Beauveria bassiana 42R strain with simultaneous insecticidal activities to various sucking insects and uses thereof

Abstract

The present invention relates to a fungal strain of Beauveria bassiana 42R having a control effect against sap-sucking pests and the use thereof. Specifically, the present invention relates to a Beauveria bassiana 42R strain having control activity against sap-sucking pests (accession number: KACC83104BP), a composition for controlling sap-sucking pests comprising the Beauveria bassiana 42R strain, a culture of the strain, a concentrate of the strain culture, or a dried product of the strain culture as active ingredients, and a method for controlling sap-sucking pests using the composition for controlling sap-sucking pests.

Description

Technology Field

[0001] The present invention relates to a fungal strain of *Buberia bacillus* 42R having a control effect against sap-sucking pests and its use. Background Technology

[0002] Various insecticides are used to control pests, which are identified as the biggest obstacles to plant growth, and recently, research for the development of eco-friendly insecticides is being actively conducted worldwide. Whether for economic purposes such as food production or for landscaping, crop protection agents for pest control are almost essential for growing plants, and the associated economic costs are substantial. To date, most crop protection agents have been developed using chemical substances; however, chemical-based agents pose problems such as various side effects, including risks to humans and animals as well as ecosystem destruction. Therefore, various eco-friendly pest control methods are being developed to address the side effects of conventional crop protection agents, and one method receiving particular attention is the development and use of microbial insecticides utilizing entomopathogenic microorganisms.

[0003] Various microorganisms, such as bacteria, viruses, and fungi, can be used as materials for microbial insecticides, and among them, entomopathogenic fungi have the longest history. Entomopathogenic fungi are microorganisms that cause disease and death in insects; during the process of invading and multiplying within an insect host, they produce various extracellular enzymes, toxins, and secondary metabolites to overcome the host insect's immune response, kill the host, and also compete with other microorganisms. Utilizing these characteristics, research on the insecticidal and antimicrobial activities of various metabolites of entomopathogenic fungi has recently been actively conducted.

[0004] Meanwhile, sap-sucking pests such as peach aphids (Myzus persicae), cotton aphids (Aphis gossypii), spider mites (Tetranychus urticae), western flower thrips (Frankliniella occidentalis), greenhouse whiteflies (Trialeurodes vaporariorum), and tobacco whiteflies (Bemisia tabaci) are difficult to control because they cannot directly ingest chemical insecticides. Therefore, there is a need to develop new pest control agents using microorganisms that can effectively control these sap-sucking pests. Prior art literature

[0005] Korean Registered Patent 10-1836007 The problem to be solved

[0006] Accordingly, the inventors completed the present invention by confirming that Beauveria bassiana 42R, a novel entomopathogenic fungus isolated and identified from the peach aphid, not only has excellent insecticidal activity against the peach aphid but also has very effective control activity against other sap-sucking pests such as the cotton aphid, spider mite, western flower thrips, greenhouse whitefly, and tobacco whitefly.

[0007] Therefore, the objective of the present invention is to provide a Beauveria bassiana 42R strain (accession number: KACC83104BP) having control activity against sap-sucking pests.

[0008] Another objective of the present invention is to provide a composition for controlling sap-sucking pests comprising, as an active ingredient, the Beauveria bassiana 42R strain of the present invention (accession number: KACC83104BP), a culture of the strain, a concentrate of the strain culture, or a dried product of the strain culture.

[0009] Another objective of the present invention is to provide a method for controlling sap-sucking pests using the composition for controlling sap-sucking pests of the present invention. means of solving the problem

[0010] To achieve the above-mentioned objective of the present invention, the present invention provides a Beauveria bassiana 42R strain (accession number: KACC83104BP) having control activity against sap-sucking pests.

[0011] In one embodiment of the present invention, the pest may be one or more selected from the group consisting of peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly.

[0012] In addition, the present invention provides a composition for controlling sap-sucking pests comprising as an active ingredient the Beauveria bassiana 42R strain (accession number: KACC83104BP), said strain culture, said strain culture concentrate, or said strain culture dry product.

[0013] In one embodiment of the present invention, the sap-sucking pest may be one or more selected from the group consisting of peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly.

[0014] Furthermore, the present invention provides a method for controlling sap-sucking pests using the composition for controlling sap-sucking pests according to the present invention.

[0015] In one embodiment of the present invention, the composition may be sprayed onto soil or crops where the pest has bred.

[0016] In one embodiment of the present invention, the pest may be one or more selected from the group consisting of peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly.

[0017] In one embodiment of the present invention, the crop may be an eggplant, chili pepper, tomato, strawberry, napa cabbage, pear, apple, cucumber, rose, cherry, pine tree, Japanese quince, plum, prickly ash, tangerine, potato, sweet potato, tobacco, cotton, evergreen tree, oleander, barberry, goji berry, paulownia, apricot, plum, or wild persimmon. Effects of the invention

[0018] The strain of Vieuveria bassiana 42R of the present invention (accession number: KACC83104BP) exhibits specific and excellent insecticidal effects against peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly. Therefore, the strain of the present invention can be usefully used as a pest control agent that is very safe for humans, livestock, and the environmental ecosystem, and is also very useful for cost reduction as it has the effect of simultaneously controlling various sap-sucking pests. Brief explanation of the drawing

[0019] Figure 1 is a graph comparing the results of the insecticidal activity evaluation against peach aphids by spores of the Vieuveria bassiana 42R strain, liquid culture medium, and budding spores. Figure 2 is a graph showing the results of the insecticidal activity evaluation against cotton aphids by the spores of the Vieuveria bassiana 42R strain. Figure 3 is a graph showing the results of evaluating the insecticidal activity of the culture solution against cotton aphids by liquid culture of the Vieuveria bacillus 42R strain. Figure 4 is a graph showing the results of the insecticidal efficacy evaluation of the spores of the Vieuveria bacillus 42R strain against spider mites, western flower thrips, greenhouse whiteflies, and tobacco whiteflies. Specific details for implementing the invention

[0020] The present invention is characterized by providing a strain of Vieuveria bacillus 42R (accession number: KACC83104BP) which has excellent control ability against sap-sucking pests, and is also characterized by providing a method to control pests using said strain.

[0021] To address the problem of pests, which is a major obstacle in plant cultivation, various insecticides, including chemical and eco-friendly insecticides, are being used, and active research is continuously being conducted to develop effective and new control agents. In particular, research on the development of insecticides for sap-sucking pests is being carried out worldwide. Sap-sucking pests, such as aphids like the peach aphid, mites like the spotted spider mite, thrips like the western flower thrips, and whiteflies like the greenhouse whitefly, have a very diverse and wide range of host plants, including herbaceous and woody plants, making their damage a global problem.

[0022] Meanwhile, most insecticides, including the chemical insecticides currently most widely used, have a problem in that their insecticidal active ingredients reach the insect's body through the feeding process to exhibit activity, and sap-sucking insects have very low opportunities to consume these active ingredients, making control very difficult. Although such sap-sucking insects are recognized as a major obstacle in plant cultivation, there are almost no effective control agents available to control them.

[0023] In this regard, the inventors isolated and identified a novel Beauveria bassiana 42R strain, previously unknown, during the rearing of peach aphid, and confirmed that the strain has insecticidal activity against peach aphid as well as insecticidal activity against various sap-sucking pests such as cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly.

[0024] Accordingly, the inventors deposited the novel strain, *Buveria baciana 42R*, isolated and identified in the present invention, with the National Institute of Agricultural Sciences Microbiome (KACC) of the Rural Development Administration on November 19, 2024, and were assigned deposit number (KACC83104BP).

[0025] In one embodiment of the present invention, a bioassay was performed on peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly to analyze whether the Vieuveria bacillus 42R strain of the present invention has insecticidal activity against sap-sucking pests.

[0026] Specifically, in one embodiment of the present invention, the pest control ability of a culture medium containing spores of the Vieuveria bacillus 42R strain, budding spores obtained by culturing the strain, and metabolites of the strain was analyzed.

[0027] As a result of spraying a spore suspension of the Vieuveria bassiana 42R strain onto peach aphids and observing daily for 7 days to check for dead insects, a high insecticidal efficacy of over 96% was observed 7 days after treatment with the Vieuveria bassiana 42R strain. The group treated with the budding spore suspension showed an insecticidal efficacy of approximately 71% 7 days after treatment, while the group treated with the culture solution showed a high insecticidal efficacy of over 91% 7 days after treatment. Additionally, the group treated with both spores and the culture solution showed an insecticidal efficacy of over 87% 7 days after treatment, and the group treated with both budding spores obtained through liquid culture and the culture solution also showed a high insecticidal efficacy of approximately 93% 7 days after treatment.

[0028] Through this, the inventors were able to confirm that the spores, budding spores, and culture medium of the Buberia bassiana 42R strain isolated and identified in the present invention all have high insecticidal activity against peach aphids.

[0029] In addition, the insecticidal activity against cotton aphids was also analyzed, and the spores of the Beauveria bassiana 42R strain of the present invention showed high insecticidal activity of about 92% against cotton aphids, and the culture solution of the Beauveria bassiana 42R strain also showed high insecticidal activity of about 82% against cotton aphids.

[0030] Furthermore, in another embodiment of the present invention, insecticidal activity against other sap-sucking pests other than aphids, such as spider mites, western flower thrips, greenhouse whiteflies, and tobacco whiteflies, was evaluated. As a result, the spore treatment group of the Vieuveria bassiana 42R strain showed excellent insecticidal activity of about 87% against spider mites, about 57% against western flower thrips, about 73% against greenhouse whiteflies, and about 71% against tobacco whiteflies 7 days after treatment.

[0031] Through this, the inventors found that the spores, budding spores, and culture medium of the Buberia bassiana 42R strain of the present invention can all be usefully used as microbial agents for controlling various sap-sucking pests.

[0032] Therefore, the present invention can provide a Beauveria bassiana 42R strain (accession number: KACC83104BP) having control activity against sap-sucking pests.

[0033] In addition, the present invention may provide a composition for controlling sap-sucking pests comprising one or more active ingredients selected from the group consisting of the above-mentioned Buveria bacillus 42R strain, a culture of the strain, a concentrate of the culture, and a dried product of the culture.

[0034] The pests that the strain according to the present invention can control are not limited thereto, but may be one or more selected from the group consisting of peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly.

[0035] The above culture can be obtained by culturing in large quantities using a conventional method of culturing microorganisms, and a culture medium containing a carbon source, a nitrogen source, vitamins, and minerals can be used as the culture medium, and starch, sucrose, citrate, maltose, glucose, mannitol, glycerol, or xylose can be used as the carbon source.

[0036] In addition, the above culture may be used in the form of the culture itself containing the strain of the present invention, or it may undergo centrifugation or filtration to remove the culture medium from the culture solution and recover only the concentrated cells, and such steps may be performed by a person skilled in the art as necessary. The concentrated cells may be preserved by freezing or lyophilizing according to conventional methods so as not to lose their activity.

[0037] For the purpose of stable formulation suitable for actual use, the composition of the present invention may additionally include one or more substances such as water, a carrier, a diluent, a surfactant, an efficacy enhancer, inorganic salts, an adjuvant, a binder, and a bulking agent in addition to the active ingredients (strain, strain culture, concentrate of strain culture, or dried strain culture) described above.

[0038] The above surfactant is an amphiphilic substance having both hydrophilic and lipophilic molecular groups in its molecule, and is understood to have excellent cleaning power, dispersion power, emulsifying power, solubilizing power, wetting power, bactericidal power, foaming power, and penetration power, and can be understood to function to hydrate, suspend, and disperse the active ingredient (a strain or a culture thereof) in the mosquito insecticidal composition according to the present invention so that it effectively exhibits medicinal effects.

[0039] The above surfactants may be used alone or in a mixture of two or more types, such as anionic surfactants like alkylbenzenesulfonate, alkylnaphthalenesulfonate, dialkylsulfosuccinate, ligninsulfonate, alkylnaphthalenesulfonate formalin condensate, sodium or calcium salts of sulfonates like polyoxyalkylenealkylphenylsulfonate, sodium or calcium salts of sulfates like alkyl sulfate, polyoxyalkylenealkylsulfate, or polyoxyalkylenealkylphenylsulfate, sodium or calcium salts of succinates like naphthalenesulfosuccinate or polyoxyalkylenesuccinate, nonionic surfactants like ethoxylated alkyl ethers, polyoxyalkylenealkylphenyl polymers, and polyalcohols. These are all listed as examples, and it will be readily understood by those skilled in the art that surfactants other than these may be used.

[0040] The above-mentioned filler is a substance that can be used together with a surfactant to adsorb and disperse the surfactant, and examples include starch, soybean meal, wheat bran, granular fiber, ammonium sulfate, diatomaceous earth, zeolite, bentonite, talc, kaolin, pyrophyllite, white carbon, etc., which may be used alone or in a mixture of two or more types.

[0041] The above binder is a substance that binds the components within the composition together, and for example, water-soluble starch, dextrin, carboxymethylcellulose, sodium polyacrylate, polyvinyl alcohol, gum arabic, or xanthan gum may be used alone or in a mixture of two or more types.

[0042] In addition, the present invention may provide a method for controlling sap-sucking pests using the composition for controlling sap-sucking pests of the present invention, and the method may specifically be carried out through the step of spraying on soil or crops where sap-sucking pests have proliferated.

[0043] The types of crops that can be sprayed with the composition of the present invention are not limited thereto, but may include eggplant, chili pepper, pear, apple, cucumber, rose, cherry, pine tree, Japanese quince, plum, prickly ash, tangerine, potato, tobacco, cotton, evergreen tree, oleander, barberry, goji berry, paulownia, apricot, plum, or wild persimmon.

[0045] The present invention will be explained in more detail below through examples. These examples are intended to explain the invention more specifically, and the scope of the invention is not limited to these examples.

[0047] <Preparation and Experimental Methods>

[0048] (1) Pest rearing conditions

[0049] Peach aphid (*Myzus persicae*) was supplied with spring cabbage and cotton aphid (*Aphis gossypii*) with cucumber leaves, and they were reared under laboratory conditions of temperature 25℃, relative humidity 70%, and light conditions 12L:12D, and then separated using an art brush for use in the experiment.

[0050] The spotted mite (Tetranychus urticae) was used in the experiment by supplying kidney beans and rearing them under laboratory conditions of a temperature of 25℃, relative humidity of 70%, and light conditions of 12L:12D.

[0051] The western flower thrips (Frankliniella occidentalis) were used in experiments by providing kidney bean cotyledons and rearing them under laboratory conditions of temperature 25℃, relative humidity 50-60%, and light conditions 16L:8D.

[0052] Greenhouse whiteflies (Trialeurodes vaporariorum) and tobacco whiteflies (Bemisia tabaci) were used in experiments by supplying tomato seedlings and rearing them under laboratory conditions of temperature 25℃, relative humidity 50-60%, and light conditions 16L:8D.

[0054] (2) Isolation of insect pathogenic fungal strains

[0055] We isolated and identified the naturally occurring Beauveria bassiana 42R strain during the rearing of peach aphid.

[0057] ① Strain identification

[0058] Fungal genome DNA was purified by treating a portion of fungal cells cultured on PDA for 2 weeks with fungal DNA extraction buffer (0.2 M Tris-Cl (pH 7.5), 0.5 M NaCl, 10 mM EDTA (pH 8.0), 1% (w / v) SDS) followed by centrifugation with phenol-chloroform-isoamyl alcohol (25:24:1) extraction. The purified DNA solution was precipitated using cold ethanol, centrifuged, and dissolved in sterile distilled water for use in the experiment.

[0059] For the molecular biological identification of the strain, PCR primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGAT ATGC-3') were used to amplify the ITS region (internal transcribed spacer (ITS1-5.8S-ITS2)). The PCR reaction was performed using an AccuPower PCR PreMix (Bioneer Co., Korea) with a PCR instrument (TaKaRa, Japan) under conditions of 94˚C for 30 seconds, 53˚C for 30 seconds, and 72˚C for 1 minute and 35 cycles.

[0060] After the PCR reaction, the amplified product was purified and sent to Macrogen Co., Korea for sequencing analysis. The sequencing was compared with previously reported sequences of other fungi using the BLAST search tool.

[0062] ② Solid culture

[0063] Fungal strains were cultured on potato dextrose agar (PDA) plates at 25°C for 14 days, after which 14-day-old fungal conidia were scraped off from the PDA plates and collected by resuspending the material in a 0.01% Tween-80 solution. To remove mycelial debris, the conidia suspension was vigorously stirred and filtered through cotton gauze. Spore concentration was measured using a hemocytometer.

[0065] ③ Liquid culture

[0066] Spore suspensions obtained through solid culture were tested for spore germination in SDAY+B medium (SDAY (Saboraud dextrose agar with 1% yeast extract, pH 5.6) supplemented with 0.05% benomyl, 95% active ingredient)) before inoculation into liquid media; only those showing a survival rate of 90% or higher were used. The spore suspensions were inoculated into PDB (potato dextrose broth, pH 5.6) medium and cultured for 14 days at 25°C, 150 rpm, and in the dark. The culture product after 14 days was centrifuged to separate the cells and the culture medium; the obtained culture medium was filtered once using filter paper (ADVANTEC, No. 2), and the pure culture medium obtained by secondary filtration using a 0.45 µm filter was used in the experiment. For the collection of blastospores, the cells separated after centrifugation were washed twice with sterile distilled water to remove the culture medium, and distilled water was added in an amount equal to the original culture medium and homogenized to prepare a suspension. Afterward, the cells were removed with sterile gauze, and only the blastospores were collected and used for the experiment.

[0068] (3) Bioassay

[0069] Fungal spores, budding spores obtained through liquid culture, and culture media from which hyphae and budding spores had been removed were each used for biological assays. Spore suspensions with a viability exceeding 90% were used for biological assays, and spore viability was determined on SDAY+B medium.

[0070] For the bioassay against peach aphid, cotton aphid, and spider mite, leaves of each host plant cut to a diameter of 25 mm were placed in a 60 mm petri dish containing excessively moistened cotton wool, 30 pests were placed on top, and then 1 mL (1 × 10⁶) of spore suspension collected from the grain medium was used. 8 spores / mL) and 1 mL (1 × 10⁶) of budding spores collected by liquid culture 8 1 mL of culture solution (spores / mL) was spray-inoculated. After inoculation, the temperature was maintained at 25℃, light conditions at 12L:12D, and humidity at 70%, and observations were made daily at 24-hour intervals. Only 0.02% Tween-80 solution was used as a control, and bioassays were performed in triplicate.

[0071] For the biological test on the western flower thrips, a cabbage leaf cut to a diameter of 60 mm was placed in a 90 mm insect breeding dish inoculated with 1.5% agar, and 20 adult western flower thrips were inoculated onto it using an art brush for analysis.

[0072] For the bioassay on greenhouse whiteflies or tobacco whiteflies, 20 adult greenhouse whiteflies or tobacco whiteflies were inoculated onto a 90 mm insect breeding dish inoculated with 1.5% agar and a 60 mm diameter cut soybean leaf was placed on top.

[0074] Statistical analysis

[0075] The insecticidal activity evaluation was performed three times, and the results were tested for significance using the SPSS statistical program at a significance level of 0.05 or less. Data were expressed as mean ± standard error (SE).

[0077] <Example 1>

[0078] Isolation and Identification of the Novel Vieuveria bassiana 42R Strain

[0079] For entomopathogenic fungi isolated from peach aphids, fungal genome DNA was extracted as described in the experimental method above, and molecular biological analysis was performed using the ITS region.

[0080] As a result, it was found that it showed the highest homology with Beauveria bassiana among previously reported entomopathogenic fungi and had some differences from the base sequence of previously known entomopathogenic fungi, so the inventors named the strain isolated and identified in the present invention as the 'Beauveria bassiana 42R' strain.

[0081] The nucleotide sequence corresponding to the ITS region in the genomic DNA of the novel Buberia bassiana 42R strain isolated and identified in the present invention is as follows.

[0082] <Numer sequence of the ITS region of the Vieuveria bassiana 42R strain>

[0083] AGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCA GCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCAT CGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTGGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATG GAGTGGCGGCCCGTCCGCGGCGACCTCTGCGTAGTAATACAGCTCGCACCGGAACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAA

[0085] <Example 2>

[0086] Analysis of the insecticidal activity of the Vieux bacillus 42R strain of the present invention against sap-sucking pests

[0087] <2-1> Confirmation of insecticidal efficacy against peach aphids

[0088] In this invention, the insecticidal activity of the Buberia bassiana 42R strain isolated and identified was analyzed against peach aphid. The insecticidal activity against peach aphid was evaluated using spores produced on a solid medium and liquid culture products, such as budding spores and culture solution.

[0090] As a result of the analysis, high insecticidal rates of approximately 96% and 91% were observed 7 days after treatment when treated with spores or culture medium alone, respectively, while an insecticidal rate of approximately 71% was confirmed when treated with budding spores alone (Fig. 1). In addition, high insecticidal rates of approximately 87% and 93% were observed in the group treated with both culture medium and spores, and in the group treated with both culture medium and budding spores, respectively (Fig. 1). Furthermore, the group treated with a mixture of spores or budding spores of the Vieuveria bassiana 42R strain of the present invention and culture medium showed a higher insecticidal rate on days 4 and 5 after treatment compared to the groups treated with them alone.

[0091] Through this, it was found that the Buberia bassiana 42R strain identified in the present invention has high insecticidal activity against peach aphids in all of its spores, budding spores, or culture medium.

[0093] <2-2> Confirmation of insecticidal efficacy against cotton aphids

[0094] Next, the insecticidal activity against cotton aphids was evaluated using the spores and culture solution of the Beauveria bassiana 42R strain of the present invention.

[0096] After treating cotton aphids with spores formed on a solid medium and analyzing the insecticidal activity, a high insecticidal activity of approximately 92% was confirmed 7 days after treatment (see Fig. 2). The culture solution treatment group showed an insecticidal activity of approximately 82% 7 days after treatment, confirming that the culture solution also has excellent insecticidal activity against cotton aphids (see Fig. 3).

[0097] Through this, the inventors were able to see that the Beauveria bassiana 42R strain of the present invention has high insecticidal activity against not only peach aphids but also cotton aphids.

[0099] <2-3> Confirmation of insecticidal efficacy against spider mites, western flower thrips, greenhouse whiteflies, and tobacco whiteflies

[0100] Furthermore, the inventors evaluated the insecticidal activity against major sap-sucking pests other than aphids, such as spider mites, western flower thrips, greenhouse whiteflies, and tobacco whiteflies, using the spores of the Beauveria bassiana 42R strain of the present invention.

[0102] As a result of the analysis, when spores formed on a solid medium were treated, approximately 87% insecticidal activity was observed against spider mites 7 days after treatment, and high insecticidal activity of approximately 57% against western flower thrips, approximately 73% against greenhouse whiteflies, and approximately 71% against tobacco whiteflies was confirmed (see Fig. 4).

[0103] Through this, the inventors were able to see that the Vieuveria baciana 42R strain of the present invention has excellent insecticidal activity against not only aphids but also spider mites, western flower thrips, greenhouse whiteflies, and tobacco whiteflies.

[0105] Through this, the inventors were able to confirm that the Vieuveria baciana 42R strain of the present invention has high insecticidal activity against peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly, and is very useful as a microbial control agent for the simultaneous control of various sap-sucking pests.

[0107] In addition, the inventors deposited the novel strain *Buveria bassiana 42R*, isolated and identified in the present invention, with the Korean Agricultural Culture Collection (KACC) of the National Institute of Agricultural Sciences, Rural Development Administration on November 19, 2024, and were assigned deposit number (KACC83104BP).

[0109] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0110] Depository Name: National Institute of Agricultural Sciences, Rural Development Administration, Microbial Bank (KACC) Accession Number: KACC83104BP Date of Deposit: 2024-11-19

Claims

Claim 1 A Beauveria bassiana 42R strain deposited under accession number KACC83104BP having control activity against sap-sucking pests, wherein the strain is characterized by having control activity against all sap-sucking pests, including peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly. Claim 2 delete Claim 3 A composition for controlling sap-sucking pests comprising, as an active ingredient, the strain of claim 1, a culture of the strain, a concentrate of the strain culture, or a dried product of the strain culture, wherein the composition is characterized by having control activity against all sap-sucking pests, such as the peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly. Claim 4 delete Claim 5 A method for simultaneously controlling all sap-sucking pests, including peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly, using the composition for controlling sap-sucking pests of claim 3. Claim 6 A method for simultaneously controlling all sap-sucking pests, including peach aphid, cotton aphid, spotted mite, western flower thrips, greenhouse whitefly, and tobacco whitefly, characterized in that, in claim 5, the above composition is sprayed onto soil or crops where the pests have proliferated. Claim 7 delete Claim 8 A method for simultaneously controlling all sap-sucking pests, including peach aphid, cotton aphid, spider mite, western flower thrips, greenhouse whitefly, and tobacco whitefly, according to claim 6, characterized in that the crop is eggplant, chili pepper, tomato, strawberry, cabbage, pear, apple, cucumber, rose, cherry, pine tree, Japanese quince, plum, prickly ash, tangerine, potato, sweet potato, tobacco, cotton, evergreen tree, oleander, crape myrtle, goji berry, Paulownia tree, apricot tree, plum tree, or wild persimmon tree.

Images