KASP primer set composition based on SNP for discriminating Phytophthora blight resistant soybean to Phytophthora sojae and uses thereof

Abstract

The present invention relates to an SNP-based KASP primer set composition for determining soybean late blight resistance and its use. Since using the SNP-based KASP primer set of the present invention saves labor and time compared to bioassays for late blight resistance, it can quickly respond to the demand for selecting late blight-resistant genetic resources and can be usefully utilized in breeding new soybean varieties.

Description

Technology Field

[0001] The present invention relates to an SNP-based KASP primer set composition for determining soybean late blight resistance and the use thereof. Background Technology

[0002] Soybean blight is caused by phytophthora, an oomycete that survives in the soil ( Phytophthora sojae Caused by the pathogen, it is one of the major soybean diseases that significantly reduces yields in large-scale soybean-producing countries such as the United States, Brazil, and Argentina. The soybean late blight pathogen has a very narrow host range, to the extent that soybeans are its sole host plant. It can survive the winter in the soil or on plant debris and exhibits chemotaxis, being attracted by isoflavones released from soybean roots. When susceptible soybean plants are infected with the pathogen, their roots and stems rot, leading to plant death and consequently reduced yield. The pathogen has a higher probability of occurrence in poorly drained or wet soils, and because it can survive for years in soil or on plant debris, making control difficult, utilizing plant resistance is the most sustainable control method.

[0003] In Korea, since the first discovery of soybean late blight in 1998, reported cases have steadily increased; however, research has been limited since then, and genetic analysis studies on late blight resistance remain in their early stages. Biological assays to confirm resistance to soybean late blight are conducted by directly inoculating the strain onto the hypocotyl of seedlings. This method requires prior steps of cultivating plants to a uniform growth stage and incubating the strain in a culture medium. Furthermore, it takes 14 days from sowing to confirm the disease response, and space is required for growing beds to maintain the plants. Testing large quantities of genetic resources or conducting experiments on numerous breeding lines necessitates significant labor, space, and time. Therefore, prioritizing the exploration of soybean late blight-resistant resources and securing genes related to resistance is essential. Additionally, there is an urgent need to establish a research pipeline and secure related technologies, such as the development of molecular markers for the application of resistance-related genes in molecular and genomic breeding systems, as well as gene sequencing analysis.

[0004] The major disease resistance mechanism of soybeans is Rps (Resistance to Phytophthora sojae A resistance gene called ) R gene, R It manifests as qualitative resistance formed by ). In plant bodies RThe R protein produced by the gene specifically recognizes the virulence (Avr) protein produced by the pathogen, thereby conferring resistance; this interaction is called gene-for-gene resistance. Since Korean soybean genetic resources exhibit high genetic diversity and have been reported in various studies to be genetically different from those of the United States or China, there is a high probability that they possess novel late blight resistance genes not found in native soybeans from the U.S. or China. Therefore, it is necessary to secure their value by discovering and researching late blight resistance genes that have not been previously reported.

[0005] Meanwhile, Korean Published Patent No. 2022-0092112 discloses a 'marker composition for determining soybean varieties having resistance or susceptibility to soybean late blight pathogens and the use thereof' regarding an SNP located on soybean chromosome 3, and Korean Published Patent No. 2018-0028410 discloses a 'locus related to phytophthora root and stem rot in soybeans' located on soybean chromosome 7, but there is no description of the 'SNP-based KASP primer set composition for determining soybean late blight resistance and the use thereof' located on soybean chromosome 18 of the present invention. The problem to be solved

[0006] The present invention was derived from the above-mentioned requirements, and the inventor [is] a soybean late blight pathogen ( Phytophthora sojae Resistance gene conferring resistance to strain 40468, which is one of the strains (Resistance to Phytophthora sojae , Rps...was explored. Gene mapping and locus location analysis of recombinant inbred lines (RIL) using the 'Cheonal' variety, which exhibits resistance to soybean blight, and the 'Daepung' variety, which exhibits susceptibility, as parent and maternal parents were performed. It was confirmed that the region of 55,912,198–56,412,565 bp on chromosome 18, which is highly significantly associated with blight resistance, is closely associated with blight resistance. Furthermore, 16 SNP markers capable of distinguishing blight resistance or susceptibility within the said region were developed, and the present invention was completed by confirming that a KASP primer set based on the said SNP markers can accurately distinguish between blight-resistant and susceptible soybean genetic resources. means of solving the problem

[0007] To solve the above problem, the present invention provides an SNP marker composition for identifying disease-resistant or susceptible soybean genetic resources, comprising one or more polynucleotides selected from the group consisting of polynucleotides composed of eight or more consecutive nucleotides including a single nucleotide polymorphism (SNP) located at the 101st position in each of the nucleotide sequences of SEQ ID NOs 49 to 64, or polynucleotides complementary to the same.

[0008] In addition, the present invention provides a microarray for identifying disease-resistant or susceptible soybean genetic resources comprising a polynucleotide containing the above-mentioned SNP base or cDNA thereof.

[0009] In addition, the present invention provides a probe for determining disease-resistant or susceptible soybean genetic resources comprising a polynucleotide containing the above-mentioned SNP base or cDNA thereof.

[0010] In addition, the present invention provides a KASP (kompetitive allele specific PCR) primer set composition for identifying disease-resistant or susceptible soybean genetic resources, comprising one or more primer sets selected from a group consisting of 16 oligonucleotide primer sets, characterized in that three adjacent oligonucleotides starting from SEQ ID NO. 1 form a single primer set among the oligonucleotides represented by SEQ ID NO. 1 to 48.

[0011] In addition, the present invention provides a kit for determining disease-resistant or susceptible soybean genetic resources, comprising: the above-mentioned KASP primer set composition; and a reagent for performing an amplification reaction.

[0012] In addition, the present invention provides a method for determining disease-resistant or susceptible soybean genetic resources, comprising the steps of: isolating genomic DNA from a soybean sample; performing KASP using the isolated genomic DNA as a template and a KASP primer set composition according to the present invention; and analyzing the amplification product of the KASP. Effects of the invention

[0013] Using the SNP-based KASP primer set of the present invention can save labor and time compared to bioassays for blight resistance, allowing for a rapid response to the demand for the selection of blight-resistant genetic resources, and thus can be usefully utilized in breeding new soybean varieties. Brief explanation of the drawing

[0014] Figure 1 shows the soybean late blight pathogen ( Phytophthora sojae This is a photo of the 'Daepung' variety, which is susceptible to the disease caused by KACC 40468, and the 'Cheonal' variety, which is resistant. Figure 2 is a genetic map of soybean chromosome 18 containing the SNP markers of the present invention. Since the region of 55,912,198–56,412,565 bp within chromosome 18 has a significantly high LOD (logarithm of odds) value, the region is for strain 40468 Rps (Resistance to Phytophthora sojae It is highly likely that a resistance gene called ) exists. Figure 3 shows the results of applying 16 sets of SNP-based KASP primers of the present invention (Tables 3 and 4) to Daepung and Cheonal used as maternal and paternal parents, their recombinant incubation line populations (18 resistant lines, 18 susceptible lines), and synthetic heterozygotes made by mixing equal amounts of Daepung and Cheonal DNA. Blue represents soybean lines (genetic resources) containing the Daepung allele, red represents soybean lines (genetic resources) containing the Cheonal allele, green represents synthetic heterozygotes, and black represents a negative control (distilled water treatment). Specific details for implementing the invention

[0015] To achieve the objective of the present invention, the present invention provides a SNP marker composition for identifying disease-resistant or susceptible soybean genetic resources, comprising one or more polynucleotides selected from the group consisting of polynucleotides composed of eight or more consecutive nucleotides including a single nucleotide polymorphism (SNP) located at the 101st position in each of the nucleotide sequences of SEQ ID NOs 49 to 64, or polynucleotides complementary to the same.

[0016] In one embodiment of the present invention, the consecutive nucleotides may be 8 to 100 consecutive nucleotides, but are not limited thereto.

[0017] In the present invention, the term “nucleotide” refers to a deoxyribonucleotide or ribonucleotide existing in a single-stranded or double-stranded form, and includes analogs of natural nucleotides unless specifically otherwise noted.

[0018] In an SNP marker composition according to one embodiment of the present invention, the SNP position base is the 101st of all base sequences of SEQ ID NOs 49 to 64, and polymorphic base information is indicated by [ / ] in the SNP base sequence information of Tables 1 and 2, and the base sequences of SEQ ID NOs 49 to 64 of the present invention refer to sequences including bases located before the diagonal line ( / ) in Tables 1 and 2.

[0019] The SNP marker of the present invention can be used for determining late blight-resistant or susceptible soybean genetic resources in such a way that the 101st SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 49 is C or T, the 101st SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 50 is T or G, the 101st SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 51 is T or C, the 101st SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 52 is G or A, the 101st SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 53 is C or T, the 101st SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 54 is G or A, the 101st SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 55 is T or C, and the 101st SNP variant position in the nucleotide sequence indicated by SEQ ID NO. 56 is C or It is based on the fact that the 101st position of the SNP variant in the base sequence indicated by SEQ ID NO. 57 is C or T, the 101st position of the SNP variant in the base sequence indicated by SEQ ID NO. 58 is C or T, the 101st position of the SNP variant in the base sequence indicated by SEQ ID NO. 59 is C or T, the 101st position of the SNP variant in the base sequence indicated by SEQ ID NO. 60 is T or C, the 101st position of the SNP variant in the base sequence indicated by SEQ ID NO. 61 is T or C, the 101st position of the SNP variant in the base sequence indicated by SEQ ID NO. 62 is G or A, the 101st position of the SNP variant in the base sequence indicated by SEQ ID NO. 63 is A or G, and the 101st position of the SNP variant in the base sequence indicated by SEQ ID NO. 64 is T or C. In the above SNP position bases, if the 101st base of the base sequences of SEQ ID NOs 49 to 64 is T, G, C, A, T, A, C, A, T, T, T, C, C, A, G, and C bases, respectively, it can be identified as a soybean genetic resource resistant to late blight (see Tables 1, 2, 7, and 8).

[0020] The present invention relates to base variants at SNP locations in the base sequences of SEQ ID NOs 49 to 64, but when such SNP base variants are found in double-stranded gDNA (genomic DNA), they are interpreted to include polynucleotide sequences complementary to the nucleotide sequences. Accordingly, the bases at the SNP locations in the complementary polynucleotide sequences also become complementary bases. In this regard, all sequences presented in this specification are based on sequences in the sense strand of genomic DNA unless otherwise noted.

[0021] The present invention also provides a microarray for identifying disease-resistant or susceptible soybean genetic resources, comprising one or more polynucleotides selected from the group consisting of polynucleotides composed of eight or more consecutive nucleotides including an SNP base located at the 101st position in each of the nucleotide sequences of SEQ ID NOs 49 to 64, or polynucleotides complementary to the same.

[0022] Preferably, the polynucleotide may be immobilized on a substrate coated with an active group of amino-silane, poly L-lysine, or aldehyde, but is not limited thereto. Preferably, the substrate may be a silicon wafer, glass, quartz, metal, or plastic, but is not limited thereto. Methods for immobilizing the polynucleotide on the substrate may include micropipetting using a piezoelectric method, a method using a pin-shaped spotter, etc.

[0023] The microarray according to the invention can be manufactured by conventional methods known to those skilled in the art using the polynucleotide or its complementary polynucleotide according to the invention, the polypeptide encoded by it, or its cDNA.

[0024] The present invention also provides a probe for identifying disease-resistant or susceptible soybean genetic resources, comprising one or more polynucleotides selected from the group consisting of polynucleotides composed of eight or more consecutive nucleotides including an SNP base located at the 101st position in each of the nucleotide sequences of SEQ ID NOs 49 to 64, or polynucleotides complementary to the same.

[0025] In this specification, the term 'probe' refers to a hybridization probe comprising a natural or modified monomer or a linear oligomer having a bond, comprising a deoxyribonucleotide and a ribonucleotide, capable of sequence-specifically binding to the complementary strand of a nucleic acid. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species, so that it hybridizes to a DNA fragment derived from one member but not to a fragment derived from the other member. Preferably, the probe may be a single strand, more preferably a deoxyribonucleotide, for maximum efficiency in hybridization, but is not limited thereto.

[0026] In this specification, the term 'hybridization' means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur between two nucleic acid strands that are completely matched or substantially matched with some mismatch. The complementarity for hybridization may vary depending on the hybridization conditions, particularly temperature.

[0027] As a probe used in the present invention, a sequence that is perfectly complementary to the polynucleotide containing the SNP may be used, but a sequence that is substantially complementary may also be used within a range that does not interfere with specific hybridization. Preferably, the probe used in the present invention comprises a sequence that can hybridize to a sequence comprising 8 to 100 consecutive nucleotides, including the nucleotide at the 101st position of SEQ ID NOs 49 to 64, which are SNP nucleotides. More preferably, the 3'-terminus or 5'-terminus of the probe has a base complementary to the SNP base. Generally, since the stability of a duplex formed by hybridization tends to be determined by the matching of the terminal sequences, if the terminal portion of a probe having a base complementary to the SNP base at the 3'-terminus or 5'-terminus does not hybridize, such a duplex may be disassembled under strict conditions. Suitable conditions for hybridization can be determined by referring to what is commonly known in the art. The stringent conditions used for hybridization must be sufficiently stringent to hybridize to only one of the alleles, and can be determined by controlling factors such as temperature, ionic strength (buffer concentration), and the presence of compounds like organic solvents. These stringent conditions may be determined differently depending on the sequence being hybridized.

[0028] The present invention also provides a KASP (kompetitive allele specific PCR) primer set composition for identifying disease-resistant or susceptible soybean genetic resources, comprising one or more primer sets selected from the group consisting of 16 oligonucleotide primer sets, characterized in that three adjacent oligonucleotides starting from SEQ ID NO. 1 are one primer set among the oligonucleotides represented by SEQ ID NO. 1 to 48.

[0029] In the present invention, the term "KASP" is one of the PCR (polymerase chain reaction) based analysis methods and is a homogeneous and fluorescence-based genotyping technique. KASP is a technique based on fluorescence resonance energy transfer for allele-specific oligo extension and signal generation.

[0030] The KASP primer set composition of the present invention is a Phytophthora material, which is a soybean late blight pathogen ( Phytophthora sojae This is a primer set for detecting the base type of a single nucleotide polymorphism (SNP) that is specifically differentiated in the 55,912,198–56,412,565 bp region within chromosome 18 of soybeans showing resistance or susceptibility to late blight caused by the KACC 40468 strain. The primer set composition of the present invention was produced using the genome sequence of a population of recombinant inbred lines (RIL) with the 'Cheonal' variety, which shows resistance to late blight, and the 'Daepung' variety, which shows susceptibility, as the parent and parent, and it is possible to determine resistance or susceptibility to late blight for various soybean genetic resources, not limited to a small number of soybean varieties.

[0031] The KASP primer set composition of the present invention comprises three consecutive oligonucleotides of sequence number 3 forming a primer set, and consists of two forward primers and one reverse primer. In the primer set composition of the present invention, the three adjacent oligonucleotides are composed, in order, of a forward primer bound to FAM, a forward primer bound to HEX, and a reverse primer. Specifically, a FAM or HEX fluorescent substance is attached to the 5' end of the forward primer and a base representing an SNP is bound to the 3' end, and it is composed of one common reverse primer.

[0032] The KASP primer set composition of the present invention may preferably include one or more primer sets selected from the group consisting of the 16 primer sets, and using the 16 primer sets simultaneously can effectively identify soybean genetic resources resistant to or susceptible to late blight.

[0033] Depending on the sequence length of each primer, the above primer may include an oligonucleotide composed of a fragment of 29 or more, 30 or more, 31 or more, 32 or more, or 33 or more consecutive nucleotides within the sequences of SEQ ID NOs 1 to 48. For example, the primer of SEQ ID NO. 1 (34 oligonucleotides) may include an oligonucleotide composed of a fragment of 31 or more, 32 or more, or 33 or more consecutive nucleotides within the sequence of SEQ ID NO. 1. Additionally, the above primer may also include a sequence that has been added, deleted, or substituted from the nucleotide sequences of SEQ ID NOs 1 to 48 that can bind to an amplification site. The oligonucleotide primers of SEQ NOs 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43 and 46 are forward primers attached with the fluorescent substance FAM, the oligonucleotide primers of SEQ NOs 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, 41, 44 and 47 are forward primers attached with the fluorescent substance HEX, and the oligonucleotide primers of SEQ NOs 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45 and 48 are reverse primers.

[0034] In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer must allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the complexity of the required DNA or RNA target, as well as primer usage conditions such as temperature and ionic strength.

[0035] In this specification, the oligonucleotide used as a primer may also comprise a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate, or a peptide nucleic acid, or may comprise an intercalating agent. Additionally, the primer may incorporate additional features that do not alter the basic properties of the primer acting as a starting point for DNA synthesis. The primer nucleic acid sequence of the present invention may include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical, or chemical means, if necessary. Examples of labels include enzymes (e.g., HRP (horse radish peroxidase), alkaline phosphatase), radioisotopes (e.g., 32 There are P), fluorescent molecules, chemical groups (e.g., biotin), etc.

[0036] The appropriate length of the primer is determined by the characteristics of the primer to be used. The primer does not need to be exactly complementary to the template sequence, but must be complementary enough to form a hybrid complex with the template.

[0037] The present invention also provides a kit for determining disease-resistant or susceptible soybean genetic resources, comprising: the KASP primer set composition; and a reagent for performing an amplification reaction.

[0038] In the kit of the present invention, the KASP primer set composition is as described above.

[0039] In the kit of the present invention, the reagent for performing the amplification reaction may include, but is not limited to, DNA polymerase, dNTPs, and a buffer.

[0040] The kit of the present invention may also additionally include a user guide describing optimal reaction performance conditions. The guide is a printed document explaining how to use the kit, for example, how to prepare PCR buffer, the presented reaction conditions, etc. The guide includes instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Additionally, the guide includes information disclosed or provided through electronic media, such as the Internet.

[0041] The present invention also,

[0042] Step of isolating genomic DNA from a soybean sample;

[0043] A step of performing KASP using the above-described isolated genomic DNA as a template and the KASP primer set composition of the present invention; and

[0044] A method for determining disease-resistant or susceptible soybean genetic resources is provided, comprising the step of analyzing the amplification product of the above KASP.

[0045] In a method according to one embodiment of the present invention, the KASP primer set composition is as described above.

[0046] The method of the present invention includes the step of isolating genomic DNA from a soybean sample. The method of isolating genomic DNA from the soybean sample may utilize methods known in the art, for example, the CTAB method or the Wizard prep kit (Promega). Using the isolated genomic DNA as a template, an amplification reaction may be performed using a primer set composition according to one embodiment of the present invention to amplify a target sequence. Methods for amplifying the target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification, or amplification via Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a primer pair that specifically binds to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

[0047] In a method according to one embodiment of the present invention, the soybean sample may be a leaf, stem, root, fruit, or seed of a plant, but is not limited thereto.

[0048] In one embodiment of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance may be a fluorescent, phosphorescent, or radioactive substance, but is not limited thereto. Preferably, the labeling substance may be FAM, HEX, VIC, JOE, ROX, TAMRA, Cy3, or Cy5, etc. When PCR is performed by labeling the 5' end of a primer with the labeling substance during the amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling substance. The set of oligonucleotide primers used to amplify the target sequence is as described in Tables 3 and 4 below.

[0049] In addition, in a method according to one embodiment of the present invention, the step of analyzing the amplification product of the KASP can be performed through genotype analysis. Specifically, the genotype can be distinguished through a fluorescent substance FAM or HEX attached to the 5' end of a forward primer and an SNP attached to the 3' end.

[0051] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.

[0053] Materials and Methods

[0054] 1. Plant materials

[0055] The present invention relates to soybean blight pathogens ( Phytophthora sojae A segregation population consisting of 36 recombinant inbred lines (RIL) was used, created by crossing the 'Daepung' variety, which is susceptible to KACC 40468, and the 'Cheonal' variety, which is resistant, as the maternal and paternal parents, respectively.

[0057] 2. DNA Extraction and SNP (Single Nucleotide Polymorphism) Marker Analysis

[0058] Young leaves were collected from seedlings of 36 lines from the Daepung (maternal parent), Cheonal (paternal parent), and RIL populations, and genomic DNA was extracted using the CTAB (Cetyl Trimethyl Ammonium Bromide) method. For each DNA sample, Axiom ® SNP genotype analysis was performed using the 180K SoyaSNP array (Affymetrix, USA).

[0060] 3. Phenotyping for plague

[0061] Soybean late blight pathogen 40468 was inoculated onto V8 medium and cultured for 10 days, after which the medium was ground together with the pathogen using a syringe to prepare an inoculum. The soybean lines (genetic resources) to be used for inoculation were sown in circular pots with 15 seeds each and germinated in a growth chamber. Inoculation was performed by making a 1 cm longitudinal incision in the middle of the upper hypocotyl of a 7-day-old seedling using a medical knife, and filling the incision site with the ground V8 medium. The medium was ground by passing it through a 50 ml syringe twice. After grinding, approximately 0.4 ml of medium was inoculated using a 10 ml syringe and an 18 gauge (G) needle to ensure sufficient medium reached the internal vascular bundle system of the hypocotyl incision site.

[0062] After inoculation, the plants were subjected to high humidity for approximately 16 hours and then cultured in a growth bed set at 25°C with a day / night length of 16:8 (L:D)h. Seven days after inoculation, the resistance or susceptibility response of each seedling was counted, and the ratio (%) of the number of dead seedlings to the total number of seedlings was calculated as follows: (Number of dead seedlings / Total number of seedlings) × 100 (%).

[0063] The phenotype was determined as resistant if the proportion of dead seedlings was 20% or less, susceptible if 80% or more, and intermediate if exceeding 20% ​​but less than 80%. The above method was repeated three times per line.

[0065] 4. Construction of single nucleotide variant-based gene mapping and analysis of disease resistance-associated loci

[0066] The gene map was constructed using IciMapping (version 4.2) software. After obtaining 169,028 high-quality SNP data distributed across the entire genome, 22,637 SNPs exhibiting polymorphism between the mother and father were filtered. SNPs with significant redundancy in the results were removed through binning, and the gene map was ultimately constructed using 2,322 SNPs. Subsequently, the locations of loci associated with blight resistance were identified through single-factor analysis of variance and interval mapping.

[0068] 5. Preparation of KASP (Kompetitive Allele Specific PCR) Primer Set

[0069] Based on the results of genetic analysis, 16 SNPs (Tables 1 and 2) located in the gene region and capable of specifically responding to each allele were selected from among 52 SNPs existing in the 55,912,198–56,412,565 bp range of soybean chromosome 18, and KASP primer sets (Tables 3 and 4) were developed. Each primer set includes two allele-specific forward primers and a common reverse primer. In the KASP primer sets, two types of oligotails corresponding to FRET cassettes in the master mix are attached to the 5'-ends of the two allele-specific forward primers, allowing for genotype analysis through differences in fluorescent substances that vary according to the allele type. In the present invention, within the parentheses in Tables 1 and 2 below, the SNP bases to the left of the ' / ' represent SNPs related to blight susceptibility, and the SNP bases to the right represent SNPs related to blight resistance.

[0070] SNP marker information of the present invention (1) chromosome Physical location (bp) SNP ID Sequence information Sequence number 18 55,912,849 AX-90485402 AGACGAAATAAACAACTAGTACCTAACCATACTAAAATAACAGAAGTGGTTGATGATCAAATATTTGGCTTCTAGTTAAATATATTATTGTATTTGGAGG [C / T] CCCAGAACGAGTGGCTCTTGAGTCATCAAATTCATCAACCCTTCTTTCTTCTTGCTCTTTGAGATGAAACTGCCTTTCCAAATCTCCTTTTTCCTCCAAA 49 55,944,116 AX-90490662 ATGCCTATGAATTGCTCTTGCAAAGATGATCCTTCCCATAATAAACGCCAATGCACTTGTAATGTTGTGTGTAACACATGAGACAATTTTGCCTCTAGAG [T / G] GCACTTCAGTCCAAATTATTCATAAAATAAAAAAACGGTGTACTGATCTTGTAATTTCTCTACATATGTTGAGAATTTTAAAAGCCCATCACCTAATGTTC 50 55,983,605 AX-90402411 GCTCATATATGCTTACAGGTACTGGAGGCTTCTTAGGTGACCAAGAGAGGGAGGAATCCCCCCACTGAAGAAGTTGTTAGAGAGATCAAGCGTTTGAAGC [T / C] TTGAAAGTTTGCCTAACTCTGAAGGGATTGGTCCACTTATGTTGTTATTCTGTAGCAGCCTGAAAAGTAGTCCAAAAAACCCTTCTTAGTGAACAAAGAA 51 56,037,382 AX-90400765 ACATTTTTATTTTAAATATTATTTTCCATGTTCCTCTTCCTTATTAATTTTGTTGCAAATTCATTTCTGTGCATGTTCACTACGCTAAGTTCAAAAATGG [G / A] AGATCGATGCAATTGCACATGTTAAGGTTTGAAACAAATTGTGATTGCACCCAAGTTTCCAATTTGAATATTGAACACAAAACTGAAACAAAGTTCCGAT 52 56,075,982 AX-90487878 CTCTTCTTTTTTTTGTTCTTATCTCTTTTTTATTGAACAAATTTTTATCAAGGAAAAATATAAATACATGTGCCTTGTCATTTTACTTGTAGCCTGGTTAG [C / T] TCACCTAAGTCCATTATGATATTCAACTAATTCAAGGATTAGGTAAATGATCAAATGGAAGTAACATGCATGAAAGCATCAAGCATGCATGCCGAGGAAA 53 56,102,697 AX-90476841 TCCCACAATTCAGGTATTTCATCGTGTTATGTACTACCAACTACTACATTAGGAATGTATTATTTGTTGGTTCTTCAATGTTGTTTGTTGTTAACCTTG [G / A] AAATTTGTTACTGAGATAAATATCAAAAGAATTTCCCAGTAGTGCTTAAACTTGAATTAGATACTCTCAGATATAATGGATTCTGTTTCCTGGATACTTC 54 56,123,124 AX-90413289 AGCACATGTGGATCGAATAAAAGGAAAAGGTGTTCGTATATGCTCCTCCATTGATCATGATCATGTTCAGAACAATATCATATACGGTTCAAATCATTCG [T / C] AAGAAGCTATAAATGCTATGACTCCATTACAAGGTACAACTACTTTGTCACTCTCACTGGAAGAAGAAAAAAAAACTAACTTAACTTTAACTTTACCCT 55 56,144,514 AX-90344000 ACGTTAGAAGAGACTTAAGTGCTGAAATTGTACTAAATGAAACTATTATAATTTAATATAGTACACAAGGCTAGGCATAAAGCACCCATTTCCATTTAAT [C / A] ATTTAAATATGGAAAGTGTTGCAACTGAATACAATAAATGACCTCTCATGCTGAATTTTTTGGCACCTTTTCACTCTAGGCTGTATTAAACACTGTTTAA 56

[0071] SNP marker information of the present invention (2) chromosome Physical location (bp) SNP ID Sequence information Sequence number 18 56,187,634 AX-90413871 CTCACCATGTGATTCACACCTCTCTTCCACCGTCCACTCGTTAACCCAGTAATCTCCATTTGTCTTTCCCATATGATATATATATCACCTTTGCCTTCAA [C / T] ACATCCCACATAACATAACCTCTTGTTTTGTCATCTAAGAAAACCTAGTGAGAGTAAGCACACATTGATCAGCAACAATGGCAGCCTACTCAAGCCATGC 57 56,214,870 AX-90448445 TTGATTCCCTCATCATTACTCCTATGATTCTCCAATTTTCTCCTCCCAATTTCCTTTTGCCAGCTGTGTTTTCTGTTGAGCATTTCCCTCTTCCAACCGA [C / T] TTCTCCACTCCTTCTCTTCCTTCTTTCATCAAATTCCATCCTGGCCCCCTTTTTCTCATCTTCTTTGGCACACCTAAAGGCCCATTTTTTCATTTCTTCC 58 56,232,280 AX-90374236 AGATCGGCTTAGCTCAACCTTTAGCCTCTTCCTGATAGTATCATCTCTACCTTAAAGAATGGAGAGCTGCCTCTGCAGCTCAAACATCATAATATTCAAT [C / T] AACTTGTGATGTTGATCATGTGGGTTTTTACGTTCCAACTTTGCATGTTGTAATGTCATAAGTTATTAGTTTAAGGTATTGATAACAAATTAACCTAAAA 59 56,278,301 AX-90453819 GGCGGCGGAGACTCCGGTGGCGGTGGCGGAGGCGGCGTCGGCGGGGGATGAGGAGGTGCACCTCTATGATAGTAATCGGAGGGTTGGGAGTGAGGATGGG [T / C] TGTTCTCGGATTCTGAGAAGGACGAGGTTTTGCTTTTAGCCGCTGCCAAGGATGTTCCTGCACCTGTTCCTCTCTCAGGTTCAATTTTGGACATTGTGTG 60 56,299,436 AX-90516634 GATTGGTGAGTGAGACCACAACTAAATTATAATAATAATTGACAAAGGTTTTTTTTCCTAATTTAACTTGGAATACTTCTAGTTTTTCAGTGGTGTATAT [T / C] TGGATGCATCAATATCAATAGCAATAAGTAATAACAATAAAAGATTGCCTTGATTGATGGCATTGCATATATGGGTATGGTATTGCCAATAAGATGTTTAT 61 56,321,318 AX-90428430 CTCACAATCCAATAACGATCCAAAAATCATAGAAAGCAGAGCCAGCCAACCAACAAACGAAACAAACGAGAAATCGAGATCTAAAATAATGGGAA [G / A] AGTTTTAAGCGAAGTGATTAAATTAGGGTTCCAATTTCGTTCCTTCGAAAATCTCAGATTTAGGGCGCAACAACAGTGTTAAAAAACCAAAATCGGAAGT 62 56,353,723 AX-90370966 CACTGAAGTTCAAGTTCTTGTGTGTAAAATGGCCAACATTTTCCTACACAATGGGGGCAACACTTGCAAGGCTACCCTCTATCTCTTATTCATAACCACA [A / G] CCTTTTTTATCGCAAACTCTGCAAGGATTCTAGATGAAGTGGAATCCCAACCCCAAGCCATAGGCAATCTACCAGCACCTGGAGCTACCAATCCTTCACT 63 56,370,352 AX-90510781 ATGCCTTAAGAATTACCCTCAGCAACTAAAGCACACATAAGATATAGTGCATTTGAATGAATCTAAGATCACAGGTCAACAAAAAAACTGAAAAATCACAT [T / C] ATTAGCCAAACTACTTAAATATTAGACAACTTGAAAAATAAATACATTGACCCGTTGTAGGGTGATAAAGAAAGGGAAGAAGATTATCAAACTTGCTTC 64

[0072] Information on the primer set for KASP of the present invention (1) No. SNP ID Primer name direction Primer sequence information (5' → 3') Sequence number 1 AX-90485402 PS_18_55912849 Forward direction GCTTCTAGTTAAATATATTATTGTATTTGGAGGC 1 Forward direction CTTCTAGTTAAATATATTATTGTATTTGGAGGT 2 reverse direction AATTTGATGACTCAAGAGCCACTCGTT 3 2 AX-90490662 PS_18_55944116 Forward direction TTTTATTTTATGAATAATTTGGACTGAAGTGCA 4 Forward direction TTATTTTATGAATAATTTGGACTGAAGTGCC 5 reverse direction GTGTAACACATGAGACAATTTTGCCTCTA 6 3 AX-90402411 PS_18_55983605 Forward direction TGTTAGAGAGATCAAGCGTTTGAAGCT 7 Forward direction TTAGAGAGATCAAGCGTTTGAAGCC 8 reverse direction AATCCCTTCAGAGTTAGGCAAACTTTCAA 9 4 AX-90400765 PS_18_56037382 Forward direction CTTAACATGTGCAATTGCATCGATCTC 10 Forward direction CTTAACATGTGCAATTGCATCGATCTT 11 reverse direction TGTGCATGTTCACTACGCTAAGTTCAAA 12 5 AX-90487878 PS_18_56075982 Forward direction GTTGAATATCATAATGGACTTAGGTGAG 13 Forward direction ATTAGTTGAATATCATAATGGACTTAGGTGAA 14 reverse direction TGCCTTGTCATTTTACTTGTAGCTGGTTA 15 6 AX-90476841 PS_18_56102697 Forward direction CTTCAATGTTGTTTGTTGTTAACCTTGG 16 Forward direction TTCTTCAATGTTGTTTGTTGTTAACCTTGA 17 reverse direction GTTTAAGCACTACTGGGAAATTCTTTTGAT 18 7 AX-90413289 PS_18_56123124 Forward direction ACAATATCATATACGGTTCAAATCATTCGT 19 Forward direction CAATATCATATACGGTTCAAATCATTCGC 20 reverse direction GTAATGGAGTCATAGCATTTATAGCTTCTT 21 8 AX-90344000 PS_18_56144514 Forward direction TTCAGTTGCACACTTTCCATATTTAAATG 22 Forward direction TATTCAGTTGCAACACTTTCCATATTTAAATT 23 reverse direction CTAGGCATAAAGCACCCATTTCCATTTAA 24

[0073] Information on the primer set for KASP of the present invention (2) No. SNP ID Primer name direction Primer sequence information (5' → 3') Sequence number 9 AX-90413871 PS_18_56187634 Forward direction CAAGAGGTTATGTTATGTGGGATGTG 25 Forward direction ACAAGAGGTTATGTTATGTGGGATGTA 26 reverse direction CCAGTAATCTCCATTTGTCTTTCCCATAT 27 10 AX-90448445 PS_18_56214870 Forward direction GCATTTCCCTCTTCCAACCGAC 28 Forward direction AGCATTTCCCTCTTCCAACCGAT 29 reverse direction GAAAGAAGGAAGAGAAGGAGTGGAGAA 30 11 AX-90374236 PS_18_56232280 Forward direction CCCACATGATCAACATCACAAGTTG 31 Forward direction AACCCACATGATCAACATCACAAGTTA 32 reverse direction TGCCTCTGCAGCTCAAACATCATAATATT 33 12 AX-90453819 PS_18_56278301 Forward direction GTCCTTCTCAGAATCCGAGAACAA 34 Forward direction TCCTTCTCAGAATCCGAGAACAG 35 reverse direction TCGGAGGGTTGGGAGTGAGGAT 36 13 AX-90516634 PS_18_56299436 Forward direction TACTTATTGCTATTGATATTGATGCATCCAA 37 Forward direction CTTATTGCTATTGATATTGATGCATCCAG 38 reverse direction GGAATACTTCTAGTTTTTTCAGTGGTGTATA 39 14 AX-90428430 PS_18_56321318 Forward direction TCGAATCGAGATCTAAAATAATGGGAAG 40 Forward direction AATCGAATCGAGATCTAAAATAATGGGAAA 41 reverse direction GGAACCCTAATTTAATCACTTCGCCTTAA 42 15 AX-90370966 PS_18_56353723 Forward direction CCCTCTATCTCTTATTCATAACCACAA 43 Forward direction CCTCTATCTCTTATTCATAACCACAG 44 reverse direction TCTAGAATCCTTGCAGAGTTTGCGATAAA 45 16 AX-90510781 PS_18_56370352 Forward direction AAGTTGTCTAATATTTAAGTAGTTGGCTAATA 46 Forward direction GTTGTCTAATATTTAAGTAGTTTGGCTAATG 47 reverse direction TGAATGAATCTAAGATCACAGGTCAAACAAA 48

[0076] 6. KASP (kompetitive allele specific PCR) analysis

[0077] To confirm the specific amplification of the KASP primer set, 16 KASP primer sets of the present invention were applied to each of the following: 36 RIL population lines (18 resistant lines, 18 susceptible lines), Daepung and Cheonal used as maternal and paternal parents, synthetic heterozygosity samples mixed with Daepung and Cheonal DNA, and a negative control group (water). The KASP reaction was performed using QuantStudio3 Real-Time PCR (Applied Biosystems, Thermo Fisher Scientific, USA), and the KASP reagent reaction composition and execution conditions were carried out according to the user manual of LGC genomics (Laboratory of the Government Chemist genomics) (Tables 5 and 6).

[0078] KASP Reactant Reagent Composition furtherance Usage (µl) DNA (2 ng / µl) 5.00 2x KASP Master mix 5.00 KASP Assay Mix 0.14 Total amount 10.14

[0079] KASP conditions steppe temperature hour Cycle (number of times) Hot-start activation 94℃ 15 minutes 1 Denture 94℃ 20 seconds 10 Annealing / Elongation 61-55℃ 1 minute (0.6℃ decrease per cycle) Denture 94℃ 20 seconds 29 Annealing / Elongation 55℃ 1 minute Denture 94℃ 20 seconds 3 Annealing / Elongation * 57℃ 1 minute

[0080] * Perform additional steps if PCR amplification amount is low.

[0082] Example 1. Results of Phenotype Test for Blight Resistance and Analysis of Variance

[0083] Phenotypic analysis of strain 40468 within the RIL population revealed that it was separated into 18 blight-resistant and 18 susceptible strains, confirming a phenotypic segregation ratio of 1:1 within the RIL population. This indicated that the observed blight response was phenotypic segregation caused by a single gene.

[0084] In addition, a total of 22,637 SNPs were used in the analysis of variance, and the analysis revealed 52 highly significant SNPs in the chromosome 18 region from 55,912,198 to 56,370,352 bp. The phenotypic variance explained by the markers was approximately 98%, which indicates a very high probability that disease resistance genes exist in the genomic regions where these SNPs are located (Tables 7 and 8).

[0085]

[0086]

[0088] Example 2. Gene mapping and association analysis of phenotypes

[0089] The total length of the gene map constructed with a total of 2,322 SNPs is 2,407 cM, and the locations and arrangements of the SNPs on the map generally correspond to the information on 20 known soybean chromosomes. The number of marker bins on the gene map is 785, and the average distance between markers calculated by dividing the total length by the number of bins is 3.1 cM (Table 9).

[0090] Exceptionally, for chromosomes 7 and 19, results for 8,126 and 8,166 SNPs were obtained from the SNP chip data, respectively; however, only 26 and 86 SNPs, respectively, exhibited polymorphism during the preprocessing stage. Consequently, the chromosomal regions covered by the gene maps were limited to specific areas, and the average spacing between SNPs was 8.2 cM and 9.0 cM, which is 2 to 4 times farther than that of other chromosomes. Excluding chromosomes 7 and 19, SNPs in the remaining 18 chromosomes are evenly distributed, with an average of 127 markers per chromosome and an average distance of 2.9 cM.

[0091]

[0093] In addition, as a result of association analysis on the resistance of strain 40468 using the constructed gene map and resistance test results, a locus explaining 93.9% (LOD=23.1) of the phenotypic variation was discovered in the region of 55,912,198–56,412,565 bp on chromosome 18, and it was confirmed that this region includes the region identified by the one-way ANOVA results (Table 10 and Fig. 2).

[0094] According to a predicted gene model based on the soybean standard genome (Glyma.Wm82.a2.v1), there are a total of 63 genes in the region, 9 of which are genes that synthesize the LRR (leucine rich repeat) domain or STK (serine / threonine kinase), which are well known to be associated with plant immune responses.

[0095]

[0097] Example 3. Verification of the KASP primer set of the present invention

[0098] KASP analysis was performed by applying the KASP primer set of the present invention (refer to Tables 3 and 4 above) to 36 RIL population lines (18 resistant lines, 18 susceptible lines), Daepung and Cheonal used as the maternal and paternal parents, and synthetic heterozygotes containing all alleles of Daepung and Cheonal.

[0099] As a result, it was confirmed that the phenotypic results regarding disease resistance or susceptibility corresponded to the genotypic segregation of the KASP primer set. The 18 resistant lines from the RIL population containing Cheon-al alleles, used as paternal lines, appeared on the x-axis due to the HEX fluorescence, while the 18 susceptible lines from the RIL population containing Daepung alleles, used as maternal lines, appeared closer to the y-axis due to the FAM fluorescence. Additionally, the synthetic heterozygos were located in the middle of the two groups (Fig. 3).

Claims

Claim 1 An SNP marker composition for identifying disease-resistant or susceptible soybean genetic resources, comprising one or more polynucleotides selected from the group consisting of 16 polynucleotides composed of 8 or more consecutive nucleotides including a single nucleotide polymorphism (SNP) base located at the 101st position of each of the 16 polynucleotides formed by the nucleotide sequences of SEQ ID NOs 49 to 64, or polynucleotides complementary thereof. Claim 2 A microarray for identifying disease-resistant or susceptible soybean genetic resources comprising a polynucleotide containing the SNP bases described in claim 1 or the cDNA thereof. Claim 3 A probe for determining disease-resistant or susceptible soybean genetic resources comprising a polynucleotide containing the SNP bases described in claim 1 or the cDNA thereof. Claim 4 Oligonucleotide primer set of SEQ ID NOs 1 to 3, oligonucleotide primer set of SEQ ID NOs 4 to 6, oligonucleotide primer set of SEQ ID NOs 7 to 9, oligonucleotide primer set of SEQ ID NOs 10 to 12, oligonucleotide primer set of SEQ ID NOs 13 to 15, oligonucleotide primer set of SEQ ID NOs 16 to 18, oligonucleotide primer set of SEQ ID NOs 19 to 21, oligonucleotide primer set of SEQ ID NOs 22 to 24, oligonucleotide primer set of SEQ ID NOs 25 to 27, oligonucleotide primer set of SEQ ID NOs 28 to 30, oligonucleotide primer set of SEQ ID NOs 31 to 33, oligonucleotide primer set of SEQ ID NOs 34 to 36, oligonucleotide primer set of SEQ ID NOs 37 to 39, oligonucleotide primer set of SEQ ID NOs 40 to 42, oligonucleotide primer set of SEQ ID NOs 43 to 45, and SEQ ID NOs 46 to 48 A KASP (kompetitive allele specific PCR) primer set composition for identifying disease-resistant or susceptible soybean genetic resources, comprising one or more primer sets selected from the group consisting of oligonucleotide primer sets. Claim 5 A kit for determining disease-resistant or susceptible soybean genetic resources, comprising: the KASP primer set composition of claim 4; and a reagent for performing an amplification reaction. Claim 6 In claim 5, the kit comprises a reagent for performing the amplification reaction, the reagent comprising DNA polymerase, dNTPs, and a buffer. Claim 7 A method for determining disease-resistant or susceptible soybean genetic resources, comprising: a step of isolating genomic DNA from a soybean sample; a step of performing KASP using the isolated genomic DNA as a template and the KASP primer set composition of claim 4; and a step of analyzing the amplification product of the KASP. Claim 8 A method according to claim 7, characterized in that the step of analyzing the amplified product is performed through fluorescence measurement, phosphorescence measurement, or radioactivity measurement.

Images