMS:F001287 (Bristol-Myers Squibb); Phy906 / KD108 (Phytoceutica); kynurenine-degrading enzyme (Kynase, Kyn Therapeutics); and is selected from NLG-919 (WO09 / 73620, WO009 / 1156652, WO11 / 56652, WO12 / 142237).

[0498] In some embodiments, the immuno-oncology agent is an OX40 agonist. In some embodiments, the OX40 agonist is an antagonistic OX40 antibody. In some embodiments, the OX40 antibody is MEDI-6383 or MEDI-6469.

[0499] In some embodiments, the immuno-oncology agent is an OX40L antagonist. In some embodiments, the OX40L antagonist is an antagonistic OX40 antibody. In some embodiments, the OX40L antagonist is RG-7888 (WO06 / 029879).

[0500] In some embodiments, the immuno-oncology agent is a CD40 agonist. In some embodiments, the CD40 agonist is an agonist CD40 antibody. In some embodiments, the immuno-oncology agent is a CD40 antagonist. In some embodiments, the CD40 antagonist is an antagonist CD40 antibody. In some embodiments, the CD40 antibody is rucatumumab or dasetuzumab.

[0501] In some embodiments, the immuno-oncology agent is a CD27 agonist. In some embodiments, the CD27 agonist is an agonist CD27 antibody. In some embodiments, the CD27 antibody is varilumab.

[0502] In some embodiments, the immuno-oncology agent is MGA271 (for B7H3) (WO11 / 109400).

[0503] In some embodiments, the immuno-oncology agent is avagovomab, adecaturumab, aputuzumab, alemtuzumab, anatumomab mapenatox, apolizumab, atezolimab, avelumab, blinatumomab, BMS-936559, katamaxomab, durvalumab, epacadostat, efratuzumab, indoximod, innotuzumab ozogamicin, intelumumab, ipilimumab, isatuximab, lambrolizumab, MED14736, MPDL3280A, nivolumab, obinutuzumab, ocaratuzumab, ofatumomab, olatutamab, pembrolizumab, fidilizumab, rituximab, ticilimumab, samallizumab, or tremelimumab.

[0504] In some embodiments, the immuno-oncology agent is an immunostimulator. For example, antibodies blocking the PD-1 and PD-L1 inhibition axes can trigger activated tumor-reactive T cells and have been shown in clinical trials to induce sustained anti-tumor responses in an increasing number of tumor histologies, including some tumor types not typically considered immunotherapy-sensitive. For example, the literature (cf. Okazaki, T. et al. (2013) Nat. Immunol. 14, 1212-1218; Zou et al. See (2016) Sci. Transl. Med. 8). The anti-PD-1 antibody nivolumab (also known as Opdivo®, Bristol-Myers Squibb, ONO-4538, MDX1106, and BMS-936558) has shown potential to improve overall survival in RCC patients who experienced disease progression during or after previous anti-angiogenic therapy.

[0505] In some embodiments, the immunomodulatory therapeutic agent specifically induces apoptosis in tumor cells. Approved immunomodulatory therapeutic agents that may be used in the present invention include pomalidomide (Pomalyst®, Celgene); lenalidomide (Revlimid®, Celgene); and ingenol mebutate (Picato®, LEO Pharma).

[0506] In some embodiments, the immuno-oncology agent is a cancer vaccine. In some embodiments, the cancer vaccine is selected from Cipulecel-T (Provenge®, Dendreon / Valeant Pharmaceuticals), approved for the treatment of asymptomatic or minimally symptomatic metastatic castration-resistant (hormone-refractory) prostate cancer; and Talimogen Laherparepvec (Imlygic®, BioVex / Amgen, formerly known as T-VEC), a genetically modified oncolytic virus therapy approved for the treatment of unresectable cutaneous, subcutaneous, and nodular lesions in melanoma.In some embodiments, the immuno-oncology agent is Pexastimogen Devasirebvec (PexaVec / JX-594, SillaJen / formerly Jennerex Biotherapeutics), a thymidine kinase-(TK-) deficient vaccinia virus engineered to express GM-CSF for oncolytic viral therapy, e.g., hepatocellular carcinoma (NCT02562755) and melanoma (NCT00429312); colorectal cancer (NCT01622543); prostate cancer (NCT01619813); head and neck squamous cell carcinoma (NCT01166542); pancreatic adenocarcinoma (NCT00998322); Pelareorep (Reolysin®, Oncolytics Biotech), a variant of respiratory enteric orphan virus (reovirus) that does not replicate in RAS-unactivated cells in a number of cancers including non-small cell lung cancer (NSCLC) (NCT 00861627); ovarian cancer (NCT02028117); enadenotusirev (NG-348, PsiOxus, formerly known as ColoAd1), an adenovirus engineered to express full-length CD80 and antibody fragments specific to the T-cell receptor CD3 protein in metastatic or advanced epithelial tumors, e.g., colorectal cancer, bladder cancer, head and neck squamous cell carcinoma, and salivary gland cancer (NCT02636036); melanoma (NCT03003676); It is selected from ONCOS-102 (Tagobox / formerly Oncos), an adenovirus engineered to express GM-CSF in peritoneal disease, colorectal cancer, or ovarian cancer (NCT02963831); peritoneal carcinomatosis (NCT01443260); GL-ONC1 (GLV-1h68 / GLV-1h153, Genelux GmbH), a vaccinia virus engineered to express beta-galactosidase (beta-gal) / beta-glucoronidase or beta-gal / human sodium iodide co-transporter (hNIS), respectively, studied in fallopian tube cancer and ovarian cancer (NCT 02759588); or CG0070 (Cold Genesys), an adenovirus engineered to express GM-CSF in bladder cancer (NCT02365818).

[0507] In some embodiments, the immuno-oncology agents are JX-929 (SillaJen / formerly Jennerex Biotherapeutics), a TK- and vaccinia growth factor-deficient vaccinia virus engineered to express a cytosine deaminase capable of converting the prodrug 5-fluorocytosine into the cytotoxic drug 5-fluorouracil; TG01 and TG02 (Targovax / formerly Oncos), peptide-based immunotherapies targeting hard-to-treat RAS mutations; and TILT-123 (TILT Biotherapeutics), a specified engineered adenovirus: Ad5 / 3-E2F-delta24-hTNFa-IRES-hIL20; and antigen-specific CD8 + It is selected from VSV-GP (ViraTherapeutics), which is a vesicular stomatitis virus (VSV) engineered to express a glycoprotein (GP) of lymphocytic choriomeningitis virus (LCMV) that can be further engineered to express an antigen designed to enhance T cell response.

[0508] In some embodiments, the immuno-oncology agent is a T-cell engineered to express a chimeric antigen receptor or CAR. T-cells engineered to express such a chimeric antigen receptor are referred to as CAR-T cells.

[0509] A CAR was designed comprising a single-chain variable fragment (scFv) derived from a monoclonal antibody specific to a cell surface antigen fused to a binding domain that may be derived from a natural ligand, an endodomain which is the functional terminal of a T-cell receptor (TCR), for example, the CD3-zeta signaling domain of a TCR capable of generating an activation signal in T lymphocytes. Upon antigen binding, this CAR connects to the endogenous signaling pathway of the effector cell and generates an activation signal similar to those initiated by the TCR complex.

[0510] For example, in some embodiments, the CAR-T cell is one of those described in U.S. Patent No. 8,906,682 (June; incorporated herein by reference in its entirety) disclosing a CAR-T cell engineered to include an extracellular domain having an antigen-binding domain (e.g., a domain binding to CD19) fused to an intracellular signaling domain of the T cell antigen receptor complex zeta chain (e.g., CD3 zeta). When expressed in T cells, the CAR can redirect antigen recognition based on antigen-binding specificity. In the case of CD19, the antigen is expressed in malignant B cells. Currently, more than 200 clinical trials using CAR-T for various indications are underway.[https: / / clinicaltrials.gov / ct2 / results?term=chimeric+antigen+receptors&pg=1].

[0511] In some embodiments, the immunostimulator is an activator of retinoic acid receptor-associated orphan receptor γ (RORγt). RORγt is a transcription factor that plays a crucial role in the differentiation and maintenance of type 17 effector subsets of CD4+ (Th17) and CD8+ (Tc17) T cells, as well as in the differentiation of IL-17, which expresses innate immune cell subpopulations such as NK cells. In some embodiments, the activator of RORγt is LYC-55716 (Lycera), which is currently being evaluated in a clinical trial for the treatment of solid tumors (NCT02929862).

[0512] In some embodiments, the immunostimulator is an agonist or activator of a Toll-like receptor (TLR). Suitable activators of TLRs include agonists or activators of TLR9, such as SD-101 (Dynavax). SD-101 is an immunostimulatory CpG being studied for B-cell, follicular, and other lymphomas (NCT02254772). A agonist or activator of TLR8 that may be used in the present invention includes motolimod (VTX-2337, VentiRx Pharmaceuticals), which is being studied for head and neck squamous cell carcinoma (NCT02124850) and ovarian cancer (NCT02431559).

[0513] Other immuno-oncology agents that can be used in the present invention include urelumab (BMS-663513, Bristol-Myers Squibb), an anti-CD137 monoclonal antibody; varilumab (CDX-1127, Celldex Therapeutics), an anti-CD27 monoclonal antibody; BMS-986178 (Bristol-Myers Squibb), an anti-OX40 monoclonal antibody; rillilumab (IPH2102 / BMS-986015, Innate Pharma, Bristol-Myers Squibb), an anti-KIR monoclonal antibody; monalizumab (IPH2201, Innate Pharma, AstraZeneca), an anti-NKG2A monoclonal antibody; andecaliximab (GS-5745, Gilead Sciences), an anti-MMP9 antibody; and MK-4166 (Merck & Co.), an anti-GITR monoclonal antibody.

[0514] In some embodiments, the immunostimulator is selected from elotuzumab, mifamutide, agonists or activators of Toll-like receptors, and activators of RORγt.

[0515] In some embodiments, the immunostimulatory therapeutic is recombinant human interleukin 15 (rhIL-15). rhIL-15 has been tested in a clinic as a therapy for melanoma and renal cell carcinoma (NCT01021059 and NCT01369888) and leukemia (NCT02689453). In some embodiments, the immunostimulator is recombinant human interleukin 12 (rhIL-12). In some embodiments, the IL-15-based immunotherapeutic is a heterodimeric IL-15 (hetIL-15, Novartis / Admune), which is a fusion complex (IL15:sIL-15RA) composed of a synthetic form of endogenous IL-15 complexed to the soluble IL-15 binding protein IL-15 receptor alpha chain tested in a Phase 1 clinical trial for melanoma, renal cell carcinoma, non-small cell lung cancer, and head and neck squamous cell carcinoma (NCT02452268). In some embodiments, recombinant human interleukin 12 (rhIL-12) is NM-IL-12 (Neumedicines, Inc.), NCT02544724, or NCT02542124.

[0516] In some embodiments, the immuno-oncology agent is referenced in the literature (see Jerry L. Adams ET. AL., "Big opportunities for small molecules in immuno-oncology," Cancer Therapy 2015 Selected from those described in (, Vol. 14, pages 603-622), the contents of which are incorporated herein by reference in their entirety. In some embodiments, the immuno-oncology agent is selected from the examples described in Table 1 of the literature (Reference: Jerry L. Adams ET. AL). In some embodiments, the immuno-oncology agent is a small molecule that targets an immuno-oncology target selected from those listed in Table 2 of the literature (Reference: Jerry L. Adams ET. AL). In some embodiments, the immuno-oncology agent is a small molecule preparation selected from those listed in Table 2 of the literature (Reference: Jerry L. Adams ET. AL).

[0517] In some embodiments, the immuno-oncology agent is a literature (see: Peter L. Toogood, "Small molecule immuno-oncology therapeutic agents," Bioorganic & Medicinal Chemistry Letters 2018 Selected from small molecule immunooncology agents described in , Vol. 28, pages 319-329), the contents of which are incorporated herein by reference in their entirety. In some embodiments, the immunooncology agent is a agent that targets a pathway described in the literature (Ref. Peter L. Toogood).

[0518] In some embodiments, the immuno-oncology agent is selected from those described in the literature (cf. Sandra L. Ross et al., "Bispecific T cell engager (BiTE®) antibody constructs can mediate bystander tumor cell killing", PLoS ONE 12(8): e0183390), the contents of which are incorporated herein by reference in their entirety. In some embodiments, the immuno-oncology agent is a bispecific T cell engager (BiTE®) antibody construct. In some embodiments, the bispecific T cell engager (BiTE®) antibody construct is a CD19 / CD3 bispecific antibody construct. In some embodiments, the bispecific T cell engager (BiTE®) antibody construct is an EGFR / CD3 bispecific antibody construct. In some embodiments, the bispecific T cell engager (BiTE®) antibody construct activates T cells. In some embodiments, the bispecific T cell engager (BiTE®) antibody construct activates T cells, which release cytokines that induce the upregulation of intercellular adhesion molecule 1 (ICAM-1) and FAS in bystander cells. In some embodiments, the bispecific T cell engager (BiTE®) antibody construct activates T cells, resulting in bystander cell lysis induced by this activation. In some embodiments, bystander cells are present in a solid tumor. In some embodiments, the bystander cells being lysed are in proximity to BiTE®-activated T cells. In some embodiments, the bystander cells comprise tumor-associated antigen (TAA)-negative cancer cells. In some embodiments, the bystander cells comprise EGFR-negative cancer cells. In some embodiments, the immuno-oncology agent is an antibody that blocks the PD-L1 / PD1 axis and / or CTLA4. In some embodiments, the immuno-oncology agent is an ex vivo expanded tumor-infiltrating T cell. In some embodiments, the immuno-oncology agent is a bispecific antibody construct or a chimeric antigen receptor (CAR) that directly links T cells to tumor-associated surface antigens (TAAs).

[0519] Exemplary immune checkpoint inhibitor

[0520] In some embodiments, the immuno-oncology agent is an immune checkpoint inhibitor as described herein.

[0521] The term "checkpoint inhibitor" as used herein refers to agents useful for preventing cancer cells from evading a patient's immune system. One of the major mechanisms of antitumor immune overturning is known as "T-cell depletion" resulting from chronic exposure to antigens, which leads to the upregulation of inhibitory receptors. These inhibitory receptors act as immune checkpoints to prevent uncontrolled immune responses.

[0522] Co-inhibitory receptors such as PD-1 and cytotoxic T-lymphocyte antigen 4 (CTLA-4), B and T lymphocyte attenuator (BTLA; CD272), T cell immunoglobulin and mucin domain-3 (Tim-3), lymphocyte activation gene-3 (Lag-3; CD223), and others are often referred to as checkpoint regulators. They act as molecular "gatekeepers" that direct extracellular information to proceed with cell cycle progression and other intracellular signaling processes.

[0523] In some embodiments, the immune checkpoint inhibitor is an antibody against PD-1. PD-1 binds to programmed cell death 1 receptor (PD-1) and prevents the receptor from binding to the inhibitory ligand PDL-1, thereby interrupting the tumor's ability to suppress the host anti-tumor immune response.

[0524] In one aspect, the checkpoint inhibitor is a biological therapeutic agent or a small molecule. In another aspect, the checkpoint inhibitor is a monoclonal antibody, a humanized antibody, a fully human antibody, a fusion protein, or a combination thereof. In an additional aspect, the checkpoint inhibitor inhibits a checkpoint protein selected from CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK 1, CHK2, A2aR, B-7 family ligands, or a combination thereof. In an additional aspect, the checkpoint inhibitor interacts with a ligand of a checkpoint protein selected from CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK 1, CHK2, A2aR, B-7 family ligands, or combinations thereof. In one aspect, the checkpoint inhibitor is an immunostimulant, T cell growth factor, interleukin, antibody, vaccine, or a combination thereof. In an additional aspect, the interleukin is IL-7 or IL-15. In a specific aspect, the interleukin is glycosylated IL-7. In an additional aspect, the vaccine is a dendritic cell (DC) vaccine.

[0525] Checkpoint inhibitors comprise any agent that blocks or inhibits the inhibitory pathways of the immune system in a statistically significant manner. Such inhibitors may comprise small molecule inhibitors, or antibodies or their antigen-binding fragments that bind to block or inhibit immune checkpoint receptors, or antibodies that bind to block or inhibit immune checkpoint receptor ligands. Exemplary checkpoint molecules that may be targeted for blockade or inhibition are CTLA-4, PDL1, PDL2, PD1, B7-H3, B7-H4, BTLA, HVEM, GAL9, LAG3, TIM3, VISTA, KIR, 2B4 (belonging to the CD2 family of molecules and all NK, γδ, and memory CD8 +(αβ) expressed in T cells), CD160 (also referred to as BY55), CGEN-15049, CHK1 and CHK2 kinases, A2aR, and various B-7 family ligands, but are not limited thereto. B7 family ligands include, but are not limited to, B7-1, B7-2, B7-DC, B7-H1, B7-H2, B7-H3, B7-H4, B7-H5, B7-H6, and B7-H7. Checkpoint inhibitors include antibodies or antigen-binding fragments thereof, other binding proteins, biological therapeutics, or small molecules that bind to and block or inhibit the activity of one or more of CTLA-4, PDL1, PDL2, PD1, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, and CGEN-15049. Exemplary immune checkpoint inhibitors include tremelimumab (CTLA-4 blocking antibody), anti-OX40, PD-L1 monoclonal antibody (anti-B7-H1; MEDI4736), MK-3475 (PD-1 blocker), nivolumab (anti-PD1 antibody), CT-011 (anti-PD1 antibody), BY55 monoclonal antibody, AMP224 (anti-PDL1 antibody), BMS-936559 (anti-PDL1 antibody), MPLDL3280A (anti-PDL1 antibody), MSB0010718C (anti-PDL1 antibody), and ipilimumab (anti-CTLA-4 checkpoint inhibitor). Checkpoint protein ligands include, but are not limited to, PD-L1, PD-L2, B7-H3, B7-H4, CD28, CD86, and TIM-3.

[0526] In certain embodiments, the immune checkpoint inhibitor is selected from PD-1 antagonists, PD-L1 antagonists, and CTLA-4 antagonists. In some embodiments, the checkpoint inhibitor is selected from the group consisting of nivolumab (Opdivo®), ipilimumab (Yervoy®), and pembrolizumab (Keytruda®). In some embodiments, the checkpoint inhibitor is selected from nivolumab (anti-PD-1 antibody, Opdivo®, Bristol-Myers Squibb); pembrolizumab (anti-PD-1 antibody, Keytruda®, Merck); ipilimumab (anti-CTLA-4 antibody, Yervoy®, Bristol-Myers Squibb); durvalumab (anti-PD-L1 antibody, Imfinzi®, AstraZeneca); and atezolizumab (anti-PD-L1 antibody, Tecentriq®, Genentech).

[0527] In some embodiments, the checkpoint inhibitor is selected from lambrolizumab (MK-3475), nivolumab (BMS-936558), fidilizumab (CT-011), AMP-224, MDX-1105, MEDI4736, MPDL3280A, BMS-936559, ipilimumab, rirrumab, IPH2101, pembrolizumab (Keytruda®), and tremelimumab.

[0528] In some embodiments, the immune checkpoint inhibitor is REGN2810 (Regeneron), an anti-PD-1 antibody tested in patients with basal cell carcinoma (NCT03132636); NSCLC (NCT03088540); cutaneous squamous cell carcinoma (NCT02760498); lymphoma (NCT02651662); and melanoma (NCT03002376); and pidilizumab (CureTech), also known as CT-011, an antibody that binds to PD-1 in clinical trials for diffuse large B-cell lymphoma and multiple myeloma; Avelumab (Bavencio®, Pfizer / Merck KGaA), also known as MSB0010718C, is a fully human IgG1 anti-PD-L1 antibody in clinical trials for non-small cell lung cancer, Merkel cell carcinoma, mesothelioma, solid tumors, kidney cancer, ovarian cancer, bladder cancer, head and neck cancer and gastric cancer; or PDR001 (Novartis), is an inhibitory antibody that binds to PD-1 in clinical trials for non-small cell lung cancer, melanoma, triple-negative breast cancer and advanced or metastatic solid tumors. Tremelimumab (CP-675,206; Astrazeneca) is a fully human monoclonal antibody against CTLA-4 studied in clinical trials for a number of indications including mesothelioma, colorectal cancer, renal cancer, breast cancer, lung cancer and non-small cell lung cancer, pancreatic ductal adenocarcinoma, pancreatic cancer, germ cell cancer, head and neck squamous cell carcinoma, hepatocellular carcinoma, prostate cancer, endometrial cancer, metastatic liver cancer, liver cancer, large B-cell lymphoma, ovarian cancer, cervical cancer, metastatic anaplastic thyroid cancer, urothelial carcinoma, fallopian tube cancer, multiple myeloma, bladder cancer, soft tissue sarcoma, and melanoma. AGEN-1884 (Agenus) is an anti-CTLA4 antibody being studied in a Phase 1 clinical trial for advanced solid tumors (NCT02694822).

[0529] In some embodiments, the checkpoint inhibitor is an inhibitor of T-cell immunoglobulin mucin-containing protein-3 (TIM-3). TIM-3 inhibitors that may be used in the present invention include TSR-022, LY3321367, and MBG453. TSR-022 (Tesaro) is an anti-TIM-3 antibody being studied in solid tumors (NCT02817633). LY3321367 (Eli Lilly) is an anti-TIM-3 antibody being studied in solid tumors (NCT03099109). MBG453 (Novartis) is an anti-TIM-3 antibody being studied in advanced malignant tumors (NCT02608268).

[0530] In some embodiments, the checkpoint inhibitor is an inhibitor of TIGIT, which is a T cell immune receptor having Ig and ITIM domains, or an immune receptor on specific T cells and NK cells. TIGIT inhibitors that may be used in the present invention include BMS-986207 (Bristol-Myers Squibb), an anti-TIGIT monoclonal antibody (NCT02913313); OMP-313M32 (Oncomed); and an anti-TIGIT monoclonal antibody (NCT03119428).

[0531] In some embodiments, the checkpoint inhibitor is an inhibitor of lymphocyte-activating gene-3 (LAG-3). LAG-3 inhibitors that may be used in the present invention include BMS-986016, REGN3767, and IMP321. BMS-986016 (Bristol-Myers Squibb), an anti-LAG-3 antibody, is being studied in glioblastoma and gliosarcoma (NCT02658981). REGN3767 (Regeneron) is also an anti-LAG-3 antibody and is being studied in malignant tumors (NCT03005782). IMP321 (Immutep SA) is a LAG-3-Ig fusion protein being studied in melanoma (NCT02676869); adenocarcinoma (NCT02614833); and metastatic breast cancer (NCT00349934).

[0532] Checkpoint inhibitors that can be used in the present invention include OX40 agonists. OX40 agonists currently under investigation in clinical trials include PF-04518600 / PF-8600 (Pfizer), an agonist anti-OX40 antibody in metastatic renal carcinoma (NCT03092856) and advanced cancers and neoplasms (NCT02554812; NCT05082566); GSK3174998 (Merck), an agonist anti-OX40 antibody in a Phase 1 cancer trial (NCT02528357); and MEDI0562 (Medimmune / AstraZeneca), an agonist anti-OX40 antibody in advanced solid tumors (NCT02318394 and NCT02705482). It includes MEDI6469, an agonist anti-OX40 antibody (Medimmune / AstraZeneca) for colorectal cancer (NCT02559024), breast cancer (NCT01862900), head and neck cancer (NCT02274155), and metastatic prostate cancer (NCT01303705); and BMS-986178 (Bristol-Myers Squibb), an agonist anti-OX40 antibody for advanced cancer (NCT02737475).

[0533] Checkpoint inhibitors that can be used in the present invention include CD137 (also referred to as 4-1BB) agonists. CD137 agonists being studied in clinical trials include utomilumab (PF-05082566, Pfizer), an agonist anti-CD137 antibody in diffuse large B-cell lymphoma (NCT02951156) and advanced cancers and neoplasms (NCT02554812 and NCT05082566); and urelumab (BMS-663513, Bristol-Myers Squibb), an agonist anti-CD137 antibody in melanoma and skin cancer (NCT02652455) and glioblastoma and edema (NCT02658981).

[0534] Checkpoint inhibitors that can be used in the present invention include CD27 agonists. CD27 agonists currently under investigation in clinical trials include varilumab (CDX-1127, Celldex Therapeutics), an anti-CD27 antibody effective in squamous cell head and neck cancer, ovarian carcinoma, colorectal carcinoma, renal cell carcinoma, and glioblastoma (NCT02335918); lymphoma (NCT01460134); and glioma and astrocytoma (NCT02924038).

[0535] Checkpoint inhibitors that can be used in the present invention include glucocorticoid-induced tumor necrosis factor receptor (GITR) agonists. GITR agonists currently under investigation in clinical trials include TRX518 (Leap Therapeutics), an agonist anti-GITR antibody in malignant melanoma and other malignant solid tumors (NCT01239134 and NCT02628574); GWN323 (Novartis), an agonist anti-GITR antibody in solid tumors and lymphoma (NCT 02740270); INCAGN01876 (Incyte / Agenus), an agonist anti-GITR antibody in advanced cancer (NCT02697591 and NCT03126110); and MK-4166 (Merck), an agonist anti-GITR antibody in solid tumors (NCT02132754). It includes MEDI1873 (Medimmune / AstraZeneca), an agonist hexameric GITR-ligand molecule having a human IgG1 Fc domain in advanced solid tumors (NCT02583165).

[0536] Checkpoint inhibitors that can be used in the present invention include inducible T-cell co-stimulators (also known as ICOS, CD278) agonists. ICOS agonists being studied in clinical trials include MEDI-570 (Medimmune), an agonist anti-ICOS antibody in lymphoma (NCT02520791); GSK3359609 (Merck), an agonist anti-ICOS antibody in Phase 1 (NCT02723955); and JTX-2011 (Jounce Therapeutics), an agonist anti-ICOS antibody in Phase 1 (NCT02904226).

[0537] Checkpoint inhibitors that can be used in the present invention include killer IgG-like receptor (KIR) inhibitors. KIR inhibitors currently under investigation in clinical trials include ririlumab (IPH2102 / BMS-986015, Innate Pharma / Bristol-Myers Squibb), an anti-KIR antibody in leukemia (NCT01687387, NCT02399917, NCT02481297, NCT02599649), multiple myeloma (NCT02252263), and lymphoma (NCT01592370); IPH2101 (1-7F9, Innate Pharma) in myeloma (NCT01222286 and NCT01217203); It includes IPH4102 (Innate Pharma), an anti-KIR antibody that binds to three domains of the long cytoplasmic tail (KIR3DL2) in lymphoma (NCT02593045).

[0538] Checkpoint inhibitors that can be used in the present invention include CD47 inhibitors of the interaction between CD47 and signal regulatory protein alpha (SIRPa). CD47 / SIRPa inhibitors currently under investigation in clinical trials include ALX-148 (Alexo Therapeutics), an antagonistic variant of (SIRPa) that binds to CD47 and prevents CD47 / SIRPa-mediated signaling in Phase 1 (NCT03013218); and TTI-621 (SIRPa-Fc, Trillium Therapeutics), a soluble recombinant fusion protein produced by linking the N-terminal CD47-binding domain of SIRPa with the Fc domain of human IgG1, which acts by binding to human CD47 and preventing its "do not eat" signal to macrophages and is currently undergoing Phase 1 clinical trials (NCT02890368 and NCT02663518). Includes CC-90002 (Celgene), an anti-CD47 antibody in leukemia (NCT02641002); and Hu5F9-G4 (Forty Seven, Inc.) in colorectal neoplasms and solid tumors (NCT02953782), acute myeloid leukemia (NCT02678338), and lymphoma (NCT02953509).

[0539] Checkpoint inhibitors that can be used in the present invention include CD73 inhibitors. CD73 inhibitors currently under investigation in clinical trials include MEDI9447 (Medimmune), an anti-CD73 antibody in solid tumors (NCT02503774); and BMS-986179 (Bristol-Myers Squibb), an anti-CD73 antibody in solid tumors (NCT02754141).

[0540] Checkpoint inhibitors that can be used in the present invention include agonists of stimulants of interferon gene proteins (STING, also known as transmembrane protein 173 or TMEM173). Agonists of STING being studied in clinical trials include MK-1454 (Merck), an agonist synthetic cyclic dinucleotide in lymphoma (NCT03010176); and ADU-S100 (MIW815, Aduro Biotech / Novartis), an agonist synthetic cyclic dinucleotide in Phase 1 trials (NCT02675439 and NCT03172936).

[0541] Checkpoint inhibitors that can be used in the present invention include CSF1R inhibitors. CSF1R inhibitors currently under investigation in clinical trials include pexidartinib (PLX3397, Plexxikon), a CSF1R small molecule inhibitor in colorectal cancer, pancreatic cancer, metastatic and advanced cancer (NCT02777710), and melanoma, non-small cell lung cancer, squamous cell head and neck cancer, gastrointestinal stromal tumor (GIST), and ovarian cancer (NCT02452424); and IMC-CS4 (LY3022855, Lilly), an anti-CSF-1R antibody in pancreatic cancer (NCT03153410), melanoma (NCT03101254), and solid tumors (NCT02718911). It includes BLZ945 (4-[2((1R,2R)-2-hydroxycyclohexylamino)-benzothiazole-6-yloxyl]-pyridine-2-carboxylic acid methylamide, Novartis), an orally available inhibitor of CSF1R in advanced solid tumors (NCT02829723).

[0542] Checkpoint inhibitors that can be used in the present invention include NKG2A receptor inhibitors. NKG2A receptor inhibitors currently under investigation in clinical trials include monalizumab (IPH2201, Innate Pharma), an anti-NKG2A antibody in head and neck neoplasms (NCT02643550) and chronic lymphocytic leukemia (NCT02557516).

[0543] In some embodiments, the immune checkpoint inhibitor is selected from nivolumab, pembrolizumab, ipilimumab, avelumab, durvalumab, atezolizumab, or fidilizumab.

[0544] In addition to the methods of prevention and / or treatment as described above, the present invention also provides corresponding uses for preventing and / or treating diseases, disorders, or conditions as described herein. In some embodiments, the present invention provides uses of compounds or pharmaceutically acceptable salts thereof as described herein for preventing and / or treating viral infections, or inflammatory diseases, disorders, or conditions, or cancer as described herein. In some embodiments, the use provided by the present invention for preventing and / or treating HIV infection is intended for patients in whom the presence and / or expression level of an HIV splice variant as a biomarker is measured and / or monitored by the method described herein. In some embodiments, the use provided by the present invention for preventing and / or treating inflammatory diseases, disorders, or conditions, or cancer is intended for patients in whom the presence and / or expression level of a long non-coding RNA spliced ​​at the miR-124 locus is measured and / or monitored by the method described herein.

[0545] The present invention provides a chemical formula as defined above for use in treating or preventing inflammatory diseases, disorders or conditions, or cancer in patients requiring it. I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc or IVd A compound of or a pharmaceutically acceptable salt thereof is further provided. In some embodiments, a formula as defined above for use as an anti-inflammatory agent. I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc or IVdThe compound or its pharmaceutically acceptable salt is intended for patients in whom the presence and / or expression level of long non-coding RNA spliced ​​at the miR-124 locus is monitored in the patient's blood and / or tissue samples prior to and during use.

[0546] The present invention provides a chemical formula as defined above for use in treating HIV infection in patients who require it. I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc or IVd A compound of or a pharmaceutically acceptable salt thereof is further provided. In some embodiments, a chemical formula as defined above for use as an HIV therapeutic agent. I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc or IVd The compound or its pharmaceutically acceptable salt is intended for patients in whom the presence and / or expression level of HIV splice variants is monitored in the patient's blood and / or tissue samples prior to and during use.

[0547] Additional exemplary implementation examples:

[0548] 1. A method of using an HIV splice variant of SEQ ID NO. 1 as a biomarker of the efficacy of an HIV infection or a therapeutic treatment of an HIV infection, comprising the step of measuring the presence or expression level of an HIV splice variant of SEQ ID NO. 1 in a biological sample.

[0549] 2. A method for evaluating the biological effect of a compound for treating HIV infection, comprising the step of measuring the presence or expression level of an HIV splice variant of SEQ ID NO. 1 as a biomarker for HIV infection.

[0550] 3. A method for screening a compound or vaccine in the prevention and / or treatment of HIV infection, comprising the step of measuring the presence or expression level of an HIV splice variant of SEQ ID NO. 1 as a biomarker of HIV infection.

[0551] 4. A method for treating HIV infection comprising the steps of administering therapeutic treatment to a patient and measuring and / or monitoring the presence and / or expression level of an HIV splice variant of SEQ ID NO. 1 in the patient.

[0552] 5. A method of using lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the therapeutic efficacy of an inflammatory disease, disorder or condition, or cancer, comprising the step of measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus of a biological sample.

[0553] 6. A method for evaluating the biological effects of a compound or medical device for the treatment of an inflammatory disease, disorder or condition, or cancer, comprising the step of measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the inflammatory disease, disorder or condition, or cancer.

[0554] 7. A method for screening a compound or medical device for the treatment of an inflammatory disease, disorder or condition, or cancer, comprising the step of measuring the presence or expression level of lncRNA 0599-205 at the miR-124-1 locus as a biomarker for the inflammatory disease, disorder or condition, or cancer.

[0555] 8. A method for treating an inflammatory disease, disorder or condition, or cancer, comprising the steps of administering a therapeutic treatment to a patient and measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the patient's miR-124-1 locus.

[0556] 9. A method for treating an inflammatory disease, disorder or condition, or cancer, comprising the steps of administering a therapeutic treatment to a patient and measuring and / or monitoring the presence and / or expression level of miR-124 in the patient.

[0557] 10. A method for selecting a patient for therapeutic treatment of an inflammatory disease, disorder or condition, or cancer, comprising the step of measuring and / or monitoring the presence and / or expression level of lncRNA 0599-205 at the patient's miR-124-1 locus.

[0558] 11. A method for selecting a patient for therapeutic treatment, comprising the step of measuring and / or monitoring the presence and / or expression level of miR-124 in the patient.

[0559] 12. Method in any one of embodiments 4 and 8-11, wherein the therapeutic treatment is a compound of formula I or a pharmaceutically acceptable salt thereof:

[0560] Chemical Formula I

[0561]

[0562] In the above formula,

[0563] Z is C or N and;

[0564] V is C or N;

[0565] is where V is C or N, and when V is N, V ​​means an ortho, meta, or para aromatic ring with respect to Z;

[0566] Each R is independently hydrogen, halogen, -CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, -NO2, -NR1R2, (C1-C4)alkoxy, phenoxy, -NR1-SO2-NR1R2, -NR1-SO2-R1, -NR1-C(=O)-R1, -NR1-C(=O)-NR1R2, -SO2-NR1R2, -SO3H, -O-SO2-OR3, -OP(=O)-(OR3)(OR4), -O-CH2-COOR3, (C1-C3)alkyl, and said alkyl is a hydroxyl group or formula IIa The group of, or chemical formula IIIa Arbitrarily one- or two-substituted into a group of;

[0567] Q is N or O, provided that if Q is O, R" does not exist;

[0568] R1 and R2 are each independently hydrogen or (C1-C3)alkyl;

[0569] R3 and R4 are independently hydrogen, Li + , Na + , K + , N + (Ra)4 or benzyl;

[0570] n is 1, 2, or 3, and;

[0571] n' is 1, 2, or 3 and;

[0572] Each R' is independently hydrogen, (C1-C3)alkyl, hydroxyl, halogen, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3)fluoroalkyl, (C1-C4)alkoxy, -OP(=O)-(OR3)(OR4), -CN, chemical formula IIa The group of, or chemical formula IIIa It is a group of,

[0573] A is a covalent bond, oxygen, or NH;

[0574] B is a covalent bond or NH;

[0575] m is 1, 2, 3, 4, or 5;

[0576] p is 1, 2, or 3, and;

[0577] Ra and Rb are each independently hydrogen, (C1-C5)alkyl or (C3-C6)alkyl, or

[0578] Ra and Rb form a saturated pentatonic or hexavalent heterocycle with the nitrogen atoms to which they are attached, said heterocycle being optionally substituted by one or more Ra, provided that if R' is a group of formula IIa or IIIa, n' can be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa;

[0579] R" is hydrogen, (C1-C4)alkyl, or a group of formula IIa as defined above.

[0580] 13. Method of Embodiment 12, wherein the compound is selected from formulas Ia to 1d or pharmaceutically acceptable salts thereof:

[0581] Chemical formula Ia

[0582]

[0583] Chemical formula Ib

[0584]

[0585] Chemical formula Ic

[0586]

[0587] Chemical formula Ib'

[0588]

[0589] Chemical formula Id

[0590]

[0591] 14. Method according to Embodiment 12 or 13, wherein the compound is ABX464 or a pharmaceutically acceptable salt thereof.

[0592] 15. Method in any one of Embodiments 4 or 8-11, wherein the therapeutic treatment is a compound of Formula IV or a pharmaceutically acceptable salt thereof:

[0593] Chemical Formula IV

[0594]

[0595] In the above formula,

[0596] Variables V, Z, R, R', n, and n' are as described in Example 8, respectively.

[0597] 16. Method of Embodiment 15, wherein the compound is selected from formulas IVa to IVd or pharmaceutically acceptable salts thereof:

[0598] Chemical formula IVa

[0599]

[0600] Chemical formula IVb

[0601]

[0602] Chemical formula IVc

[0603]

[0604] Chemical formula IVb'

[0605]

[0606] Chemical formula IVd

[0607]

[0608] adduction

[0609] human samples

[0610] All experiments on human biopsies were conducted in accordance with relevant guidelines and regulations. The experiments were contracted N° EudraCT : 2016-002797-1ttulo ESTUDIO ABIERTODE LA SEGURIDAD, FARMACOCINETICA Y FARMACODINAMICA DE ABX464 EN ADULTOS SERONEGATIVOS Y SEROPOSITIVOS Y SEROPOSITIVOS Y SEROPOSITIVOS Y SEROPOSITIVOS PARA EL VIH-1 under AEMPS (Spanish Agency) Nº AEMPS : Approved by 16-0728. Prior consent was obtained from all subjects.

[0611] Cell culture, infection, and transfection

[0612] Buffy coats from HIV-negative individuals were obtained from the local blood donation center at Centre de transfusion sanguine Montpellier. Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll (Histopaque, Sigma) gradient centrifugation. CD4+ and CD8+ T cells were purified from PBMCs after Ficoll gradient centrifugation by human CD4+ bead-positive selection and CD8+ bead-positive selection (Miltenyi), respectively. PBMCs, CD4+, and CD8+ T cells were grown for 2 days at 37°C and 5% CO2 in RPMI GlutaMAX medium (Life Technologies) supplemented with 10% fetal calf serum (FCS) (Thermo Fisher), 40 U / ml IL2 (PeproTech), and 5 μg / mL PHA (Roche) at a density of 1.5 x 10⁶ cells / ml. After 3 days, cells were resuspended at 5 x 10⁶ cells / ml in RPMI supplemented with 10% FCS and 40 U / ml IL2, and separated into two groups (infected cells and uninfected cells). Cells were infected with 80 ng of YU-2 strain p24 / 10⁶ cells for 4 to 6 hours, and then washed with PBS before updating the medium.

[0613] Subsequently, both infected and uninfected cells were centrifuged and resuspended at a density of 1.5 x 10⁶ cells / ml in medium supplemented with a final concentration of 0.05% DMSO or a diluted drug solubilized in DMSO (Sigma) with an antiretroviral compound, according to the manufacturer's instructions. The cells were treated for 6 days with medium renewal on day 3. HIV p24 titration by ELISA was performed on the cell culture supernatant using the Innotest kit (Ingen) according to the manufacturer's instructions.

[0614] To generate monocyte-derived macrophages, monocytes were isolated using CD14+ positive micro beads (Miltenyi) and cultured for 7 days in X-VIVO 10 medium (Lonza) supplemented with 10 mM HEPES, 1 mM sodium pyruvate, 1% non-essential amino acids, 10% FBS, 10 ng / ml GM-CSF, and 100 ng / ml M-CSF, with medium renewal on day 3. After differentiation on day 7, cells were washed, plated in 6-well plates, and cultured in medium for 24 hours without cytokine addition. Cells were treated for 6 days with partial medium change on day 3.

[0615] ATCC HeLa cells were cultured in DMEM GlutaMAX medium (Life Technologies) supplemented with 10% FCS (Thermo Fisher) at 37°C and 5% CO2. The region corresponding to lncRNA0599-205 was synthesized by IDT (Integrated DNA Technologies) and cloned into pcDNA3.1 to generate the pc-lncRNA-0599-205 plasmid. pc-lncRNA-0599-205 (2 µg per 400,000 cells) was transiently transfected in HeLa cells using jetPEI reagent (Polyplus) according to the manufacturer's instructions.

[0616] miRNA (RT-q)-PCR analysis

[0617] miRNAs were extracted from PBMCs, CD4+, or CD8+ T cells using the NucleoSpin miRNeasy kit (Macherey-Nagel) according to the manufacturer's instructions. miRNA reverse transcription (RT) was performed using the miScript II RT kit (Qiagen). The generated cDNA was used as a template for real-time qPCR performed with the miScript SYBR Green PCR kit (Qiagen) along with appropriate primers (Qiagen). Relative qPCR was performed using specific miR-124 primers (Hs_miR-124a), control-specific primers (Ce_miR-39), and two housekeeping gene (miR-26 and miR-191)-specific primers (Hs_miR-26a and Hs_miR-191). PCR analysis was performed on a LightCycler 480 Instrument II (Roche Molecular Systems, Inc). All reactions were conducted in triplicate. The relative level of miR-124 is 2 -△△Ct It was calculated using the method.

[0618] Total RNA was extracted from macrophages using the Macherey-Nagel NucleoSpin miRNeasy kit. miRNA reverse transcription (RT) was performed on 2 μl of total RNA according to the Applied Biosystems TaqMan Advanced miRNA assay protocol for TaqMan qPCR. Relative qPCR was performed using specific miR-124 primers (Hs_miR-124a), spike control-specific primers (Ce_miR-39), and housekeeping gene (miR-191)-specific primers (Hs_miR-191). PCR runs were analyzed using Applied Biosystems ViiA 7 software.

[0619] Quantification of miR-124 in human biopsies

[0620] Quantification of miR-124 was performed on patient rectal biopsy samples collected in PAXgene tissue containers (PreAnalytiX). RNA extraction was performed using the PAXgene Tissue miRNA Kit (PreAnalytiX) according to the manufacturer's protocol. Briefly, samples were immersed in 250 μl of TM1 buffer in a 2 ml Safe-Lock microcentrifuge tube containing one 5 mm stainless steel bead. Samples were disrupted and homogenized using a Qiagen TissueLyser device at 20 Hz for 2 x 2 minutes. The remaining procedure was performed according to the manufacturer's protocol. At the end of the procedure, each RNA was eluted with 32 μl of TM4 buffer. RNA concentration and purity were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific). RNA integrity was evaluated using an Agilent 2200 TapeStation with RNA ScreenTape. cDNA templates were prepared using the TaqMan Advanced miRNA cDNA Synthesis Kit (Applied Biosystems) according to the manufacturer's protocol, starting from a 10 ng total RNA matrix. qPCR was performed using two TaqMan Advanced miRNA assays (Applied Biosystems); one targeted miR-124-1 miRNA (Assay ID: 477879_mir), and the other targeted miR16 (Assay ID: 477860_mir), an endogenous miRNA used as a reference for expression data normalization according to the manufacturer's instructions. QPCR was performed on a LightCycler 480 Instrument II (Roche Molecular Systems, Inc). All assays were labeled using FAM-MGB chemistry.

[0621] Statistical data analysis

[0622] All statistical analyses and plots were performed using R software v3.5. For normalization and processing, the inventors used edgeR v3.22.1, EDASeq v2.14, and DESeq2 v1.20. The inventors decided to use CPM per million (CPM) rather than Transcriptome per million (TPM), primarily because TPM discarded much information regarding the original count size and thus generated too much noise for differential testing. The first step was to filter the data. The inventors considered that the gene was expressed at an appropriate level in the sample if there were at least 5 counts for each of the 1 million mapped reads in the sample. For marker selection, the inventors selected Type 1 set to 5% (*)Using an error α threshold, a highly flexible approach enables differential analysis despite the lack of replication. For the same reason, the log2-fold change cutoff was set to 1.5 for both positive and negative values, and the cutoff p-value was typically ≤ 0.05. These appropriate cutoffs allowed for the identification of differentially expressed genes. The Error Discovery Rate (FDR) value was calculated for explanatory purposes but was not considered in the decision due to the lack of replication. The first methodology choice was Benjamini and Hochberg. This procedure provides less stringent control over Type 1 errors compared to the Full Force Error Rate (FWER) procedure (e.g., Bonferroni correction). The inventors added MDS plots to the data using the R and edgeR packages. MDS plots generate a plot where the distance between samples corresponds to the principal biological coefficient of variation (BCV) between those samples. In these plots, the inventors did not observe any separation between the DMSO-NI, 464-NI, DMSOI, and 464-I conditions. The inventors also generated several volcanic plots using the R and EDASeq packages. These plots were a good representation of differential expression (DE) tests in RNA-Seq experiments. These plots showed the log-2-fold change (FC) and the -log of p-values ​​for all genes investigated in the DE test. 10 It indicated... The highlighted green dots are markers that met the selection criteria (significant in both p-value and log2FC). The highlighted yellow dots are genes that met the log2FC criterion but failed the p-value criterion. The inventors retained these dots for further investigation despite their lack of definitive value.

[0623] Sequence analysis and bioinformatics analysis

[0624] RNA CaptureSeq of HIV RNA and cellular microRNA

[0625] Total RNA was extracted from infected and uninfected PBMC samples using the TRIzol reagent (Invitrogen) according to the manufacturer's protocol. RNA concentration and purity were determined using the RNA 6000 Bioanalyzer kit (Agilent). For cDNA synthesis, 1 μg of total RNA was treated with DNase I (Invitrogen) and then used as a template for reverse transcription using the Verso cDNA kit containing a blend of random hexamers and immobilized oligo-dT (Thermo Scientific) according to the manufacturer's instructions. After preparing the KAPA Hyper Prep (ROCHE) library from 1 μg of total RNA, the inventors proceeded with SeqCap EZ capture (ROCHE) according to the manufacturer's recommendations. Hybrid selection was performed using a custom SeqCap EZ selection library (Roche NimbleGen) containing the following regions: chromosome 8 (9,760,617 to 9,761,780 and 65,285,285 to 65,296,944), chromosome 20 (61,797,549 to 61,812,855), chromosome 1 (1,102,000 to 1,106,000), chromosome 13 (92,000,074 to 92,006,641), chromosome 15 (22,512,831 to 2,513,641) and the genome of the HIV Ada8 strain. This library was designed via the NimbleDesign portal (v1.2.R1) using the genome build hg19 NCBI build 37.1 / GRCh37. Sequencing was performed on a NextSeq 500 (Illumina) using 18 samples in HighOutput cartridges (2 x 400 million reads of 75 bases each).

[0626] CD4+ T cell sequencing

[0627] A complete detailed report describing the full analysis was submitted to the Gene Expression Omnibus (GEO, https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE116073). Total RNA extraction was performed according to the Qiagen miRNeasy□ kit. RNA concentration was determined using Qubit□ fluorescence quantification, and purity was determined by the RNA 6000 bioanalyzer kit (Agilent). RNA-Seq libraries were constructed using Illumina's TruSeq strand mRNA sample preparation kit (low-throughput protocol) according to the manufacturer's instructions. A 1.2 μg aliquot of total RNA was used for library construction. The final cDNA libraries were validated with a fragment analyzer (Advanced Analytical, Ankeny, IA) and quantified with the KAPA qPCR kit (Kapa Biosystems, Wilmington, MA). In the eight sequencing lanes of flow cell V4, 32 libraries were pooled in equal proportions of four library sets per lane, denatured with NaOH, and diluted to 16 pM prior to clustering. Cluster formation, primer hybridization, single-terminal reads, and 50-cycle sequencing were performed on cBot and HiSeq 2500 (Illumina, San Diego, CA), respectively. Image analysis and base sequencing were performed using HiSeq control software along with real-time analysis components. Demultiplexing was performed using Illumina's sequencing analysis software. Data quality was evaluated using Babraham Institute's FastQC and Illumina's Sequence Analysis Viewer (SAV). Potential contaminants were investigated using Babraham Institute's FastQ Screen software.

[0628] To investigate splicing activity, the inventors used SUPPA v2.0.0, a tool developed in Python 3.4 and specifically designed for this approach. To study splicing under various conditions, the inventors performed three separate modular tasks. The first step was to generate events from annotation files, commonly referred to as GTF files (General Transfer Format). The second step was to quantify the Event Inclusion Level (PSI) in this sample. Finally, differential splicing across various conditions was calculated for all replicas.

[0629] To generate different alternative splicing events from an input annotation file (GTF format), the method reads transcriptome and genetic information only from the "exon" lines of the GTF. Subsequently, it generates events and outputs an 'ioe' file containing the relationships between each event and the transcripts that share this specific event. Specifically, it provides the transcripts that contribute to the numerator (one form of the event) and denominator (two forms of the event) of the PSI calculation. To generate PSI values, SUPPA reads the ioe file generated in the first step and a transcriptome expression file containing transcript abundances.

[0630] SUPPA calculates the magnitude of splicing variation (△PSI) and their significance across biological conditions using four replicates per condition. Conditions are analyzed in the sequential order specified as input. Statistical significance is calculated by comparing the △PSI observed between conditions with the distribution of △PSI between replicates as a function of gene expression (measured by the expression of the transcript defining the event). Using the output of the differential splicing analysis, the inventors classified events into four major groups: alternative 5' splice sites (A5), alternative 3' splice sites (A3), alternative first and final exons (Altexons), and retained introns (RI). Using this classification, the inventors classified differential splicing events occurring in different comparisons of samples using a very strict cutoff of psi-score difference (△PSI) fixed at > 0.4 and a p-value < 0.05. The inventors established a raw coefficient table from the SUPPA output using a simple Perl script.

[0631] MicroRNA array analysis

[0632] Total RNA was extracted from infected and uninfected PBMC samples using the miRNeasy kit (Qiagen) according to the manufacturer's protocol. RNA concentrations were determined using a Nanodrop spectrophotometer (ThermoFisher). Quality control was performed using expression console metrics. A complete detailed report describing the full analysis was submitted to GEO (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE116148). All miRNA assays were normalized using the "RMA + DABG" normalization method within the Affymetrix expression console, along with a dedicated annotation file downloaded from the Affymetrix web server. A probe was considered expressed if its DABG p-value was less than 0.05 and it was not otherwise expressed. If the probe was expressed in more than 3 / 4 of the replicates, the miRNA was considered expressed under one condition. Finally, the miRNA was considered expressed if 1) it was expressed in A or B; and 2) its fold change was ≥ 1.5; 3) When his paired t-test p-value was ≤ 0.05, it was considered to be differentially expressed between conditions A and B.

[0633] Volcanic plots were generated using R. They show the M-values ​​(log2 (fold change)) and -log10 (p-values) of all miRNAs for comparisons 464_I vs. DMSO_I, 464_NI vs. DMSO_NI, and DMSO_I vs. DMSO_NI. MiRNAs that were significantly (FC ≥ 1.5 and p-value ≤ 0.05) upregulated are highlighted in red, and miRNAs that were downregulated are highlighted in green.

[0634] TaqMan Low Density Array (TLDA)

[0635] MicroRNA profiling of the samples was performed using the TaqMan array Human MicroRNA Panels A and B (Life Technologies). Each TLDA card detects 384 characteristics, including 377 human miRNAs, 3 endogenous small RNA controls (one of which is present in quadruples), and a negative control. A total of 754 human miRNAs were quantified. Reverse transcription and pre-amplification were performed according to the manufacturer's instructions (Megaplex™ RT primers and Megaplex™ PreAmp primers, Life Technologies). 9 µl of diluted pre-amplified product was added to a total mixture of 900 µl per TLDA card. Real-time quantitative PCR was performed on the ViiA 7 Real-time PCR system, and data were collected using the manufacturer's ViiA™ software. Array data was further processed using the Gene Expression Suite software (Applied Biosystems). Automatic thresholds were checked individually and modified as necessary.

[0636] In the data preprocessing stage, the HiSeq control and real-time analysis software automatically generates image analysis, base sequencing, and base sequencing quality in real time. "Dirty" raw reads were defined as reads containing high content of adapter sequences or unknown bases, as well as low-quality reads. These reads were removed prior to downstream analysis to reduce data noise. The filtering steps were as follows:

[0637] The quality of the RNA-seq library was first evaluated using FastQC v0.11.5 software. The inventors use the FastQ Screen Contaminant Finder to test the alignment of large datasets against other genomes that indicate potential contaminants. The software generates a graph showing the proportion of reads aligned with the other genomes tested. FastQ Screen uses the Bowtie2 aligner. Alignment is performed on a subset of sequences from each sample.

[0638] Next, the readings were subjected to standard quality control (QC) and filtering criteria according to the following parameters: (1) trimming and cleaning readings aligned with primers and / or adapters, (2) readings having more than 50% low-quality bases (quality value ≤ 15) in a single reading, and (3) readings having more than 10% unknown bases (N bases). The inventors used a program called Trimmomatic to remove primers and poor-quality readings. After filtering, the inventors removed short readings (<36bp); the remaining readings were referred to as "cleaned readings" and stored in FASTQ format.

[0639] Once the inventors were confident in the quality of the sequencing data, they proceeded to align the clean reads within the FASTQ file to the reference sequence. Alignment was performed using the TopHat2 v2.0.8b tool on the human GRCh38 reference genome.

[0640] TopHat2 is a splice-aware aligner that uses the Bowtie2 aligner to align data before counting reads mapped to each gene. Bowtie2 behavior was tuned to support local alignment by setting it to sensitive. TopHat2 output was saved as a BAM file (typically, accepted_hits.bam) containing all alignments. TopHat2 output also reported alignment statistics. Subsequently, because the SAM file format was required to count the reads, the BAM files were sorted by name and converted to SAM format using SAMtools-1.3.1 software. To calculate raw gene-level counts from the mapped reads of each library, the inventors used the htseq-count tool v0.6.1p1 of the Python package HTSeq, which uses the default integrated counting method. The HTSeq package generated raw count tables for each library, which were necessary to determine the expression levels of each gene. DEG (differentially expressed genes) screening aims to identify genes that are differentially expressed between samples and to perform additional functional analyses on them. Gene expression levels and DEGs were calculated using R software and a set of R packages. The inventors decided to focus their efforts on explaining and gaining a deeper understanding of the effects of ABX464 and to limit the statistical analysis to specific libraries. In this work, the inventors decided to compare the DMSO vs. DMSOi libraries, ABX464 vs. DMSO libraries, and 464i vs. DMSOi libraries. Additionally, to obtain meaningful results, in this statistical design, the inventors considered four donors as biological replicas.

[0641] Flow cytometry analysis

[0642] PBMC or CD4+ T cells from different donors in suspension were labeled with appropriate anti-human monoclonal antibodies (mAbs) (all from BioLegend). Washing and reagent dilution were performed with FACS buffer (PBS containing 2% fetal calf serum and 0.05% sodium azide [NaN3]). All acquisitions were performed on a Cyan ADP (Beckman Coulter) flow cytometer. Data were analyzed using FlowJo software (Ashland, OR). Cell debris and dead cells were excluded due to their light scattering properties.

[0643] Measurement of unspliced ​​and spliced ​​lncRNA 599-205

[0644] Reverse transcription (RT) reactions were performed with 1 µg of total RNA using the Maxima First Strand cDNA synthesis kit (ThermoFisher Scientific). Genomic DNA removal was performed prior to amplification, but an enzyme-free RT negative control was performed to confirm the absence of DNA contamination. qPCR was performed using LightCycler® 480 SYBR Green I Master Mix (Roche) and the following primers: total lncRNA 599-205 Fwd (CCCTCCACCACTTGGGAC) and total lncRNA 599-05 Rev (GACCTGGGGATTCAGCCTTC), unspliced ​​lncRNA 599-205 Fwd (GAACAAAGAGCCTTTGGAAGAC) and unspliced ​​lncRNA 599-205 Rev (GGAAGGGACCACAGCATC), spliced ​​lncRNA 599-205 Fwd (CACTCAGCGATGGAGGAAA) and spliced ​​lncRNA 599-205 Rev (CCAATCACACAGACAATGAGATAAC), internal control β-actin Fwd (GTGAAGGTGACAGCAGTCGGTT) and β-actin Rev(GAAGTGGGGTGGCTTTTAGGA). The amplification execution conditions were as follows: 95°C (10 sec), 58°C (30 sec), and 72°C (30 sec) for 40 cycles.

[0645] result

[0646] 1. ABX464 generates spliced ​​HIV RNA variants.

[0647] To profile viral transcription events regulated by ABX464 and thereby evaluate the full depth of the HIV transcriptome, the inventors used a recently described targeted RNA capture and sequencing strategy (RNA CaptureSeq). This strategy involves the construction of a tiling array across the HIV genome in which cDNA is hybridized, eluted, and sequenced. RNA CaptureSeq is similar to previous in-solution capture methods and exome sequencing approaches, but when combined with deep sequencing techniques, it provides a saturation range and allows for the robust assembly of rare and unannotated HIV transcriptomes.

[0648] PBMCs from six HIV-negative donors were infected with the YU-2 strain and then treated with ABX464. This protocol resulted in mild infection that did not lead to cell death at 8 days post-infection (dpi), and viral replication was inhibited by more than 70% with 5 μM of ABX464 (Fig. 1b). After cDNA capture from untreated or ABX464-treated infected cells, libraries were prepared and sequenced using the Illumina sequencing facility. To highlight potential novel splicing events induced by ABX464, the inventors used a custom bioinformatics pipeline with key steps involving the assembly of putative transcripts from targeted RNA sequencing reads to construct contic (Illumina paired terminal 2x75 bp) (Figs. 6a and b). Subsequently, the putative transcripts (contic) were mapped to the HIV genome. The HIV profiling dataset used in this analysis yielded a high sequence range (2 to 30 million reads for a 9kb genome), enabling in-depth quantification of HIV splice variants. The inventors were able to reliably quantify each HIV alternative splicing for various transcriptome abundances and demonstrated that while ABX464 treatment resulted in enhanced splicing, ABX464 did not favor the generation of random splice variants compared to others (Fig. 1c, Table III).

[0649] To test whether enhanced splicing by ABX464 generates new viral RNA variants, splicing events were filtered and analyzed. After mapping contices to the genome of the YU-2 strain, the latter were used as anchors for the further clustering and assembly of new HIV transcripts. Partial genetic structures generated by spliced ​​alignments were merged whenever they shared consecutive splicing sites across the intronic viral sequence. The superstructures thus formed correspond to all possible HIV genetic structures in which each complete exon is supported by at least one alignment. At the HIV transcriptome level, this induces the formation of superassemblies, where each superassembly is a merge of initial contices that match the predicted superstructure. In particular, the requirement that all splicing sites among the contic linkages and merged contices match the HIV-1 genome sequence makes the formation of spurious superassemblies impossible. Figure 1c and Table III provide the distribution of multiple contices that merge to form a single superassembly for each donor. In all samples treated with ABX464, most assembled contices (90%) corresponded to spliced ​​RNA (Fig. 1c, Table IV and Fig. 7) or small RNA containing gag-pol sequences that can be released from introns, whereas in untreated samples, spliced ​​RNA represented a minimal fraction (less than 24%) and most contices corresponded to unspliced ​​full-length viral RNA (more than 74%) (Fig. 1c, Table IV and Fig. 7). These results demonstrated that ABX464 preferentially generated spliced ​​HIV RNA variants in infected PBMCs, which impairs the subsequent synthesis of full-length HIV-1 pre-mRNA and the assembly of infectious particles, thereby inducing inhibition of viral replication.

[0650] Interestingly, one of the spliced ​​variants generated by ABX464 treatment (Figs. 1a and d) was present in cells infected by both YU-2 and Ada-M strains, and its sequence polymorphism was not detected in HIV-1 B and C subtypes that were strongly suppressed by ABX464. Furthermore, this novel spliced ​​variant was detected using long-read sequencing, which indicates additional accuracy for this method in describing complex and rare spliced ​​isoforms and estimating their relative abundance. This novel RNA variant may produce immunogenic peptides or exhibit toxicity to cells harboring proviral DNA. This is consistent with the reduced viral load and reduced viral DNA levels observed in HIV patients treated with ABX464 (ABIVAX, data within file). Thus, ABX464 not only enhanced the splicing of HIV RNA but also generated novel HIV spliced ​​variants.

[0651] Table III shows the reading assemblies and contic counts from PBMCs infected with the YU2 strain, either untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO, and D8_DMSO) or treated with ABX464 (D1_464, D4_464, D5_464, D6_464, D7_464, and D8_464).

[0652] Table IV shows the contic coefficients of the complete mRNA or spliced ​​RNA transcripts of Gag, Pol, vif, vpr, tat, rev, vpu, and env from PBMCs infected with the YU2 strain, either untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO, and D8_DMSO) or treated with ABX464 (D1_464, D4_464, D5_464, D6_464, D7_464, and D8_464).

[0653] [Table 3]

[0654]

[0655] [Table 4]

[0656]

[0657] 2. ABX464 does not affect cell splicing.

[0658] To ensure that ABX464 acts specifically on HIV splicing and does not significantly or entirely affect splicing events of human genes, the inventors used a high-throughput RNAseq approach. Many genome-wide expression studies of HIV infection are based on the analysis of total peripheral blood mononuclear cells (PBMCs) composed of more than 12 cell subsets, including T cells, B cells, NK cells, and monocytes. To avoid the dilution of specific gene expression signals from specific cell subsets of different cells and thus the reduction in the specificity of this approach, the inventors used CD4+ T cells purified from PBMCs of four donors. CD4+ T cells were either uninfected or infected with the YU-2 strain, and after being untreated or treated with ABX464 for 6 days, high-throughput RNAseq was performed. Each raw dataset of the samples contained 44 million to 105 million single-terminal reads (50 bp), with an average of approximately 60 million raw reads per sample (Fig. 2a). More than 97% of the bases had a quality score of ≥ Q20. Approximately 98% of the total raw reads were mapped to the human genome sequence (GRCh38), providing an average of 60 million human reads per sample for further analysis. Reads correctly mapped to gene and transcriptome locations (GTF annotation file) (Fig. 2a) (approximately 98% of the total input reads) were subsequently analyzed using an in-house package set for transcriptome abundance normalization and evaluation. Multidimensional scaling analysis (MDS) is an unsupervised global analysis approach useful for reducing the dimensionality of gene expression data (Fig. 2b). MDS minimizes dimensions to preserve the distance between data points and allows multidimensional genetic data to be projected onto two or three new dimensions that account for most of the variance. Consequently, major trends in the data can be visually interpreted in terms of similarity between various data points.The MDS of the gene expression data showed that different donors were well separated and distributed across infected or uninfected DMSO (untreated) and ABX464 treatments without any outliers. The indicated variability was donor-dependent (clustered by donor) but treatment-independent (no data structures related to different treatments), suggesting that the ABX464 molecule did not cause major differences in CD4+ T cell gene expression (Fig. 2b).

[0659] To comprehensively evaluate alternative splicing events modulated by ABX464 in infected and uninfected CD4+ T cells, the inventors compared junction read counts derived from exon-exon boundaries across different samples (Fig. 2c). Although the alignment of reads to exon junctions was purely random, the inventors did not observe a gross difference in the total number of reads corresponding to exon-exon boundaries between treated and untreated CD4+ T cells across any sample, whether infected or uninfected (Fig. 2c). To provide a more statistically validated evaluation of alternative splicing in these CD4+ T cells, the inventors followed a differential splicing analysis method under various conditions called SUPPA (Ultra-fast pipeline for alternative splicing analysis). Alternative splicing events were classified into five major groups: alternative 5' splice site (A5SS), alternative 3' splice site (A3SS), alternative first and final exons (Alt exons), and retained exons (RI) (Fig. 2c). The "percent splicing index (psi)" score (Ψ-score) was calculated for each transcriptome variant of each sample. Using a strict cutoff, the Ψ-score difference from the untreated sample was fixed at 0.4, and the p-value was fixed at 0.05, which is considered significant for differential splicing events induced by treatment with ABX464. The number of significant events for each of the five possible AS events is presented in Fig. 2c and Table I. No switch-like events were detected, where the psi-score difference was exactly 1 or -1. The inventors next calculated the Ψ-scores of transcripts in uninfected CD4+ T cells versus infected CD4+ T cells (Fig. 2c). No switch-like events were detected in infected or uninfected T CD4+ samples compared to ABX464-treated samples (Fig. 2c).Although the exact number of common and differential splicing events between infected CD4+ T cells treated with ABX464 and uninfected CD4+ T cells was very low (fewer than 10 events, Table I), depletion of up to just 50% of NCBP1 (nuclear cap binding protein subunit 1), a component of CBC in stem cells, resulted in large fluctuations with 81 Alt exons, 12 A 5'SS, 10 A 3'SS, and 206 IR events (Fig. 2c). Since high levels of IR indicate that most unspliced ​​transcripts are degraded by nonsense-mediated decay (NMD), this suggested that the CBC complex is a key component in preventing the accumulation of unspliced ​​RNA. A comparison of exon coverage reads for B2M, a commonly highly expressed gene, between ABX464 and DMSO conditions in four donors indicated that ABX464 did not increase splicing events in B2M (Fig. 2d). In summary, ABX464 treatment did not induce alternative transcript splicing, and therefore ABX464 was not likely to dramatically alter gene expression in activated CD4+ T cells. Consistent with these results, FACS analysis of purified activated CD4+ T cells or PBMCs from 7 donors 6 days after ABX464 treatment showed no changes in the CCR6 / CXCR3 or CD45 / CCR7 subpopulations (Th17 / Th1 and effector memory cells, respectively) (Fig. 8).

[0660] Table I below lists splicing events in CD4 T cells: infected vs. uninfected (DMSO_I vs. DMSO), uninfected and treated with ABX464 vs. uninfected and untreated (464 vs. DMSO), and infected and treated with ABX464 vs. infected and untreated (464_I vs. DMSO_I).

[0661] [Table I]

[0662]

[0663]

[0664]

[0665] 3. ABX464 does not alter cell gene expression.

[0666] To determine whether ABX464 induced quantitative changes in the transcriptomes of infected cells, the inventors measured transcriptome levels from RNAseq data (see Fig. 6 for the pipeline). Over 60,000 distinct transcriptomes were detected in all samples. After counts per million normalized (CPM), transcriptomes from each sample were filtered with a coverage cutoff value of CPM > 5; that is, a gene was considered to be expressed in a sample if it had at least 5 counts for each million mapped reads in that sample. Since this experiment used four donors, four replicates were available for each condition (infected / uninfected cells with / without ABX464 treatment), and a gene was considered to be expressed if it had at least 5 counts for each million mapped reads in all replicates. Based on these selection criteria, the inventors concluded with a list of transcriptomes common to all samples, including 11,700 distinct transcriptomes with an average of about 3,000 raw counts per transcriptome. Overall expression plots for each donor were generated using the CPM values ​​of eligible genes. Under the mild infection conditions used in this study, the inventors did not detect strong changes in gene expression, and only 15 genes were downregulated in response to infection in untreated samples (top panel of Fig. 2e; Table II). ABX464 treatment resulted in the upregulation of 9 genes in infected samples, and 6 downregulated genes and 7 upregulated genes in uninfected samples (middle and bottom panels of Fig. 2e, respectively; Table II), demonstrating the mild effect of ABX464 treatment on gene expression (Fig. 2e). The 6 genes upregulated after ABX464 treatment were shared between infected and uninfected samples, suggesting that this upregulation was mediated by ABX464 treatment and was independent of infection. Three of the 6 genes, TOR1AIP2, SCML1, and PPP1R2, were 10-5 It had a p-value greater than 3 and a multiple change. Interestingly, TOR1AIP2, a protein considered to regulate intracellular trafficking as well as protein folding, has recently been shown to limit the late stages of HIV replication and may therefore be an effector of ABX464-induced changes.

[0667] Table II below lists the genes regulated in T CD4 cells: infected vs. uninfected (DMSO_I vs. DMSO), uninfected and treated with ABX464 vs. uninfected and untreated (464 vs. DMSO), and infected and treated with ABX464 vs. infected and untreated (464_I vs. DMSO_I). Upregulated genes are in bold and downregulated genes are in italics.

[0668] [Table II]

[0669]

[0670]

[0671]

[0672] 4. ABX464 upregulates miR-124.

[0673] The CBC complex targeted by ABX464 is involved in the biosynthesis of small non-coding RNAs; since previous comprehensive analyses have not included these, the inventors decided to evaluate whether miRNAs or small nuclear RNAs (snoRNAs) were differentially regulated by ABX464. The inventors performed microarray analysis on these RNAs from PBMCs from six donors. Cells treated with ABX464 after infection with the YU-2 strain were compared to uninfected and untreated controls. A total of 104 human miRNAs and 40 snoRNAs were significantly differentially expressed in infected PBMCs compared to uninfected PBMCs (data not provided), with an error detection rate of less than 0.05 and a fold change greater than 1.5. Cluster analysis demonstrated complete separation between infected and uninfected samples based on the expression profiles of the differentially expressed miRNAs (Fig. 3a). Although infection brought about these significant changes in the expression of small non-coding RNAs (Fig. 3a, left panel), ABX464 treatment induced reproducible upregulation of a single microRNA, miR-124, in infected and uninfected cells (Fig. 3a, middle and right panels, respectively). To confirm these results, the inventors used TaqMan Low Density Array (TLDA), another microRNA profiling method based on reverse transcription real-time PCR with screening capability for 760 miRNAs (Fig. 9a). Again, it was observed that only miR-124 was upregulated by ABX464. In addition, quantitative PCR of total RNA isolated from infected and uninfected PBMCs from five donors demonstrated that while infection led to a slight decrease in miR-124 expression (Fig. 3b, also seen in the full analysis in Fig. 3a), treatment with ABX464 resulted in significant upregulation of miR-124 in both infected and uninfected cells (Fig. 3b).Next, the inventors determined whether the observed miR-124 response to ABX464 treatment in PBMCs could be attributed to specific cell types. Using purified CD4+, CD8, and macrophage cells, the inventors found that ABX464 treatment resulted in the upregulation of miR-124 in lymphocyte cells (Fig. 3c) rather than in monocyte-derived macrophages, where miR-124 expression was not detected (Fig. 3c, Fig. 9b). Finally, the inventors demonstrated that this upregulation of miR-124 is specific to the ABX class of small molecules, as other antiretroviruses, e.g., maraviroc, efavirentz, darunavir, and AZT, did not upregulate miR-124 expression in PBMCs, whereas ABX530, a molecule with the same characteristics as ABX464, induced the upregulation of miR-124 to a similar degree as ABX464 (Fig. 3d).

[0674] In recent years, miR-124 has emerged as an important regulator of immunity and inflammation. miR-124 is known to be both a major regulator of microglia arrest and a regulator of monocyte and macrophage activation in the central nervous system. miR-124 also plays a significant role in both innate and adaptive immune responses. In particular, miR-124 has been shown to be an important mediator of cholinergic anti-inflammatory action by reducing the production of IL-6, TNF-α, and MCP-1. Interestingly, while IL-6, TNF-α, and MCP-1 were upregulated in commonly used DSS-induced experimental colitis mouse models, ABX464 reduced the expression of these pro-inflammatory cytokines. Sustained immune activation and systemic inflammation also play a pivotal role in the pathogenesis of HIV disease. Many HIV-infected individuals treated with antiretroviral therapy (ART) exhibit residual inflammation associated with non-AIDS-related morbidity and mortality. Based on the observed downregulation of miR-124 expression upon HIV infection of PBMCs or CD4+ T cells and the subsequent upregulation by ABX464 treatment, the inventors decided to investigate whether similar regulation of miR-124 expression occurred in HIV patients receiving antiretroviral therapy (ART). Since the chronic inflammatory status of patients receiving combination ART is primarily associated with the degree of damaged intestinal lymphocyte tissue, miR-124 expression was monitored in rectal biopsies of HIV-infected patients (N=9) who received ART and were treated with ABX464. miR-124 expression was downregulated in HIV patients treated with ART compared to expression in colon biopsies from healthy donors (N=10). Treatment with ABX464 for 28 days restored miR-124 expression to the level of healthy donors (Fig. 3e).When ABX464 treatment was discontinued for 28 days, miR-124 expression decreased to pre-treatment levels (Figs. 9c and d), indicating that the observed change in expression was particularly attributed to ABX464. Thus, ABX464 regulates miR-124 expression in both in vitro and in HIV patients.

[0675] 5. ABX464-induced splicing of a long non-coding RNA at the miR-124-1 locus results in the upregulation of miR-124.

[0676] miR-124 is encoded by three independent genes, miR-124-1, miR-124-2, and miR-124-3, located on human chromosomes 8 and 20 (Fig. 4a). To determine which of these genes is induced by ABX464, the inventors evaluated the full depth of the transcriptome using targeted RNA CaptureSeq. Using the increased sequencing depth of RNA CaptureSeq along with the initial transcriptome assembly, the inventors determined which loci were affected by ABX464 treatment (Figs. 4a and b). The inventors reconstructed all transcriptomes assembled within the pre-captured RNA-Seq data with similar transcriptional coverage uniformity (100% of the reconstructed transcriptome chains, Figs. 4a and b). The total number of reads for ABX464-treated samples as well as untreated samples varied between 2 million and 30 million in infected and uninfected PBMCs (Table V). The number of reads from the three loci encoding miR-124 in the treated samples was 4 to 12 times higher than in the untreated samples (Fig. 4b, Table V), confirming that ABX464 significantly increased miR-124. In contrast, ABX464 did not affect the expression of miR-429 located outside the miR-124 region (Fig. 4b), further demonstrating the specificity of ABX464 in targeting miR-124.

[0677] Most of the reads aligned in the 10-kb region of each locus originated from miR-124-1 and miR-124-3, whereas the number of reads aligned in miR-124-2 remained very low even after ABX464 treatment (Fig. 4b). The effect of ABX464 on miR-124 expression was most pronounced at the miR-124-1 locus (Fig. 4b). All reads mapped at the miR-124-1 locus of the treated samples are aligned with miR-124 and the surrounding 2kb region. Close examination of this region indicated that the miR-124 sequence is embedded in a long non-coding RNA (lncRNA 0599-205) at the miR-124-1 locus (Figs. 4a and c).

[0678] The sequencing depth of RNA CaptureSeq enabled the assembly of the original transcripts, which exhibited a complex array of splicing patterns. This approach demonstrated that the splicing of lncRNA 0599-205 was activated by ABX464 and that this splicing was absent in untreated samples (Figs. 4c and d). Most contices in the untreated samples aligned with unspliced ​​lncRNA 0599-205. Mapping the reads at the splice junctions (J1, J2, J3, and J4) and exon-exon junctions (J5 and J6) of this lncRNA enabled the quantification of spliced ​​and unspliced ​​RNA in the treated samples (Fig. 4d). After 8 days of treatment with ABX464, which was assumed to be sufficient time for the transcripts to reach steady-state levels, the levels of unspliced ​​RNA were 9-fold higher than those of spliced ​​RNA. Since spliced ​​RNA is more stable than unspliced ​​RNA, the inventors must consider that spliced ​​lncRNA 0599-205 is the source of miR-124 upregulation and is therefore less stable. Consistent with this prediction, the inventors found that R-124 production (reads mapped only to the 85bp miR-124 region) compensates for the lack of spliced ​​lncRNA 0599-205 (Fig. 4d).

[0679] Table V shows the read counts for the three genes encoding miR-124; mir124.1, mir124.2, and mir124.3 in untreated (D1_DMSO, D4_DMSO, D5_DMSO, D6_DMSO, D7_DMSO, and D8_DMSO) or ABX464-treated (D1_464, D4_464, D5_464, D6_464, D7_464, and D8_464) PBMCs.

[0680] [Table V]

[0681]

[0682] 6. Splicing of lncRNA 0599-205 is required for the production of miR-124.

[0683] To directly evaluate the contribution of lncRNA 0599-205 to the production of miR-124, the inventors cloned the genomic sequence of lncRNA 0599-205 from 9903167 to 9904210 of chromosome 8 into a plasmid vector (Fig. 5a). Both spliced ​​and unspliced ​​transcripts of lncRNA 0599-205 were readily detectable in transfected HeLa cells (Fig. 5b). However, the inventors could not detect upregulation of miR-124 in HeLa cells transfected in response to ABX464 treatment, as splicing is maximized in HeLa cells and the CBC complex affects the transcription site (Fig. 5b). Nevertheless, transient transfection of the plasmid into HeLa cells dramatically (1250-fold) increased miR-124 levels (Fig. 5c, left panel). In contrast, when the splice site of lncRNA 0599-205 is mutated, only trace amounts of miR-124 are detected (Fig. 5c, left panel). Consistent with the fact that unspliced ​​lncRNA 0599-205 is less stable, the amount of mutated lncRNA 0599-205 is lower than that of the wild type (Fig. 5c, right panel). Together, the results demonstrate that splicing of lncRNA 0599-205 is a prerequisite for the production of miR-124.

[0684] argument

[0685] This investigation provides novel insights into the mechanism of action of ABX464, which upregulates the anti-inflammatory miR-124 in treated UC patients and inhibits viral replication in HIV patients. ABX464 binds to CBC (ABIVAX, data within file), a complex that stimulates the treatment responses of capped RNA, including splicing, 3'-terminal formation, degradation, and transport. Given that CBC is considered to bind to all classes of m7G-capped RNA, including precursors and mature forms of mRNA, stable long non-coding RNA (lncRNA), non-denylated histone RNA, and precursors of spliciosome micronucleus RNA (snRNA), it is important to understand how the binding of ABX464 to the CBC complex achieves specificity. Splicing modifications of both HIV RNA and lncRNA 0599-205 are strongly induced by ABX464. The inventors do not know the reason for this. The weak splice site characterizing the two transcripts may lie in the origin of the induction of these splicing events by the ABX464-CBC complex. Most human protein-coding genes are spliced ​​unless they are degraded in the nucleus before being exported to the cytoplasm, and the translation of the precursor round is important for mRNA quality control in the cytoplasm. lncRNA 0599-205 will either degrade like any RNA in the cell or remain at the transcription site, as is the case for many long coding RNAs. The miR-124 sequence is located in the third exon of lncRNA 0599-205, which is also an unusual situation because most microRNAs are generally classified as "intergenetic" or "intronic" based on their genomic location. Intergenetic miRNAs are known to be transcribed as independent transcriptional units, while intronic miRNAs are processed from the introns of the hosting transcriptional unit and are considered to share common regulatory mechanisms and expression patterns with the host gene.Since ABX464 treatment did not induce any mutations in microRNAs other than miR-124 and there were few mutations in the expression of genes capable of hosting microRNAs, the inventors consider that ABX464-CBC interactions induce specific effects on viral RNA and miR-124 biogenesis. This latter claim is also supported by the fact that miR-124 is transcribed by three loci, but only the miR-124.1 locus is affected by ABX464 treatment, and splicing of lncRNA 0599-205 is also required for the production of miR-124 (Fig. 5).

[0686] Nuclear capping function is mediated by the proteins CBP80 and CBP20, which co-transcribeally bind to early RNA. CBP20 interacts directly with the m7G cap via the classical RNA recognition motif (RRM), whereas CBP80 ensures high-affinity binding of the entire CBC and provides a platform for interaction with other factors. The inventors demonstrated that by binding to CBC, ABX464 prevents the production of unspliced ​​viral RNA required for viral replication and induces the production of miR-124 from lncRNA-0599-205. However, ABX464 had a negligible effect on cell splicing. Therefore, ABX464 acts as a viral enhancer rather than a cell splicer. The binding of ABX464 can alter the conformation of CBC, enabling efficient interaction between CBP80 and splicing factors, thereby making the recognition of viral splicing sites more efficient. It is known that HIV RNA possesses a suboptimal splicing site that enables the inhibition of splicing of 9kb primary transcripts during the late stages of infection. In contrast, most cellular genes require splicing for expression, and unspliced ​​intron-containing transcripts are retained in the nucleus, where they are degraded. 50% depletion of NCBP1 leads to the upregulation of unspliced ​​IR transcripts, which confirms the effects of CBC on NMD. ABX464 confirms that viral HIV RNA is spliced ​​(since it is transcribed from integrated proviral DNA similar to any cellular gene), exported, and that unspliced ​​viral RNA is degraded (presumably by NMD). Since ABX464 does not alter any CBC function, it is not expected that ABX464 binds to the CBC complex and alters the cell's general RNA biogenesis. However, little is known about the CBC complex under HIV infection or immune cell activation.The discovery that ABX464 binds to CBC and induces specific changes in immune cells; the enhancement of miR-124 overexpression and HIV RNA splicing by regulating splicing 0599-205 long coding RNA will be of great help in understanding the relevance of CBC under HIV infection and inflammation.

[0687] Prediction of splice site strength using maximum entropy (MaxEnt) indicated that the 5' splice site between exon 2 and intron 2 of lncRNA 0599-205 is very weak compared to other splice sites (Table VI). Since unspliced ​​lncRNA 0599-205 cannot escape the nucleus due to quality control machinery and CBC-mediated control, spliced ​​lncRNA 0599-205 likely constitutes a miRNA storage form in addition to other functional characteristics of intact spliced ​​transcripts. This storage can be maintained through the low transcriptional and degradation activities of unspliced ​​lncRNA 0599-205, which can produce only low levels of mature miR-124 release under normal conditions. In fact, when lncRNA 0599-205 is not spliced, its fate is similar to other short transcripts and is sensitive to a CBC complex called CBC-NEXT, which promotes RNA degradation via nuclear RNA exosomes. Consistently, splicing of lncRNA 0599-205 is a prerequisite for the production of miR-124. Splicing of lncRNA 0599-205 is crucial for generating miR-124 by stabilizing the mature transcript for recognition by the microRNA processing machinery. Therefore, ABX464 treatment can enable the rapid release of large amounts of miR-124 through lncRNA 0599-205 splicing without requiring transcriptional activation of the lncRNA 0599-205 locus. In HIV patients, this may be the mechanism by which miR-124 is upregulated after treatment with ABX464 (Fig. 3e).

[0688] HeLa cells containing large amounts of splicing factors efficiently produce HIV viral RNA splicing products and large amounts of miR-124 from transfected HIV and lncRNA 0599-205 constructs, respectively. Therefore, ABX464 does not interfere with the normal function of CBCs in splicing, but makes it more efficient. Since viral but non-cellular genes require an unspliced ​​state for viral replication, and the splicing of lncRNA 0599-205 can affect miR-124 expression, ABX464 inhibits viral replication and induces anti-inflammatory miR-124 expression. Numerous studies in different cells and systems have revealed that miR-124 is an important regulator of inflammation and immune responses. The finding that ABX464 upregulates miR-124 expression in infected patients may be a major benefit in treating residual inflammation associated with non-AIDS-related morbidity and mortality in HIV patients. In many cases, miR-124 functions as a negative regulator of inflammatory signals, providing negative feedback that helps maintain homeostasis. Furthermore, ulcerative colitis patients treated with ABX464 also demonstrate an elevation of miR-124, presenting evidence of a strong and consistent efficacy signal of ABX464. Therefore, ABX464 is a small molecule with therapeutic potential for inflammatory diseases as well as HIV.

[0689] Table VI shows the prediction of splice site strengths using maximum entropy (MaxEnt). MAXENT scores for the 5' and 3' splice sites at the exon 1-intron 1-exon 2 (exon 1-exon 2 ss) and exon 2-intron 2-exon 3 (exon 2-exon 3 ss) boundaries.

[0690] [Table VI]

[0691]

[0692] order

[0693]

Claims

Claim 1 A composition for selecting a patient for therapeutic treatment of an inflammatory disease, disorder, or condition, comprising a reagent capable of measuring the expression level of miR-124, wherein the measured expression level of said miR-124 in an isolated biological sample is compared with a control reference value. Claim 2 In claim 1, the composition wherein the therapeutic treatment is a compound of Formula I or a pharmaceutically acceptable salt thereof: Formula I In the above formula, Z is C or N; V is C or N; is where V is C or N, and when V is N, V ​​represents an ortho, meta, or para aromatic ring with respect to Z; each R is independently hydrogen, halogen, -CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, -NO2, -NR1R2, (C1-C4)alkoxy, phenoxy, -NR1-SO2-NR1R2, -NR1-SO2-R1, -NR1-C(=O)-R1, -NR1-C(=O)-NR1R2, -SO2-NR1R2, -SO3H, -O-SO2-OR3, -OP(=O)-(OR3)(OR4), -O-CH2-COOR3, (C1-C3)alkyl, and the alkyl is a hydroxyl group or formula IIa The group of, or chemical formula IIIa Optionally uni- or bi-substituted with the group; Q is N or O, provided that if Q is O, R" is absent; R1 and R2 are each independently hydrogen or (C1-C3)alkyl; R3 and R4 are each independently hydrogen, Li + , Na + , K + , N + (Ra)4 or benzyl; n is 1, 2 or 3; n' is 1, 2 or 3; each R' is independently hydrogen, (C1-C3)alkyl, hydroxyl, halogen, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3)fluoroalkyl, (C1-C4)alkoxy, -OP(=O)-(OR3)(OR4), -CN, chemical formula IIa The group of, or chemical formula IIIa A group of; where, A is a covalent bond, oxygen, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4, or 5; p is 1, 2, or 3; Ra and Rb are each independently hydrogen, (C1-C5)alkyl, or (C3-C6)cycloalkyl, or Ra and Rb form a saturated pentatonic or hexacyclic heterocycle with the nitrogen atom to which they are attached, said heterocycle being optionally substituted by one or more Ra, provided that if R' is a group of formula IIa or IIIa, n' may be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa; and R' is hydrogen, (C1-C4)alkyl, or a group of formula IIa as defined herein. Claim 3 In paragraph 2, the composition wherein the compound is selected from formulas Ia to Id or pharmaceutically acceptable salts thereof: formula Ia ,chemical formula Ib ,chemical formula Ic ,chemical formula Ib' ,chemical formula Id ,where R, R', R'', n, and n' are as defined in paragraph 2, and R'" is hydrogen or group However, where A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3. Claim 4 In paragraph 3, the composition wherein the therapeutic treatment comprises the administration of a compound of formula Ib or Ib' or a pharmaceutically acceptable salt thereof: formula Ib ,chemical formula Ib' ,where R, R', R'', n, and n' are as defined in paragraph 3. Claim 5 A composition according to paragraph 2, wherein the compound is ABX464 or 8-chloro-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine, or a pharmaceutically acceptable salt thereof. Claim 6 In claim 1, the composition: Chemical Formula IV, wherein the therapeutic treatment is a compound of Chemical Formula IV or a pharmaceutically acceptable salt thereof. In the above formula, V is C or N; Z is C or N; is where V is C or N, and when V is N, V ​​represents an ortho, meta, or para aromatic ring with respect to Z; each R is independently hydrogen, halogen, -CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, -NO2, -NR1R2, (C1-C4)alkoxy, phenoxy, -NR1-SO2-NR1R2, -NR1-SO2-R1, -NR1-C(=O)-R1, -NR1-C(=O)-NR1R2, -SO2-NR1R2, -SO3H, -O-SO2-OR3, -OP(=O)-(OR3)(OR4), -O-CH2-COOR3, (C1-C3)alkyl, and the alkyl is a hydroxyl group or formula IIa The group of, or chemical formula IIIa Optionally uni- or ib-substituted with a group of; each R' is independently hydrogen, (C1-C3)alkyl, hydroxyl, halogen, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3)fluoroalkyl, (C1-C4)alkoxy, -OP(=O)-(OR3)(OR4), -CN, chemical formula IIa The group of, or chemical formula IIIa It is a group of; n is 1, 2, or 3; n' is 1, 2, or 3; where, R1 and R2 are each independently hydrogen or (C1-C3)alkyl; and R3 and R4 are each independently hydrogen, Li + , Na + , K + , N + (Ra)4 or benzyl; A is a covalent bond, oxygen, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4, or 5; p is 1, 2, or 3; Ra and Rb are each independently hydrogen, (C1-C5)alkyl, or (C3-C6)cycloalkyl, or Ra and Rb form a saturated pentagonal or hexacyclic heterocycle with the nitrogen atom to which they are attached, said heterocycle being optionally substituted by one or more Ras, provided that if R' is a group of formula IIa or IIIa, n' can be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa. Claim 7 In claim 6, the composition wherein the compound is selected from formula IVa to IVd or a pharmaceutically acceptable salt thereof: formula IVa ,chemical formula IVb ,chemical formula IVc ,chemical formula IVb' ,chemical formula IVd ,where R, R', n, and n' are as defined in paragraph 6, and R'" is hydrogen or group However, where A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3. Claim 8 An in vitro or in vitro method for providing information for selecting a patient for therapeutic treatment of an inflammatory disease, disorder or condition, wherein miR-124 is used as a biomarker for selecting a patient for therapeutic treatment of an inflammatory disease, disorder or condition, and the measured expression level of said miR-124 in an isolated biological sample is compared with a control reference value. Claim 9 In claim 8, the in vitro or in vitro method comprising the administration of a compound of formula I, Ia, Ib, Ib', Ic, Id, IV, IVa, IVb, IVb', IVc, or IVd or a pharmaceutically acceptable salt thereof: formula I ,chemical formula Ia ,chemical formula Ib ,chemical formula Ic ,chemical formula Ib' ,chemical formula Id ,Chemical formula IV ,chemical formula IVa ,chemical formula IVb ,chemical formula IVc ,chemical formula IVb' ,chemical formula IVd ,where,Z is C or N and;V is C or N and; is where V is C or N, and when V is N, V ​​represents an ortho, meta, or para aromatic ring with respect to Z; each R is independently hydrogen, halogen, -CN, hydroxyl, (C1-C3)fluoroalkyl, (C1-C3)fluoroalkoxy, (C3-C6)cycloalkyl, -NO2, -NR1R2, (C1-C4)alkoxy, phenoxy, -NR1-SO2-NR1R2, -NR1-SO2-R1, -NR1-C(=O)-R1, -NR1-C(=O)-NR1R2, -SO2-NR1R2, -SO3H, -O-SO2-OR3, -OP(=O)-(OR3)(OR4), -O-CH2-COOR3, (C1-C3)alkyl, and the alkyl is a hydroxyl group or formula IIa The group of, or chemical formula IIIa Optionally uni- or bi-substituted with the group; Q is N or O, provided that if Q is O, R" is absent; R1 and R2 are each independently hydrogen or (C1-C3)alkyl; R3 and R4 are each independently hydrogen, Li + , Na + , K + , N + (Ra)4 or benzyl; n is 1, 2 or 3; n' is 1, 2 or 3; each R' is independently hydrogen, (C1-C3)alkyl, hydroxyl, halogen, -NO2, -NR1R2, morpholinyl, morpholino, N-methylpiperazinyl, (C1-C3)fluoroalkyl, (C1-C4)alkoxy, -OP(=O)-(OR3)(OR4), -CN, chemical formula IIa The group of, or chemical formula IIIa A is a group of; A is a covalent bond, oxygen, or NH; B is a covalent bond or NH; m is 1, 2, 3, 4, or 5; p is 1, 2, or 3; Ra and Rb are each independently hydrogen, (C1-C5)alkyl, or (C3-C6)cycloalkyl, or Ra and Rb form a saturated pentatonic or hexacyclic heterocycle with the nitrogen atom to which they are attached, said heterocycle being optionally substituted by one or more Ra, provided that if R' is a group of formula IIa or IIIa, n' may be 2 or 3 only if the other R' group is different from the group of formula IIa or IIIa; R" is hydrogen, (C1-C4)alkyl, or a group of formula IIa as defined herein, and R'" is hydrogen or a group However, where A is O or NH, m is 2 or 3, and X1 is O, CH2 or N-CH3. Claim 10 In claim 9, an in vitro or in vitro method in which the therapeutic treatment comprises the administration of a compound of formula Ib or Ib': formula Ib ;Chemical formula Ib' ,where R, R', R'', n, and n' are as defined in Paragraph 9. Claim 11 An in vitro or in vitro method according to any one of claims 8 to 10, wherein the therapeutic treatment comprises the administration of ABX464 or 8-chloro-N-(4-(trifluoromethoxy)phenyl)quinoline-2-amine, or a pharmaceutically acceptable salt thereof. Claim 12 A composition according to any one of claims 1 to 7, wherein the biological sample is a biological fluid, a cell sample, a tissue biopsy, or a plurality of samples from a clinical trial. Claim 13 In any one of claims 8 to 10, the biological sample is a biological fluid, cell sample, tissue biopsy, or multiple samples from a clinical trial, in vitro or in vitro method. Claim 14 In paragraph 12, the biological fluid is a composition selected from the group consisting of biological tissue samples, whole blood samples, swab samples, plasma samples, serum samples, saliva samples, vaginal fluid samples, sperm samples, pharyngeal fluid samples, bronchial fluid samples, excretory samples, cerebrospinal fluid samples, tear fluid samples, and tissue culture supernatant samples. Claim 15 In paragraph 13, the biological fluid is selected from the group consisting of biological tissue samples, whole blood samples, swab samples, plasma samples, serum samples, saliva samples, vaginal fluid samples, sperm samples, pharyngeal fluid samples, bronchial fluid samples, excretory samples, cerebrospinal fluid samples, tear fluid samples, and tissue culture supernatant samples, in vitro or in vitro method. Claim 16 A composition according to any one of claims 1 to 7, wherein the biological sample is blood. Claim 17 In any one of paragraphs 8 to 10, the biological sample is blood, in vitro or in vitro method. Claim 18 A composition according to any one of claims 1 to 7, wherein the control reference value is measured in a control sample taken from a set of normal, disease-free members, or in a control sample taken from a patient prior to treatment. Claim 19 In any one of claims 8 to 10, the control reference value is measured in an in vitro or in vitro method, from a control sample taken from a set of normal, disease-free members, or from a control sample taken from a patient prior to treatment. Claim 20 A composition according to any one of claims 1 to 7, wherein the inflammatory disease, disorder, or condition is an inflammatory disorder selected from the group consisting of rheumatoid arthritis, asthma, chronic obstructive pulmonary disease, psoriasis, hepatomegaly, Crohn's disease, ulcerative colitis, ankylosing spondylitis, axial spondyloarthritis, primary biliary cirrhosis, polymyalgia rheumatica, giant cell arteritis, or inflammatory bowel disease. Claim 21 In any one of claims 8 to 10, the inflammatory disease, disorder, or condition is an inflammatory disorder selected from the group consisting of rheumatoid arthritis, asthma, chronic obstructive pulmonary disease, psoriasis, hepatomegaly, Crohn's disease, ulcerative colitis, ankylosing spondylitis, axial spondylitis, primary biliary cirrhosis, polymyalgia rheumatica, giant cell arteritis, or inflammatory bowel disease, in vitro or in vitro method. Claim 22 delete Claim 23 delete Claim 24 delete Claim 25 delete Claim 26 delete Claim 27 delete

Images