Method for control of translation using dead-Cas13d in bacteria

Abstract

The present invention relates to a method for regulating translation in bacteria. It was verified that by constructing a dCas13d-based CRISPR interference system capable of specifically binding to RNA in bacteria, the nucleotides in the stem, bulge, and flanking sequence regions of the guide RNA are substituted with other nucleotides to alter the binding efficiency between dCas13d and the guide RNA, thereby enabling the wide application of this method to regulate the degree of inhibition of translation of mRNA to which dCas13d binds in various target genes. Through this, the production of target substances can be optimized without directly replacing promoter and 5'-UTR sequences within the genome, and it can be applied to non-model strains where it is difficult to directly modify the genome.

Description

Technology Field

[0001] The present invention relates to a method for regulating translation in bacteria, and more specifically, to a method for multi-level regulating translation in bacteria based on the use of dead-Cas13d (dCas13d, hereinafter referred to as dCas13d). Background Technology

[0002] In the case of Cas13, which activates non-specific RNA degradation ability upon binding to a DNA sequence complementary to guide RNA, it has demonstrated the ability to specifically degrade only target RNA in some mammalian cells; however, in bacterial cells, it induces a state of dormancy by non-specifically degrading intracellular RNAs. Cas13 is classified phylogenetically into Cas13a, Cas13b, Cas13c, and Cas13d. It has recently been confirmed that dead Cas13a (dCas13a), in which the amino acid sequence associated with the non-specific RNA degradation mechanism is substituted with alanine, can suppress the expression of the corresponding gene at the translation level without degradation of other intracellular RNAs when specifically binding to the translation start sequence of mRNA.

[0003] dCas13a has limitations in the field of metabolic engineering, where precise control of gene expression is required, because technology capable of suppressing gene expression at various levels in bacteria has not been developed. This is because when attempting to increase the production of a specific substance by inhibiting a byproduct production pathway, if the byproduct pathway is related to cell growth, removing or excessively suppressing the gene can actually hinder cell growth and impair the ability to produce the substance.

[0004] Therefore, there is a need to develop a technology that enables precise control at the translation stage while overcoming the limitations of CAS proteins used in conventional CRISPR interference systems, even though they belong to the Cas13 group. Prior art literature

[0005] Korean Registered Patent No. 10-2422842 (Registration Date: July 14, 2022) describes a CRISPR technology that targets the RNA of a target gene, stating that because the RNA is targeted to inhibit its function or to inhibit gene expression through translation interference, it is a technology capable of targeting a single gene rather than the entire operon. Korean Published Patent No. 10-2023-0009285 (Publication Date: January 17, 2023) describes a method for regulating or editing RNA expression through chemical or optogenetic regulation of Cas13 protein activity, stating that in order to regulate the activity of Cas13 in a CRISPR-Cas13 system, fragments of the Cas13 protein are generated to enable recombination, and a protein capable of chemical or optogenetic binding is attached to each fragment so that the Cas13 protein can be activated by treatment with a small molecule compound or light irradiation. It is listed. The problem to be solved

[0006] We sought to devise a new method to overcome the limitations of CAS proteins used in conventional CRISPR interference systems, and to construct a dCas13d-based CRISPR interference system capable of inhibiting the translation step by binding to messenger RNA (mRNA) to control the intensity of translation regulation at various levels. means of solving the problem

[0007] The present invention provides a target gene expression kit characterized by comprising: a gene encoding a guide RNA of RfxCas13d in which one or more of the nucleotides in the stem, bulge, and flanking sequence regions among the nucleotides constituting the guide RNA of RfxCas13d are substituted with a nucleotide other than the wild type; and a gene encoding a dCas13d protein with non-specific RNA degradation activity removed.

[0008] Meanwhile, in the target gene expression kit of the present invention, the target gene is preferably one of the genes constituting an operon.

[0009] Meanwhile, in the target gene expression kit of the present invention, the target gene expression is preferably controlled by controlling the translation process to control the expression of the target gene. Effects of the invention

[0010] The present invention verified that a dCas13d-based CRISPR interference system capable of specifically binding to RNA in bacteria can be widely used to regulate the degree of inhibition of translation of mRNA bound to dCas13d in various target genes by constructing a system that specifically binds to RNA in bacteria and changing the binding efficiency between dCas13d and guide RNA by substituting nucleotides in the stem, bulge, and flanking sequence regions of the guide RNA with other nucleotides. Through this, the production of target substances can be optimized without directly replacing promoter and 5'-UTR sequences within the genome, and it can be applied to non-model strains where it is difficult to directly modify the genome. Brief explanation of the drawing

[0011] Figure 1 is a schematic diagram showing the RNA secondary structure of a direct repeat sequence (DR) of guide RNA. Figure 2 shows the results of confirming mCherry expression using variant guide RNAs. Figure 3 shows the results of confirming the expression of GFP or nanoluciferase using variant guide RNAs. Fig. 4 is Vibrio natriegens This is the result confirming the extent to which the mutated guide RNA regulates the translation level of the target protein, mCherry. Figure 5 shows the results of confirming the production of 3-HP following the repression of translation and decrease in expression of the gene of the corresponding pathway by utilizing the dRfxCas13d-based translation regulation technology of the present invention in the pathway that produces 3-hydroxypropionic acid (3-HP). Figure 6 shows a schematic diagram of the dRfxCas13d-based translation control technology of the present invention. Specific details for implementing the invention

[0012] The present invention provides a target gene expression kit characterized by comprising: a gene encoding a guide RNA of RfxCas13d in which one or more of the nucleotides in the stem, bulge, and flanking sequence regions among the nucleotides constituting the guide RNA of RfxCas13d are substituted with a nucleotide other than the wild type; and a gene encoding a dCas13d protein with non-specific RNA degradation activity removed.

[0013] In the present invention, various variant guide RNAs were obtained by substituting one or more nucleotides in the stem, bulge, and flanking sequence regions among the nucleotides constituting the guide RNA of RfxCas13d with nucleotides other than the wild type. Through this, by changing the binding efficiency between the dCas13d and the guide RNA, the expression of the target gene can be controlled by adjusting the degree of inhibition of translation of mRNA to which dCas13d binds in various target genes.

[0014] Meanwhile, in the present invention, the stem belonging to the structure of the nucleotides constituting the guide RNA refers to the portion forming base pairing, the portion extending beyond the base pairing is referred to as the bulge, and a single outside the stem The portion forming a single strand can be viewed as a flanking sequence. These terms are common concepts in the industry and can be verified in relevant papers (Mitchell R. O'Connell, "Molecular Mechanisms of RNA Targeting by Cas13-containing Type VI CRISPR-Cas Systems", 2019, Journal of Molecular Biology, Vol.431, pages 66-87).

[0015] In the target gene expression kit of the present invention, a gene encoding a guide RNA of RfxCas13d in which one or more of the nucleotides in the stem, bulge, and flanking sequence regions among the nucleotides constituting the guide RNA of RfxCas13d are substituted with a nucleotide other than the wild type; and a gene encoding a dCas13d protein with non-specific RNA degradation activity removed are preferably inserted into separate vectors, respectively.

[0016] In this invention, Cas13 was selected, which activates non-specific RNA degradation ability when bound to a target RNA having a sequence complementary to the guide RNA. Although Cas13 is classified into Cas13a, Cas13b, Cas13c, and Cas13d, 'Cas13d' was specifically used. This overcomes the limitations of previously known dead Cas13a (dCas13a, in which the amino acid sequence related to the non-specific RNA degradation mechanism is substituted with alanine), as technology capable of suppressing gene expression at various levels in bacteria has not been developed, making it unsuitable for use in the field of metabolic engineering requiring precise control of gene expression. In other words, existing technologies have limitations because when attempting to increase the production of a specific substance by inhibiting byproduct pathways, removing or excessively suppressing the gene can actually hinder cell growth and impede the substance's production capacity if the corresponding byproduct pathway is related to cell growth; this invention overcomes these limitations.

[0017] Accordingly, in the present invention, a dead RfxCas13d (dRfxCas13d) with the non-specific RNA degradation activity removed was used as the dCas13d protein with the non-specific RNA degradation activity removed from RfxCas13d (CasRx), a type of Cas13d, and by constructing a CRISPR interference system based on this, Cas13-based gene expression inhibition can be implemented at various levels.

[0018] In the present invention, the target gene is a gene intended for transcription or expression, and is not limited to any gene that requires expression in a host strain from a metabolic engineering perspective.

[0019] Meanwhile, in the method of the present invention, the bacteria are not limited to any type known in the art, but as an example, a representative Gram-negative bacterium E.coli It can be a marine microorganism belonging to Gram-negative bacteria. Vibrio natriegens It may be. In the present invention, the above-mentioned translation control system is a representative Gram-negative bacterium E.coli yes Vibrio natriegens It was confirmed that this can be applied to various strains, as it was possible to precisely control the mRNA translation level in this case as well.

[0020] Meanwhile, according to the following experiment, the dRfxCas13d-based CRISPRi system of the present invention was able to regulate the intensity of expression control of various target genes by utilizing various variant guide RNAs, and this E.coli yes Vibrio natriegens It was also possible to implement it, and furthermore, it could be used to optimize material flow to increase the production of the target substance by utilizing it to regulate the expression level of genes corresponding to intracellular metabolism.

[0021] As such, the present invention is a technology that constructs a dCas13d-based CRISPR interference system and, by changing the binding efficiency between dCas13d and a guide RNA, which can inhibit translation by binding to the translation initiation sequence of mRNA transcribed from a gene, can control the degree of inhibition of translation of mRNA bound to dCas13d for various target genes (Fig. 6). Unlike existing CRISPRi systems, this system does not require promoter components of various transcription intensities to control the intensity of translation inhibition, so it has the advantage of being easily utilized for diversifying gene expression levels even in non-model strains where the discovery and identification of gene components are limited. In addition, since it does not alter the guide RNA spacer sequences that determine the target RNA sequences, it has the advantage of being able to change only the intensity of inhibition while maintaining specificity for the mRNA to be inhibited.

[0022] By utilizing such technology, it is possible to contribute to research that quantitatively controls the translation stage in not only Gram-negative bacteria but also various industrially available Gram-negative bacteria, and applies this to the optimization of high-value-added material production.

[0024] The contents of the present invention will be explained in more detail below through the following examples and experimental examples. However, the scope of the present invention is not limited to the following examples and experimental examples, but includes variations of equivalent technical concepts.

[0025] Tables 1 to 3 below show the strains, plasmids, primers, and gene information used in the following embodiments and experimental examples of the present invention.

[0026] Strains and plasmids used strain name Related features source Mach-T1 R E. coliF- 80(lacZ)ΔM15 ΔlacX74 hsdR(rK-mK+)ΔrecA1398 endA1 tonA Invitrogen Escherichia coli K-12 MG1655 P OXB20 -mCherry E. coli F- lambda- ilvG - rfb -50 rph -1 P OXB20 -mCherry The present invention Escherichia coli K-12 MG1655 P J23119 -GFP E. coli F- lambda- ilvG - rfb -50 rph -1 P J23119 -GFP The present invention Escherichia coli K-12 MG1655 P J23100 -nanoluciferase E. coli F- lambda- ilvG - rfb -50 rph -1 P J23100 -nanoluciferase The present invention Vibrio natriegens ATCC 14048 Gram-negative marine bacteria ATCC Escherichia coli WATCC 9637 Acid tolerant E. coli strain ATCC Plasmid name Related features source pACYCDuet Cm R , p15A origin Novagen pACYC_TetR tetR, Cm R , p15A origin The present invention pACYC_TetR-dRfxCas13d tetR , dRfxCas13d, Cm R , p15A origin The present invention pCDF-J23119-sgRNA-BsaI sgRNA(BsaI site(x2)), Sm R , CloDF13 origin Prior research pCDF_J23119-WTDR-BsaI(non-target) RfxcrRNA(WTDR-BsaI site(x2)), Sm R , CloDF13 origin The present invention pCDF_J23119-WTDR-mCherry sp RfxcrRNA(WTDR-mCherry sp), Sm R , CloDF13 origin The present invention pCDF_J23119-WTDR-GFP sp RfxcrRNA(WTDR-GFP sp), Sm R , CloDF13 origin The present invention pCDF_J23119-WTDR-nluc sp RfxcrRNA(WTDR-nluc sp), Sm R , CloDF13 origin The present invention pCDF_J23119-WTDR-fabI sp RfxcrRNA(WTDR-fabI sp), Sm R , CloDF13 origin The present invention pSIM5 lambda-red recombinase expression vector, Cm R Prior research pACYC_TetR-dRfxCas13d_TJmT100 tetR , dRfxCas13d, P J23100 -mCherry, Cm R , p15A origin The present invention pACYC_TetR-dRfxCas13d_TJmT100_DRXYY(XYY=S12, S15, S19, S22, S25, F01)-mCherry sp tetR , dRfxCas13d, P J23100 -mCherry, RfxcrRNA(DRXYY-mCherry sp), Cm R , p15A origin The present invention pCDF_J23119-DRXYY(XYY=S01~S29, F01~F09, B01~B06)-mCherry sp RfxcrRNA(DRXYY-mCherry sp), Sm R , CloDF13 origin The present invention pCDF_J23119-DRXYY(XYY=S12, S14, S15, S16, S17, S19, S25, F01)-GFP sp RfxcrRNA(DRXYY-GFP sp), Sm R , CloDF13 origin The present invention pCDF_J23119-DRXYY(XYY=S12, S14, S15, S16, S17, S19, S25, F01)-nluc sp RfxcrRNA(DRXYY-nluc sp), Sm R , CloDF13 origin The present invention pCDF_J23119-DRXYY(XYY=S10, S12, S15, S19, S22)-fabI sp RfxcrRNA(DRXYY-fabI sp), Sm R , CloDF13 origin The present invention pET_Ptac-mcr malonyl-CoA reductase, Amp R , pBR322 origin The present invention

[0028] Primer sequences used 1 (listed as part of the FR set) Primer name order Sequence information TetR_BciVI_F TCGTCGTATCCCACTACggaTCCttcattatggtgaaagttggaac Sequence No. 1 Ptet_RBS_GA_R gataaagacctcctaattttgaattcttgtcGACttctctatcactgatagggag Sequence No. 2 rrnBT1_RBS_F aagaattcaaaattaggaggtctttatcgagctctaaggatctccaggcatc Sequence No. 3 rrnBT1_pACYC_GA_R TGCTTCTCAAATGCCTGAGGgagagcgttcaccgacaaac Sequence No. 4 mCherrysp_BsaI_F / mCherrysp_BsaI_R aaacCCATATAAACCCTCCCTTTTCCGACACTCCT / cttgAGGAGTGTCGGAAAAGGGAGGGTTTATATGG Sequence No. 5 / Sequence No. 6 GFPsp_BsaI_F / GFPsp_BsaI_R aaacATGCCATAAATTACCTCCTTAAGATTCCTGA / cttgTCAGGAATCTTAAGGAGGTAATTTATGGCAT Sequence No. 7 / Sequence No. 8 nlucsp_BsaI_F / nlucsp_BsaI_R aaacCCATTAATACCTCCTCTATCCACTCGCGAAG / cttgCTTCGCGAGTGGATAGAGGAGGTATTAATGG Sequence No. 9 / Sequence No. 10 fabIsp_BsaI_F / fabIsp_BsaI_R aaacGAAAACCCATAGCTTTAATCCTT / cttgAAGGATTAAAGCTATGGGTTTTTC Sequence No. 11 / Sequence No. 12 RfxCas13d_matureRNA_BsaI_F / RfxCas13d_matureRNA_BsaI_R GGAGACCGAGATTGGTCTCGcaagTTTTCCTCAGGCATTTGAGAAGC / gtttcaaaccccgaccagttggtaggggttgctagcattatacctaggactgagc Sequence No. 13 / Sequence No. 14 L3S2P21_Bsu36I_F TTTTCCTCAGGCTCGGGACCAAATTCCAG Sequence number 15 L3S2P21_AgeI_R GTTTACCGGTggaccaaaacgaaaaaaggc Sequence number 16 mCherrysp_blunt_F CATATAAACCCTCCCTTTTCCG Sequence number 17 GFPsp_blunt_F ATGCCATAAATTACCTCCTTAAGATTC Sequence number 18 nlucsp_blunt_F CCATTAATACCTCCTCTATCCACTC Sequence No. 19 fabIsp_blunt_F GAAAACCCATAGCTTTAATCCTT Sequence number 20 PJ23119_DRS01_R gtttcaaaTcccgaccagttggtagggAttGCTAGCATTATACCTAGGACTGAGC Sequence number 21 PJ23119_DRS02_R gtttcaaaTTccgaccagttggtaggAAttGCTAGCATTATACCTAGGACTGAGC Sequence number 22 PJ23119_DRS03_R gtttcaaaTTTcgaccagttggtagAAAttGCTAGCATTATACCTAGGACTGAGC Sequence number 23 PJ23119_DRS04_R gtttcaaaTTTTgaccagttggtaAAAAttGCTAGCATTATACCTAGGACTGAGC Sequence No. 24 PJ23119_DRS05_R gtttcaaaccgaccagttggtaggttGCTAGCATTATACCTAGGACTGAGC Sequence number 25 PJ23119_DRS06_R gtttcaaacccgaccagttggtagggttGCTAGCATTATACCTAGGACTGAGC Sequence number 26 PJ23119_DRS07_R gtttcaaaccccggaccagttggtacggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 27 PJ23119_DRS08_R gtttcaaaccccgggaccagttggtaccggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 28 PJ23119_DRS09_R gtttcaaaccccggggaccagttggtacccggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 29 PJ23119_DRS10_R gtttcaaacccTgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 30 PJ23119_DRS11_R gtttcaaaccTcgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence No. 31 PJ23119_DRS12_R gtttcaaacTccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence No. 32 PJ23119_DRS13_R gtttcaaaTcccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 33 PJ23119_DRS14_R gtttcaaaccTTgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence No. 34 PJ23119_DRS15_R gtttcaaacTTcgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 35 PJ23119_DRS16_R gtttcaaaTTccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 36 PJ23119_DRS17_R gtttcaaacTTTgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 37 PJ23119_DRS18_R gtttcaaaTTTcgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 38 PJ23119_DRS19_R gtttcaaaTTccgaccagttggtaggggAtGCTAGCATTATACCTAGGACTGAGC Sequence number 39 PJ23119_DRS20_R gtttcaaGTTccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 40 PJ23119_DRS21_R gtttcaaaTcccgaccagttggtaggggAAGCTAGCATTATACCTAGGACTGAGC Sequence number 41 PJ23119_DRS22_R gtttcaGGTcccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence No. 42

[0029] Primer sequence 2 used Primer name order Sequence information PJ23119_DRS23_R gtttcaaaTTTTgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence No. 43 PJ23119_DRS24_R gtttcaaacTTTgaccagttggtagggAttGCTAGCATTATACCTAGGACTGAGC Sequence No. 44 PJ23119_DRS25_R gtttcaaaTTTcgaccagttggtaAgggttGCTAGCATTATACCTAGGACTGAGC Sequence number 45 PJ23119_DRS26_R gtttcaaaTTTcgaccagttggtaggggAtGCTAGCATTATACCTAGGACTGAGC Sequence number 46 PJ23119_DRS27_R gtttcaaGTTTcgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 47 PJ23119_DRS28_R gtttcaaaTTccgaccagttggtaggggAAGCTAGCATTATACCTAGGACTGAGC Sequence number 48 PJ23119_DRS29_R gtttcaGGTTccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 49 PJ23119_DRF01_R gtttcTaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 50 PJ23119_DRF02_R gtttcCaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 51 PJ23119_DRF03_R gtttcGaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence No. 52 PJ23119_DRF04_R gtttTaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 53 PJ23119_DRF05_R gtttAaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 54 PJ23119_DRF06_R gtttGaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 55 PJ23119_DRF07_R gttAcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 56 PJ23119_DRF08_R gttCcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 57 PJ23119_DRF09_R gttGcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 58 PJ23119_DRF10_R gtAtcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 59 PJ23119_DRF11_R gtCtcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 60 PJ23119_DRF12_R gtGtcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 61 PJ23119_DRF13_R gAttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 62 PJ23119_DRF14_R gCttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 63 PJ23119_DRF15_R gGttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 64 PJ23119_DRF16_R TtttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 65 PJ23119_DRF17_R AtttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 66 PJ23119_DRF18_R CtttcaaaccccgaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 67 PJ23119_DRB01_R gtttcaaaccccgaccagttggtTggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 68 PJ23119_DRB02_R gtttcaaaccccgaccagttggtCggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 69 PJ23119_DRB03_R gtttcaaaccccgaccagttggtGggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 70 PJ23119_DRB04_R gtttcaaaccccTaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 71 PJ23119_DRB05_R gtttcaaaccccAaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 72 PJ23119_DRB06_R gtttcaaaccccCaccagttggtaggggttGCTAGCATTATACCTAGGACTGAGC Sequence number 73 TJmT_pACYC_GA_F GGTATCGTCGTATCCCACTACggaTCCTGCCATTGCGTGTGTCGAAC Sequence number 74 mCherryRBS_J23100_GA_R CGTCTGCtggactatgtACTAGTttgacggctagctcagtcctaggtacagtgctagcAGAAGGAGTGTCGGAAAAGG Sequence number 75 TJmT_Pr_GA_F ACTAGTacatagtccaGCAGACG Sequence number 76 L3S2P21_TJmT_GA_R gaaagtgggtcttaagacgtcAGAATCATATACCCTGGCTCG Sequence number 77 L3S2P21_pACYC_GA_R GGTATCGTCGTATCCCACTACggaTCCggaccaaaacgaaaaaaaggc Sequence number 78 UPJ23119_TJmT_GA_F CGGTCACACTGCTTCCGGTAGTctGGTACCgcgcgcctcaaaaagagtaTTG Sequence number 79 Ptac_EcoNI_F / mcr_AvrII_R acgctctcccttatgcgactcctgcattaggttgacaattaatcatcggctcg / gttattgctcagcggtggcagcagcctaggTTACACGGTAATCGCCCGTC Sequence No. 80 / Sequence No. 81

[0030] Spacer sequence used mCherry sp ccatataaaccctcccttttccgacactcct Sequence number 82 GFP sp atgccataaattacctccttaagattcctga Sequence number 83 nluc sp ccttaatacctcctctatccactcgcgaag Sequence number 84 fabI sp gaaaacccatagctttaatcctt Sequence number 85

[0031] Gene sequences used gene note dRfxCas13d Sequence number 86 mcherry Sequence number 87 GFP Sequence number 88 nanoluciferase Sequence number 89 mcr Sequence number 90

[0033] [Example 1: Construction of guide RNA variants for constructing a dCas13d-based translation precision control CRISPRi system]

[0034] In this embodiment, dead RfxCas13d (dRfxCas13d), in which the non-specific RNA degradation activity of RfxCas13d (CasRx), a type of Cas13d, was removed, was utilized.

[0035] First, to conditionally activate the expression of the corresponding CRISPR protein only upon the addition of anhydroustetracycline (aTc), we intended to clone the dRfxCas13d sequence downstream of the Ptet promoter. After restricting the pACYCDuet plasmid with BciVI and Bsu36I, TetR_BciVI_F and Ptet_RBS_GA_R Amplified using primer tetR -Ptet sequence and rrnBT1_RBS_F, rrnBT1_pACYC_GA_R The pACYC_TetR plasmid was constructed by Gibson assembly of the rrnBT1 terminator sequence amplified using primers. Subsequently, the pACYC_TetR-dRfxCas13d plasmid was constructed by cloning the dRfxCas13d sequence, amplified with RfxCas13d_NTD_GA_F and RfxCas13d_CTD_GA_R primers at the SacI enzyme site between the Ptet promoter and the terminator, using Gibson assembly. In order to express the guide RNA as the J23119 promoter on a plasmid with a CloDF13 replication origin, the pCDF-J23119-sgRNA-BsaI plasmid was amplified with RfxCas13d_matureRNA_BsaI_F and RfxCas13d_matureRNA_BsaI_R and then self-ligated, and the L3S2P21 sequence was cloned between the Bsu36I and AgeI enzyme sites as the terminator. After treating the pCDF-J23119-WTDR-BsaI plasmid constructed in this manner with BsaI restriction enzyme, various spacer sequences were cloned by constructing spacer sequence fragments having identical 4bp sticky ends at both ends using PNK treatment and oligo annealing. Based on the pCDF_J23119-WTDR-mCherry sp plasmid, which contains a spacer that binds to the 5'-untranslated region (UTR) sequence of mCherry mRNA, guide RNAs were constructed with mutations applied to the direct repeat (DR) sequence of the guide RNA, which is the binding site between the guide RNA and dCas13d. As shown in Figure 1, the RNA secondary structure of the DR can be divided into three structures: stem, bulge, and flanking sequence. In the case of the stem, mutations were applied to either change only the sequence while maintaining the structure or to change the secondary structure itself.All applicable variant sequences were applied to both bulge sequences and flanking sequences.

[0036] A plasmid containing the cloned original guide RNA was PCR amplified using a pair of primers—one binding to the J23119 sequence and having a variant DR sequence, and the other binding to the spacer sequence of the guide RNA—and subsequently subjected to blunt end ligation. All plasmids of the present invention are Mach-T1 R It was cloned from the strain and cultured at 37°C with the addition of appropriate concentrations of antibiotics (Spectinomycin (Spec) 50 µg / mL, Chloramphenicol (Cm) 34 µg / mL). Plasmid extraction was performed using the GeneAll Exprep™ Plasmid SV, mini kit after incubating colonies overnight for at least 12 hours. The mCherry protein, the translation inhibition target, was P OXB20 It was made to be continuously expressed downstream of the promoter, and the expression cassette was utilized as a pSIM5 plasmid-based lambda-red recombinase system Escherichia coli of the K-12 MG1655 strain nupG It was inserted into the gene region.

[0038] [Experimental Example 1: Verification of Diversification of Target Gene Expression Regulation Levels and Modularity]

[0039] In this experimental example, the expression level of mCherry fluorescent protein when a guide RNA having a spacer sequence that does not bind to separate mRNA is expressed was set to 100%, and from this value, the relative value of the fluorescence expression level when controlling the translation of mCherry mRNA using the mutant guide RNAs prepared in Example 1 was obtained. After overnight culture of a strain transformed with the pACYC_TetR-dRfxCas13d plasmid and the pCDF plasmid expressing the mutant guide RNA in LB medium supplemented with Spec and Cm, dRfxCas13d was expressed by diluting it to a 1 / 100 ratio and adding 100 ng / mL of aTc, and the mCherry fluorescence value of the liquid medium was measured using a HIDEX Sense plate reader after 8 hours.

[0040] As a result, as shown in Table 6 and Figure 2, using non-mutated guide RNAs resulted in a significant decrease in expression to 3.5% compared to the non-repressed control group, whereas using the constructed mutant guide RNAs allowed for the expression of mCherry, a translation control target gene, to be achieved at varying levels ranging from 2.6% to 86.3% compared to the non-repressed control group. Based on these results, mutant repeat sequences with different expression inhibition intensities were selected to verify whether the expression of other genes, in addition to mCherry, could also be regulated at various levels.

[0041] DR Name order Sequence information Relative fluorescence value (%) DRS01DRS02DRS03DRS04DRS05DRS06DRS07DRS08DRS09DRS10DRS11DRS12DRS13DRS14DRS15DRS16DRS17DRS18DRS19DRS20DRS21DRS22DRS23DRS24DRS25DRS26DRS27DRS28DRS29 aaTccctaccaactggtcgggAtttgaaacaaTTcctaccaactggtcggAAtttgaaacaaTTTctaccaactggtcgAAAtttgaaacaaTTTTtaccaactggtcAAAAtttgaaacaacctaccaactggtcggtttgaaacaaccctaccaactggtcgggtttgaaacaaccccgtaccaactggtccggggtttgaaacaaccccggtaccaactggtcccggggtttgaaacaaccccgggtaccaactggtccccggggtttgaaacaacccctaccaactggtcAgggtttgaaacaacccctaccaactggtcgAggtttgaaacaacccctaccaactggtcggAgtttgaaacaacccctaccaactggtcgggAtttgaaacaacccctaccaactggtcAAggtttgaaacaacccctaccaactggtcgAAgtttgaaacaacccctaccaactggtcggAAtttgaaacaacccctaccaactggtcAAAgtttgaaacaacccctaccaactggtcgAAAtttgaaacaTcccctaccaactggtcggAAtttgaaacaacccctaccaactggtcggAACttgaaacTTcccctaccaactggtcgggAtttgaaacaacccctaccaactggtcgggACCtgaaacaacccctaccaactggtcAAAAtttgaaacaaTccctaccaactggtcAAAgtttgaaacaacccTtaccaactggtcgAAAtttgaaacaTcccctaccaactggtcgAAAtttgaaacaacccctaccaactggtcgAAACttgaaacTTcccctaccaactggtcggAAtttgaaacaacccctaccaactggtcggAACCtgaaac Sequence No. 91 Sequence No. 92 Sequence No. 93 Sequence No. 94 Sequence No. 95 Sequence No. 96 Sequence No. 97 Sequence No. 98 Sequence No. 99 Sequence No. 100 Sequence No. 101 Sequence No. 102 Sequence No. 103 Sequence No. 104 Sequence No. 105 Sequence No. 106 Sequence No. 107 Sequence No. 108 Sequence No. 109 Sequence No. 110 Sequence No. 111 Sequence No. 112 Sequence No. 113 Sequence No. 114 Sequence No. 115 Sequence No. 116 Sequence No. 117 Sequence No. 118 Sequence No. 119 3.503.343.393.8586.252.676.1731.7048.9113.554.0510.8211.0717.0025.0911.6243.4528.9246.8637.085.8518.92>10037.8160.9539.4636.95>100>100 DRF01DRF02DRF03DRF04DRF05DRF06DRF07DRF08DRF09DRF10DRF11DRF12DRF13DRF14DRF15DRF16DRF17DRF18 aacccctaccaactggtcggggttAgaaacaacccctaccaactggtcggggttGgaaacaacccctaccaactggtcggggttCgaaacaacccctaccaactggtcggggtttAaaacaacccctaccaactg gtcggggtttTaaacaacccctaccaactggtcggggtttCaaacaacccctaccaactggtcggggtttgTaacaacccctaccaactggtcggggtttgGaacaacccctaccaactggtcggggtttgCaac aacccctaccaactggtcggggtttgaTacaacccctaccaactggtcggggtttgaGacaacccctaccaactggtcggggtttgaCacaacccctaccaactggtcggggtttgaaTcaacccctaccaactg gtcggggtttgaaGcaacccctaccaactggtcggggtttgaaCcaacccctaccaactggtcggggtttgaaaAaacccctaccaactggtcggggtttgaaaTaacccctaccaactggtcggggtttgaaaG Sequence No. 120 Sequence No. 121 Sequence No. 122 Sequence No. 123 Sequence No. 124 Sequence No. 125 Sequence No. 126 Sequence No. 127 Sequence No. 128 Sequence No. 129 Sequence No. 130 Sequence No. 131 Sequence No. 132 Sequence No. 133 Sequence No. 134 Sequence No. 135 Sequence No. 136 Sequence No. 137 31.5933.079.453.185.0082.992.744.968.054.263.112.614.112.974.222.723.474.70 DRB01DRB02DRB03DRB04DRB05DRB06 aaccccAaccaactggtcggggtttgaaacaacccGaccaactggtcggggtttgaaacaaccccCaccaactggtcggggtttgaaacaacccctaccaactggtAggggtttgaaacaacccctaccaactggtTggggtttgaaacaacccctaccaactggtGggggtttgaaac Sequence No. 138 Sequence No. 139 Sequence No. 140 Sequence No. 141 Sequence No. 142 Sequence No. 143 4.805.344.465.165.8810.12

[0043] The targeted fluorescent protein GFP and the luminescent protein nanoluciferase utilize the pSIM5 plasmid, similar to mCherry. E.coliIt was inserted into the chromosome of the K-12 MG1655 strain. For the nanoluciferase luminescence assay, the Nano-Glo® Luciferase Assay System was utilized, and the fluorescence of GFP and the luminescence of nanoluciferase were measured using a HIDEX Sense plate reader. When the expression of GFP and nanoluciferase was inhibited using guide RNAs combined with original and selected variant repeat sequences and spacer sequences binding to the 5'-UTR of GFP or nanoluciferase mRNA, respectively, it was confirmed that the translation levels of GFP and nanoluciferase varied as shown in Figure 3, and results were obtained showing an expression inhibition intensity similar to that of mCherry in the guide RNAs to which each variant repeat sequence was applied.

[0044] From this, it was verified that the variant guide RNAs obtained in the present invention can be widely used to regulate the intensity of expression control of various target genes.

[0046] [Experimental Example 2: Vibrio natriegens [Precise regulation of mRNA translation levels in]

[0047] In this experimental example, the translation level precision control technology based on the variant repeat sequences selected in Experimental Example 1 is a Gram-negative bacterial model strain Escherichia coli In addition, Gram-negative bacteria that grow in high-salt environments Vibrio natriegens We intended to verify whether it is also applicable.

[0048] To this end, we intended to additionally clone the target protein mCherry and variant guide RNA sequences capable of inhibiting its expression based on the pACYC_TetR-dRfxCas13d plasmid. First, from the pACYC_TetR-dRfxCas13d plasmid tetRP obtained by amplification with TJmT_pACYC_GA_F and mCherryRBS_J23100_GA_R between the downstream AatII and BamHI restriction enzyme recognition sequences J23100 Gibson assembly was performed on the -mCherry sequence and the L3S2P21 terminator sequence obtained by amplification with TJmT_Pr_GA_F and L3S2P21_TJmT_GA_R. Finally, the pACYC_TetR-dRfxCas13d_TJmT100_DRXYY-mCherry sp plasmid was constructed by Gibson assembling the PCR compounds obtained by amplifying the resulting plasmids with the L3S2P21_pACYC_GA_R and UPJ23119_TJmT_GA_F primers from the respective mutant guide RNA plasmids. These plasmids Vibrio natriegens The strains were transformed, and selected colonies were cultured overnight in LB medium (CLBv2) supplemented with 204 mM NaCl, 4.2 mM KCl, 23.14 mM MgCl2, and 34 µg / mL chloramphenicol. Subsequently, dRfxCas13d was expressed by diluting the solution to a 1 / 100 ratio and adding 100 ng / mL of aTc. Fluorescence was measured after 16 hours, and the fluorescence values ​​of the strains expressing mutant guide RNAs binding to mCherry mRNA were obtained as relative values ​​compared to the non-repressive control group.

[0049] As a result, as shown in Fig. 4 Escherichia coli Similar to the expression regulation intensity shown in Vibrio natriegens It was also confirmed that each variant guide RNA varied the translation level of the target protein, mCherry. This suggests that the translation precision control CRISPRi system developed through the present invention has the potential to be widely utilized in other non-model strains.

[0051] [Experimental Example 3: Optimization of Intracellular Material Flow for High-Efficiency 3-Hydroxypropionic Acid Production]

[0052] In this experimental example, an experiment was conducted to optimize the material flow to increase the production of a target substance by utilizing the dRfxCas13d-based translation step regulation technology devised in the present invention to regulate the expression levels of genes responsible for intracellular metabolism. As an example, a pathway was utilized to produce 3-hydroxypropionic acid (3-HP) by expressing the malonyl-CoA reductase (mcr) enzyme.

[0053] In this case, since malonyl-CoA, used as a precursor, is also used as a precursor in the fatty acid synthesis pathway, inhibiting fatty acid synthesis can increase the production of 3-HP; however, this has the limitation that it inhibits strain growth. Therefore, in this experiment, the component responsible for the fatty acid synthesis pathway fabI We aimed to suppress gene expression levels at various levels using variant guide RNA. mcr The gene used was the N940V / K1106W / S1114R variant with enhanced function, and a cassette induced to be expressed upon the addition of isopropyl β-D-1-thiogalactopyranoside (IPTG) downstream of the Ptac promoter was amplified using Ptac_EcoNI_F and mcr_AvrII_R primers and cloned by ligating it into pETDuet treated with EcoNI and AvrII restriction enzymes. The resulting pET_Ptac-mcr plasmid, pACYC_TetR-dRfxCas13d, and fabI The pCDF_J23119-DRXYY-fabI sp plasmid to regulate gene expression is an acid-resistant strain Escherichia coli It was transformed into the W ATCC 9637 strain. All three types of plasmids were transformed E. coliAfter overnight culture of the W strain in Modified M9 medium (Glucose 8 g / L, NaCl 2.0 g / L, NH4Cl 2.0 g / L, K2HPO4 10.7 g / L, KH2PO4 5.2 g / L, MgSO4·7H2O 0.5 g / L, Yeast extract 1 g / L), dRfxCas13d was expressed by diluting to a 1 / 100 ratio and adding 100 ng / ml of aTc, and after 2 hours, 20 µM of IPTG was additionally added mcr Genes were expressed. After 24 hours, 800 µL of medium was obtained, centrifuged at 14,000 rpm for 10 minutes, and the supernatant was separated and used to measure 3-HP production. 3-HP analysis was performed using an Agilent 1260 Infinity II LC system, utilizing a Hi-Plex-H column with 5 mM sulfuric acid as the mobile phase, a flow rate of 0.6 ml / min, and a temperature of 40℃ for separation and quantification. As a result of measuring cell growth and 3-HP production of strains possessing each variant guide RNA, as shown in Figure 5, it was confirmed that when a guide RNA with weaker translation inhibition than the existing guide RNA was used, strain growth recovered somewhat as expected, and consequently, 3-HP production increased, ultimately showing a 14.2-fold increase compared to the non-inhibited strain.

[0054] These results suggest that the translation precision control technology devised in the present invention can be utilized for the optimization of high-value material production based on cell factories by regulating intracellular metabolic flow to an optimal level.

Claims

Claim 1 A kit for regulating the protein expression level of a target gene comprising: a gene encoding a guide RNA of RfxCas13d; and a gene encoding a dCas13d protein with non-specific RNA degradation activity removed; wherein the guide RNA is mutated such that one or more nucleotides among the stem, bulge, and flanking sequence regions are substituted with a nucleotide other than the wild type while maintaining a state in which the spacer sequence is complementary to the target mRNA and there is no positional or sequence modification, and the target gene expression kit is characterized by regulating the protein expression level of the target gene by regulating the binding efficiency between the dCas13d protein and the guide RNA. Claim 2 A target gene expression kit according to claim 1, characterized in that the target gene is one of the genes constituting the operon. Claim 3 delete

Images