Cyclin-dependent kinase 2 biomarkers and their uses

Abstract

Biomarkers are provided that predict and / or indicate an individual's responsiveness to cyclin-dependent kinase 2 (CDK2) inhibitors. The biomarkers, compositions, and methods described herein are useful for selecting appropriate treatment modalities and monitoring treatment for individuals who have, are suspected of having, or are at risk of developing a disease or disorder associated with CDK2.

Description

Technology Field

[0001] Related applications

[0002] This application claims priority to US Patent Application No. 62 / 806,265 filed February 15, 2019, which is incorporated herein by reference in its entirety.

[0003] Sequence list

[0004] This application contains a sequence list, which was submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The said ASCII copy created on January 23, 2020, is named 20443-0588WO1_SL.txt and is 15,865 bytes in size.

[0005] Technology field

[0006] The present invention relates generally to biomarkers and cancer. Background Technology

[0007] background

[0008] Cyclin-dependent kinases ("CDKs") are a family of serine / threonine kinases. When heteromerized with a regulatory subunit known as a cycline, CDKs become fully activated and serve as the driving force behind the cell cycle and cell division. Uncontrolled proliferation is a hallmark of cancer cells, and dysregulation of CDK function occurs with high frequency in many tumors. CDK2 and CDK4 receive particular attention because dysregulation of their activity occurs frequently in a wide variety of human cancers. For this reason, CDKs are recognized as attractive targets for the design and development of compounds that can specifically bind to cancer cells and inhibit CDK activity in these cells, thereby serving as therapeutic agents. Poisonous and highly selective CDK4 / 6 inhibitors, palbociclib, abemaciclib, and ribociclib, have been developed and approved by the U.S. Food and Drug Administration ("FDA") for the treatment of ER+ advanced breast tumors. Despite significant efforts, there are currently no FDA-approved agents targeting CDK2. The lack of biomarkers reliably reporting CDK2 enzymatic and / or oncogenic activity has hindered the development of effective target-associated assays for lead discovery and optimization. Identifying biomarkers of CDK2-mediated oncogenesis is clearly required to provide rapid and effective means for the development and evaluation of CDK2-targeted anticancer therapies. The problem to be solved

[0009] summation

[0010] The present invention is at least partially based on the discovery that the functional status of cyclin-dependent kinase inhibitor 2A ("CDKN2A"; also referred to as "p16") is a biomarker for predicting sensitivity to CDK2-targeted therapy in G1 / S-specific cyclin-E1- ("CCNE1-") amplified cells suitable for use in patient stratification. In addition, the present invention is at least partially based on the discovery that in CCNE1-amplified cell lines, the level of human retinoblastoma-associated protein ("Rb") phosphorylation at the serine corresponding to amino acid position 780 of SEQ ID NO: 3 is a pharmacodynamic marker for CDK2 activity and is suitable for use in cell assays or in preclinical and clinical applications to measure CDK2 enzyme activity, for example, to monitor the progression of responsiveness to treatment with CDK2 inhibitors.

[0011] The present invention features a method for treating a human individual who has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2, said method comprising administering a CDK2 inhibitor to the human individual, wherein the human individual (i) has a nucleotide sequence encoding a p16 protein comprising the amino acid sequence of SEQ No. 1, (b) has a CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions, and / or (c) expresses the p16 protein, and (ii) has (a) amplification of the CCNE1 gene and / or (b) a previously determined expression level of CCNE1 higher than a control expression level of CCNE1 in a biological sample obtained from the human individual. In some embodiments, the individual has a disease or disorder associated with CDK2. In some embodiments, the individual is suspected of having, or is at risk of developing a disease or disorder associated with CDK2. In some embodiments, it was previously determined that a human individual has (i) a CDKN2A gene lacking (a) a nucleotide sequence encoding a p16 protein containing the amino acid sequence of SEQ No. 1 and / or (b) one or more inactivating nucleic acid substitutions and / or deletions, and (ii) an amplification of the CCNE1 gene within a biological specimen obtained from the human individual. In some embodiments, the CDKN2A gene encodes a protein containing the amino acid sequence of SEQ No. 1. In some embodiments, a second therapeutic agent is administered to the human individual in combination with a CDK2 inhibitor. In some embodiments, the second therapeutic agent is a BCL2 inhibitor or a CDK4 / 6 inhibitor.

[0012] The present invention also features a method for treating a human individual who suffers from, is suspected of suffering from, or is at risk of developing a disease or disorder associated with CDK2, said method comprising: (i) confirming, in a biological sample obtained from the human individual, the presence of (a) a nucleotide sequence encoding a p16 protein comprising the amino acid sequence of SEQ No. 1, (b) a CDKN2A gene lacking one or more inactivated nucleic acid substitutions, and / or (c) a p16 protein; (ii) confirming, in a biological sample obtained from the human individual, (a) amplification of the CCNE1 gene and / or (b) an expression level of CCNE1 higher than a control expression level of CCNE1; and (iii) administering a CDK2 inhibitor to the human individual. In some embodiments, the individual suffers from a disease or disorder associated with CDK2. In some embodiments, the individual is suspected of suffering from a disease or disorder associated with CDK2, or is at risk of developing such a disorder. In some embodiments, the method comprises: (i) confirming, in a biological sample obtained from a human individual, the presence of (a) a nucleotide sequence encoding a p16 protein comprising the amino acid sequence of SEQ No. 1, (b) a CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions, and / or (c) a p16 protein; (ii) confirming, in a biological sample obtained from a human individual, (a) the amplification of a CCNE1 gene; and (iii) administering a CDK2 inhibitor to the human individual. In some embodiments, the CDKN2A gene encodes a protein comprising the amino acid sequence of SEQ No. 1. In some embodiments, a second therapeutic agent is administered to the human individual in combination with the CDK2 inhibitor. In some embodiments, the second therapeutic agent is a BCL2 inhibitor or a CDK4 / 6 inhibitor.

[0013] The present invention also features a method for predicting the response of a human individual to a CDK2 inhibitor who has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2, said individual, said method comprising the steps of: (i) determining from a biological specimen obtained from the human individual, (a) the nucleotide sequence of the CDKN2A gene, (b) the presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions, and / or (c) the presence of the p16 protein; and (ii) from a biological specimen obtained from a human individual, the method comprises the step of determining (a) the number of copies of the CCNE1 gene and / or (b) the expression level of CCNE1, wherein (1) (a) the presence of a CDKN2A gene encoding a p16 protein comprising the amino acid sequence of SEQ No. 1, (b) the presence of a CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions and / or (c) the presence of the p16 protein, and (2) (a) amplification of the CCNE1 gene and / or (b) an expression level of CCNE1 higher than the control expression level of CCNE1 predicts that the human individual will respond to a CDK2 inhibitor. In some embodiments, the individual suffers from a disease or disorder associated with CDK2. In some embodiments, the individual is suspected of suffering from a disease or disorder associated with CDK2, or is at risk of developing such a disease or disorder.In some embodiments, the method comprises: (i) determining from a biological sample obtained from a human individual (a) the nucleotide sequence of the CDKN2A gene and / or (b) the presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions; and (ii) determining from a biological sample obtained from a human individual (a) the copy number of the CCNE1 gene, wherein (1) the presence of the CDKN2A gene encoding the p16 protein containing the amino acid sequence of (a) sequence number: 1 and / or (b) the presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions, and (2) the amplification of (a) the CCNE1 gene predicts that the human individual will respond to a CDK2 inhibitor.

[0014] In some embodiments of the method described above, the amplification of the CCNE1 gene comprises at least three gene copies. In some embodiments of the method described above, the amplification of the CCNE1 gene comprises at least five gene copies. In some embodiments of the method described above, the amplification of the CCNE1 gene comprises at least 21 gene copies.

[0015] In some embodiments of the method described above, the control expression level of CCNE1 is a pre-established cutoff value. In some embodiments of the method described above, the control expression level of CCNE1 is the expression level of CCNE1 in a sample or specimen obtained from one or more individuals who did not respond to treatment with a CDK2 inhibitor.

[0016] In some embodiments of the method described above, the expression level of CCNE1 is the expression level of CCNE1 mRNA. In some embodiments of the method described above, the expression level of CCNE1 is the expression level of CCNE1 protein. In some embodiments where the expression level of CCNE1 is the expression level of CCNE1 mRNA, the expression level of CCNE1 is measured by RNA sequencing, quantitative polymerase chain reaction (PCR), hybridization in situ, nucleic acid array, or RNA sequencing. In some embodiments where the expression level of CCNE1 is the expression level of CCNE1 protein, the expression level of CCNE1 is measured by Western blot, enzyme-linked immunosorbent assay, or immunohistochemical staining.

[0017] The present invention also features a method for assessing the CDKN2A gene and the CCNE1 gene, the method comprising the step of determining, from a biological specimen obtained from a human individual suffering from a disease or disorder associated with CDK2, (i) (a) the nucleotide sequence of the CDKN2A gene or (b) the presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions, and (ii) the copy number of the CCNE1 gene.

[0018] The present invention also features a method for evaluating the response of a human individual to a CDK2 inhibitor who has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2, said method comprising: (a) administering a CDK2 inhibitor to a human individual, wherein the human individual is previously determined to have amplification of the CCNE1 gene and / or a CCNE1 expression level higher than a control expression level of CCNE1; and (b) measuring the level of retinoblastoma (Rb) protein phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3 in a biological sample obtained from the individual following the administration of step (a), wherein a reduced level of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3, compared to a control level of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3, indicates that the human individual responds to the CDK2 inhibitor. In some embodiments, the individual has a disease or disorder associated with CDK2. In some embodiments, the individual is suspected of having a disease or disorder associated with CDK2, or is at risk of developing it. In some embodiments, biological specimens include blood specimens or tumor biopsy specimens.

[0019] The present invention also features a method for measuring the amount of protein in a sample, the method comprising: (a) providing a biological sample obtained from a human individual suffering from a disease or disorder associated with CDK2; and (b) measuring the level of Rb protein phosphorylation at serine corresponding to amino acid position 780 of SEQ ID NO: 3 within the biological sample. In some embodiments, the biological sample comprises a blood sample or a tumor biopsy sample.

[0020] In some specific embodiments of the method described above, the CDK2 inhibitor is the compound described below, or a pharmaceutically acceptable salt thereof.

[0021] In some specific examples of the aforementioned method, the disease or disorder associated with CDK2 is cancer.

[0022] Details regarding one or more embodiments of the present invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the present invention will be apparent from the detailed description, the drawings, and the claims. Brief explanation of the drawing

[0023] Description of the drawing Figs. 1a-b Characterization of ovarian and endometrial cell lines. Fig. 1a The cell lines used in the study included four cell lines with CCNE1 amplification and three cell lines without CCNE1 amplification. The number of CCNE1 amplification copies is indicated. Fig. 1b CCNE1 expression was determined by Western blot in the indicated cell lines. These blots show that cell lines with CCNE1 function acquired by copy number (CN > 2) expressed higher levels of CCNE1 protein compared to cell lines with copy neutrality or loss of function of the said gene (CN ≤ 2). GAPDH was detected as a loading control. Non-Amp, non-amplification; Amp, amplification. Figs. 2a-b : siRNA-mediated CDK2 knockdown inhibits proliferation in CCNE1-amplified cell lines. Fig. 2a CCNE1-amplified Fu-ov1 (top) and KLE (bottom) cells were harvested, and cell cycle analysis was performed 72 hours after transfection with either scrambled siRNAs ("Ctl") or CDK2 siRNAs. Cell cycle phase distributions were evaluated by FACS. Representative images of three distinct experiments are shown. Fig. 2b CDK2 knockdown was confirmed by Western blot analysis after transfection with CDK2 siRNA. GAPDH was used as a loading control. Figs. 3a-bCDK2 knockdown does not inhibit proliferation in CCNE1 non-Amp cell lines. Fig. 3a CCNE1 non-amplified COV504 and Igrov1 cells were harvested, and cell cycle analysis was performed 72 hours after transfection with Ctl siRNAs and CDK2 siRNAs. Cell cycle phase distribution was evaluated by FACS. Representative images of three distinct experiments are shown. Fig. 3b CDK2 knockdown was confirmed by Western blot analysis after transfection with CDK2 siRNA. GAPDH was used as a loading control. Fig. 4 : CDK2 knockdown by siRNA inhibits proliferation in CCNE1-amplified human cancer cell lines, but not in CCNE1-non-amplified human cancer cell lines. Percentage of cells in the S phase 3 days after transfection with CDK2 siRNAs compared to Ctl siRNA. Cell cycle phase distribution was evaluated by FACS. Means represent three independent experiments in four CCNE1 Amp cell lines and three non-Amp cell lines. Fig. 5 : Palbociclib treatment induces dose-dependent inhibition of proliferation in CCNE1 non-amplified cell lines, but not in amplified cell lines. Cell cycle analysis of CCNE1 non-amplified cell line COV504 (top) and CCNE1-amplified OVCAR3 cells (bottom) after 16 hours of palbociclib treatment. Cell cycle phase distribution was evaluated by FACS. Fig. 6 : Palbociclib treatment selectively inhibits proliferation in CCNE1 non-amplified cancer cell lines. Percentage of cells in the S phase after 16 hours of palbociclib at the indicated dose compared to DMSO. Figs. 7a-b CDK2 knockdown by siRNAs blocks RB phosphorylation at S780 in CCNE1-amplified ovarian cells, but not in non-amplified ovarian cells. Fig. 7aFour CCNE1 Amp cell lines, COV318, Fu-OV1, OVCAR3, and KLE cells were transfected with CDK2 siRNAs for 72 hours. Fig. 7b Three CCNE1 non-Amp cell lines, COV504, OV56, and Igrov1, were transfected with CDK2 siRNAs for 72 hours. Total protein was extracted from cells transfected with CDK2 siRNA or Ctl siRNA, and Western blotting was performed. GAPDH was used as a loading control. Figs. 8a-b : Palbociclib blocks RB phosphorylation at S780 in CCNE1 non-amplified ovarian cells, but not in amplified ovarian cells. Fig. 8a CCNE1 Amp OVCAR3 and COV318 cells were treated with various concentrations of palbociclib as indicated for 1 hour or 15 hours. Fig. 8b CCNE1 non-Amp COV504 and OV56 were treated with various concentrations of palbociclib as indicated for 1 or 15 hours. Total protein was extracted from these palbociclib or DMSO (control) treated cells, and Western blotting was performed on p-RB, phosphorylated retinoblastoma protein. GAPDH was used as a loading control. Figs. 9a-b : CDK2 degradation by dTAG reduces RB phosphorylation at S780. Fig. 9a : Chemical structure of dTAG. Fig. 9b : Degradation of CDK2-FKBP12(F36V) by CDK2-dTAG treatment for 14 hours inhibited RB phosphorylation at S780 in CDK2 knockout OVCAR3 cells (right, Cas9+, CDK2-FKBP12(F36V)-HA+, CDK2-gRNA), but not in OVCAR3 cells with endogenous CDK2 (left, Cas9+, CDK2-FKBP12(F36V)-HA+, Ctl-gRNA). Figs. 10a-b: p-RB S780 HTRF cell assay for confirmation of CDK2 inhibitor. Fig. 10a : IC in CDK2 biochemical kinase activity assay 50 . Fig. 10b : Concentration-response analysis of reference compounds tested in the p-RB S780 HTRF cell assay. HTRF, uniform time-resolved fluorescence. IC from the HTRF cell assay 50 The IC50 in the CDK2 enzyme assay 50 It relates to. Fig. 11 Bioinformatics analysis of the CCLE dataset reveals that sensitivity to CDK2 inhibition in CCNE1-amplified cells depends on functional p16. Fig. 11 Figure 1 illustrates the status of p16 in CDK2-sensitive versus insensitive cell lines. CCLE: Broad Institute Cancer Cell Line Encyclopedia (see Barretina below). Figs. 12a-b CCNE1-amplified cells with dysfunctional p16 do not respond to CDK2 inhibition. Fig. 12a Western blot analysis of p16 in three gastric cell lines with CCNE1 Amp. Fig. 12b : Percentage of cells in the S phase on day 3 after transfection with CDK2 siRNAs compared to Ctl siRNA. Cell cycle phase distribution was evaluated by FACS. Fig. 13 : p16 knockdown by siRNA abolishes CDK2 inhibition-induced cell cycle inhibition in CCNE1-amplified cells. Percentage of S-phase cells after p16 knockdown and CDK2 inhibitor treatment, normalized for cells treated with Ctl siRNA and DMSO. CCNE1-amplified COV318 cells were transfected with either Ctl siRNAs or p16 siRNA. 72 hours after transfection, cells were treated with 100 nM CDK2 inhibitor compound A. Cells were harvested, and cell cycle analysis was performed 16 hours after treatment. Specific details for implementing the invention

[0024] details

[0025] The present invention provides predictive markers (e.g., biomarkers and pharmacodynamic markers, e.g., gene copy number, gene sequence, expression level, or phosphorylation level) for identifying human individuals suffering from, suspected of suffering from, or at risk of developing a CDK2-associated disease or disorder for which administration of a CDK2 inhibitor is likely to be effective. The present invention also provides pharmacodynamic markers (e.g., phosphorylation level) for identifying human individuals suffering from, suspected of suffering from, or at risk of developing a CDK2-associated disease or disorder for which response to a CDK2 inhibitor is likely to be effective. The present invention also provides a method for treating human individuals suffering from, suspected of suffering from, or at risk of developing a CDK2-associated disease or disorder (e.g., cancer), and such a method comprises the step of administering a CDK2 inhibitor to the human individual.

[0026] Diseases and disorders associated with CDK2

[0027] CDK2-associated diseases or disorders are those in which the underlying pathology is wholly or partially mediated by CDK2. Such diseases include cancer and other diseases accompanied by proliferative disorders. In certain embodiments, CDK2-associated diseases or disorders are treatable with CDK2 inhibitors.

[0028] In some embodiments, a disease or disorder associated with CDK2 is a cancerous tumor containing an abnormality that activates CDK2 kinase activity. This includes, but is not limited to, cancers characterized by amplification or overexpression of CCNE1, such as ovarian cancer, uterine carcinosarcoma, and breast cancer, and cancers characterized by p27 inactivation, such as breast cancer and melanoma.

[0029] In some embodiments, CDK2-associated diseases or disorders include N-myc-amplified neuroblastoma (cf. Molenaar, et al., Proc Natl Acad Sci USA 106(31): 12968-12973), K-Ras mutant lung cancer (cf. Hu, S., et al., Mol Cancer Ther, 2015. 14(11): p. 2576-85), or cancers with FBW7 mutations and CCNE1 overexpression (cf. Takada, et al., Cancer Res , 2017. 77 (18): p. 4881-4893)

[0030] In some embodiments, the disease or disorder associated with CDK2 is pulmonary squamous cell carcinoma, pulmonary adenocarcinoma, pancreatic adenocarcinoma, breast invasive carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, gastric adenocarcinoma, esophageal carcinoma, bladder urothelial carcinoma, mesothelioma, or sarcoma.

[0031] In some specific examples, diseases or disorders associated with CDK2 are lung adenocarcinoma, breast invasive carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, or gastric adenocarcinoma.

[0032] In some embodiments, the disease or disorder associated with CDK2 is an adenocarcinoma, carcinoma, or cystadenocarcinoma.

[0033] In some specific examples, the disease or disorder associated with CDK2 is uterine cancer, ovarian cancer, gastric cancer, esophageal cancer, lung cancer, bladder cancer, pancreatic cancer, or breast cancer.

[0034] In some specific examples, the disease or disorder associated with CDK2 is cancer.

[0035] In some embodiments, the cancer is characterized by amplification or overexpression of CCNE1. In some embodiments, the cancer is ovarian cancer or breast cancer characterized by amplification or overexpression of CCNE1.

[0036] In some embodiments, breast cancer is breast cancer resistant to chemotherapy or radiation therapy, endocrine-resistant breast cancer, trastuzumab-resistant breast cancer, or breast cancer exhibiting primary or acquired resistance to CDK4 / 6 inhibition. In some embodiments, breast cancer is advanced or metastatic breast cancer.

[0037] Examples of cancers treatable with CDK2 inhibitors using the method of the present invention include bone cancer, pancreatic cancer, skin cancer, cancer of the head and neck, malignant melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, gastric cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tube, carcinoma of the endometrium, endometrial cancer, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's disease, non-Hodgkin lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid, cancer of the parathyroid gland, cancer of the adrenal gland, soft tissue sarcoma, cancer of the urethra, cancer of the penis, acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic or acute leukemia including chronic lymphocytic leukemia, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or urethra, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), and primary CNS Lymphoma, tumor angiogenesis, vertebral axis tumor, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, epidermal carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancer including those induced by asbestos, Merkel cell carcinoma, and combinations of the above cancers, but not limited thereto. The method of the present invention is also useful for the treatment of metastatic cancer, particularly metastatic cancer expressing PD-Ll.

[0038] In some embodiments, cancers treatable with CDK2 inhibitors using the method of the present invention include melanoma (e.g., metastatic malignant melanoma, BRAF and HSP90 inhibitor-resistant melanoma), renal cancer (e.g., clear cell carcinoma), prostate cancer (e.g., hormone-refractory prostatic adenocarcinoma), breast cancer, colon cancer, lung cancer (e.g., non-small cell lung cancer and small cell lung cancer), squamous cell head and neck cancer, urothelial carcinoma (e.g., bladder), and high microsatellite instability (MSI 높음 It includes cancer having ). Additionally, the present invention includes refractory or recurrent malignant tumors whose growth can be inhibited using the compound of the present invention.

[0039] In some embodiments, cancers treatable with a CDK2 inhibitor using the method of the present invention include, but are not limited to, solid tumors (e.g., prostate cancer, colon cancer, esophageal cancer, endometrial cancer, ovarian cancer, uterine cancer, kidney cancer, liver cancer, pancreatic cancer, gastric cancer, breast cancer, lung cancer, cancer of the head and neck, thyroid cancer, glioblastoma, sarcoma, bladder cancer, etc.), blood cancers (e.g., lymphoma, leukemia such as acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), DLBCL, mantle cell lymphoma, non-Hodgkin lymphoma (including relapsed or refractory NHL and relapsed follicular NHL), Hodgkin lymphoma or multiple myeloma), and combinations of said cancers.

[0040] In some embodiments, cancers treatable with a CDK2 inhibitor using the method of the present invention include, but are not limited to, cholangiocarcinoma, cholangiocarcinoma, triple-negative breast cancer, rhabdomyosarcoma, small cell lung cancer, leiomyosarcoma, hepatocellular carcinoma, Ewing sarcoma, brain cancer, brain tumor, astrocytoma, neuroblastoma, neurofibroma, basal cell carcinoma, chondrosarcoma, epithelioid sarcoma, eye cancer, fallopian tube cancer, gastrointestinal cancer, gastrointestinal stromal tumor, fibroblastic leukemia, intestinal cancer, islet cell carcinoma, oral cancer, oral cancer, throat cancer, laryngeal cancer, lip cancer, mesothelioma, cervical cancer, nasal cancer, ocular cancer, ocular melanoma, pelvic cancer, rectal cancer, renal cell carcinoma, salivary gland cancer, paranasal sinus cancer, spinal cancer, tongue cancer, tubular carcinoma, urethral cancer, and ureteral cancer.

[0041] In some embodiments, diseases and indications treatable with CDK2 inhibitors using the method of the present invention include, but are not limited to, hematological cancers, sarcomas, lung cancers, gastrointestinal cancers, urological cancers, liver cancers, bone cancers, nervous system cancers, gynecological cancers, and skin cancers.

[0042] Exemplary blood cancers include lymphomas and leukemias such as acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute promyelocytic leukemia (APL), chronic lymphoblastic leukemia (CLL), chronic myeloid leukemia (CML), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma, non-Hodgkin lymphoma (including relapsed or refractory NHL and relapsed follicular NHL), Hodgkin lymphoma, myeloproliferative disorders (e.g., primary myelofibrosis (PMF), polycythemia vera (PV) and essential thrombocythemia (ET)), spinal dysplasia syndrome (MDS), T-cell acute lymphoblastic lymphoma (T-ALL), and multiple myeloma (MM).

[0043] Exemplary sarcomas include chondrosarcoma, Ewing sarcoma, osteosarcoma, rhabdomyosarcoma, angiosarcoma, fibrosarcoma, liposarcoma, myxoma, rhabdomyosarcoma, rhabdomyosarcoma, fibroma, lipoma, hamartoma, and teratoma.

[0044] Exemplary lung cancers include non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), bronchial-derived carcinoma, squamous cell carcinoma, undifferentiated small cell carcinoma, undifferentiated large cell carcinoma, adenocarcinoma, alveolar (bronchiolar) carcinoma, bronchial adenoma, chondromatous hamartoma, and mesothelioma.

[0045] Exemplary gastrointestinal cancers include cancer of the esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), cancer of the stomach (carcinoma, lymphoma, leiomyosarcoma), cancer of the pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumor, biforma), cancer of the small intestine (adenocarcinoma, lymphoma, carcinoid tumor, Kaposi sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), cancer of the large intestine (adenocarcinoma, ductal adenoma, villous adenoma, hamartoma, leiomyoma), and colorectal cancer.

[0046] Exemplary cancers of the urinary system include cancer of the kidney (adenocarcinoma, Wilms tumor [nephroblastoma]), cancer of the bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), cancer of the prostate (adenocarcinoma, sarcoma), and cancer of the testis (semioma, teratomatosis, embryonic carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatous tumor, lipoma).

[0047] Exemplary liver cancers include liver cancer (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, and hemangioma.

[0048] Exemplary bone cancers include, for example, osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing sarcoma, malignant lymphoma (reticular cell sarcoma), multiple myeloma, malignant giant cell tumor chordoma, osteochondroma (osteochondrosis), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma, and giant cell tumor.

[0049] Exemplary cancers of the nervous system include cancers of the skull (osteoma, hemangioma, granuloma, xanthomas, degenerative osteitis), cancers of the meninges (meningioma, meningeal sarcoma, gliomatosis), cancers of the brain (astrocytoma, medulloblastoma, glioma, ependymoma, germ cell tumor (pineal tumor), glioblastoma, glioblastoma pleomorphic, oligodendroglioma, Schwann cell tumor, retinoblastoma, congenital tumor), and cancers of the spinal cord (neurofibroma, meningioma, glioma, sarcoma), as well as neuroblastoma and Lhermitte-Duclois disease.

[0050] Exemplary gynecological cancers include cancer of the uterus (endometrial carcinoma), cancer of the cervix (cervical carcinoma, pre-tumor cervical dysplasia), cancer of the ovary (ovarian carcinoma (serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma), granulosarcoma, Sertoli-Leydig cell tumor, undifferentiated cell tumor, malignant teratoma), cancer of the vulva (squamous cell carcinoma, carcinoma in situ, adenocarcinoma, fibrosarcoma, melanoma), cancer of the vagina (clear cell carcinoma, squamous cell carcinoma, staphylococcal sarcoma (germstone rhabdomyosarcoma)), and cancer of the fallopian tube (carcinoma).

[0051] Exemplary skin cancers include melanoma, basal cell carcinoma, Merkel cell carcinoma, squamous cell carcinoma, Kaposi's sarcoma, mole dysplastic nevus, lipoma, hemangioma, dermatofibroma, and keloid. In some embodiments, diseases and indications treatable with the compounds of the present invention include, but are not limited to, triple-negative breast cancer (TNBC), myelodysplastic syndrome, testicular cancer, cholangiocarcinoma, esophageal cancer, and urothelial cell carcinoma.

[0052] In some embodiments, diseases or disorders associated with CDK2 are infections, for example, viral infections, bacterial infections, fungal infections, or parasitic infections.

[0053] Biomarkers and methods for predicting responsiveness to CDK2 inhibitors

[0054] Biomarkers useful for predicting the responsiveness (e.g., improvement in disease state as evidenced by disease remission / dissolution) of individuals suffering from, suspected of suffering from, or at risk of developing a CDK2-associated disease or disorder to CDK2 inhibitors are provided herein. Accordingly, methods for predicting the response of human individuals suffering from, suspected of suffering from, or at risk of developing a CDK2-associated disease or disorder to CDK2 inhibitors are provided herein. In certain embodiments, the prediction methods described herein predict that an individual will respond to treatment with a CDK2 inhibitor with an accuracy of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or 100%. For example, in some embodiments, if the prediction method described herein is applied to 10 individuals who have, are suspected of having, or are at risk of developing a disease or disorder associated with CDK2, and 8 of these 10 individuals are predicted to respond to treatment with a CDK2 inhibitor based on the prediction method described herein, and 7 of these 8 individuals actually respond to treatment with a CDK2 inhibitor, the prediction method has an accuracy of 87.5% (7 divided by 8). If an individual shows any improvement in the disease state, such as evidenced by, for example, a reduction or alleviation of symptoms, disease remission / dissolution, etc., said individual is considered to respond to a CDK2 inhibitor.

[0055] CCNE1 and p16

[0056] CCNE1 and p16 were identified as a gene combination useful for predicting the responsiveness (e.g., improvement in the disease as evidenced by disease remission / degradation) of individuals suffering from CDK2-associated diseases or disorders to CDK2 inhibitors in the examples.

[0057] p16 (also known as cyclin-dependent kinase inhibitor 2A, cyclin-dependent kinase 4 inhibitor A, multiple tumor suppressor factor 1, and p16-INK4a) acts as a negative regulator of normal cell proliferation by interacting with CDK4 and CDK6. p16 Cyclin-dependent kinase inhibitor 2A (" CDKN2A It is encoded by the gene (GenBank accession number NM_000077). CDKN2A The cellular location of the gene is 9p21.3, which is the short (p) arm of chromosome 9 at position 21.3. CDKN2A The molecular location of the gene is base pairs 21,967,752 to 21,995,043 on chromosome 9 (Homo sapiens Annotation Release 109, GRCh38.p12). Genetic and epigenetic malformations in the gene encoding p16 are thought to cause escape from aging and cancer formation (Okamoto et al., 1994, PNAS 91(23):11045-9). Unlimited examples of genetic malformations in the gene encoding p16 are described in Table 1 below. The amino acid sequence of human p16 is provided below (GenBank accession number NP_000068 / UniProtKB accession number P42771):

[0058] 1 MEPAAGSSME PSADWLATAA ARGRVEEVRA LLEAGALPNA PNSYGRRPIQ VMMMGSARVA

[0059] 61 ELLLLHGAEP NCADPATLTR PVHDAAREGF LDTLVVLHRA GARLDVRDAW GRLPVDLAEE

[0060] 121 LGHRDVARYL RAAAGGTRGS NHARIDAAEG PSDIPD (Sequence No.: 1).

[0061] CCNE1 is an essential cell cycle factor for the control of the cell cycle during the G1 / S transition (Ohtsubo et al., 1995, Mol. Cell. Biol. 15:2612-2624). CCNE1 acts as a regulatory subunit of CDK2, interacting with CDK2 to form a serine / threonine kinase complete enzyme complex. The CCNE1 subunit of this complete enzyme complex provides the complex's substrate specificity (Honda et al., 2005, EMBO 24:452-463). CCNE1 Cyclin E1 (" CCNE1 It is encoded by the gene (GenBank accession number NM_001238). The amino acid sequence of human CCNE1 is provided below (GenBank accession number NP_001229 / UniProtKB accession number P24864):

[0062] 1 mprerrerda kerdtmkedg gaefsarsrk rkanvtvflq dpdeemakid rtardqcgsq

[0063] 61 pwdnnavcad pcsliptpdk edddrvypns tckpriiaps rgsplpvlsw anreevwkim

[0064] 121 lnkektylrd qhfleqhpll qpkmrailld wlmevcevyk lhretfylaq dffdrymatq

[0065] 181 envvktllql igisslfiaa kleeiyppkl hqfayvtdga csgdeiltme lmimkalkwr

[0066] 241 lspltivswl nvymqvayln dlhevllpqy pqqifiqiae lldlcvldvd clefpygila

[0067] 301 asalyhfsss elmqkvsgyq wcdiencvkw mvpfamvire tgssklkhfr gvadedahni

[0068] 361 qthrdsldll dkarakkaml seqnrasplp sglltppqsg kkqssgpema (Sequence No.: 2).

[0069] The examples demonstrate that CDK2 knockdown inhibits proliferation in CCNE1-amplified cell lines but not in CCNE1-non-amplified cell lines. Conversely, the examples demonstrate that CDK4 / 6 inhibition inhibits proliferation in CCNE1-non-amplified cell lines but not in CCNE1-amplified cell lines. The examples further demonstrate that the presence of a normal (e.g., non-mutated or non-deleted) p16 gene is required for the observed inhibition of cell proliferation in CCNE1-amplified cells treated with a CDK2 inhibitor. Therefore, CCNE1 and p16 together are combination biomarkers: cells responding to treatment with a CDK2 inhibitor exhibit amplification of the CCNE1 gene and / or expression levels of CCNE1 higher than the control expression levels of CCNE1, and have a nucleotide sequence (e.g., gene or mRNA) encoding the p16 protein (e.g., p16 protein containing the amino acid sequence of SEQ ID NO: 1) and / or have the p16 protein present, whereas control cells not responding to treatment with a CDK2 inhibitor do not have amplification of the CCNE1 gene and / or expression levels of CCNE1 higher than the control expression levels of CCNE1, and tend to have a mutated or deleted gene encoding the p16 protein and / or lack expression of the p16 protein. Accordingly, methods related to the use of (i) amplification of the CCNE1 gene and / or expression levels of CCNE1; and (ii) the presence of a nucleotide sequence encoding the p16 protein comprising the amino acid sequence of SEQ No. 1, the presence of the CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions, and / or expression of the p16 protein as biomarkers for predicting an individual's response to a CDK2 inhibitor are provided herein.In a specific embodiment, a human individual suffers from a disease or disorder associated with CDK2. In a specific embodiment, a human individual is suspected of having a disease or disorder associated with CDK2, or is at risk of developing it.

[0070] In a specific embodiment, a method for predicting the response of a human individual to a CDK2 inhibitor, which has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2, is provided herein, said method comprising the steps of: (i) determining from a biological specimen obtained from the human individual, (a) the nucleotide sequence of the CDKN2A gene, (b) the presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions, and / or (c) the presence of the p16 protein; and (ii) from a biological specimen obtained from a human individual, the method comprises the step of determining (a) the copy number of the CCNE1 gene and / or (b) the expression level of CCNE1, wherein (1) (a) the presence of a CDKN2A gene encoding a p16 protein comprising the amino acid sequence of SEQ No. 1, (b) the presence of a CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions and / or (c) the presence of the p16 protein, and (2) (a) amplification of the CCNE1 gene and / or (b) an expression level of CCNE1 higher than the control expression level of CCNE1 predicts that the human individual will respond to a CDK2 inhibitor. In a specific embodiment, the human individual suffers from a disease or disorder associated with CDK2. In a specific embodiment, the human individual is suspected of suffering from a disease or disorder associated with CDK2, or is at risk of developing such a disease or disorder.In a specific embodiment, the (i) determination step of (a) the nucleotide sequence of the CDKN2A gene, (b) the presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions, and / or (c) the presence of the p16 protein is performed prior to administering the CDK2 inhibitor to a human individual (e.g., at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, or at least 4 weeks, or 6 to 16 hours, 6 to 20 hours, or 6 to 24 hours, 2 to 3 days, 2 to 4 days, 2 to 5 days, 2 to 6 days, 2 to 7 days, 1 to 2 weeks, 1 to 3 weeks, or 1 to 4 weeks prior). In a specific embodiment, the step of determining (a) the number of copies of the CCNE1 gene and / or (b) the expression level of CCNE1 in a biological specimen obtained from a human individual, and (ii) the step of determining the CDK2 inhibitor is performed prior to administering the CDK2 inhibitor to the human individual (e.g., at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, or at least 4 weeks, or 6 to 16 hours, 6 to 20 hours, or 6 to 24 hours, 2 to 3 days, 2 to 4 days, 2 to 5 days, 2 to 6 days, 2 to 7 days, 1 to 2 weeks, 1 to 3 weeks, or 1 to 4 weeks prior).

[0071] The presence of a CDKN2A gene encoding a p16 protein containing the amino acid sequence of SEQ No. 1, the presence of a CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions, and / or amplification of the CCNE1 gene combined with the presence of a p16 protein (e.g., a p16 protein containing the amino acid sequence of SEQ No. 1), and / or a level of CCNE1 expression higher than the control expression level of CCNE1, indicate / predict that a human individual suffering from, suspected of suffering from, or at risk of developing a disease or disorder associated with CDK2 will respond to a CDK2 inhibitor.

[0072] In some embodiments, the CCNE1 gene is amplified to 3 to 25 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 3 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 5 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 7 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 10 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 12 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 14 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 21 copies of the gene.

[0073] In a specific embodiment, the expression level of CCNE1 is the level of CCNE1 mRNA. In a specific embodiment, the expression level of CCNE1 is the level of CCNE1 protein.

[0074] In a specific embodiment, the CDKN2A gene encodes a protein containing the amino acid sequence of sequence number: 1.

[0075] In specific embodiments, one or more inactive nucleic acid substitutions and / or deletions in the CDKN2A gene are as described in Table 1. In specific embodiments, one or more inactive nucleic acid substitutions and / or deletions in the CDKN2A gene are as described in Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574, 1999; Liggett and Sidransky, Biology of Neoplasia, Journal of Oncology, 16(3):1197-1206, 1998; and Cairns et al., Nature Genetics, 11:210-212, 1995, each incorporated herein by reference in their entirety.

[0076] Table 1 . CDKN2A gene substitutions, deletions, and modifications

[0077] explanation References C-to-T transition of codon 232 of the CDKN2A gene from an arginine codon to a stop codon RefSNP accession number rs121913388; Kamb et al., Science 264: 436-440, 1994 A 19-base-pair germline deletion at nucleotide 225 that causes a frame-of-view shift predicted to severely truncate the p16 protein RefSNP accession number rs587776716; Gruis et al., Nature Genet. 10: 351-353, 1995 6-base pair deletion at nucleotides 363-368 of the CDKN2A gene ClinVar accession number RCV000010017.2; Liu et al., Oncogene 11: 405-412, 1995 Mutation in chromosome 9:21971058 predicted to substitute tryptophan with glycine corresponding to amino acid position 101 of sequence number 1. RefSNP accession number rs104894094; Ciotti et al., Am. J. Hum. Genet. 67: 311-319, 2000 A germline mutation in which an inframe 3-base pair duplication occurs at nucleotide 332 within exon 2 of the CDKN2A gene. ClinVar accession number RCV000010020.3; Borg et al., Cancer Res. 56: 2497-2500, 1996 A mutation predicted to substitute methionine with isoleucine at amino acid position 53 of sequence number 1 RefSNP accession number rs104894095; Harland et al., Hum. Molec. Genet. 6: 2061-2067, 1997 A mutation predicted to substitute arginine with proline at amino acid position 24 of sequence number 1 RefSNP accession number rs104894097; Monzon et al., New Eng. J. Med. 338: 879-887, 1998 24-base pair repeat inserted between 21974795 and 21974796 (forward strand) on chromosome 9 RefSNP accession number rs587780668; Pollock et al., Hum. Mutat. 11: 424-431, 1998) Displacement of nucleotide -34 from G to T in the CDKN2A gene ClinVar accession number RCV000010024.5; Liu et al., Nature Genet. 21: 128-132, 1999 p14(ARF)-specific exon 1-beta deletion of CDKN2A ClinVar accession number RCV000010026.2; Randerson-Moor et al., Hum. Molec. Genet. 10: 55-62, 2001 A mutation predicted to substitute valine with isoleucine at amino acid position 126 of sequence number 1. RefSNP accession number rs104894098; Goldstein et al., Brit. J. Cancer 85: 527-530, 2001 Transposition in intron 2 of the CDKN2A gene (IVS2-105 AG) creating a 105-base pseudo-GT splice donor site at the 5-terminus of exon 3 that causes deviant splicing of mRNA ClinVar accession number RCV000010028.3; Harland et al., Hum. Molec. Genet. 10: 2679-2686, 2001 A mutation predicted to cause the substitution of glycine with arginine corresponding to amino acid position 122 of sequence number 1. RefSNP accession number rs113798404; Hewitt et al., Hum. Molec. Genet. 11: 1273-1279, 2002 A mutation predicted to cause the substitution of valine with arginine corresponding to amino acid position 59 of sequence number 1 RefSNP accession number rs113798404; Yakobson et al., Melanoma Res. 11: 569-570, 2001 Tandem germline 339G-C shift and 340C-T transition in the CDKN2A gene causing a proline-serine substitution corresponding to amino acid position 114 of Sequence No. 1 RefSNP accession numbers rs113798404 and rs104894104; Kannengiesser et al., Genes Chromosomes Cancer 46: 751-760, 2007 A mutation predicted to cause the substitution of serine to isoleucine corresponding to amino acid position 56 of sequence number 1. RefSNP accession number rs104894109; Kannengiesser et al., Genes Chromosomes Cancer 46: 751-760, 2007 A mutation predicted to cause the substitution of glycine with aspartic acid corresponding to amino acid position 89 of sequence number 1. RefSNP accession number rs137854599; Goldstein et al., J. Med. Genet. 45: 284-289, 2008 Heterozygous A-to-G transition in exon 1B of the CDKN2A gene affecting p14(ARF) homozygous splicing ClinVar accession number RCV000022943.3; Binni et al., Clin. Genet. 77: 581-586, 2010 Heterozygous 5-bp duplication (19_23dup) in the CDKN2A gene causing frameshift and premature termination ClinVar accession number RCV000030680.6; Harinck, F., Kluijt et al., J. Med. Genet. 49: 362-365, 2012 A mutation predicted to cause the substitution of aspartic acid with valine corresponding to amino acid position 84 of sequence number 1 Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574 A mutation predicted to cause the substitution of aspartic acid with glycine corresponding to amino acid position 84 of sequence number 1 Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574 A mutation predicted to cause the substitution of arginine with proline corresponding to amino acid position 87 of sequence number 1. Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574 A mutation predicted to cause the substitution of proline with leucine corresponding to amino acid position 48 of sequence number 1 Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574 A mutation predicted to cause the substitution of aspartic acid with asparagine corresponding to amino acid position 74 of sequence number 1. Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574 A mutation predicted to cause the substitution of arginine with leucine corresponding to amino acid position 87 of sequence number 1 Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574 A mutation predicted to cause the substitution of asparagine with serine corresponding to amino acid position 71 of sequence number 1. Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574 A mutation predicted to cause the substitution of arginine with leucine corresponding to amino acid position 80 of sequence number 1 Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574 A mutation predicted to cause the substitution of histidine with tyrosine corresponding to amino acid position 83 of sequence number 1. Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574

[0078] Rb S780

[0079] Phosphorylation of Rb at serine corresponding to amino acid position 780 of sequence number 3 (referred herein as "Ser780" or "S780") was identified as a pharmacodynamic marker useful for assessing the responsiveness (e.g., inhibition by CDK2) of human individuals with a disease or disorder having CCNE1 amplification to CDK2 inhibitors in the examples.

[0080] Rb is a cell cycle regulator and acts as a tumor suppressor. Rb is activated upon phosphorylation by cyclin D-CDK4 / 6 at Ser780 and Ser795 and by cyclin E / CDK2 at Ser807 and Ser811. Rb RB transcription co-repressor 1 (" RB1It is encoded by the gene (GenBank accession number NM_000321). The amino acid sequence of human Rb is provided below (GenBank accession number NP_000312 / UniProtKB accession number P06400) (S780 is shown in bold and underlined):

[0081] 1 MPPKTPRKTA ATAAAAAAEP PAPPPPPPPE EDPEQDSGPE DLPLVRLEFE ETEEPDFTAL

[0082] 61 CQKLKIPDHV RERAWLTWEK VSSVDGVLGG YIQKKKELWG ICIFIAAVDL DEMSFTFTEL

[0083] 121 QKNIEISVHK FFNLLKEIDT STKVDNAMSR LLKKYDVLFA LFSKLERTCE LIYLTQPSSS

[0084] 181 ISTEINSALV LKVSWITFLL AKGEVLQMED DLVISFQLML CVLDYFIKLS PPMLLKEPYK

[0085] 241 TAVIPINGSP RTPRRGQNRS ARIAKQLEND TRIIEVLCKE HECNIDEVKN VYFKNFIPFM

[0086] 301 NSLGLVTSNG LPEVENLSKR YEEIYLKNKD LDARLFLDHD KTLQTDSIDS FETQRTPRKS

[0087] 361 NLDEEVNVIP PHTPVRTVMN TIQQLMMILN SASDQPSENL ISYFNNCTVN PKESILKRVK

[0088] 421 DIGYIFKEKF AKAVGQGCVE IGSQRYKLGV RLYYRVMESM LKSEEERLSI QNFSKLLNDN

[0089] 481 IFHMSLLACA LEVVMATYSR STSQNLDSGT DLSFPWILNV LNLKAFDFYK VIESFIKAEG

[0090] 541 NLTREMIKHL ERCEHRIMES LAWLSDSPLF DLIKQSKDRE GPTDHLESAC PLNLPLQNNH

[0091] 601 TAADMYLSPV RSPKKKGSTT RVNSTANAET QATSAFQTQK PLKSTSLSLF YKKVYRLAYL

[0092] 661 RLNTLCERLL SEHPELEHII WTLFQHTLQN EYELMRDRHL DQIMMCSMYG ICKVKNIDLK

[0093] 721 FKIIVTAYKD LPHAVQETFK RVLIKEEEYD SIIVFYNSVF MQRLKTNILQ YASTRPPTL S

[0094] 781 PIPHIPRSPY KFPSSPLRIP GGNIYISPLK SPYKISEGLP TPTKMTPRSR ILVSIGESFG

[0095] 841 TSEKFQKINQ MVCNSDRVLK RSAEGSNPPK PLKKLRFDIE GSDEADGSKH LPGESKFQQK

[0096] 901 LAEMTSTRTR MQKQKMNDSM DTSNKEEK (서열 번호: 3).

[0097] As previously mentioned, the examples demonstrate that CDK2-knockdown inhibits proliferation in CCNE1-amplified cell lines but not in CCNE1-non-amplified cell lines. The examples further demonstrate that CDK2-knockdown or inhibition blocks Rb phosphorylation at S780 in CCNE1-amplified cell lines but not in CCNE1-non-amplified cell lines. Thus, Rb phosphorylation at the serine corresponding to amino acid position 780 of SEQ No. 3 is a pharmacodynamic marker for assessing the response to CDK2 inhibition in CCNE1-amplified cancer cells, or in patients suffering from diseases or disorders with CCNE1 amplification. Accordingly, a method relating to the use of the level of Rb phosphorylation at the serine corresponding to amino acid position 780 of SEQ No. 3 as a marker to indicate the response of a human individual to a CDK2 inhibitor is provided herein, in a human individual having a disease or disorder associated with CDK2, suspected of having such a disease or disorder, or at risk of developing such a disease or disorder, wherein the human individual has an increased expression level of CCNE1.

[0098] In a specific embodiment, a method for evaluating the response of a human individual to a CDK2 inhibitor who has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2, said method

[0099] (a) administering a CDK2 inhibitor to a human individual, wherein the human individual is previously determined to have amplification of the CCNE1 gene and / or a CCNE1 expression level higher than the control expression level of CCNE1; and

[0100] (b) comprising the step of measuring the level of Rb phosphorylation at the serine corresponding to amino acid position 780 of SEQ ID NO: 3 in a biological specimen obtained from a human individual, following the administration of step (a), and

[0101] Here, compared to the control level of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3, a reduced level of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3 indicates that the human individual responds to a CDK2 inhibitor. In a specific embodiment, the human individual suffers from a disease or disorder associated with CDK2. In a specific embodiment, the human individual is suspected of suffering from a disease or disorder associated with CDK2, or is at risk of developing it. In a specific embodiment, the human individual was previously further determined to possess a CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions that prevent the CDKN2A gene from encoding a protein containing the amino acid sequence of SEQ No. 1, and / or a p16 protein lacking one or more inactivating amino acid substitutions and / or deletions (e.g., a p16 protein containing the amino acid sequence of SEQ No. 1). In certain embodiments, the measurement of step (b) occurs at least 6 hours, at least 16 hours, at least 20 hours, or at least 24 hours after the administration of step (a). In some embodiments, the measurement of step (b) occurs at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, or at least 4 weeks after the administration of step (a). In certain embodiments, the measurement of step (b) occurs 6 to 16 hours, 6 to 20 hours, or 6 to 24 hours after the administration of step (a). In some embodiments, the measurement of step (b) occurs 2 to 3 days, 2 to 4 days, 2 to 5 days, 2 to 6 days, 2 to 7 days, 1 to 2 weeks, 1 to 3 weeks, or 1 to 4 weeks after administration of step (a).

[0102] Reduced levels of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3, compared to control levels of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3, combined with amplification of the CCNE1 gene and / or higher expression levels of CCNE1 than control expression levels of CCNE1, indicate that a human individual suffering from, suspected of suffering from, or at risk of developing a disease or disorder associated with CDK2 responds to a CDK2 inhibitor. For example, biological specimens obtained from an individual after treatment with a CDK2 inhibitor having low (e.g., reduced compared to control) or undetectable levels of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3 in an individual undergoing amplification of the CCNE1 gene and / or higher expression levels of CCNE1 than control expression levels of CCNE1 indicate that the individual responds to a CDK2 inhibitor.

[0103] A biological specimen obtained from an individual having a reduced level of Rb phosphorylation in serine corresponding to amino acid position 780 of SEQ No. 3 compared to a control level of Rb phosphorylation in serine corresponding to amino acid position 780 of SEQ No. 3, combined with (i) amplification of the CCNE1 gene and / or a higher expression level of CCNE1 than the control expression level of CCNE1, and (ii) the presence of the CDKN2A gene encoding the p16 protein containing the amino acid sequence of SEQ No. 1, the presence of the CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions and / or the presence of the p16 protein (e.g., the p16 protein containing the amino acid sequence of SEQ No. 1), indicates that a human individual suffering from, suspected of suffering from, or at risk of developing a disease or disorder associated with CDK2 responds to the CDK2 inhibitor. For example, biological specimens obtained from a human individual after administration of a CDK2 inhibitor to an individual having (i) amplification of the CCNE1 gene and / or a CCNE1 expression level higher than the control expression level of CCNE1, and (ii) the presence of the CDKN2A gene encoding the p16 protein containing the amino acid sequence of SEQ No. 1, the presence of the CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions, and / or the presence of the p16 protein (e.g., the p16 protein containing the amino acid sequence of SEQ No. 1), having a low (e.g., reduced compared to the control) or undetectable level of Rb phosphorylation at the serine corresponding to amino acid position 780 of SEQ No. 3, indicate that the human individual responds to the CDK2 inhibitor.

[0104] In some embodiments, the CCNE1 gene is amplified to 3 to 25 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 3 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 5 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 7 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 10 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 12 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 14 copies of the gene. In a specific embodiment, the CCNE1 gene is amplified to at least 21 copies of the gene.

[0105] In a specific embodiment, the expression level of CCNE1 is the level of CCNE1 mRNA. In a specific embodiment, the expression level of CCNE1 is the level of CCNE1 protein.

[0106] In a specific embodiment, the CDKN2A gene encodes a protein containing the amino acid sequence of sequence number: 1.

[0107] In specific embodiments, one or more inactive nucleic acid substitutions and / or deletions in the CDKN2A gene are as described in Table 1. In specific embodiments, one or more inactive nucleic acid substitutions and / or deletions in the CDKN2A gene are as described in Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574, 1999; Liggett and Sidransky, Biology of Neoplasia, Journal of Oncology, 16(3):1197-1206, 1998; and Cairns et al., Nature Genetics, 11:210-212, 1995, each incorporated herein by reference in their entirety.

[0108] contrast

[0109] As described above, the method of the present invention may comprise the step of measuring one or more markers (e.g., biomarkers or pharmacodynamic markers, e.g., amplification of the CCNE1 gene, expression level of CCNE1, presence of the CDKN2A gene encoding the p16 protein containing the amino acid sequence of SEQ No. 1, presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions, presence of the p16 protein (e.g., p16 protein containing the amino acid sequence of SEQ No. 1), and Rb phosphorylation at serine corresponding to amino acid position 780 of SEQ No. 3) in a biological specimen obtained from a human individual having a CDK2-associated disease or disorder. In a specific embodiment, the human individual is suspected of having a CDK2-associated disease or disorder, or is at risk of developing it. In certain aspects, compared to control levels of one or more biomarkers, the levels of these one or more biomarkers (e.g., amplification levels (e.g., for the CCNE1 gene), expression levels (e.g., for CCNE1 or p16 proteins), or phosphorylation levels (e.g., for Rb)) predict / indicate the response of a human individual to a treatment containing a CDK2 inhibitor.In certain embodiments, when (i) the CCNE1 gene is amplified and / or the expression level of CCNE1 is higher than the control expression level of CCNE1, and (ii) the CDKN2A gene encoding the p16 protein containing the amino acid sequence of SEQ No. 1 is present, and the CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions is present, and / or the p16 protein (e.g., the p16 protein containing the amino acid sequence of SEQ No. 1) is present, the human individual is found to be likely to respond to a CDK2 inhibitor. In another embodiment, when (i) the CCNE1 gene is amplified and / or the expression level of CCNE1 is higher than the control expression level of CCNE1, and (ii) in a biological sample obtained from a human individual after administration of a CDK2 inhibitor to the human individual, the level of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3 is lower than the control level of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ No. 3, the human individual is confirmed to respond to the CDK2 inhibitor. In another embodiment, (i) the CCNE1 gene is amplified and / or the expression level of CCNE1 is higher than the control expression level of CCNE1, (ii) the CDKN2A gene encoding a p16 protein containing the amino acid sequence of SEQ No. 1 is present, the CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions is present, and / or the p16 protein (e.g., the p16 protein containing the amino acid sequence of SEQ No. 1) is present, and (iii) in a biological sample obtained from a human individual after administration of a CDK2 inhibitor to the human individual, the level of Rb phosphorylation in serine corresponding to amino acid position 780 of SEQ No. 3 is lower than the control level of Rb phosphorylation in serine corresponding to amino acid position 780 of SEQ No. 3, the human individual is confirmed to respond to the CDK2 inhibitor.In this context, the term "control" includes a sample (from the same tissue type) obtained from a human individual known to be unresponsive to a CDK2 inhibitor. The term "control" also includes a sample (from the same tissue type) previously obtained from a human individual known to be unresponsive to a CDK2 inhibitor and used as a reference for future comparison with a test sample taken from a human individual expected to be therapeutically responsive. "Control" levels (e.g., gene copy number, expression level, or phosphorylation level) for a specific biomarker (e.g., CCNE1, p16, or Rb phosphorylation) in a specific cell type or tissue may be established in advance by analyzing biomarker levels (e.g., expression level or phosphorylation level) in one or more human individuals (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, or 40 or more) who did not respond to treatment with a CDK2 inhibitor. These pre-established reference values ​​(which may be the mean or median level (e.g., gene copy number, expression level, or phosphorylation level) taken from multiple human individuals who did not respond to therapy) may subsequently be used as "control" levels for the biomarker (e.g., CCNE1, p16, or Rb phosphorylation) in comparison with test samples. In this comparison, if the CCNE1 gene is amplified and / or the expression level of CCNE is higher than a previously established reference, and if the CDKN2A gene encoding the p16 protein containing the amino acid sequence of SEQ No. 1 is present, and if the CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions is present, and / or if the p16 protein (e.g., the p16 protein containing the amino acid sequence of SEQ No. 1) is present, the human individual is predicted to respond to a CDK2 inhibitor.In other such comparisons, if (i) the CCNE1 gene is amplified and / or the expression level of CCNE is higher than a previously established reference, and (ii) after administering a CDK2 inhibitor to a human individual, the level of Rb phosphorylation at the serine corresponding to amino acid position 780 of sequence number: 3 is lower than a previously established reference, the human individual is predicted to respond to the CDK2 inhibitor. In another such comparison, if (i) the CCNE1 gene is amplified and / or the expression level of CCNE is higher than a previously established reference, (ii) the CDKN2A gene encoding the p16 protein containing the amino acid sequence of SEQ No. 1 is present, the CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or deletions is present, and / or the p16 protein (e.g., the p16 protein containing the amino acid sequence of SEQ No. 1) is present, and (iii) after administering the CDK2 inhibitor to the human individual, the level of Rb phosphorylation at the serine corresponding to amino acid position 780 of SEQ No. 3 is lower than a previously established reference, the human individual is indicated to respond to the CDK2 inhibitor.

[0110] Alternatively, a “control” level for a specific biomarker in a specific cell type or tissue may be pre-established by analyzing the biomarker level in one or more human subjects who responded to treatment with a CDK2 inhibitor. This pre-established reference value (which may be the mean or median level taken from multiple human subjects who responded to the therapy (e.g., expression level or phosphorylation level)) may subsequently be used as a “control” level (e.g., expression level or phosphorylation level) in comparison with a test sample. In such comparison, if the level of the biomarker being analyzed (e.g., copy number of the CCNE1 gene, expression level of CCNE1, expression level of p16, or phosphorylation level of Rb in serine corresponding to amino acid position 780 of SEQ ID NO: 3) is equivalent to or comparable to the pre-established reference (e.g., at least 85% but not exceeding 115%), the human subject is indicated as responding to the CDK2 inhibitor.

[0111] In certain embodiments, the “control” is a pre-established cutoff value. The cutoff value is typically a level of a biomarker (e.g., copy number, expression level, or phosphorylation level) considered to predict the responsiveness of a human individual to the therapy of interest when exceeded or below. Thus, according to the methods and compositions described herein, a reference level (e.g., CCNE1 gene copy number, CCNE1 expression, p16 expression, or Rb phosphorylation at serine corresponding to amino acid position 780 of SEQ ID NO: 3) is identified as a cutoff value predicting responsiveness to a CDK2 inhibitor when exceeded or below. The cutoff value determined for use in the methods described herein may be compared, for example, with a disclosed concentration range, but may be individualized to the methodology used and the patient population.

[0112] In some embodiments, the expression level of CCNE1 is increased compared to the expression level of CCNE1 in the control. For example, the analyzed CCNE1 expression level is at least 1.5, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 25, at least 50, at least 75, or at least 100 times higher than the CCNE1 expression level in the control, or at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, at least 1,000%, at least 1,500%, at least 2,000%, at least It can be 2,500%, at least 3,000%, at least 3,500%, at least 4,000%, at least 4,500%, or at least 5,000% higher.

[0113] If the p16 protein is detectable by any assay known in the art or described herein, e.g., Western blot, immunohistochemistry, fluorescence-activated cell sorting, and enzyme-linked immunoassay, said protein is present. In some embodiments, the p16 protein is present at an expression level within at least 5%, at least 10%, at least 20%, or at least 30% of the p16 expression levels in a healthy control.

[0114] In some embodiments, the level of Rb phosphorylation in serine corresponding to amino acid position 780 of sequence number: 3 being analyzed is reduced compared to the level of Rb phosphorylation in serine corresponding to amino acid position 780 of sequence number: 3 in the control. For example, the level of Rb phosphorylation in serine corresponding to amino acid position 780 of sequence number: 3 being analyzed may be at least 1.5, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 25, at least 50, at least 75, or at least 100 times lower than the level of Rb phosphorylation in serine corresponding to amino acid position 780 of sequence number: 3 in the control, or at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% lower.

[0115] Biological specimens

[0116] Suitable biological specimens for the method described herein include any specimen containing blood or tumor cells obtained from or derived from a human individual requiring treatment. For example, a biological specimen may contain tumor cells from a biopsy obtained from a patient suffering from a solid tumor. The tumor biopsy may be obtained by various means known in the art. Alternatively, a blood specimen may be obtained from a patient suffering from blood cancer.

[0117] Biological specimens may be obtained from human individuals who suffer from, are suspected of suffering from, or are at risk of developing a disease or disorder associated with CDK2. In some embodiments, the disease or disorder associated with CDK2 is cancer. In some embodiments, the disease or disorder associated with CDK2 is N-myc-amplified neuroblastoma cells, K-Ras mutant lung cancer, and cancer with FBW7 mutations and CCNE1 overexpression. In some embodiments, the disease or disorder associated with CDK2 is pulmonary squamous cell carcinoma, pulmonary adenocarcinoma, pancreatic adenocarcinoma, invasive breast carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, gastric adenocarcinoma, esophageal carcinoma, bladder urothelial carcinoma, mesothelioma, or sarcoma. In some embodiments, the disease or disorder associated with CDK2 is pulmonary adenocarcinoma, invasive breast carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, or gastric adenocarcinoma. In some embodiments, the disease or disorder associated with CDK2 is an adenocarcinoma, carcinoma, or cystadenocarcinoma. In some embodiments, the disease or disorder associated with CDK2 is uterine cancer, ovarian cancer, gastric cancer, esophageal cancer, lung cancer, bladder cancer, pancreatic cancer, or breast cancer.

[0118] In some embodiments, breast cancer is breast cancer resistant to chemotherapy or radiation therapy, endocrine-resistant breast cancer, trastuzumab-resistant breast cancer, or breast cancer exhibiting primary or acquired resistance to CDK4 / 6 inhibition. In some embodiments, breast cancer is advanced or metastatic breast cancer.

[0119] Methods for obtaining and / or preserving specimens that preserve the activity or integrity of molecules (e.g., nucleic acids or proteins) within the specimen are widely known to those skilled in the art. For example, biological specimens may be further contacted with one or more additional agents that preserve molecules within the specimen or minimize changes thereto, such as buffers and / or inhibitors comprising one or more of nuclease, protease, and phosphatase inhibitors.

[0120] Evaluation of biomarkers and pharmacodynamic markers

[0121] The expression level of CCNE1 or p16 can be detected, for example, as RNA expression of the target gene (i.e., the gene encoding CCNE1 or p16). In other words, the expression level (amount) of CCNE1 or p16 can be determined by detecting and / or measuring the level of mRNA expression of the gene encoding CCNE1. Alternatively, the expression level of CCNE1 or p16 can be detected, for example, as protein expression of the target gene (i.e., the gene encoding CCNE1 or p16). In other words, the expression level (amount) of CCNE1 or p16 can be determined by detecting and / or measuring the level of protein expression of the gene encoding CCNE1 or p16.

[0122] In some embodiments, the expression levels of CCNE1 or p16 are determined by measuring RNA levels. Various suitable methods may be used to detect and / or measure the levels of gene mRNA expression. For example, mRNA expression may be determined using Northern blot or dot blot analysis, reverse transcriptase-PCR (RT-PCR; e.g., quantitative RT-PCR), hybridization in situ (e.g., quantitative hybridization in situ), nucleic acid arrays (e.g., oligonucleotide arrays or gene chips), and RNA sequencing. Details regarding these methods are provided below, and for example, Sambrook et al., Molecular Cloning: A Laboratory Manual Second Edition vol. 1, 2 and 3. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York, USA, Nov. 1989; Gibson et al. (1999) Genome Res., 6(10):995-1001; and Zhang et al. (2005) Environ. Sci. Technol., 39(8):2777-2785; US Publication No. 2004086915; European Patent No. 0543942; and US Patent No. 7,101,663; described in Kukurba et al. (2015) Cold Spring Harbor Protocols., 2015 (11): 951-69; each of these disclosures is incorporated herein by reference in its entirety.

[0123] In one example, the presence or quantity of one or more distinct mRNA populations within a biological sample can be determined by isolating whole mRNA from the biological sample (cf., e.g., Sambrook et al. (above) and US Patent No. 6,812,341) and separating the mRNA by size by performing agarose gel electrophoresis on the isolated mRNA. The size-separated mRNA is then transferred to a solid support, such as a nitrocellulose membrane (e.g., by diffusion). The presence or quantity of one or more mRNA populations within the biological sample can then be determined using one or more detectably-labeled polynucleotide probes complementary to the mRNA sequence of interest, which bind to their corresponding mRNA populations to make them detectable. Detectable labels include, for example, fluorescence (e.g., umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, monochloride, allophycocyanin, or phycoerythrin), luminescence (e.g., europium, terbium, Qdot™ nanoparticles supplied by Quantum Dot Corporation, Palo Alto, CA), radiation (e.g., 125I, 131I, 35S, 32P, 33P, or 3H), and enzyme (horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase) labels.

[0124] In some embodiments, the expression level of CCNE1 or p16 is determined by measuring protein levels. Various suitable methods may be used to detect and / or measure the level of protein expression of the target gene. For example, CCNE1 or p16 protein expression may be determined using Western blot, enzyme-linked immunosorbent assay ("ELISA"), fluorescence-activated cell sorting, or immunohistochemical analysis (e.g., using CCNE1-specific or p16-specific antibodies, respectively). Details regarding these methods are described below and, for example, in Sambrook et al., as above.

[0125] In one example, the presence or amount of one or more distinct protein populations (e.g., CCNE1 or p16) within a biological sample can be determined by Western blot analysis, for example, by isolating the whole protein from the biological sample (cf. e.g., Sambrook et al. (above)), and by performing agarose gel electrophoresis on the isolated protein to separate the protein by size. The size-separated protein is then transferred to a solid support, such as a nitrocellulose membrane (e.g., by diffusion). The presence or amount of one or more protein populations within the biological sample can then be determined using one or more antibody probes, for example, a first antibody specific to the protein of interest (e.g., CCNE1 or p16), and a second antibody specific to the first antibody, which is detectably labeled (this binds to the corresponding protein population, making it detectable). Detectable labels suitable for use in Western blot analysis are known in the art.

[0126] Methods for detecting or measuring gene expression (e.g., mRNA or protein expression) may optionally be performed in a format that enables the rapid preparation, processing, and analysis of multiple samples. This may be performed, for example, on a multi-well assay plate (e.g., 96-well or 386-well) or an array (e.g., a nucleic acid chip or a protein chip). Stock solutions for various reagents may be provided manually or by a robot, and subsequent sample preparation (e.g., RT-PCR, labeling, or cell fixation), pipetting, dilution, mixing, dispensing, washing, incubation (e.g., hybridization), sample reading, data acquisition (optical data), and / or analysis (computer-assisted image analysis) may be performed by a robot using commercially available analysis software, robotics, and detection mechanisms capable of detecting signals produced from the assay. Examples of such detectors include, but are not limited to, spectrophotometers, photometers, fluorometers, and devices for measuring radioisotope decay. Exemplary high-throughput cell-based assays (e.g., detecting the presence or level of a target protein in cells) may utilize ArrayScan® VTI HCS reader or KineticScan® HCS reader technology (Cellomics Inc., Pittsburg, PA).

[0127] In some embodiments, the presence of the CDKN2A gene encoding the p16 protein containing the amino acid sequence of SEQ No. 1 and / or the presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions is determined by evaluating the DNA sequence of the CDKN2A gene (e.g., genomic DNA or cDNA) or by evaluating the RNA sequence of the CDKN2A gene (e.g., RNA, e.g., mRNA). Methods for performing nucleic acid sequencing are known and described in the art. Unlimited examples of inactivated nucleic acid substitutions and / or deletions that prevent the CDKN2A gene from encoding the protein containing the amino acid sequence of SEQ No. 1 are described in Table 1 above. In certain embodiments, one or more inactivated nucleic acid substitutions and / or deletions in the CDKN2A gene are described in Yarbrough et al., Journal of the National Cancer Institute, 91(18):1569-1574, 1999; As described in Liggett and Sidransky, Biology of Neoplasia, Journal of Oncology, 16(3):1197-1206, 1998, and Cairns et al., Nature Genetics, 11:210-212, 1995, which are incorporated herein by reference in their entirety.

[0128] In some embodiments, the expression level of a gene, or the presence of a gene lacking one or more inactive nucleic acid substitutions or deletions, is determined by evaluating the copy number variation (CNV) of the gene. The CNV of a gene (e.g., the CCNE1 gene and / or the CDKN2A gene) can be determined / identified by various suitable methods. For example, CNV can be determined using fluorescence in situ hybridization (FISH), multiplex ligation-dependent probe amplification (MLPA), array comparison genomic hybridization (aCGH), single-nucleotide polymorphism (SNP) arrays, and next-generation sequencing (NGS) technology.

[0129] In one example, copy number variation of one or more distinct genes within a biological sample can be determined by MLPA, for example, by extracting a DNA sample from a biological sample (see, e.g., Sambrook et al. (above) and US Patent No. 6,812,341), and by amplifying a DNA sequence of interest (e.g., CCNE1 or CDKN2A) using a mixture of MLPA probes. Each MLPA probe consists of two oligonucleotides that hybridize to an immediately adjacent target DNA sequence (e.g., CCNE1 or CDKN2A) to be ligated into a single probe. The ligated probe is amplified via PCR using a single fluorescently labeled PCR primer, allowing the amplified product to be visualized during fragment separation by capillary electrophoresis. The presence, absence, or amplification of one or more genes of interest within the biological sample is calculated by measuring the PCR-derived fluorescence, quantifying the amount of the PCR product after normalization, and comparing this to a control DNA sample.

[0130] The level of Rb phosphorylation at the serine corresponding to amino acid position 780 of sequence number 3 can be detected by various suitable methods. For example, the phosphorylation status can be determined using Western blot, ELISA, fluorescence-activated cell sorting, or immunohistochemical analysis. Details regarding these methods are described below and, for example, in Sambrook et al., same as above.

[0131] As in the case of the method for detecting or measuring gene expression (above), the method for detecting or measuring the level of Rb phosphorylation in serine corresponding to amino acid position 780 of sequence number: 3 may optionally be performed in a format that enables rapid preparation, processing, and analysis of multiple samples.

[0132] CDK2 inhibitor

[0133] A useful compound in the method of the present invention is a CDK2 inhibitor. In some embodiments, the CDK2 inhibitor inhibits CDK2, CDK4, and CDK6. In some embodiments, the CDK2 inhibitor selectively inhibits CDK2 compared to CDK1 and CDK9. In some embodiments, the CDK2 inhibitor selectively inhibits CDK2 compared to CDK4 and CDK6. In some embodiments, the CDK2 inhibitor selectively inhibits CDK2 compared to CDK1, CDK9, CDK4, and CDK6. In some embodiments, these compounds are IC according to the method in Examples A, B, and C. 50 When calculated by measuring, it is about 2, 3, 5, 10, 15, or 20 times more selective for CDK2 compared to CDK1 and CDK9. In some embodiments, these compounds are IC according to the method in Examples A, B, C, D, and E. 50When calculated by measuring, it is about 2, 3, 5, 10, 15, or 20 times more selective for CDK2 compared to CDK1, CDK9, CDK4, or CDK6. In some embodiments, these compounds are IC according to the method in Examples A, D, and E. 50 When calculated by measuring, it is about 2, 3, 5, 10, 15, or 20 times more selective for CDK2 compared to CDK4 and CDK6.

[0134] In some embodiments, the CDK2 inhibitors are dinaciclib (Merck), albociclib (Tolero Pharmaceuticals), seliciclib (Cyclacel Pharmaceuticals), roniciclib (Bayer), milciclib (Nerviano), abemaciclib (Eli Lilly), trilaciclib (G1 Therapeutics), CYC065 (Cyclacel Pharmaceuticals), AT-7519 (Astex Therapeutics; J Med. Chem. , 2008, 51, 4986), BMS-387032 / SNS032 (Sunesis; J Med. Chem. , 2004, 47, 1719), TG02 (Trajara Pharmaceuticals), R547 (Roche; Mol. Can. Ther. 2006, 2644), AZD5438 (AstraZeneca, Mol. Can. Ther. 2009, 1856), RGB-286638 (Agennix; Leukemia , 2013, 2366), AMG295 (Amgen; WO 2009 / 085185), PHA-793887 (Nerviano, BMC, 2010 18, 1844), ZK-304709 ( Biomed. Pharmacother. 2006, 269), and AG-024322 (Pfizer; Cancer Res.2005, 1045), or one of the aforementioned pharmaceutically acceptable salts. The chemical structures of CYC065, AT7519, BMS-387032 / SN032, TG02, R547, AZD5438, RGB-286638, AMG925, PHA-793887, ZK-304709, and AG-24322 are provided below:

[0135]

[0136] In some embodiments, the CDK2 inhibitor is compound A having the structure below (8-((1R,2R)-2-hydroxy-2-methylcyclopentyl)-2-((1-(methylsulfonyl)piperidin-4-yl)amino)pyrido[2,3-d]pyrimidin-7(8H)-one), or a pharmaceutically acceptable salt thereof:

[0137] Compound A

[0138] (8-[(1R,2R)-2-hydroxy-2-methylcyclo-pentyl]-2-{[1-(methylsulfonyl)piperidin-4-yl]amino}pyrido[2,3-d]pyrimidin-7(8H)-one; see also page 51, paragraph

[0987] of US Patent Application Publication No. 2018 / 0044344, which is incorporated herein by reference in its entirety).

[0139] In some embodiments, the compound is the compound of any embodiment or example compound of US Patent Application Publication No. 2018 / 0044344, which is incorporated herein by reference in its entirety, or a pharmaceutically acceptable salt thereof.

[0140] In some embodiments, the compound is a compound, or a pharmaceutically acceptable salt thereof, in any embodiment or example compound of US Patent Application No. 16 / 598,777 filed October 10, 2019, which is incorporated herein by reference in its entirety; or US Provisional Application No. 62 / 806,269 filed February 15, 2019.

[0141] In a specific embodiment, the CDK2 inhibitor is a compound of the chemical formula (AI):

[0142] (AI)

[0143] or a pharmaceutically acceptable salt thereof, where:

[0144] R 1 H, C 1-6 Alkyl and C 1-6 Selected from haloalkyls;

[0145] R 2 is C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl, 5-10-membered heteroaryl-C 1-4 Alkyl, C(=O)R b , C(=O)NR c R d , C(=O)OR a , C(=NR e )R b , C(=NR e )NR c R d , S(=O)R b , S(=O)NR c R d , NR c S(=O)2Rb , NR c S(=O)2NR c R d , S(=O)2R b and S(=O)2NR c R d Selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 2A Arbitrarily substituted with a substituent;

[0146] Each R a , R c and R d is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 2A Arbitrarily substituted with a substituent;

[0147] Each R b is C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 2A Arbitrarily substituted with a substituent;

[0148] Each R e is H, CN, OH, C 1-4 Alkyl and C 1-4 Independently selected from alkoxy;

[0149] Each R f is H, C 1-4 Alkyl and C 1-4 Independently selected from haloalkyls;

[0150] R 3 C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 3A Arbitrarily substituted with a substituent;

[0151] R 4 , R 5 , R 6 and R 7 is defined in group (a) or (b):

[0152] Group (a):

[0153] R 4 and R 5 is Halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl and C 3-6 Independently selected from cycloalkyl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl and C 3-6 Each cycloalkyl is one, two, three, or four independently selected Rs G Arbitrarily substituted with a substituent;

[0154] Or alternatively, R 4 and R 5 They form a 3, 4, 5, 6, or 7-membered cycloalkyl ring or a 3, 4, 5, 6, or 7-membered heterocycloalkyl ring together with the carbon atoms to which they are attached, and these each have 1, 2, 3, or 4 independently selected R atoms. G Arbitrarily substituted with a substituent;

[0155] R 6 and R 7Eun H, D, Halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl and C 3-6 Independently selected from cycloalkyl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl and C 3-6 Each cycloalkyl is one, two, three, or four independently selected Rs G Arbitrarily substituted with a substituent;

[0156] Or alternatively, R 6 and R 7 They form a 3, 4, 5, 6, or 7-membered cycloalkyl ring or a 3, 4, 5, 6, or 7-membered heterocycloalkyl ring together with the carbon atoms to which they are attached, and these each have 1, 2, 3, or 4 independently selected R atoms. G Arbitrarily substituted with a substituent;

[0157] Group (b):

[0158] R 4 and R 5 is H, halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl and C 3-6 Independently selected from cycloalkyl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl and C 3-6 Each cycloalkyl is one, two, three, or four independently selected Rs G Arbitrarily substituted with a substituent;

[0159] Or alternatively, R 4 and R 5They form a 3, 4, 5, 6, or 7-membered cycloalkyl ring or a 3, 4, 5, 6, or 7-membered heterocycloalkyl ring together with the carbon atoms to which they are attached, and these each have 1, 2, 3, or 4 independently selected R atoms. G Arbitrarily substituted with a substituent;

[0160] R 6 and R 7 Eun Halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl and C 3-6 Independently selected from cycloalkyl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl and C 3-6 Each cycloalkyl is one, two, three, or four independently selected Rs G Arbitrarily substituted with a substituent;

[0161] Or alternatively, R 6 and R 7 They form a 3, 4, 5, 6, or 7-membered cycloalkyl ring or a 3, 4, 5, 6, or 7-membered heterocycloalkyl ring together with the carbon atoms to which they are attached, and these each have 1, 2, 3, or 4 independently selected R atoms. G Arbitrarily substituted with a substituent;

[0162] Each R 2A is H, D, halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl, 5-10-membered heteroaryl-C 1-4 Alkyl, OR a1 , SR a1 , C(=O)R b1 , C(=O)NR c1 R d1 , C(=O)OR a1 , OC(=O)R b1 , OC(=O)NR c1 R d1 , NR c1 R d1 , NR c1 C(=O)R b1 , NR c1 C(=O)OR b1 , NR c1 C(=O)NR c1 R d1 , C(=NR e )R b1 , C(=NR e )NR c1 R d1 , NR c1 C(=NR e )NR c1 R d1 , NHOR a1 , NR c1 S(=O)R b1 , NR c1 S(=O)NR c1 R d1 , S(=O)R b1 , S(=O)NR c1 R d1 , NR c1 S(=O)2R b1 , NR c1 S(=O)2NR c1 R d1 , S(=O)2R b1 , S(=O)(=NR f )R b1 and S(=O)2NR c1 R d1 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 2B Arbitrarily substituted with a substituent;

[0163] Each R a1 , R c1 and R d1 H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 2B Arbitrarily substituted with a substituent;

[0164] Each R b1 C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 2B Arbitrarily substituted with a substituent;

[0165] Each R 3A is H, D, halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl, 5-10-membered heteroaryl-C 1-4 Alkyl, OR a2 , SR a2 , C(=O)R b2 , C(=O)NR c2 R d2 , C(=O)OR a2 , OC(=O)R b2 , OC(=O)NR c2 R d2 , NR c2 R d2 , NR c2 C(=O)R b2 , NR c2C(=O)OR b2 , NR c2 C(=O)NR c2 R d2 , C(=NR e )R b2 , C(=NR e )NR c2 R d2 , NR c2 C(=NR e )NR c2 R d2 , NHOR a2 , NR c2 S(=O)R b2 , NR c2 S(=O)NR c2 R d2 , S(=O)R b2 , S(=O)NR c2 R d2 , NR c2 S(=O)2R b2 , NR c2 S(=O)2NR c2 R d2 , S(=O)2R b2 , S(=O)(=NR f )R b2 and S(=O)2NR c2 R d2 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 3B Arbitrarily substituted with a substituent;

[0166] Each R a2 , R c2 and Rd2 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 3B Arbitrarily substituted with a substituent;

[0167] Each R b2 is C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, C 6-10 Aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, C 6-10 Aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 3B Arbitrarily substituted with a substituent;

[0168] Each R 2B and R 3B is H, D, halo, CN, NO2, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl, 5-6-membered heteroaryl-C 1-4 Alkyl, OR a23 , SR a23 , C(=O)R b23 , C(=O)NR c23 R d23 , C(=O)OR a23 , OC(=O)R b23 , OC(=O)NR c23 R d23 , NR c23 R d23 , NR c23 C(=O)R b23 , NR c23 C(=O)OR b23 , NR c23 C(=O)NR c23 R d23 , C(=NR e )R b23 , C(=NR e )NR c23 R d23 , NR c23 C(=NR e )NR c23 R d23 , NHOR a23 , NR c23 S(=O)R b23 , NR c23 S(=O)NR c23 R d23 , S(=O)R b23 , S(=O)NR c23 R d23 , NR c23 S(=O)2Rb23 , NR c23 S(=O)2NR c23 R d23 , S(=O)2R b23 , S(=O)(=NR f )R b23 and S(=O)2NR c23 R d23 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. G Arbitrarily substituted with a substituent;

[0169] Each R a23 , R c23 and R d23 H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. G Arbitrarily substituted with a substituent;

[0170] Each R b23 C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs G Arbitrarily substituted with a substituent; and

[0171] Each R G is OH, NO2, CN, halo, C 1-3 Alkyl, C 2-3 Alkenyl, C 2-3 Alkinyl, C 1-3 Haloalkyl, Cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, C 1-3 Alkoxy-C 1-3 Alkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, amino, C 1-3 alkylamino, di(C 1-3 Alkyl)amino, thio, C 1-3 Alkylthio, C 1-3 Alkylsulfinyl, C 1-3 Alkylsulfonyl, Carbamyl, C 1-3 Alkylcarbamyl, di(C 1-3 Alkyl)carbamyl, carboxy, C 1-3 Alkyl carbonyl, C 1-3Alkoxycarbonyl, C 1-3 Alkylcarbonyloxy, C 1-3 Alkylcarbonylamino, C 1-3 Alkoxycarbonylamino, C 1-3 Alkylaminocarbonyloxy, C 1-3 Alkylsulfonylamino, aminosulfonyl, C 1-3 Alkylaminosulfonyl, di(C 1-3 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-3 Alkylaminosulfonylamino, di(C 1-3 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-3 Alkylaminocarbonylamino and di(C 1-3 It is independently selected from alkyl)aminocarbonylamino.

[0172] In some specific examples, R 1 is H.

[0173] In some specific examples, R 2 is C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 2A It is arbitrarily substituted with a substituent.

[0174] In some specific examples, R 2 is selected from 4-7-membered heterocycloalkyl and phenyl, each comprising 1, 2, 3, or 4 independently selected Rs. 2A It is replaced by a substituent.

[0175] In some specific examples, R 2 is selected from piperidine-4-yl and phenyl, each having one R 2A It is arbitrarily substituted with a substituent.

[0176] In some embodiments, at least one R2A is S(=O)2R b1 and S(=O)2NR c1 R d1 Selected from, where R b1 C 1-3 It is alkyl; and R c1 and R d1 are H and C, respectively. 1-3 It is independently selected from alkyls.

[0177] In some specific examples, each R 2A It is independently selected from S(=O)2CH3 and S(=O)2NH2.

[0178] In some specific examples, R 2 is S(=O)2R b1 Piperidine-4-yl substituted with; or R 2 is S(=O)2NR c1 R d1 It is a phenyl substituted with .

[0179] In some specific examples, R 2 is piperidine-4-yl substituted with S(=O)2CH3; or R 2 is a phenyl substituted with S(=O)2NH2.

[0180] In some specific examples, R 3 C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 3A It is arbitrarily substituted with a substituent.

[0181] In some specific examples, R 3 C 1-6 Alkyl, C3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl and 5-6-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of one or two independently selected Rs 3A It is arbitrarily substituted with a substituent.

[0182] In some embodiments, 1, 2, 3, or 4 independently selected R 3A R arbitrarily substituted with a substituent 3 1,1-difluorobutane-2-yl, cyclopentyl, phenyl, tetrahydrofuran-3-yl and (1-methyl-1 H - Selected from methyl -pyrazol-5-yl)

[0183] In some specific examples, each R 3A is H, halo, C 1-6 Alkyl and C 1-6 It is independently selected from haloalkyls.

[0184] In some specific examples, R 4 and R 5 are respectively C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls; or alternatively, R 4 and R 5 They form 3, 4, 5, or 6-membered cycloalkyl rings together with the carbon atoms to which they are attached.

[0185] In some specific examples, R 4 and R 5 They form 3, 4, 5, 6, or 7-membered cycloalkyl rings together with the carbon atoms to which they are attached.

[0186] In some specific examples, R 4 and R 5 They form a cyclopropyl ring together with the carbon atoms to which they are attached.

[0187] In some specific examples, R 4 and R 5 C independently 1-3 alkyl or C 1-3 It is a haloalkyl.

[0188] In some specific examples, R 4 and R 5 C independently 1-3 It is an alkyl.

[0189] In some specific examples, R 4 and R 5 is independently methyl.

[0190] In some specific examples, R 4 and R 5 , together with the carbon atom to which they are attached, form a cyclopropyl ring; or R 4 and R 5 C independently 1-3 It is an alkyl.

[0191] In some specific examples, R 6 and R 7 are H and C, respectively. 1-6 Alkyl and C 1-6 It is independently selected from haloalkyls.

[0192] In some specific examples, R 6 and R 7 Each is H.

[0193] In some specific examples:

[0194] R 1 is H;

[0195] R 2 is C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 2A Arbitrarily substituted with a substituent;

[0196] R3 C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 3A Arbitrarily substituted with a substituent;

[0197] R 4 and R 5 are respectively C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls;

[0198] Or alternatively, R 4 and R 5 They form a 3, 4, 5, or 6-membered cycloalkyl ring together with the carbon atoms to which they are attached;

[0199] R 6 and R 7 are H and C, respectively. 1-6 Independently selected from alkyls;

[0200] Each R 2A is Halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, OR a1 , SR a1 , C(=O)R b1 , C(=O)NR c1 R d1 , C(=O)OR a1 , OC(=O)R b1 , OC(=O)NR c1 R d1 , NR c1 R d1 , NRc1 C(=O)R b1 , NR c1 C(=O)OR b1 , NR c1 C(=O)NR c1 R d1 , NHOR a1 , NR c1 S(=O)2R b1 , NR c1 S(=O)2NR c1 R d1 , S(=O)2R b1 and S(=O)2NR c1 R d1 Selected independently from;

[0201] Each R a1 , R c1 and R d1 H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls;

[0202] Each R b1 C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls;

[0203] Each R 3A is Halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, OR a2 , SR a2 , C(=O)R b2 , C(=O)NR c2 R d2 , C(=O)OR a2 , OC(=O)R b2 , OC(=O)NR c2 R d2 , NR c2 R d2 , NR c2 C(=O)R b2 , NR c2 C(=O)OR b2 , NR c2 C(=O)NR c2 R d2 , NHOR a2, NR c2 S(=O)2R b2 , NR c2 S(=O)2NR c2 R d2 , S(=O)2R b2 and S(=O)2NR c2 R d2 Selected independently from;

[0204] Each R a2 , R c2 and R d2 is H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls; and

[0205] Each R b2 is C 1-6 Alkyl and C 1-6 It is independently selected from haloalkyls.

[0206] In some specific examples:

[0207] R 1 is H;

[0208] R 2 is selected from 4-7-membered heterocycloalkyl and phenyl, each having one R 2A Substituted by the qi;

[0209] R 2A is S(=O)2R b1 or S(=O)2NR c1 R d1 And;

[0210] R b1 C 1-3 It is alkyl;

[0211] R c1 and R d1 are H and C, respectively. 1-3 Independently selected from alkyls;

[0212] R 3 C 1-6 Alkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl and 5-6-membered heteroaryl-C 1-4Selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 3A Arbitrarily substituted with a substituent;

[0213] Each R 3A is H, halo, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls;

[0214] R 4 and R 5 are each methyl or;

[0215] or R 4 and R 5 They form a cyclopropyl ring together with the carbon atoms to which they are attached; and

[0216] R 6 and R 7 Each is H.

[0217] In a specific embodiment, the CDK2 inhibitor is a compound of the chemical formula (BI):

[0218] (BI)

[0219] or a pharmaceutically acceptable salt thereof, where:

[0220] n is an integer selected from 0, 1, 2, 3, 4, 5, and 6;

[0221] Gory Moiety A is a 3-14-membered cycloalkyl or a 4-14-membered heterocycloalkyl, where the cyclic moiety A is attached to the NH group of formula (I) in a saturated or partially saturated ring of the above 3-14-membered cycloalkyl or 4-14-membered heterocycloalkyl;

[0222] R 1 C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-14 Cycloalkyl, 6-14-memberedaryl, 4-14-memberedheterocycloalkyl, 5-14-memberedheteroaryl, C3-14 Cycloalkyl-C 1-4 Alkyl, 6-14-membered aryl-C 1-4 Alkyl, 4-14-membered heterocycloalkyl-C 1-4 Alkyl and 5-14-membered heteroaryl-C 1-4 Selected from alkyl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-14 Cycloalkyl, 6-14-memberedaryl, 4-14-memberedheterocycloalkyl, 5-14-memberedheteroaryl, C 3-14 Cycloalkyl-C 1-4 Alkyl, 6-14-membered aryl-C 1-4 Alkyl, 4-14-membered heterocycloalkyl-C 1-4 Alkyl and 5-14-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, 4, 5, or 6 independently selected Rs 4 Arbitrarily substituted by a substituent;

[0223] R 2 and R 3 are C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Independently selected from cycloalkyl, phenyl, 4-7-membered heterocycloalkyl and 5-6-membered heteroaryl, wherein C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, and 5-6-membered heteroaryl are each 1, 2, 3, or 4 independently selected R G Arbitrarily substituted by a substituent;

[0224] or R 2 and R 3 They are rings, together with the carbon atoms to which they are attached. B Forming;

[0225] ring B is a 3-7-membered cycloalkyl ring or a 4-7-membered heterocycloalkyl ring, each comprising 1, 2, 3, or 4 independently selected R G Arbitrarily substituted by a substituent;

[0226] Each R 4 is H, D, halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl, 5-10-membered heteroaryl-C 1-4 Alkyl, OR a4 , SR a4 , NHOR a4 , C(O)R b4 , C(O)NR c4 R d4 , C(O)NR c4 (OR a4 ), C(O)OR a4 , OC(O)R b4 , OC(O)NR c4 R d4 , NR c4 R d4 , NR c4 NR c4 R d4 , NR c4 C(O)R b4 , NR c4 C(O)OR a4 , NR c4 C(O)NR c4 R d4 , C(=NR e4 )R b4 , C(=NR e4 )NR c4 R d4 , NR c4 C(=NRe4 )NR c4 R d4 , NR c4 C(=NR e4 )R b4 , NR c4 S(O)NR c4 R d4 , NR c4 S(O)R b4 , NR c4 S(O)2R b4 , NR c4 S(O)(=NR e4 )R b4 , NR c4 S(O)2NR c4 R d4 , S(O)R b4 , S(O)NR c4 R d4 , S(O)2R b4 , S(O)2NR c4 R d4 , OS(O)(=NR e4 )R b4 , OS(O)2R b4 , S(O)(=NR e4 )R b4 , SF5, P(O)R f4 R g4 , OP(O)(OR h4 )(OR i4 ), P(O)(OR h4 )(OR i4 ) and BR j4 R k4 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs.4A Arbitrarily substituted with a substituent;

[0227] Each R 5 is H, D, halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl, 5-10-membered heteroaryl-C 1-4 Alkyl, OR a5 , SR a5 , NHOR a5 , C(O)R b5 , C(O)NR c5 R d5 , C(O)NR c5 (OR a5 ), C(O)OR a5 , OC(O)R b5 , OC(O)NR c5 R d5 , NR c5 R d5 , NR c5 NR c5 R d5 , NR c5 C(O)R b5 , NR c5 C(O)OR a5 , NR c5 C(O)NR c5 R d5 , C(=NR e5 )R b5 , C(=NR e5 )NR c5 R d5 , NR c5 C(=NR e5 )NR c5 R d5 , NR c5 C(=NR e5 )R b5 , NR c5S(O)NR c5 R d5 , NR c5 S(O)R b5 , NR c5 S(O)2R b5 , NR c5 S(O)(=NR e5 )R b5 , NR c5 S(O)2NR c5 R d5 , S(O)R b5 , S(O)NR c5 R d5 , S(O)2R b5 , S(O)2NR c5 R d5 , OS(O)(=NR e5 )R b5 , OS(O)2R b5 , S(O)(=NR e5 )R b5 , SF5, P(O)R f5 R g5 , OP(O)(OR h5 )(OR i5 ), P(O)(OR h5 )(OR i5 ) and BR j5 R k5 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 5A Arbitrarily substituted with a substituent;

[0228] Each R 4A is H, D, halo, CN, NO2, C 1-6Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl, 5-6-membered heteroaryl-C 1-4 Alkyl, OR a41 , SR a41 , NHOR a41 , C(O)R b41 , C(O)NR c41 R d41 , C(O)NR c41 (OR a41 ), C(O)OR a41 , OC(O)R b41 , OC(O)NR c41 R d41 , NR c41 R d41 , NR c41 NR c41 R d41 , NR c41 C(O)R b41 , NR c41 C(O)OR a41 , NR c41 C(O)NR c41 R d41 , C(=NR e41 )R b41 , C(=NR e41 )NR c41 R d41 , NR c41 C(=NR e41 )NR c41 R d41 , NR c41 C(=NR e41 )R b41 , NR c41 S(O)NR c41 R d41 , NR c41 S(O)R b41 , NR c41 S(O)2R b41 , NR c41S(O)(=NR e41 )R b41 , NR c41 S(O)2NR c41 R d41 , S(O)R b41 , S(O)NR c41 R d41 , S(O)2R b41 , S(O)2NR c41 R d41 , OS(O)(=NR e41 )R b41 , OS(O)2R b41 , S(O)(=NR e41 )R b41 , SF5, P(O)R f41 R g41 , OP(O)(OR h41 )(OR i41 ), P(O)(OR h41 )(OR i41 ) and BR j41 R k41 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 4B Arbitrarily substituted with a substituent;

[0229] Each R 4B is H, D, halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl, 5-6-membered heteroaryl-C 1-4 Alkyl, OR a42 , SR a42 , NHOR a42 , C(O)R b42 , C(O)NR c42 R d42 , C(O)NR c42 (OR a42 ), C(O)OR a42 , OC(O)R b42 , OC(O)NR c42 R d42 , NR c42 R d42 , NR c42 NR c42 R d42 , NR c42 C(O)R b42 , NR c42 C(O)OR a42 , NR c42 C(O)NR c42 R d42 , C(=NR e42 )R b42 , C(=NR e42 )NR c42 R d42 , NR c42 C(=NR e42 )NR c42 R d42 , NR c42 C(=NR e42 )R b42 , NR c42 S(O)NR c42 R d42 , NR c42 S(O)R b42 , NR c42 S(O)2R b42 , NR c42 S(O)(=NR e42 )R b42 , NR c42 S(O)2NR c42 R d42 , S(O)R b42 , S(O)NR c42 R d42, S(O)2R b42 , S(O)2NR c42 R d42 , OS(O)(=NR e42 )R b42 , OS(O)2R b42 , S(O)(=NR e42 )R b42 , SF5, P(O)R f42 R g42 , OP(O)(OR h42 )(OR i42 ), P(O)(OR h42 )(OR i42 ) and BR j42 R k42 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. G Arbitrarily substituted with a substituent;

[0230] Each R 5A is H, D, halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl, 5-6-membered heteroaryl-C 1-4 Alkyl, OR a51 , SR a51 , NHORa51 , C(O)R b51 , C(O)NR c51 R d51 , C(O)NR c51 (OR a51 ), C(O)OR a51 , OC(O)R b51 , OC(O)NR c51 R d51 , NR c51 R d51 , NR c51 NR c51 R d51 , NR c51 C(O)R b51 , NR c51 C(O)OR a51 , NR c51 C(O)NR c51 R d51 , C(=NR e51 )R b51 , C(=NR e51 )NR c51 R d51 , NR c51 C(=NR e51 )NR c51 R d51 , NR c51 C(=NR e51 )R b51 , NR c51 S(O)NR c51 R d51 , NR c51 S(O)R b51 , NR c51 S(O)2R b51 , NR c51 S(O)(=NR e51 )R b51 , NR c51 S(O)2NR c51 R d51 , S(O)R b51 , S(O)NR c51 R d51 , S(O)2R b51 , S(O)2NR c51 R d51 , OS(O)(=NR e51 )R b51 , OS(O)2R b51 , S(O)(=NR e51)R b51 , SF5, P(O)R f51 R g51 , OP(O)(OR h51 )(OR i51 ), P(O)(OR h51 )(OR i51 ) and BR j51 R k51 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 5B Arbitrarily substituted with a substituent;

[0231] Each R 5B is H, D, halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl, 5-6-membered heteroaryl-C 1-4 Alkyl, OR a52 , SR a52 , NHOR a52 , C(O)R b52 , C(O)NR c52 R d52 , C(O)NR c52 (OR a52 ), C(O)OR a52 , OC(O)R b52, OC(O)NR c52 R d52 , NR c52 R d52 , NR c52 NR c52 R d52 , NR c52 C(O)R b52 , NR c52 C(O)OR a52 , NR c52 C(O)NR c52 R d52 , C(=NR e52 )R b52 , C(=NR e52 )NR c52 R d52 , NR c52 C(=NR e52 )NR c52 R d52 , NR c52 C(=NR e52 )R b52 , NR c52 S(O)NR c52 R d52 , NR c52 S(O)R b52 , NR c52 S(O)2R b52 , NR c52 S(O)(=NR e52 )R b52 , NR c52 S(O)2NR c52 R d52 , S(O)R b52 , S(O)NR c52 R d52 , S(O)2R b52 , S(O)2NR c52 R d52 , OS(O)(=NR e52 )R b52 , OS(O)2R b52 , S(O)(=NR e52 )R b52 , SF5, P(O)R f52 R g52 , OP(O)(OR h52 )(OR i52 ), P(O)(OR h52 )(OR i52 ) 및 BRj52 R k52 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. G Arbitrarily substituted with a substituent;

[0232] Each R a4 , R c4 and R d4 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 4A Arbitrarily substituted with a substituent;

[0233] Or, any R attached to the same N atom c4 and R d4 They form a 5- or 6-membered heteroaryl or 4-10-membered heterocycloalkyl group together with the N atom to which they are attached, where the 5- or 6-membered heteroaryl and 4-10-membered heterocycloalkyl groups are each 1, 2, 3, or 4 independently selected R atoms. 4A Arbitrarily substituted with a substituent;

[0234] Each R b4 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 4A Arbitrarily substituted with a substituent;

[0235] Each R e4 is H, OH, CN, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0236] Each R f4 and R g4 is H, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0237] Each R h4 and R i4 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0238] Each R j4 and R k4 is OH, C 1-6 Alkoxy and C 1-6 Independently selected from haloalkoxy;

[0239] or any R attached to the same B atom j4 and Rk4 is together with the B atoms to which they are attached, C 1-6 Alkyl and C 1-6 Forming a 5- or 6-membered heterocycloalkyl group optionally substituted with 1, 2, 3, or 4 substituents independently selected from haloalkyls;

[0240] Each R a41 , R c41 and R d41 H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 4B Arbitrarily substituted with a substituent;

[0241] Or, any R attached to the same N atom c41 and R d41They form a 5- or 6-membered heteroaryl or 4-7-membered heterocycloalkyl group together with the N atom to which they are attached, where the 5- or 6-membered heteroaryl and 4-7-membered heterocycloalkyl groups are each 1, 2, 3, or 4 independently selected R atoms. 4B Arbitrarily substituted with a substituent;

[0242] Each R b41 C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 4B Arbitrarily substituted with a substituent;

[0243] Each R e41 H, OH, CN, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0244] Each R f41 and R g41 H, C 1-6 Alkyl, C 1-6 Alkoxy, C1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0245] Each R h41 and R i41 H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0246] Each R j41 and R k41 OH, C 1-6 Alkoxy and C 1-6 Independently selected from haloalkoxy;

[0247] or any R attached to the same B atom j41 and R k41 silver Along with the B atoms to which they are attached, C 1-6 Alkyl and C 1-6 Forming a 5- or 6-membered heterocycloalkyl group optionally substituted with 1, 2, 3, or 4 substituents independently selected from haloalkyls;

[0248] Each R a42 , R c42 and R d42is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. G Arbitrarily substituted with a substituent;

[0249] Or, any R attached to the same N atom c42 and R d42 They form a 5- or 6-membered heteroaryl or 4-7-membered heterocycloalkyl group together with the N atom to which they are attached, where the 5- or 6-membered heteroaryl and 4-7-membered heterocycloalkyl groups are each 1, 2, 3, or 4 independently selected R atoms. G Arbitrarily substituted with a substituent;

[0250] Each R b42 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs G Arbitrarily substituted with a substituent;

[0251] Each R e42 is H, OH, CN, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0252] Each R f42 and R g42 is H, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0253] Each Rh42 and R i42 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0254] Each R j42 and R k42 is OH, C 1-6 Alkoxy and C 1-6 Independently selected from haloalkoxy;

[0255] or any R attached to the same B atom j42 and R k42 Is Along with the B atoms to which they are attached, C 1-6 Alkyl and C 1-6 Forming a 5- or 6-membered heterocycloalkyl group optionally substituted with 1, 2, 3, or 4 substituents independently selected from haloalkyls;

[0256] Each R a5 , R c5 and R d5 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 5A Arbitrarily substituted with a substituent;

[0257] Or, any R attached to the same N atom c5 and R d5 They form a 5- or 6-membered heteroaryl or 4-10-membered heterocycloalkyl group together with the N atom to which they are attached, where the 5- or 6-membered heteroaryl and 4-10-membered heterocycloalkyl groups are each 1, 2, 3, or 4 independently selected R atoms. 5A Arbitrarily substituted with a substituent;

[0258] Each R b5 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 5A Arbitrarily substituted with a substituent;

[0259] Each R e5 is H, OH, CN, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0260] Each R f5 and R g5 is H, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0261] Each R h5 and R i5 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0262] Each R j5 and R k5 is OH, C 1-6 Alkoxy and C 1-6 Independently selected from haloalkoxy;

[0263] or any R attached to the same B atom j5 and R k5 is together with the B atoms to which they are attached, C 1-6 Alkyl and C 1-6 Forming a 5- or 6-membered heterocycloalkyl group optionally substituted with 1, 2, 3, or 4 substituents independently selected from haloalkyls;

[0264] Each R a51 , R c51 and R d51 H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 5B Arbitrarily substituted with a substituent;

[0265] Or, any R attached to the same N atom c51 and R d51 They form a 5- or 6-membered heteroaryl or 4-7-membered heterocycloalkyl group together with the N atom to which they are attached, where the 5- or 6-membered heteroaryl and 4-7-membered heterocycloalkyl groups are each 1, 2, 3, or 4 independently selected R atoms. 5B Arbitrarily substituted with a substituent;

[0266] Each R b51 C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 5B Arbitrarily substituted with a substituent;

[0267] Each R e51 H, OH, CN, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0268] Each R f51 and R g51 H, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0269] Each R h51 and R i51 H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0270] Each R j51 and R k51 OH, C 1-6 Alkoxy and C 1-6 Independently selected from haloalkoxy;

[0271] or any R attached to the same B atom j51 and R k51 C together with the B atoms to which they are attached.1-6 Alkyl and C 1-6 Forming a 5- or 6-membered heterocycloalkyl group optionally substituted with 1, 2, 3, or 4 substituents independently selected from haloalkyls;

[0272] Each R a52 , R c52 and R d52 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. G Arbitrarily substituted with a substituent;

[0273] Or, any R attached to the same N atom c52 and R d52 They form a 5- or 6-membered heteroaryl or 4-7-membered heterocycloalkyl group together with the N atom to which they are attached, where the 5- or 6-membered heteroaryl and 4-7-membered heterocycloalkyl groups are each 1, 2, 3, or 4 independently selected R atoms. GArbitrarily substituted with a substituent;

[0274] Each R b52 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs G Arbitrarily substituted with a substituent;

[0275] Each R e52 is H, OH, CN, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0276] Each R f52 and R g52 is H, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkyl, C 1-6 Haloalkoxy, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0277] Each R h52 and R i52 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls;

[0278] Each R j52 and R k52 is OH, C 1-6 Alkoxy and C 1-6 Independently selected from haloalkoxy;

[0279] or any R attached to the same B atom j52 and R k52 is together with the B atoms to which they are attached, C 1-6 Alkyl and C 1-6 Forming a 5- or 6-membered heterocycloalkyl group optionally substituted with 1, 2, 3, or 4 substituents independently selected from haloalkyls; and

[0280] Each R G is H, D, OH, NO2, CN, halo, C 1-3 Alkyl, C 2-3 Alkenyl, C 2-3 Alkinyl, C 1-3 Haloalkyl, Cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, C 1-3 Alkoxy-C 1-3 Alkyl, C3-7 Cycloalkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, amino, C 1-3 alkylamino, di(C 1-3 Alkyl)amino, thio, C 1-3 Alkylthio, C 1-3 Alkylsulfinyl, C 1-3 Alkylsulfonyl, Carbamyl, C 1-3 Alkylcarbamyl, di(C 1-3 Alkyl)carbamyl, carboxy, C 1-3 Alkyl carbonyl, C 1-3 Alkoxycarbonyl, C 1-3 Alkylcarbonyloxy, C 1-3 Alkylcarbonylamino, C 1-3 Alkoxycarbonylamino, C 1-3 Alkylaminocarbonyloxy, C 1-3 Alkylsulfonylamino, aminosulfonyl, C 1-3 Alkylaminosulfonyl, di(C 1-3 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-3 Alkylaminosulfonylamino, di(C 1-3 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-3 Alkylaminocarbonylamino and di(C 1-3 It is independently selected from alkyl)aminocarbonylamino.

[0281] In some specific examples:

[0282] n is an integer selected from 0, 1, 2, 3, or 4;

[0283] Gory Moiety A is a monocyclic 3-7-membered cycloalkyl or a monocyclic 4-7-membered heterocycloalkyl;

[0284] R 1 C 1-6 Haloalkyl, C 3-7 Selected from cycloalkyl and phenyl, each comprising one or two independently selected R 4 Arbitrarily substituted by a substituent;

[0285] R 2 is C2-6 Alkyl and C 1-6 Selected from haloalkyls;

[0286] R 3 C 1-6 Alkyl and C 1-6 Selected from haloalkyls;

[0287] or R 2 and R 3 They are rings, together with the carbon atoms to which they are attached. B Forming;

[0288] ring B is a 3-7-membered cycloalkyl ring;

[0289] Each R 4 is Halo, CN, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a4 and NR c4 R d4 Selected independently from;

[0290] Each R a4 , R c4 and R d4 is H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls;

[0291] Each R 5 is C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C(O)R b5 , C(O)NR c5 R d5 , C(O)OR a5 , S(O)2R b5 and S(O)2NR c5 R d5 Selected independently from;

[0292] Each R 5A is Halo, CN, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls;

[0293] Each R a5 , R c5and R d5 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 5A Arbitrarily substituted with a substituent; and

[0294] Each R b5 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 5A It is arbitrarily substituted with a substituent.

[0295] In some specific examples:

[0296] n is an integer selected from 0, 1, 2, 3, or 4;

[0297] Gory MoietyA is a monocyclic 4-7-membered heterocycloalkyl;

[0298] R 1 C 1-6 Haloalkyl, C 3-7 Selected from cycloalkyl and phenyl, each comprising one or two independently selected R 4 Arbitrarily substituted by a substituent;

[0299] R 2 is ethyl, propyl, isopropyl, and C 1-3 Selected from fluoroalkyls;

[0300] R 3 Silver, methyl, ethyl, propyl, isopropyl, and C 1-3 Selected from fluoroalkyls;

[0301] or R 2 and R 3 They are rings, together with the carbon atoms to which they are attached. B Forming;

[0302] ring B is a 3-4-membered cycloalkyl ring;

[0303] Each R 4 is C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls;

[0304] Each R 5 is C 1-6 Alkyl, C 1-6 Haloalkyl and S(O)2R b5 Selected independently from;

[0305] Each R b5 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Independently selected from cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, and 5-6-membered heteroaryl, each comprising 1 or 2 independently selected R 5A arbitrarily substituted by a substituent; and

[0306] Each R 5Ais Halo, CN, C 1-6 Alkyl and C 1-6 It is independently selected from haloalkyls.

[0307] In some embodiments, the compound is a compound of the chemical formula (B-Ia):

[0308] (B-Ia)

[0309] or a pharmaceutically acceptable salt thereof, where k is n-1.

[0310] In some specific examples, R 1 C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of 1, 2, 3, 4, 5, or 6 independently selected Rs 4 It is arbitrarily substituted by a substituent.

[0311] In some specific examples, R 1 C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, C 3-7 Cycloalkyl-C 1-3 Selected from alkyl, phenyl, 4-10-membered heterocycloalkyl, and 5-6-membered heteroaryl, each comprising 1 or 2 independently selected R 4 It is arbitrarily substituted by a substituent.

[0312] In some specific examples, each R 4 is Halo, CN, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, OR a4 , C(O)Rb4 , C(O)NR c4 R d4 , C(O)OR a4 , OC(O)R b4 , OC(O)NR c4 R d4 , NR c4 R d4 , NR c4 C(O)R b4 , NR c4 C(O)OR a4 , NR c4 C(O)NR c4 R d4 , NR c4 S(O)2R b4 , NR c4 S(O)2NR c4 R d4 , S(O)2R b4 and S(O)2NR c4 R d4 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl and C 1-6 Each haloalkyl is one, two, three, or four independently selected Rs 4A It is arbitrarily substituted with a substituent.

[0313] In some specific examples:

[0314] Each R 4A is Halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, OR a41 , SR a41 , C(O)R b41 , C(O)NR c41 R d41 , C(O)OR a41 , OC(O)R b41 , OC(O)NR c41 R d41 , NR c41 R d41 , NR c41 C(O)R b41 , NR c41 C(O)ORa41 , NR c41 C(O)NR c41 R d41 , NR c41 S(O)2R b41 , NR c41 S(O)2NR c41 R d41 , S(O)2R b41 and S(O)2NR c41 R d41 Selected independently from;

[0315] Each R a4 , R c4 and R d4 is H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 4A Arbitrarily substituted with a substituent;

[0316] Each R b4 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 4A Arbitrarily substituted with a substituent;

[0317] Each R a41 , R c41 and R d41 H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls; and

[0318] Each R b41 C 1-6 Alkyl and C 1-6 It is independently selected from haloalkyls.

[0319] In some specific examples:

[0320] Each R 4A is Halo, CN, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a41 , C(O)R b41 , C(O)NR c41 R d41 , C(O)OR a41 , NR c41 R d41 , NR c41 C(O)R b41 , NNR c41 S(O)2R b41 , S(O)2R b41 , and S(O)2NR c41 R d41 Selected independently from;

[0321] Each R a4 , R c4 and R d4 is H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls, wherein C 1-6 Alkyl and C 1-6 Each haloalkyl is one, two, three, or four independently selected Rs 4A Arbitrarily substituted with a substituent;

[0322] Each R b4 is C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls, each comprising 1, 2, 3, or 4 independently selected Rs 4A Arbitrarily substituted with a substituent;

[0323] Each R a41 , R c41 and R d41 H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls; and

[0324] Each R b41 C 1-6 Alkyl and C 1-6 It is independently selected from haloalkyls.

[0325] In some embodiments, ring moiety A is a monocyclic 3-7-membered cycloalkyl or a monocyclic 4-7-membered heterocycloalkyl.

[0326] In some embodiments, ring moiety A is a monocyclic 4-7-membered heterocycloalkyl.

[0327] In some embodiments, ring moiety A It is an azetidine ring, a pyrrolidine ring, a piperidine ring, or an azephan ring.

[0328] In some embodiments, ring moiety A is a piperidine ring.

[0329] In some embodiments, n is 1 or 2.

[0330] In some specific examples, each R 5 is Halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, OR a5 , SR a5 , C(O)R b5, C(O)NR c5 R d5 , C(O)OR a5 , OC(O)R b5 , OC(O)NR c5 R d5 , NR c5 R d5 , NR c5 C(O)R b5 , NR c5 C(O)OR a5 , NR c5 C(O)NR c5 R d5 , NR c5 S(O)2R b5 , NR c5 S(O)2NR c5 R d5 , S(O)2R b5 and S(O)2NR c5 R d5 It is selected independently from.

[0331] In some specific examples:

[0332] Each R a5 , R c5 and R d5 is H and C 1-6 Independently selected from alkyls; and

[0333] Each R b5 is C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of one or two independently selected Rs 5A It is arbitrarily substituted with a substituent.

[0334] In some specific examples, each R 5 is Halo and C1-6 It is independently selected from alkyls.

[0335] In some specific examples, each R b5 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 5A It is arbitrarily substituted with a substituent.

[0336] In some specific examples, R b5 is C 1-6 Alkyl, C 3-6 Selected from cycloalkyl, phenyl, 4-6-membered heterocycloalkyl, and 5-6-membered heteroaryl, which are each halo, C 1-6 One or two Rs independently selected from alkyl and 4-6-membered heterocycloalkyl 5A It is optionally substituted by a substituent, wherein the 4-6-membered heterocycloalkyl is C 1-3 One or two Rs independently selected from alkyls 5B It is arbitrarily substituted by a substituent.

[0337] In some specific examples:

[0338] Each R 5 is Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, OR a5 and NR c5 R d5 Selected independently from;

[0339] Each R a5 , R c5 and R d5 is H and C1-6 Independently selected from alkyls;

[0340] R b5 is C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of one or two independently selected Rs 5A Arbitrarily substituted with a substituent;

[0341] Each R 5A is Halo, CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, OR a51 , SR a51 , C(O)R b51 , C(O)NR c51 R d51 , C(O)OR a51 , OC(O)R b51 , OC(O)NR c51 R d51 , NR c51 R d51 , NR c51 C(O)R b51 , NR c51 C(O)OR a51 , NR c51 C(O)NR c51 R d51 , NR c51 S(O)2R b51 , NR c51 S(O)2NR c51 R d51 , S(O)2R b51 and S(O)2NR c51 R d51Independently selected from, where the above C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, and 5-6-membered heteroaryl are each one or two independently selected R 5B Arbitrarily substituted with a substituent;

[0342] Each R a51 , R c51 and R d51 H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls, wherein C 1-6 Alkyl and C 1-6 Each haloalkyl is one or two independently selected Rs 5B Arbitrarily substituted with a substituent;

[0343] Each R b51 C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls, each comprising one or two independently selected Rs 5B Arbitrarily substituted with a substituent; and

[0344] Each R 5B is Halo, CN, C 1-6 Alkyl and C 1-6 It is independently selected from haloalkyls.

[0345] In some specific examples:

[0346] Each R 5 is Halo and C 1-3 Independently selected from alkyls;

[0347] R b5 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Selected from cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, and 5-6-membered heteroaryl, each comprising 1 or 2 independently selected R 5A Arbitrarily substituted with a substituent;

[0348] Each R5A is Halo, C 1-6 Independently selected from alkyl and 4-7-membered heterocycloalkyl, wherein C 1-6 Alkyl and 4-7-membered heterocycloalkyl are each one or two independently selected R 5B Arbitrarily substituted with a substituent; and

[0349] Each R 5B is C 1-6 It is independently selected from alkyls.

[0350] In some embodiments, the compound is a compound of formula (B-II):

[0351] (B-II)

[0352] or a pharmaceutically acceptable salt thereof, wherein variables are defined according to the definitions provided herein.

[0353] In some embodiments, the compound is a compound of the chemical formula (B-IIa):

[0354] (B-IIa)

[0355] or a pharmaceutically acceptable salt thereof, where k is n-1, and the remaining variables are defined according to the definitions provided herein.

[0356] In some embodiments, the compound is a compound of the chemical formula (B-IIb):

[0357] (B-IIb)

[0358] or a pharmaceutically acceptable salt thereof, where k is n-1, and the remaining variables are defined according to the definitions provided herein.

[0359] In some embodiments, the ring B is a 3-7-membered cycloalkyl ring.

[0360] In some embodiments, the compound is a compound of the chemical formula (B-IIc):

[0361] (B-IIc)

[0362] or a pharmaceutically acceptable salt thereof, where k is n-1, and the remaining variables are defined according to the definitions provided herein.

[0363] In some embodiments, the compound is a compound of the chemical formula (B-IId):

[0364] (B-IId)

[0365] or a pharmaceutically acceptable salt thereof, where:

[0366] X is bonded or CH2;

[0367] Y is bonded or CH2; and

[0368] k is n-1.

[0369] In some embodiments, the compound has the chemical formula (B-Ia), where:

[0370] k is n-1 and;

[0371] n is an integer selected from 1 and 2;

[0372] Gory Moiety A is a monocyclic 4-6-membered heterocycloalkyl;

[0373] R 1 C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, phenyl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Selected from alkyl, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-10Cycloalkyl, phenyl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Each alkyl group is one, two, or three independently selected Rs. 4 Arbitrarily substituted by a substituent;

[0374] R 2 and R 3 They are rings, together with the carbon atoms to which they are attached. B Forming;

[0375] ring B is a 3-7-membered cycloalkyl ring;

[0376] Each R 4 is H, halo, CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-4 Cycloalkyl, OR a4 , C(O)R b4 , C(O)NR c4 R d4 , C(O)OR a4 , OC(O)R b4 , OC(O)NR c4 R d4 , NR c4 R d4 , NR c4 C(O)R b4 , NR c4 C(O)OR a4 , NR c4 C(O)NR c4 R d4 , NR c4 S(O)2R b4 , NR c4 S(O)2NR c4 R d4 , S(O)2R b4 and S(O)2NR c4 R d4 Selected independently from;

[0377] Each R5 is H, halo, CN, C 1-3 Alkyl and C 1-3 Independently selected from haloalkyls;

[0378] Each R 5A is H, D, halo, CN, NO2, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl, 5-6-membered heteroaryl-C 1-4 Alkyl, OR a51 , C(O)R b51 , C(O)NR c51 R d51 C(O)OR a51 , OC(O)R b51 , OC(O)NR c51 R d51 , NR c51 R d51 , NR c51 C(O)R b51 , NR c51 C(O)OR a51 , NR c51 C(O)NR c51 R d51 , NR c51 S(O)2R b51 , NR c51 S(O)2NR c51 R d51 , S(O)2R b51 and S(O)2NR c51 R d51 Independently selected from, where the above C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 5B Arbitrarily substituted with a substituent;

[0379] Each R 5B is H, halo, CN, C 1-6 Alkyl, C 1-6 Haloalkyl, OH, NO2, CN, halo, C 1-3 Alkyl, C 2-3 Alkenyl, C 2-3 Alkinyl, C 1-3 Haloalkyl, Cyano-C 1-3 Alkyl, HO-C 1-3 Alkyl, C 1-3 Alkoxy-C 1-3 Alkyl, C 3-7 Cycloalkyl, C 1-3 Alkoxy, C 1-3 Haloalkoxy, amino, C 1-3 alkylamino, di(C 1-3 Alkyl)amino, thio, C 1-3 Alkylthio, C 1-3 Alkylsulfinyl, C 1-3 Alkylsulfonyl, Carbamyl, C 1-3 Alkylcarbamyl, di(C 1-3 Alkyl)carbamyl, carboxy, C 1-3 Alkyl carbonyl, C 1-3 Alkoxycarbonyl, C 1-3 Alkylcarbonyloxy, C 1-3 Alkylcarbonylamino, C 1-3 Alkoxycarbonylamino, C 1-3 Alkylaminocarbonyloxy, C 1-3 Alkylsulfonylamino, aminosulfonyl, C 1-3 Alkylaminosulfonyl, di(C 1-3 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-3 Alkylaminosulfonylamino, di(C 1-3 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-3Alkylaminocarbonylamino and di(C 1-3 Independently selected from alkyl)aminocarbonylamino;

[0380] Each R a4 , R c4 and R d4 is H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls;

[0381] Each R b5 is C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C 1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 5A Arbitrarily substituted with a substituent;

[0382] Each R a51 , R c51 and R d51 H, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, wherein C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Each alkyl group is 1, 2, 3, or 4 independently selected Rs. 5B Arbitrarily substituted with a substituent; and

[0383] Each R b51 C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C 3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Independently selected from alkyls, each consisting of 1, 2, 3, or 4 independently selected Rs 5B It is arbitrarily substituted with a substituent.

[0384] In some embodiments of the compound of chemical formula (B-Ia):

[0385] k is n-1 and;

[0386] n is 1 or 2 and;

[0387] Gory Moiety A is a 4-6-membered heterocycloalkyl;

[0388] R 1 C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-10 Cycloalkyl, 6-10-membered aryl, 4-10-membered heterocycloalkyl, 5-10-membered heteroaryl, C 3-10 Cycloalkyl-C 1-4 Alkyl, 6-10-membered aryl-C1-4 Alkyl, 4-10-membered heterocycloalkyl-C 1-4 Alkyl and 5-10-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of 1, 2, or 3 independently selected Rs 4 Arbitrarily substituted by a substituent;

[0389] Each R 4 is Halo, CN, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a4 and NR c4 R d4 Selected independently from;

[0390] Each R a4 , R c4 and R d4 is H and C 1-6 Independently selected from alkyls;

[0391] R 2 and R 3 They are rings, together with the carbon atoms to which they are attached. B Forming;

[0392] ring B is a 3-4-membered cycloalkyl ring;

[0393] Each R 5 is Halo, C 1-3 Alkyl, C 1-3 Haloalkyl, OR a5 and NR c5 R d5 Selected independently from;

[0394] Each R a5 , R c5 and R d5 is H and C 1-6 Independently selected from alkyls;

[0395] R b5 is C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkinyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, C3-7 Cycloalkyl-C 1-4 Alkyl, Phenyl-C 1-4 Alkyl, 4-7-membered heterocycloalkyl-C 1-4 Alkyl and 5-6-membered heteroaryl-C 1-4 Selected from alkyls, each consisting of one or two independently selected Rs 5A Arbitrarily substituted with a substituent;

[0396] Each R 5A is Halo, CN, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, 5-6-membered heteroaryl, OR a51 , SR a51 , C(O)R b51 , C(O)NR c51 R d51 , C(O)OR a51 , OC(O)R b51 , OC(O)NR c51 R d51 , NR c51 R d51 , NR c51 C(O)R b51 , NR c51 C(O)OR a51 , NR c51 C(O)NR c51 R d51 , NR c51 S(O)2R b51 , NR c51 S(O)2NR c51 R d51 , S(O)2R b51 and S(O)2NR c51 R d51 Independently selected from, where the above C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, phenyl, 4-7-membered heterocycloalkyl, and 5-6-membered heteroaryl are each one or two independently selected R 5B Arbitrarily substituted with a substituent;

[0397] Each R a51 , Rc51 and R d51 H, C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls, wherein C 1-6 Alkyl and C 1-6 Each haloalkyl is one or two independently selected Rs 5B Arbitrarily substituted with a substituent;

[0398] Each R b51 C 1-6 Alkyl and C 1-6 Independently selected from haloalkyls, each comprising one or two independently selected Rs 5B Arbitrarily substituted with a substituent; and

[0399] Each R 5B is Halo, CN, C 1-6 Alkyl and C 1-6 It is independently selected from haloalkyls.

[0400] In some embodiments of the compound of chemical formula (B-Ia):

[0401] k is n-1 and;

[0402] n is 1 or 2 and;

[0403] Gory Moiety A is a piperidine ring;

[0404] R 1 C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Cycloalkyl, C 3-7 Cycloalkyl, C 3-7 Cycloalkyl-C 1-3 Selected from alkyl, phenyl, 4-10-membered heterocycloalkyl, and 5-6-membered heteroaryl, each comprising 1 or 2 independently selected R 4 Arbitrarily substituted by a substituent;

[0405] Each R 4 is halo, OH, C 1-3 Alkyl and C 1-3 Independently selected from alkoxy;

[0406] R 2 and R 3 They are rings, together with the carbon atoms to which they are attached. B Forming;

[0407] ring B is a 3-4-membered cycloalkyl ring;

[0408] Each R 5 is Halo and C 1-3 Independently selected from alkyls; and

[0409] R b5 is C 1-6 Alkyl, C 3-6 Selected from cycloalkyl, phenyl, 4-6-membered heterocycloalkyl, and 5-6-membered heteroaryl, which are each halo, C 1-6 One or two Rs independently selected from alkyl and 4-6-membered heterocycloalkyl 5A It is optionally substituted by a substituent, wherein the 4-6-membered heterocycloalkyl is C 1-3 One or two Rs independently selected from alkyls 5B It is arbitrarily substituted by a substituent.

[0410] In some embodiments, the compound is a compound selected from the compounds of the examples or pharmaceutically acceptable salts thereof.

[0411] In some embodiments, "alkyl," "alkenyl," "alkynyl," "aryl," "phenyl," "cycloalkyl," "heterocycloalkyl," or "heteroaryl" substituents as described herein or "-C 1-4 1, 2, 3, 4, 5, 6, 7, or 8 hydrogen atoms attached to the carbon atoms of the alkyl- and "alkylene" linkers are optionally replaced by deuterium atoms.

[0412] For clarity, certain features of the invention described in the context of separate embodiments are further recognized as being provided in combination in a single embodiment. Conversely, for brevity, various features of the invention described in the context of a single embodiment may also be provided separately or in any suitable sub-combination.

[0413] In various places within this specification, bivalent linking substituents are described. Each bivalent linking substituent is explicitly intended to include both the forward and reverse forms of the linking substituent. For example, -NR(CR'R'') n - is -NR(CR'R'') n - and -(CR'R'') n NR- Includes both. Where the structure explicitly requires a linker, the Markush variables listed for the above are understood to be linkers.

[0414] One R 5 is S(O)2R b5 and each remainder R 5 A specific example mentioning "is selected independently from" is, through multiple dependencies, fluid -S(O)2R b5 When combined with the chemical formula showing a substituent, the flowing -S(O)2R in the said chemical formula b5 Substituents are idioms "one R 5 is S(O)2R b5 Replaces "is". In the case of such a specific example combined with a chemical formula having an integer k, R 5 Among substituents (n possible R 5 One of the substituents) is S(O)2R of the above chemical formula b5 It is replaced by a substituent, where the remainder R 5 Substituents (k remaining R 5 Substituent) Each is "each remainder R 5 Selected independently from the list.

[0415] The term "n-one" (where n is an integer) typically describes the number of ring-forming atoms in a moiety where the number of ring-forming atoms is n. For example, piperidinyl is an example of a 6-membered heterocycloalkyl ring, pyrazolyl is an example of a 5-membered heteroaryl ring, pyridyl is an example of a 6-membered heteroaryl ring, and 1,2,3,4-tetrahydro-naphthalene is an example of a 10-membered cycloalkyl group.

[0416] As used herein, the idiom “arbitrarily substituted” means that it is not substituted or is substituted. Substituents are selected independently, and substitution may occur at any chemically accessible position. As used herein, the term “substituted” means that a hydrogen atom is removed and replaced by a substituent. A single divalent substituent, for example, oxo, can replace two hydrogen atoms. It should be understood that substitution at a given atom is limited by its valence, that the normal valence of the specified atom is not exceeded, and that such substitution results in a stable compound.

[0417] As used herein, the idiom “each ‘variable’ is selected independently in” means practically the same as “in each occurrence, the ‘variable’ is selected in”.

[0418] Arbitrary variable (e.g., R S When ) occurs one or more times in any component or formula of a compound, its definition in each occurrence is independent of its definition in all other occurrences. Thus, for example, if the group has 1, 2, 3, or 4 R S If it appears to be replaced by, the above apparatus has up to 4 Rs S It can be arbitrarily substituted with gi, and in each occurrence R S is R SIt is selected independently from the definition of. Additionally, combinations of substituents and / or variables are permitted only if such combinations result in stable compounds; for example, in a combination of two R groups, the combination of the first M group and the second M group is permitted only if such combination of MM results in a stable compound (for example, if MM forms a highly reactive compound, such as a peroxide having an OO bond, this is not permitted).

[0419] Throughout the definition, the term "C n-m " indicates a range including the endpoint, where n and m are integers representing the number of carbons. An example is C 1-3 , C 1-4 , C 1-6 Includes the back.

[0420] As used herein, the term "C" used alone or in combination with other terms. n-m "Alkyl" refers to a straight-chain or branched saturated hydrocarbon group having n to m carbons. Examples of alkyl moiety are methyl (Me), ethyl (Et), n -profile ( n -Pr), isopropyl (iPr), n -butyl, tert- Butyl, isobutyl, sec -Butyl; higher homologues e.g., 2-methyl-1-butyl, n -pentyl, 3-pentyl, n Chemical groups such as -hexyl, 1,2,2-trimethylpropyl, etc. are included but not limited to these. In some embodiments, the alkyl group contains 1 to 6 carbon atoms, 1 to 4 carbon atoms, 1 to 3 carbon atoms, or 1 to 2 carbon atoms.

[0421] As used herein, "C n-m "Alkenyl" refers to an alkyl group having n to m carbons and one or more double carbon-carbon bonds. Examples of alkenyl groups include ethenyl,n -propenyl, isopropenyl, n -Butenyl, sec - Includes butenyl, etc., but is not limited to these. In some embodiments, the alkenyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0422] As used herein, "C n-m "Alkynyl" refers to an alkyl group having one or more triple carbon-carbon bonds and having n to m carbons. Examples of alkynyl groups include, but are not limited to, ethinyl, propin-1-yl, propin-2-yl, etc. In some embodiments, the alkynyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms. As used herein, the term "C" used alone or in combination with other terms n-m "Alkoxy" refers to a group of the chemical formula -O-alkyl, where the alkyl group has n to m carbons. Examples of alkoxy groups include methoxy, ethoxy, and propoxy (e.g., n -propoxy and isopropoxy), butoxy (e.g., n - Butoxy and tert -butoxy) etc., but is not limited to these. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0423] As used herein, the term "amino" refers to the group of the chemical formula -NH2.

[0424] As used herein, the term "aryl," used alone or in combination with other terms, refers to an aromatic hydrocarbon group that may be monocyclic or polycyclic (e.g., having two fused rings). The term "C n-m"Aryl" refers to an aryl group having n to m cyclic carbon atoms. Aryl groups include, for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl, etc. In some embodiments, the aryl group has 6 to 10 carbon atoms. In some embodiments, the aryl group is phenyl or naphthyl. In some embodiments, the aryl is phenyl.

[0425] As used herein, "halo" refers to F, Cl, Br, or I. In some embodiments, the halo is F, Cl, or Br. In some embodiments, the halo is F or Cl. In some embodiments, the halo is F. In some embodiments, the halo is Cl.

[0426] As used herein, "C n-m "Haloalkoxy" refers to a group of the formula -O-haloalkyl having n to m carbon atoms. Examples of haloalkoxy groups include OCF3 and OCHF2. In some embodiments, the haloalkoxy group is merely fluorinated. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0427] As used herein, the term "C" used alone or in combination with other terms. n-m "Haloalkyl" refers to an alkyl group having 1 halogen atom or 2s+1 halogen atoms that may be the same or different, wherein "s" is the number of carbon atoms in the alkyl group, and the alkyl group has n to m carbon atoms. In some embodiments, the haloalkyl group is merely fluorinated. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of haloalkyl groups include CF3, C2F5, CHF2, CH2F, CCl3, CHCl2, C2Cl5, etc.

[0428] As used herein, the term "thio" refers to the group of the chemical formula -SH.

[0429] As used herein, the term "C n-m "Alkylamino" refers to a group of the chemical formula -NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0430] As used herein, the term "C n-m "Alkoxycarbonyl" refers to a group of the chemical formula -C(O)O-alkyl, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0431] As used herein, the term "C n-m "Alkyl carbonyl" refers to a group of the chemical formula -C(O)-alkyl, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0432] As used herein, the term "C n-m "Alkylcarbonylamino" refers to a group of the chemical formula -NHC(O)-alkyl, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0433] As used herein, the term "C n-m "Alkoxycarbonylamino" has the chemical formula -NHC(O)O(C n-m Refers to an alkyl group, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0434] As used herein, the term "C n-m"Alkylsulfonylamino" refers to a group of the chemical formula -NHS(O)2-alkyl, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0435] As used herein, the term "aminosulfonyl" refers to the group of the chemical formula -S(O)2NH2.

[0436] As used herein, the term "C n-m "Alkylaminosulfonyl" refers to a group of the chemical formula -S(O)2NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0437] As used herein, the term "D (C n-m "alkyl)aminosulfonyl" refers to a group of the chemical formula -S(O)2N(alkyl)2, wherein each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0438] As used herein, the term "aminosulfonylamino" refers to the group of the chemical formula -NHS(O)2NH2.

[0439] As used herein, the term "C n-m "Alkylaminosulfonylamino" refers to a group of the chemical formula -NHS(O)2NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0440] As used herein, the term "D (C n-m"alkyl)aminosulfonylamino" refers to a group of the chemical formula -NHS(O)2N(alkyl)2, wherein each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0441] As used herein, the term "aminocarbonylamino," used alone or in combination with other terms, refers to the group of the chemical formula -NHC(O)NH2.

[0442] As used herein, the term "C n-m "Alkylaminocarbonylamino" refers to a group of the chemical formula -NHC(O)NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0443] As used herein, the term "D (C n-m "alkyl)aminocarbonylamino" refers to a group of the chemical formula -NHC(O)N(alkyl)2, wherein each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0444] As used herein, the term "C n-m "Alkylcarbamyl" refers to a group of the chemical formula -C(O)-NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0445] As used herein, the term "C n-m"Alkylthio" refers to a group of the formula -S-alkyl, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0446] As used herein, the term "C n-m "Alkylsulfinyl" refers to a group of the chemical formula -S(O)-alkyl, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0447] As used herein, the term "C n-m "Alkylsulfonyl" refers to a group of the chemical formula -S(O)2-alkyl, wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0448] As used herein, the term "cyano-C" 1-6 "alkyl" has the chemical formula -(C 1-6 It refers to the alkylene)-CN group. As used herein, the term "cyano-C 1-3 "alkyl" has the chemical formula -(C 1-3 It refers to the alkylene)-CN group.

[0449] As used herein, the term "HO-C 1-6 "alkyl" has the chemical formula -(C 1-6 It refers to the alkylene)-OH group. As used herein, the term "HO-C 1-3 "alkyl" has the chemical formula -(C 1-3 It refers to the alkylene)-OH group.

[0450] As used herein, the term "C 1-6 Alkoxy-C 1-6 "alkyl" has the chemical formula -(C 1-6 Alkylene)-O(C 1-6It refers to a group of alkyl. As used herein, the term "C 1-3 Alkoxy-C 1-3 "alkyl" has the chemical formula -(C 1-3 Alkylene)-O(C 1-3 It refers to the alkyl group.

[0451] As used herein, the term "carboxy" refers to a group of the chemical formula -C(O)OH.

[0452] As used herein, the term "D (C n-m "-alkyl)amino" refers to a group of the chemical formula -N(alkyl)2, wherein the two alkyl groups each independently have n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0453] As used herein, the term "D (C n-m "-alkyl)carbamyl" refers to a group of the chemical formula -C(O)N(alkyl)2, wherein each of the two alkyl groups independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0454] As used herein, the term "C n-m "Alkylcarbonyloxy" is a group of the chemical formula -OC(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0455] As used herein, "aminocarbonyloxy" is a group of the chemical formula -OC(O)-NH2.

[0456] As used herein, "C n-m"Alkylaminocarbonyloxy" is a group of the chemical formula -OC(O)-NH-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0457] As used herein, "D (C n-m "alkyl)aminocarbonyloxy" is a group of the chemical formula -OC(O)-N(alkyl)2, wherein each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0458] As used in this invention, C n-m Alkoxycarbonylamino refers to a group of the chemical formula -NHC(O)-O-alkyl, where the alkyl group has n to m carbon atoms.

[0459] As used herein, the term "carbamyl" refers to the group of the chemical formula -C(O)NH2.

[0460] As used herein, the term "carbonyl," used alone or in combination with other terms, refers to a -C(O)- group.

[0461] As used herein, “cycloalkyl” refers to a non-aromatic cyclic hydrocarbon comprising cyclized alkyl and alkenyl groups. The cycloalkyl group may comprise a single or polycyclic group (e.g., having 2, 3, or 4 fused rings), a spiro ring, and a cross-linked ring (e.g., a cross-linked bicycloalkyl group). The ring-forming carbon atom of the cycloalkyl group may optionally be substituted by an oxo or sulfido (e.g., C(O) or C(S)). Moiety having one or more aromatic rings fused to (i.e., co-bonded with) the cycloalkyl ring, e.g., benzo or thienyl derivatives such as cyclopentane, cyclohexane, etc., is also included within the definition of cycloalkyl. The cycloalkyl group containing the fused aromatic ring may be attached through any ring-forming atom comprising the ring-forming atom of the fused aromatic ring. A cycloalkyl group consists of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 ring-forming carbons (in other words, C 3-14 It may have ). In some embodiments, the cycloalkyl is optionally substituted with CH2F, CHF2, CF3, and CF2CF3. 3-12 It is a monocyclic or bicyclic cycloalkyl. In some embodiments, the cycloalkyl is C 3-10 It is a monocyclic or bicyclic cycloalkyl. In some embodiments, the cycloalkyl is C 3-7 It is a monocyclic cycloalkyl. In some embodiments, the cycloalkyl is C 4-7 It is a monocyclic cycloalkyl. In some embodiments, the cycloalkyl is C 4-14It is a spiro ring or a cross-linked cycloalkyl (e.g., a cross-linked bicycloalkyl group). Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbornyl, norfinyl, norcarnyl, cuban, adamantane, bicyclo[1.1.1]pentyl, bicyclo[2.1.1]hexyl, bicyclo[2.2.1]heptanyl, bicyclo[3.1.1]heptanyl, bicyclo[2.2.2]octanyl, spiro[3.3]heptanyl, etc. In some embodiments, the cycloalkyl is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

[0462] As used herein, “heteroaryl” refers to an aromatic heterocyclic ring having at least one heterocyclic ring member selected from N, O, S, and B (e.g., having 2, 3, or 4 fused rings). In some embodiments, the heteroaryl ring has 1, 2, 3, or 4 heterocyclic ring members independently selected from N, O, S, and B. In some embodiments, any ring-forming N in the heteroaryl moiety may be an N-oxide. In some embodiments, the heteroaryl is a 5-10-membered monocyclic or bicyclic heteroaryl having 1, 2, 3, or 4 heterocyclic ring members independently selected from N, O, and S. In some embodiments, the heteroaryl is a 5-10-membered single-ring or double-ring heteroaryl having 1, 2, 3, or 4 heteroatom ring members independently selected from N, O, and S. In some embodiments, the heteroaryl is a 5-10-membered single-ring or double-ring heteroaryl having 1, 2, 3, or 4 heteroatom ring members independently selected from N, O, and S. In some embodiments, the heteroaryl is a 5-6-membered single-ring heteroaryl having 1 or 2 heteroatom ring members independently selected from N, O, S, and B. In some embodiments, the heteroaryl is a 5-6-membered single-ring heteroaryl having 1 or 2 heteroatom ring members independently selected from N, O, and S. In some embodiments, the heteroaryl group contains 3 to 14, 3 to 10, 4 to 14, 4 to 10, 3 to 7, or 5 to 6 ring-forming atoms. In some embodiments, the heteroaryl group has 1 to 4 ring-forming heteroatoms, 1 to 3 ring-forming heteroatoms, 1 to 2 ring-forming heteroatoms, or 1 ring-forming heteroatom. When the heteroaryl group contains one or more heteroatom ring members, these heteroatoms may be the same or different.For example, heteroaryl groups include pyridine, pyrimidine, pyrazine, pyridazine, pyrrole, pyrazol, azolyl, oxazole, isoxazole, thiazole, isothiaazole, imidazole, furan, thiophene, triazole, tetrazole, thiadiazole, quinoline, isoquinoline, indole, benzothiophene, benzofuran, benzisoxazole, imidazo[1, 2-b]thiazole, purine, triazine, thieno[3,2-. b ]pyridine, imidazo[1,2- a ]pyridine, 1,5-naphthiridine, 1 H -Pyrazolo [4,3- b ] Includes pyridine, etc., but is not limited to these.

[0463] A 5-membered heteroaryl is a heteroaryl group having 5 ring-forming atoms, wherein one or more of these ring-forming atoms (e.g., 1, 2, or 3) are independently selected from N, O, S, or B. Exemplary 5-membered heteroaryls are thienyl, furyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl, 1,3,4-oxadiazolyl, and 1,2-dihydro-1,2-azabolin.

[0464] A 6-membered heteroaryl ring is a heteroaryl group having 6 ring-forming atoms, wherein one or more of these ring-forming atoms (e.g., 1, 2, or 3) are independently selected from N, O, S, and B. Exemplary 6-membered heteroaryls are pyridyl, pyrazinyl, pyrimidinyl, triazinyl, and pyridazinyl.

[0465] As used herein, “heterocycloalkyl” refers to a monocyclic or polycyclic heterocyclic group having at least one non-aromatic ring (saturated or partially unsaturated ring), wherein one or more of the ring-forming carbon atoms of the heterocycloalkyl group are replaced by a heteroatom selected from N, O, S and B, and wherein the ring-forming carbon atoms and heteroatoms of the heterocycloalkyl group may optionally be substituted by one or more oxos or sulfidos (e.g., C(O), S(O), C(S), or S(O)2, etc.). The heterocycloalkyl group comprises monocyclic and polycyclic (e.g., having two fused rings) systems. Single and multi-cyclic 12, 4-12, 3-10-, 4-10-, 3-7-, 4-7-, and 5-6-membered heterocycloalkyl groups are included in the heterocycloalkyl group. The heterocycloalkyl group may also include a spiro ring and a cross-linked ring (e.g., a 5-14-membered cross-linked non-heterocycloalkyl ring in which one or more of the ring-forming carbon atoms are replaced by heteroatoms independently selected from N, O, S, and B). The heterocycloalkyl group may be attached via ring-forming carbon atoms or ring-forming heteroatoms. In some embodiments, the heterocycloalkyl group contains 0 to 3 double bonds. In some embodiments, the heterocycloalkyl group contains 0 to 2 double bonds.

[0466] Moiety having one or more aromatic rings fused to (i.e., bonded together with) a non-aromatic heterocyclic ring, such as benzo or thienyl derivatives of piperidine, morpholine, azepine, etc., are also included within the definition of heterocycloalkyl. The heterocycloalkyl group containing the fused aromatic ring may be attached through any ring-forming atom comprising the ring-forming atom of the fused aromatic ring. In some embodiments, the heterocycloalkyl group contains 3 to 14 ring-forming atoms, 4 to 14 ring-forming atoms, 3 to 10 ring-forming atoms, 4 to 10 ring-forming atoms, 3 to 7 ring-forming atoms, or 5 to 6 ring-forming atoms. In some embodiments, the heterocycloalkyl group has 1 to 4 heteroatoms, 1 to 3 heteroatoms, 1 to 2 heteroatoms, or 1 heteroatom. In some embodiments, the heterocycloalkyl is a single cyclic 4-6-membered heterocycloalkyl having 1 or 2 heteroatoms independently selected from N, O, S, and B and one or more oxidized ring members.

[0467] Examples of heterocycloalkyl groups include pyrrolidine-2-one, 1,3-isoxazolidin-2-one, pyranyl, tetrahydropyran, oxetanyl, azetidinyl, morpholino, thiomophorino, piperazinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, pyrrolidinyl, isoxazolidinyl, isothiazolidinyl, pyrazolidinyl, oxazolidinyl, thiazolidinyl, imidazolidinyl, azephanyl, benzazafene, 1,2,3,4-tetrahydroisoquinoline, azabicyclo[3.1.0]hexanyl, diazabicyclo[3.1.0]hexanyl, oxabicyclo[2.1.1]hexanyl, azabicyclo[2.2.1]heptanyl, Diazabicyclo[2.2.1]heptanil, Azabicyclo[3.1.1]heptanil, Diazabicyclo[3.1.1]heptanil, Azabicyclo[3.2.1]octanil, Diazabicyclo[3.2.1]octanil, Oxabicyclo[2.2.2]octanil, Azabicyclo[2.2.2]octanil, Azaadamantanil, Diazaadamantanil, Oxa-adamantanil, Azaspiro[3.3]heptanil, Diazaspiro[3.3]heptanil, Oxa-Azaspiro[3.3]heptanil, Azaspiro[3.4]octanil, Diazaspiro[3.4]octanil, Oxa-Azaspiro[3.4]octanil, Includes azaspiro[2.5]octanil, diazspiro[2.5]octanil, azaspiro[4.4]nonanil, diazspiro[4.4]nonanil, oxa-azaspiro[4.4]nonanil, azaspiro[4.5]decanil, diazspiro[4.5]decanil, diazspiro[4.4]nonanil, oxa-diazaspiro[4.4]nonanil, etc.

[0468] As used herein, "C o-p Cycloalkyl-C n-m Alkyl-" refers to a group of the chemical formula cycloalkyl-alkylene-, where the cycloalkyl group has 0 to p carbon atoms and the alkylene group has n to m carbon atoms.

[0469] As used in this document, "C o-p Aryl-C n-mAlkyl-" refers to a group of the chemical formula aryl-alkylene-, where aryl has 0 to p carbon atoms and alkylene linkers have n to m carbon atoms.

[0470] As used herein, "heteroaryl-C n-m Alkyl-" refers to a group of the chemical formula heteroaryl-alkylene-, where the alkylene linker has n to m carbon atoms.

[0471] As used herein, "heterocycloalkyl-C n-m Alkyl-" refers to a group of the chemical formula heterocycloalkyl-alkylene-, where the alkylene linker has n to m carbon atoms.

[0472] As used herein, the term "alkylene" refers to a straight-chain or branched alkyl linker. Examples of "alkylene groups" include methylene, ethane-1,1-diyl, ethane-1,2-diyl, propane-1,3-diyl, propane-1,2-diyl, propane-1,1-diyl, etc.

[0473] As used herein, the term “alkenylene” refers to a straight or branched alkenyl linker. Examples of “alkenylene groups” include ethene-1,1-diyl, ethene-1,2-diyl, propene-1,3-diyl, 2-butene-1,4-diyl, 3-pentene-1,5-diyl, 3-hexene-1,6-diyl, 3-hexene-1,5-diyl, etc.

[0474] As used herein, the term “alkynylene” refers to a straight or branched alkynylene linker. Examples of “alkynylene groups” include propine-1,3-diyl, 2-butyne-1,4-diyl, 3-pentyne-1,5-diyl, 3-hexine-1,6-diyl, 3-hexine-1,5-diyl, etc.

[0475] As used herein, the term “oxo” refers to an oxygen atom (i.e., =O) as a divalent substituent that forms a carbonyl group (e.g., C=O or C(O)) when attached to a carbon, or forms a nitroso, sulfinyl, or sulfonyl group when attached to a nitrogen or sulfur heteroatom.

[0476] As used herein, the term "independently selected from" means that each existence of a variable or substituent is independently selected from the applicable list in each occurrence.

[0477] In certain positions, these definitions or embodiments refer to specific rings (e.g., azetidine rings, pyridine rings, etc.). Unless otherwise indicated, these rings may be attached to any ring member as long as the valence of the atoms is not exceeded. For example, an azetidine ring may be attached at any position of the ring, whereas a pyridine-3-yl ring is attached at the 3-position.

[0478] The compounds described herein may be asymmetric (e.g., having one or more stereocenters). Unless otherwise indicated, all stereoisomers, such as enantiomers and diastereomers, are intended. Compounds of the present invention containing asymmetrically substituted carbon atoms may be isolated in an optically active or racemic form. Methods for producing an optically active form from an optically inactive starting material, for example by decomposition of a racemic mixture or by stereoselective synthesis, are known in the art. Many geometric isomers of olefins, C=N double bonds, etc., may also exist within the compounds described herein, and all such stable isomers are anticipated in the present invention. of the compounds of the present invention Sis and TransGeometric isomers are described and can be isolated as a mixture of isomers or as separate isomer forms. In some embodiments, the compound is (R)- It has a three-dimensional shape. In some embodiments, the compound is (S)- They have a stereochemical shape. The chemical formulas provided herein (e.g., chemical formulas (AI), (BI), etc.) include stereoisomers of these compounds.

[0479] The decomposition of a racemic mixture of compounds may be carried out by any various method known in the art. An exemplary method includes fractional recrystallization using a chiral decomposition acid that is an optically active, salt-forming organic acid. Suitable decomposition agents for the fractional recrystallization method are, for example, optically active acids such as tartaric acid, diacetyltranic acid, dibenzoyltranic acid, mandelic acid, malic acid, lactic acid, or various optically active camphosulfonic acids such as the D and L forms of β-camphosulfonic acid. Other decomposition agents suitable for the fractional crystallization method are α-methylbenzylamine (e.g., S and R It includes pure forms in stereoisomer form, or in partial stereoisomer form), 2-phenylglycinol, norephedrine, ephedrine, N-methyl ephedrine, cyclohexylethylamine, 1,2-diaminocyclohexane, etc.

[0480] The decomposition of the racemic mixture can also be carried out by elution on a column packed with an optically active decomposition agent (e.g., dinitrobenzoylphenylglycine). A suitable elution solvent composition can be determined by those skilled in the art.

[0481] The compounds provided herein also include tautomeric forms. Tautomeric forms arise from the swapping of a single bond with an adjacent double bond, accompanied by the concomitant migration of a proton. Tautomeric forms include protic tautomeric forms, which are isomers of protonated states having the same empirical formula and total charge. Examples of protic tautomeric forms include ketone-enol pairs, amide-imide acid pairs, lactam-lactim pairs, enamine-imine pairs, and ring forms in which a proton can occupy two or more positions in a heterocyclic system, e.g., 1H- and 3H-imidazoles, 1H-, 2H- and 4H-1,2,4-triazoles, 1H- and 2H-isoindoles, 2-hydroxypyridine and 2-pyridone, and 1H- and 2H-pyrazoles. Tautomeric forms may be in equilibrium or stereochemically locked into one form by appropriate substitution. Compounds identified herein by name or structure as one specific tautomeric form are intended to include other tautomeric forms unless otherwise specified.

[0482] All compounds and their pharmaceutically acceptable salts may be found together with other substances, such as water and solvents (e.g., hydrates and solvates), or may be isolated.

[0483] In some embodiments, the preparation of the compound may involve the addition of an acid or base that affects the catalytic action of the desired reaction or formation of, for example, a salt form such as an acid addition salt.

[0484] In some embodiments, the compounds provided herein, or salts thereof, are substantially isolated. “Substantially isolated” means that the compounds are separated at least partially or substantially from the environment in which they were formed or detected. Partial isolation may, for example, comprise a composition in which the compounds provided herein are concentrated. Substantially isolated may comprise a composition containing at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% by weight of the compounds provided herein or salts thereof. Methods for isolating the compounds and their salts are common in the art.

[0485] In some embodiments, the CDK2 inhibitor may be an isotopically labeled compound or a pharmaceutically acceptable salt thereof. An "isotopically" or "radio-labeled" compound is a compound of the present invention in which one or more atoms are replaced or substituted by atoms having an atomic mass or mass number different from the atomic mass or mass number typically found in nature (i.e., naturally occurring). Suitable radionuclides that can be incorporated into the compound of the present invention are 2 H (also listed as D in the case of deuterium), 3 H (also listed as T in the case of tritium), 11 C, 13 C, 14 C, 13 N, 15 N, 15 O, 17 O, 18 O, 18 F, 35 S, 36 Cl, 82 Br, 75 Br, 76 Br, 77 Br, 123 I, 124 I, 125 I and 131It includes, but is not limited to, I. For example, in the compounds of the present invention, one or more hydrogen atoms may be replaced by deuterium atoms (e.g., C 1-6 One or more hydrogen atoms of the alkyl group may be optionally replaced with deuterium atoms, for example, -CD3 may replace -CH3).

[0486] One or more component atoms of the compounds described herein may be replaced or substituted with isotopes of these atoms in their natural or non-natural abundance. In some embodiments, the compound comprises at least one deuterium atom. In some embodiments, the compound comprises two or more deuterium atoms. In some embodiments, the compound comprises 1-2, 1-3, 1-4, 1-5, or 1-6 deuterium atoms. In some embodiments, all hydrogen atoms in the compound may be replaced or substituted by deuterium atoms.

[0487] Synthetic methods for incorporating isotopes into organic compounds are known in the art (Deuterium Labeling in Organic Chemistry by Alan F. Thomas (New York, NY, Appleton-Century-Crofts, 1971); The Renaissance of H / D Exchange by Jens Atzrodt, Volker Derdau, Thorsten Fey and Jochen Zimmermann, Angew. Chem. Int. Ed. 2007, 7744-7765; The Organic Chemistry of Isotopic Labelling by James R. Hanson, Royal Society of Chemistry, 2011). Isotope-labeled compounds can be used in various studies, such as NMR spectroscopy, metabolic experiments and / or assays.

[0488] Substitution with heavier isotopes, such as deuterium, can provide certain therapeutic benefits arising from greater metabolic stability, such as an increased half-life or reduced dose requirements in vivo, and thus may be desirable in some situations (cf. e.g., A. Kerekes et. al. J. Med. Chem. 2011, 54, 201-210; R. Xu et. al. J. Label Compd. Radiopharm. 2015, 58, 308-312). In particular, substitution at one or more metabolic sites can provide one or more of these therapeutic benefits.

[0489] Accordingly, in some embodiments, the CDK2 inhibitor is a compound in which one or more hydrogen atoms within the compound are replaced by deuterium atoms, or a pharmaceutically acceptable salt thereof.

[0490] As used herein, the term “compound” means including all stereoisomers, geometric isomers, tautomers, and isotopes of the described structure. A compound identified herein by name or structure as one specific tautomer form is intended to include other tautomer forms unless otherwise specified.

[0491] The idiom "pharmaceuticalally acceptable" is used herein to refer to these compounds, substances, compositions, and / or drug forms suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to the reasonable benefit / risk ratio within the scope of sound medical judgment.

[0492] The present invention also comprises pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salt" refers to a derivative of the disclosed compound in which the parent compound is modified by converting an existing acid or base moiety into its salt form. Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and others. Pharmaceutically acceptable salts of the present invention comprise, for example, traditional non-toxic salts of the parent compound formed from non-toxic inorganic or organic acids. Pharmaceutically acceptable salts of the present invention may be synthesized from a parent compound containing a basic or acidic moiety by traditional chemical methods. Generally, such salts may be prepared by reacting the free acid or base form of the compound with a stoichiometric amount of a suitable base or acid in water, in an organic solvent, or in a mixture of both; Generally, non-aqueous media, e.g., ethers, ethyl acetates, alcohols (e.g., methanol, ethanol, isopropanol, or butanol), or acetonitrile (ACN) are preferred. The list of suitable salts is Remington's Pharmaceutical Sciences , 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418 and Journal of Pharmaceutical Science They are found in , 66, 2 (1977), and are incorporated here as a whole by reference.

[0493] The term "CDK2 inhibitor" includes any compound that inhibits CDK2, as well as pharmaceutically acceptable salts, hydrates, solvates, and polymorphs thereof.

[0494] synthesis

[0495] The compounds of the present invention as well as their salts can be prepared using known organic synthesis techniques and can be synthesized according to any various possible synthesis routes, such as those in the reaction schemes below.

[0496] The reaction for preparing the compound of the present invention may be carried out in a suitable solvent that can be easily selected by a person skilled in the art of organic synthesis. The suitable solvent may be substantially non-reactive with the starting material (reactant), intermediate, or product at the temperature at which the reaction is carried out, for example, within the range of the freezing temperature to the boiling temperature of the solvent. The given reaction may be carried out in a single solvent or in a mixture of one or more solvents. Depending on the specific reaction step, a suitable solvent for the specific reaction step may be selected by a person skilled in the art.

[0497] The preparation of the compounds of the present invention may involve the protection and deprotection of various chemical groups. The necessity for protection and deprotection, and the selection of a suitable protecting group, can be easily determined by those skilled in the art. The chemistry of the protecting group is, for example, Kocienski, Protecting Groups , (Thieme, 2007); Robertson, Protecting Group Chemistry , (Oxford University Press, 2000); Smith et al ., March's Advanced Organic Chemistry : Reactions, Mechanisms, and Structure , 6th Ed. (Wiley, 2007); Peturssion et al ., “Protecting Groups in Carbohydrate Chemistry,” J. Chem. Educ ., 1997, 74(11), 1297; and Wuts et al., Protective Groups in Organic Synthesis This is explained in , 4th Ed., (Wiley, 2006).

[0498] The reaction may be monitored according to any suitable method known in the art. For example, product formation may be monitored by spectroscopic means, such as nuclear magnetic resonance spectroscopy (e.g., 1 H or 13 C) It can be monitored by infrared spectroscopy, spectrophotometry (e.g., UV-visible light), mass spectrometry, or by chromatographic methods such as high-performance liquid chromatography (HPLC) or thin-layer chromatography (TLC).

[0499] The reaction scheme below provides general information regarding the preparation of the compounds of the present invention. Those skilled in the art will understand that the preparations depicted in the reaction scheme may be modified or optimized using common sense in organic chemistry to prepare the various compounds of the present invention.

[0500] Compounds of the chemical formula (AI) are, for example, the following Reaction Equation 1 and 2 It can be manufactured using the process illustrated in [the image].

[0501] A compound of chemical formula (AI) can be prepared from an intermediate of general formula (A). Intermediate (A) is Reaction Equation 1 It can be manufactured as described in. Reaction Equation 1 It shows that the dibasic acid of Formula 1-1 can be converted into a suitable diester, e.g., methyl or ethyl ester, to provide the compound of Formula 1-2, and these can be formylated with a suitable reagent (e.g., methyl or ethyl formate) to provide the compound of Formula 1-3. The reaction of the compound of Formula 1-3 with a suitable source of guanidine, e.g., guanidine carbonate or guanidine hydrochloride, can provide the compound of Formula 1-4. Finally, the reaction of the compound of Formula 1-4 with a suitable chlorination reagent, e.g., phosphorus oxychloride, can provide the structure of General Formula (A).

[0502] Reaction Equation 1

[0503]

[0504] The intermediate of general formula A is Reaction Equation 2 As illustrated in [Figure], R1 can be converted into a compound of formula (I) having various substituents. The compound of formula (A) can be converted into a suitable R2 using various methods (e.g., reductive amination with an aldehyde or ketone, Buchwald-Hartwig amination, copper-catalyzed amination, amide bond formation, etc.). The compound of Formula 2-2 may be provided by reacting with a substituent. The chloro group of the compound of Formula 2-2 may be reacted with a suitable amine under Buchwald-Hartwig amination conditions to provide the compound of Formula (I).

[0505] Reaction Equation 2

[0506]

[0507] Compounds of chemical formula (BI) can be prepared in various ways depending on the position where variation is desired. For example, ring A Compounds of chemical formula (BI) that have fluctuations in reaction equation 3 It can be manufactured as described in . Reaction Equation 3In the process described in [the example], the selective substitution of the chloro group of trihalopyrimidine 1-1 with a desired amine yields the compound of Formula 1-2. Intermediate 1-2 may be reacted via a selective Negishi cross-linking reaction (CCR) with a suitable palladium precatalyst / ligand combination (e.g., a combination of Pd2(dba)3 and QPhos or XPhos) to yield Intermediate 1-3. Intermediate 1-3 may then be reacted via base-enhanced cyclization to yield the compound of Formula 1-4. Subsequently, a desired substitution α may be introduced to the amide of Intermediate 1-4 (e.g., via sequential alkylation or Pd-catalyzed arylation) to yield the compound of Formula 1-5. Alternatively, under standard alkylation conditions Bis Reaction with an electrophile (e.g., 1,2-dibromoethane) yields a compound of formula 1-5, where R2 and R3 combine to form a ring and yield a compound of formula 1-5. Finally, Buchwald-Hartwig amination with a suitable amine yields a compound of formula (BI).

[0508] Reaction Equation 3

[0509]

[0510] R 1 Compounds of chemical formula (BI) having different groups are Reaction Equation 4 It can be formed as described in. Therefore, R of compound 2-1 as described above 2 and R 3 The introduction yields compound 2-2, which undergoes selective oxidation of sulfur (e.g., to m-CPBA), and intermediate 2-3 can be provided. From the resulting sulfone, the selective SN of intermediate 2-3 with suitable N-formylamine is formed. ArThe reaction yields intermediates 2-4. Finally, the reaction of intermediates 2-4 with a suitable amine yields a compound of general formula (BI). This linkage can be carried out in one of two ways. First, tandem Buchwald-Hartwig amination and cyclization catalyzed by a suitable pre-formed catalyst (e.g., RuPhos second-generation precatalyst or XantPhos second-generation precatalyst) may be utilized. Alternatively, SN with a suitable acidic (TFA) or basic (Hoonig base) catalyst and a suitable polar solvent (i.e., 1,1,1-trifluoroethanol or 1-butanol) may be used. Ar A two-step protocol comprising a reaction followed by cyclization induced with a suitable base (i.e., sodium hydride).

[0511] Reaction Equation 4

[0512]

[0513] Treatment methods

[0514] The method disclosed herein makes it possible to determine whether a human individual who has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2 is likely to respond to a CDK2 inhibitor (e.g., showing greater improvement in the disease as evidenced by disease remission / dissolution, or likely to have CDK2 inhibited). A human individual who has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2 and is likely to respond to a CDK2 inhibitor may be administered a CDK2 inhibitor. Conversely, a human individual who has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2 and is less likely to respond to a CDK2 inhibitor may be administered additional therapy suitable for the treatment of said disease or disorder.

[0515] The method of the present invention also enables stratifying human individuals who suffer from, are suspected of suffering from, or are at risk of developing a CDK2-associated disease or disorder into groups of human individuals who are more likely to benefit from a treatment including a CDK2 inhibitor and groups of human individuals who are less likely to benefit. The ability to select such human individuals from a pool of human individuals with CDK2-associated disease or disorder who are being considered for treatment with a CDK2 inhibitor is beneficial for administering an effective treatment to the individuals.

[0516] In one embodiment, a human individual treated with a CDK2 inhibitor has, is suspected of having, or is likely to develop a disease or disorder associated with CDK2. In a certain embodiment, a human individual treated with a CDK2 inhibitor has, is suspected of having, or is likely to develop cancer.

[0517] If a human individual with a disease or disorder associated with CDK2 is more likely to respond to a CDK inhibitor (based on one or more of the aforementioned markers (e.g., biomarkers or pharmacodynamic markers, e.g., CCNE1, p16, and Rb phosphorylation), the human individual may be administered an effective dose of a CDK2 inhibitor. The effective dose of a CDK2 inhibitor may be appropriately determined by a healthcare professional, for example, taking into account patient characteristics (age, sex, weight, race, etc.), disease progression, and prior exposure to the drug. If a human individual is less likely to respond to a CDK2 inhibitor, the human individual may be administered a regimen not containing a CDK2 inhibitor at will.

[0518] After stratifying or selecting human subjects based on whether they are more or less likely to respond to CDK inhibitors, a practitioner (e.g., a physician) may administer an appropriate therapeutic modality to the human subjects. Methods for administering CDK2 inhibitors are known in the field.

[0519] In cases where one or more non-CDK2 inhibitor therapies have been previously administered to human subjects with a disease or disorder associated with CDK2 and predicted to respond to a CDK2 inhibitor, the CDK2 inhibitor may replace or enhance the previously administered or currently administered therapies. For example, when treated with a CDK2 inhibitor, the administration of one or more non-CDK2 inhibitor therapies may be discontinued or reduced, for example, at a lower level. While the CDK2 inhibitor is being administered, the administration of the prior therapy may be maintained. In some embodiments, the prior therapy may be maintained until the level of the CDK2 inhibitor reaches a level sufficient to provide a therapeutic effect.

[0520] In a specific embodiment, a method for treating a human individual who has, is suspected of having, or is at risk of developing a disease or disorder associated with CDK2 is provided herein, said method comprising administering a CDK2 inhibitor to the human individual, wherein the human individual (i) has a nucleotide sequence encoding a p16 protein comprising the amino acid sequence of SEQ No. 1, (b) has a CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions, and / or (c) expresses a p16 protein (e.g., a p16 protein comprising the amino acid sequence of SEQ No. 1), and (ii) has (a) amplification of a CCNE1 gene and / or (b) a previously determined level of CCNE1 expression in a biological sample obtained from said individual that is higher than a control level of CCNE1. In certain embodiments, the biological specimen was obtained from a human individual at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 2 months prior to the administration of the CDK2 inhibitor. In certain embodiments, the biological specimen was obtained from a human individual at most 1 day, at most 2 days, at most 3 days, at most 4 days, at most 5 days, at most 6 days, at most 7 days, at most 2 weeks, at most 3 weeks, at most 4 weeks, or at most 2 months prior to the administration of the CDK2 inhibitor. In certain embodiments, the individual was determined to have the gene encoding the p16 protein of sequence number: 1 at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 2 months prior to the administration of the CDK2 inhibitor.In certain embodiments, the individual was determined to have the gene encoding the p16 protein of SEQ ID NO: 1 at most 1 day, at most 2 days, at most 3 days, at most 4 days, at most 5 days, at most 6 days, at most 7 days, at most 2 weeks, at most 3 weeks, at most 4 weeks, or at most 2 months prior to the administration of the CDK2 inhibitor. In certain embodiments, the method further comprises the following steps:

[0521] (1) A step of measuring a reduced level of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ ID NO: 3 in a biological specimen obtained from an individual after administering a CDK2 inhibitor to the individual, compared with a control level of Rb phosphorylation in the serine corresponding to amino acid position 780 of SEQ ID NO: 3; and

[0522] (2) After measurement, the step of continuously administering the CDK2 inhibitor to the human individual.

[0523] In certain embodiments, biological specimens obtained from an individual after administering a CDK2 inhibitor to the individual were obtained at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, or at least 4 weeks after administration of the CDK2 inhibitor. In certain embodiments, biological specimens obtained from an individual after administration of a CDK2 inhibitor were obtained from a human individual at most 1 hour, at most 2 hours, at most 3 hours, at most 4 hours, at most 5 hours, at most 6 hours, at most 7 hours, at most 8 hours after administration of the CDK2 inhibitor, at most 1 day, at most 2 days, at most 3 days, at most 4 days, at most 5 days, at most 6 days, at most 7 days, at most 2 weeks, at most 3 weeks, or at most 4 weeks after measurement of the CDK2 inhibitor. In certain embodiments, continued administration of step (2) occurs at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 2 months after measurement of step (1). In certain embodiments, continued administration of step (2) occurs at most 1 day, at most 2 days, at most 3 days, at most 4 days, at most 5 days, at most 6 days, at most 7 days, at most 2 weeks, at most 3 weeks, at most 4 weeks, or at most 2 months after measurement of step (1).

[0524] In other specific embodiments, a method for treating a human individual who suffers from, is suspected of suffering from, or is at risk of developing a disease or disorder associated with CDK2 is provided herein, said method comprising: (i) confirming, in a biological specimen obtained from the human individual, the presence of (a) a nucleotide sequence encoding a p16 protein comprising the amino acid sequence of SEQ No. 1, (b) a CDKN2A gene lacking one or more inactivating nucleic acid substitutions, and / or (c) a p16 protein (e.g., a p16 protein comprising the amino acid sequence of SEQ No. 1); (ii) confirming, in a biological specimen obtained from the human individual, (a) amplification of a CCNE1 gene and / or (b) an expression level of CCNE1 higher than a control expression level of CCNE1; and administering a CDK2 inhibitor to the human individual. In specific embodiments, the human individual suffers from a disease or disorder associated with CDK2. In certain embodiments, a human individual is suspected of having a disease or disorder associated with CDK2, or is at risk of developing it. In certain embodiments, administration occurs at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 2 months after confirming amplification of the CDKN2A gene, p16 protein, and / or CCNE1 gene and / or a level of CCNE1 expression higher than the control expression level of CCNE1 in a biological specimen obtained from the human individual.In certain embodiments, administration occurs at most 1 day, at most 2 days, at most 3 days, at most 4 days, at most 5 days, at most 6 days, at most 7 days, at most 2 weeks, at most 3 weeks, at most 4 weeks, or at most 2 months after confirming, within a biological specimen obtained from a human individual, the presence of a nucleotide sequence encoding a p16 protein comprising the amino acid sequence of SEQ No. 1, a CDKN2A gene lacking one or more inactivating nucleic acid substitutions and / or amplification of the CCNE1 gene and / or an expression level of CCNE1 higher than a control expression level of CCNE1. In a specific embodiment, the method further comprises the following steps: measuring a reduced level of Rb phosphorylation in a serine corresponding to amino acid position 780 of SEQ No. 3 in a biological sample obtained from the individual after administering a CDK2 inhibitor to the individual, compared with a control level of Rb phosphorylation in a serine corresponding to amino acid position 780 of SEQ No. 3; and, after measuring, continuing to administer the CDK2 inhibitor to the human individual. In a certain embodiment, the biological sample obtained from the individual after administering the CDK2 inhibitor to the individual was obtained from the human individual at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, or at least 4 weeks after administration.In certain embodiments, biological specimens obtained from an individual after administration of a CDK2 inhibitor were obtained from the individual at most 1 hour, at most 2 hours, at most 3 hours, at most 4 hours, at most 5 hours, at most 6 hours, at most 7 hours, at most 8 hours after administration, at most 1 day, at most 2 days, at most 3 days, at most 4 days, at most 5 days, at most 6 days, at most 7 days, at most 2 weeks, at most 3 weeks, or at most 4 weeks after administration. In certain embodiments, continued administration occurs at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 2 months after measurement. In certain embodiments, continued administration occurs at most 1 day, at most 2 days, at most 3 days, at most 4 days, at most 5 days, at most 6 days, at most 7 days, at most 2 weeks, at most 3 weeks, at most 4 weeks, or at most 2 months after measurement.

[0525] In some embodiments, diseases or disorders associated with CDK2 involve N-myc-amplified neuroblastoma cells (see: Molenaar, et al., Proc Natl Acad Sci USA 106(31): 12968-12973), K-Ras mutation lung cancer (Reference: Hu, S., et al., Mol Cancer Ther, 2015. 14(11): p. 2576-85, and cancers with FBW7 mutations and CCNE1 overexpression (Reference: Takada, et al. , Cancer Res , 2017. 77 (18): p. 4881-4893)

[0526] In some embodiments, the disease or disorder associated with CDK2 is pulmonary squamous cell carcinoma, pulmonary adenocarcinoma, pancreatic adenocarcinoma, breast invasive carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, gastric adenocarcinoma, esophageal carcinoma, bladder urothelial carcinoma, mesothelioma, or sarcoma.

[0527] In some specific examples, diseases or disorders associated with CDK2 are lung adenocarcinoma, breast invasive carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, or gastric adenocarcinoma.

[0528] In some embodiments, the disease or disorder associated with CDK2 is an adenocarcinoma, carcinoma, or cystadenocarcinoma.

[0529] In some specific examples, the disease or disorder associated with CDK2 is uterine cancer, ovarian cancer, gastric cancer, esophageal cancer, lung cancer, bladder cancer, pancreatic cancer, or breast cancer.

[0530] In some specific examples, the disease or disorder associated with CDK2 is cancer.

[0531] In some embodiments, the cancer is characterized by amplification or overexpression of CCNE1. In some embodiments, the cancer is ovarian cancer or breast cancer characterized by amplification or overexpression of CCNE1.

[0532] In some embodiments, breast cancer is breast cancer resistant to chemotherapy or radiation therapy, endocrine-resistant breast cancer, trastuzumab-resistant breast cancer, or breast cancer exhibiting primary or acquired resistance to CDK4 / 6 inhibition. In some embodiments, breast cancer is advanced or metastatic breast cancer.

[0533] Examples of cancers treatable using the method of the present invention include bone cancer, pancreatic cancer, skin cancer, cancer of the head and neck, malignant melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, gastric cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tube, carcinoma of the endometrium, endometrial cancer, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's disease, non-Hodgkin lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, soft tissue sarcoma, cancer of the urethra, cancer of the penis, acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic or acute leukemia including chronic lymphocytic leukemia, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or urethra, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), primary CNS lymphoma, and tumors. The cancers include, but are not limited to, neovascularization, vertebral axis tumors, brainstem gliomas, pituitary adenomas, Kaposi's sarcomas, epidermal carcinomas, squamous cell carcinomas, T-cell lymphomas, environmentally induced cancers including those caused by asbestos, and combinations of the above cancers. The method of the present invention is also useful for the treatment of metastatic cancer.

[0534] In some embodiments, cancers treatable by the method of the present invention include melanoma (e.g., metastatic malignant melanoma, BRAF and HSP90 inhibitor-resistant melanoma), kidney cancer (e.g., clear cell carcinoma), prostate cancer (e.g., hormone-refractory prostatic adenocarcinoma), breast cancer, colon cancer, lung cancer (e.g., non-small cell lung cancer and small cell lung cancer), squamous cell head and neck cancer, urothelial carcinoma (e.g., bladder), and high microsatellite instability (MSI 높음 It includes cancer having ). Additionally, the present invention includes refractory or recurrent malignant tumors whose growth can be inhibited using the method of the present invention.

[0535] In some embodiments, cancers treatable using the method of the present invention include, but are not limited to, solid tumors (e.g., prostate cancer, colon cancer, esophageal cancer, endometrial cancer, ovarian cancer, uterine cancer, kidney cancer, liver cancer, pancreatic cancer, gastric cancer, breast cancer, lung cancer, cancer of the head and neck, thyroid cancer, glioblastoma, sarcoma, bladder cancer, etc.), blood cancers (e.g., lymphoma, leukemia such as acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), DLBCL, mantle cell lymphoma, non-Hodgkin lymphoma (including follicular lymphomas such as relapsed or refractory NHL and relapsed follicular lymphoma), Hodgkin lymphoma or multiple myeloma), and combinations of said cancers.

[0536] In some embodiments, cancers treatable using the method of the present invention include, but are not limited to, cholangiocarcinoma, cholangiocarcinoma, triple-negative breast cancer, rhabdomyosarcoma, small cell lung cancer, leiomyosarcoma, hepatocellular carcinoma, Ewing sarcoma, brain cancer, brain tumor, astrocytoma, neuroblastoma, neurofibroma, basal cell carcinoma, chondrosarcoma, epithelioid sarcoma, eye cancer, fallopian tube cancer, gastrointestinal cancer, gastrointestinal stromal tumor, fibroblastic leukemia, intestinal cancer, islet cell carcinoma, oral cancer, oral cancer, throat cancer, laryngeal cancer, lip cancer, mesothelioma, cervical cancer, nasal cancer, ocular cancer, ocular melanoma, pelvic cancer, rectal cancer, renal cell carcinoma, salivary gland cancer, paranasal sinus cancer, spinal cancer, tongue cancer, tubular carcinoma, urethral cancer, and ureteral cancer.

[0537] In some embodiments, the method of the present invention may be used to treat sickle cell disease and sickle cell anemia.

[0538] In some embodiments, diseases and indications treatable using the method of the present invention include, but are not limited to, blood cancer, sarcoma, lung cancer, gastrointestinal cancer, urinary tract cancer, liver cancer, bone cancer, nervous system cancer, gynecological cancer, and skin cancer.

[0539] Exemplary blood cancers include lymphomas and leukemias such as acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute promyelocytic leukemia (APL), chronic lymphoblastic leukemia (CLL), chronic myeloid leukemia (CML), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma, non-Hodgkin lymphoma (including relapsed or refractory NHL and relapsed follicular NHL), Hodgkin lymphoma, myeloproliferative disorders (e.g., primary myelofibrosis (PMF), polycythemia vera (PV) and essential thrombocythemia (ET)), spinal dysplasia syndrome (MDS), T-cell acute lymphoblastic lymphoma (T-ALL), and multiple myeloma (MM).

[0540] Exemplary sarcomas include chondrosarcoma, Ewing sarcoma, osteosarcoma, rhabdomyosarcoma, angiosarcoma, fibrosarcoma, liposarcoma, myxoma, rhabdomyosarcoma, rhabdomyosarcoma, fibroma, lipoma, hamartoma, and teratoma.

[0541] Exemplary lung cancers include non-small cell lung cancer (NSCLC), small cell lung cancer (SCLC), bronchial-derived carcinoma, squamous cell carcinoma, undifferentiated small cell carcinoma, undifferentiated large cell carcinoma, adenocarcinoma, alveolar (bronchiolar) carcinoma, bronchial adenoma, chondromatous hamartoma, and mesothelioma.

[0542] Exemplary gastrointestinal cancers include cancer of the esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), cancer of the stomach (carcinoma, lymphoma, leiomyosarcoma), cancer of the pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumor, biforma), cancer of the small intestine (adenocarcinoma, lymphoma, carcinoid tumor, Kaposi sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), cancer of the large intestine (adenocarcinoma, ductal adenoma, villous adenoma, hamartoma, leiomyoma), and colorectal cancer.

[0543] Exemplary cancers of the urinary system include cancer of the kidney (adenocarcinoma, Wilms tumor [nephroblastoma]), cancer of the bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), cancer of the prostate (adenocarcinoma, sarcoma), and cancer of the testis (semioma, teratomatosis, embryonic carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatous tumor, lipoma).

[0544] Exemplary liver cancers include liver cancer (hepatocellular carcinoma), cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, and hemangioma.

[0545] Exemplary bone cancers include, for example, osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing sarcoma, malignant lymphoma (reticular cell sarcoma), multiple myeloma, malignant giant cell tumor chordoma, osteochondroma (osteochondrosis), benign chondroma, chondroblastoma, chondromyxofibroma, osteoid osteoma, and giant cell tumor.

[0546] Exemplary cancers of the nervous system include cancers of the skull (osteoma, hemangioma, granuloma, xanthomas, degenerative osteitis), cancers of the meninges (meningioma, meningeal sarcoma, gliomatosis), cancers of the brain (astrocytoma, medulloblastoma, glioma, ependymoma, germ cell tumor (pineal tumor), glioblastoma, glioblastoma pleomorphic, oligodendroglioma, Schwann cell tumor, retinoblastoma, congenital tumor), and cancers of the spinal cord (neurofibroma, meningioma, glioma, sarcoma), as well as neuroblastoma and Lhermitte-Duclois disease.

[0547] Exemplary gynecological cancers include cancer of the uterus (endometrial carcinoma), cancer of the cervix (cervical carcinoma, pre-tumor cervical dysplasia), cancer of the ovary (ovarian carcinoma (serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma), granulosarcoma, Sertoli-Leydig cell tumor, undifferentiated cell tumor, malignant teratoma), cancer of the vulva (squamous cell carcinoma, carcinoma in situ, adenocarcinoma, fibrosarcoma, melanoma), cancer of the vagina (clear cell carcinoma, squamous cell carcinoma, staphylococcal sarcoma (germstone rhabdomyosarcoma)), and cancer of the fallopian tube (carcinoma).

[0548] Exemplary skin cancers include melanoma, basal cell carcinoma, Merkel cell carcinoma, squamous cell carcinoma, Kaposi's sarcoma, mole dysplastic nevus, lipoma, hemangioma, dermatofibroma, and keloid. In some embodiments, diseases and indications treatable with the compounds of the present invention include, but are not limited to, sickle cell disease (e.g., sickle cell anemia), triple-negative breast cancer (TNBC), myelodysplastic syndrome, testicular cancer, cholangiocarcinoma, esophageal cancer, and urothelial cell carcinoma.

[0549] Combination therapy

[0550] Human subjects treated with a CDK2 inhibitor according to the method described herein may be treated in combination with one or more additional compositions or therapies effective for the treatment of diseases or disorders associated with CDK2. In some embodiments, the CDK2 inhibitor is administered together with or in combination with a BCL2 inhibitor or a CDK4 / 6 inhibitor.

[0551] I. Cancer Therapy

[0552] Cancer cell growth and survival can be affected by dysfunction in multiple signaling pathways. Therefore, to treat such diseases, it is useful to combine different enzyme / protein / receptor inhibitors that exhibit different preferences for the targets whose activity is modulated by them. Targeting one or more signaling pathways (or one or more biological molecules associated with a given signaling pathway) can reduce the potential for drug resistance in the cell population and / or decrease the toxicity of the treatment.

[0553] One or more additional pharmaceutical agents, e.g., chemotherapy agents, anti-inflammatory agents, steroids, immunosuppressants, immuno-oncology agents, metabolic enzyme inhibitors, chemokine receptor inhibitors, and phosphatase inhibitors, as well as targeted therapies, e.g., Bcr-Abl, Flt-3, EGFR, HER2, JAK, c-MET, VEGFR, PDGFR, c-Kit, IGF-1R, RAF, FAK, and CDK4 / 6 kinase inhibitors, e.g., those described in WO 2006 / 056399, may be used in combination with the compounds of the present invention for the treatment of CDK2-associated diseases, disorders, or abnormalities. Other agents, e.g., therapeutic antibodies, may be used in combination with the compounds of the present invention for the treatment of CDK2-associated diseases, disorders, or abnormalities. One or more additional pharmaceutical agents may be administered to the patient simultaneously or sequentially.

[0554] In some embodiments, the CDK2 inhibitor is administered together with or in combination with a BCL2 inhibitor or a CDK4 / 6 inhibitor.

[0555] Compounds as disclosed herein may be used in combination with one or more other enzyme / protein / receptor inhibitor therapies for the treatment of diseases, e.g., cancer, and other diseases or disorders described herein. Examples of diseases and indications treatable by combination therapy include those described herein. Examples of cancer include solid tumors and non-solid tumors, e.g., liquid tumors, blood cancers. Examples of infection include viral infections, bacterial infections, fungal infections, or parasitic infections. For example, the compound of the present invention may be used in combination with one or more inhibitors of the following kinases for the treatment of cancer: Akt1, Akt2, Akt3, BCL2, CDK4 / 6, TGF-βR, PKA, PKG, PKC, CaM-kinase, phosphorylase kinase, MEKK, ERK, MAPK, mTOR, EGFR, HER2, HER3, HER4, INS-R, IDH2, IGF-1R, IR-R, PDGFαR, PDGFβR, PI3K (alpha, beta, gamma, delta, and multiple or optional), CSF1R, KIT, FLK-II, KDR / FLK-1, FLK-4, flt-1, FGFR1, FGFR2, FGFR3, FGFR4, c-Met, PARP, Ron, Sea, TRKA, TRKB, TRKC, TAM kinase (Axl, Mer, Tyro3), FLT3, VEGFR / Flt2, Flt4, EphA1, EphA2, EphA3, EphB2, EphB4, Tie2, Src, Fyn, Lck, Fgr, Btk, Fak, SYK, FRK, JAK, ABL, ALK, and B-Raf. In some embodiments, the compounds of the present invention may be used in combination with one or more of the following inhibitors for the treatment of cancer or infection.Unlimited examples of inhibitors that may be used in combination with the compounds of the present invention for the treatment of cancer and infection include FGFR inhibitors (FGFR1, FGFR2, FGFR3, or FGFR4, e.g., pemigatinib (INCB54828), or INCB62079), EGFR inhibitors (also known as ErB-1 or HER-1; e.g., erlotinib, gefitinib, vandetanib, osimertinib, cetuximab, necitumumab, or panitumumab), VEGFR inhibitors or pathway blockers (e.g., bevacizumab, pazopanib, sunitinib, sorafenib, axitinib, regorafenib, ponatinib, cabozantinib, vandetanib, ramucirumab, lenvatinib, ziv-aflivercept), and PARP inhibitors (e.g., olaparib, rucaparib, Beliparib or niraparib), JAK inhibitors (JAK1 and / or JAK2; e.g., ruxolitinib or baricitinib; or JAK1 inhibitors; e.g., itacinib (INCB039110), INCB052793, or INCB054707), seitacitinib (INCB39110). IDO inhibitors (e.g., epacadstat, NLG919, or BMS-986205, MK7162), LSD1 inhibitors (e.g., GSK2979552, INCB59872, or INCB60003), TDO inhibitors, PI3K-delta inhibitors (e.g., parsaclisib (INCB50465) or INCB50797), PI3K-gamma inhibitors, e.g., PI3K-gamma selective inhibitors, Pim inhibitors (e.g., INCB53914), CSF1R inhibitors, TAM receptor tyrosine kinases (Tyro-3, Axl, and Mer; e.g., INCB081776), adenosine receptor antagonists (e.g., A2a / A2b receptor antagonists), HPK1 inhibitors, chemokine receptor inhibitors (e.g., CCR2 or CCR5 inhibitors), SHP1 / 2 phosphatase inhibitors, histone deacetylase inhibitors (HDACs), e.g., HDAC8 inhibitors, angiogenesis inhibitors, interleukin receptor inhibitors, bromo and additional terminal family member inhibitors (e.g., bromodomain inhibitors or BET inhibitors, e.g., INCB54329 and INCB57643), TAM receptor tyrosine kinase inhibitors (Tyro-3, Axl and Mer; e.g., INCB81776); c-MET inhibitors (e.g., capmatinib); anti-CD19 antibodies (e.g., tafacitamab); ALK2 inhibitors (e.g., INCB00928); or combinations thereof.

[0556] In some embodiments, the compound or salt described herein is administered with a PI3Kδ inhibitor. In some embodiments, the compound or salt described herein is administered with a JAK inhibitor. In some embodiments, the compound or salt described herein is administered with a JAK1 or JAK2 inhibitor (e.g., baricitinib or ruxolitinib). In some embodiments, the compound or salt described herein is administered with a JAK1 inhibitor. In some embodiments, the compound or salt described herein is administered with a JAK1 inhibitor that is selective compared to JAK2.

[0557] Example antibodies for use in combination therapy include trastuzumab (e.g., anti-HER2), ranibizumab (e.g., anti-VEGF-A), and bevacizumab (AVASTIN TM , e.g., anti-VEGF), panitumumab (e.g., anti-EGFR), cetuximab (e.g., anti-EGFR), rituxan (e.g., anti-CD20), and antibodies directed toward c-MET, but are not limited to these.

[0558] One or more of the following agents may be used in combination with the compound of the present invention and are presented as an unlimited list: bacteriostatic agents, cisplatin, doxorubicin, taxotere, taxol, etoposide, irinotecan, camptosar, topotecan, paclitaxel, docetaxel, epotillon, tamoxifen, 5-fluorouracil, methotrexate, temozolomide, cyclophosphamide, SCH 66336, R115777, L778,123, BMS 214662, IRESSA TM (Gefitinib), TARCEVA TM(Erlotinib), Antibody against EGFR, Intron, ara-C, Adriamycin, Cytoxan, Gemcitabine, Uracil Mustard, Chlormethine, Ifosfamide, Melphalan, Chlorambucil, Pipobroman, Triethylenemelamine, Triethylenethiophosphoramine, Busulfan, Carmustine, Lomustine, Streptozosin, Dacarbazine, Fluxuridine, Cytarabine, 6-Mercaptopurine, 6-Thioguanine, Fludarabine Phosphate, Oxaliplatin, Leucovirine, ELOXATIN™ (Oxaliplatin), Pentostatin, Vinblastine, Vincristine, Vindecin, Bleomycin, Dactinomycin, Daunorubicin, Doxorubicin, Epirubicin, Idarubicin, Mitramycin, Deoxycoformycin, Mitomycin-C, L-Asparaginase, Tenifoside 17. Alpha-alpha-Ethinyl Estradiol, Diethylstilbestrol, Testosterone, Prednisone, Fluocimesterone, Dromostanolone Propionate, Testolactone, Megestrol Acetate, Methylprednisolone, Methyltestosterone, Prednisolone, Triamcinolone, Chlorotrianisene, Hydroxyprogesterone, Aminoglutecithimide, Estramustine, Medroxyprogesterone Acetate, Leuprolide, Flutamide, Toremifene, Goserelin, Carboplatin, Hydroxyurea, Amsacrin, Procarbazine, Mitotan, Mithoxantrone, Levamisole, Nabelben, Anastrozol, Letrazol, Capecitabine, Reloxapine, Droloxapine, Hexamethylmelamine, Avastin, HERCEPTIN TM (Trastuzumab), BEXXAR TM (Tocitumomab), VELCADE TM (Bortezomib), ZEVALIN TM (Ibritumomab tiuxetane), TRISENOX TM (Arsenic trioxide), XELODA TM (Capecitabine), Vinorelbine, Porfimer, ERBITUX TM(cetuximab), tiotepa, altretamine, melphalan, trastuzumab, lerosole, fulvestrant, exemestane, ifosformide, rituximab, C225 (cetuximab), campas (alemtuzumab), cloparabine, cladribine, apidicolone, rituxan, sunitinib, dasatinib, tezacitabine, Sml1, fludarabine, pentostatin, triapine, didox, trimidox, amidox, 3-AP, and MDL-101,731.

[0559] The compounds of the present invention may be further used in combination with other methods of treating cancer, such as chemotherapy, radiation therapy, tumor-targeted therapy, adjuvant therapy, immunotherapy, or surgery. Examples of immunotherapy include cytokine therapy (e.g., interferon, GM-CSF, G-CSF, IL-2), CRS-207 immunotherapy, cancer vaccines, monoclonal antibodies, bispecific or multispecific antibodies, antibody-drug conjugates, adoptive T cell delivery, Toll receptor agonists, RIG-I agonists, cancer lysis virotherapy, and immunomodulatory small molecules including thalidomide or JAK1 / 2 inhibitors, PI3Kδ inhibitors, etc. These compounds may be administered in combination with one or more anticancer drugs, such as chemotherapy agents.Examples of chemotherapy agents include the following: avarelix, aldesleukin, alemtuzumab, alitretinoin, allopurinol, altretamine, anastrozole, arsenic trioxide, asparaginase, azacitidine, bevacizumab, bexarotene, baricitinib, bleomycin, bortezomib, intravenous busulfan, oral busulfan, calosterone, capecitabine, carboplatin, carmustine, cetuximab, chlorambucil, cisplatin, cladribine, cloparabine, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, dalteparin sodium, dasatinib, daunorubicin, decitabine, denilukin, denilukin diptitox, dexrazoxaine, docetaxel, doxorubicin, dromostanolone propionate, eculizumab, Epirubicin, Erlotinib, Estramustine, Etoposide Phosphate, Etoposide, Exemestane, Fentanyl Citrate, Filgrastim, Fluxuridine, Fludarabine, Fluorouracil, Fulvestrant, Gefitinib, Gemcitabine, Gemtuzumab Ozogamicin, Goserelin Acetate, Histrelin Acetate, Ibritumomab Tiuxetane, Idarubicin, Ifosfamide, Imatinib Mesylate, Interferon Alpha 2a, Irinotecan, Lapatinib Ditosylate, Lenalidomide, Letrozole, Leucovorin, Leuprolide Acetate, Levamisole, Lomustine, Mechloretamine, Megestrol Acetate, Melphalan, Mercaptopurine, Methotrexat, Methoxalenn, Mitomycin C, Mitotan, Mitoxantrone, Nandrolone Fenpropionate, Nelarabine, Nofetumomab, Oxaliplatin, Paclitaxel, Famidronate, Panitumumab, Pegaspargase, Pegfilgrastim, Pemetrexid Disodium, Pentostatin, Pifobroman, Plicamycin, Procarbazine, Quinacrine, Rasburicase, Rituximab, Ruxolitinib, Sorafenib, Streptozosin, Sunitinib, Sunitinib Maleate, Tamoxifen, Temozolomide, Tenifoside, Testolactone, Thalidomide, Thioguanine, Thiotepa, Topotecan, Toremifene, Tocitumomab, Trastuzumab, Tretinoin, Uracil Mustard, Valubicin, Vinblastine, Vincristine, Vinorelbine, Vorinostat, and Zoledronate.

[0560] Additional examples of chemotherapy agents include proteasome inhibitors (e.g., bortezomib), thalidomide, revlimid, and DNA-damaging agents such as melphalan, doxorubicin, cyclophosphamide, vincristine, etoposide, carmustine, etc.

[0561] Examples of steroids include corticosteroids such as dexamethasone or prednisone.

[0562] Examples of Bcr-Abl inhibitors include imatinib mesylate (GLEEVAC™), nilotinib, dasatinib, bosutinib, and ponatinib, and pharmaceutically acceptable salts. Other suitable examples of Bcr-Abl inhibitors include compounds of the genus and species disclosed in US Patent No. 5,521,184, WO 04 / 005281, and US Serial No. 60 / 578,491, and pharmaceutically acceptable salts thereof.

[0563] Suitable examples of Flt-3 inhibitors include midostaurine, restaurtinib, linifanib, sunitinib, sunitinib maleate, sorafenib, quizartinib, crenoranib, pacitinib, tandutinib, PLX3397 and ASP2215, and pharmaceutically acceptable salts thereof. Other suitable examples of Flt-3 inhibitors include compounds as disclosed in WO 03 / 037347, WO 03 / 099771 and WO 04 / 046120, and pharmaceutically acceptable salts thereof.

[0564] Suitable examples of RAF inhibitors include dabrafenib, sorafenib, and vemurafenib, and pharmaceutically acceptable salts thereof. Other suitable examples of RAF inhibitors include compounds as disclosed in WO 00 / 09495 and WO 05 / 028444, and pharmaceutically acceptable salts thereof.

[0565] Suitable examples of FAK inhibitors include VS-4718, VS-5095, VS-6062, VS-6063, BI853520 and GSK2256098, and pharmaceutically acceptable salts thereof. Other suitable examples of FAK inhibitors include compounds as disclosed in WO 04 / 080980, WO 04 / 056786, WO 03 / 024967, WO 01 / 064655, WO 00 / 053595 and WO 01 / 014402, and pharmaceutically acceptable salts thereof.

[0566] Suitable examples of CDK4 / 6 inhibitors include palbociclib, ribociclib, trilaxiclib, lerosiclib, and abemaciclib, and pharmaceutically acceptable salts thereof. Other suitable examples of CDK4 / 6 inhibitors include compounds as disclosed in WO 09 / 085185, WO 12 / 129344, WO 11 / 101409, WO 03 / 062236, WO 10 / 075074, and WO 12 / 061156, and pharmaceutically acceptable salts thereof.

[0567] In some embodiments, the compound of the present invention may be used in combination with one or more other kinase inhibitors, including imatinib, to treat patients who are particularly resistant to imatinib or other kinase inhibitors.

[0568] In some embodiments, the compounds of the present invention may be used in combination with chemotherapy agents in the treatment of cancer and may enhance the therapeutic response without exacerbating the toxic effects compared to the response to the chemotherapy agent alone. In some embodiments, the compounds of the present invention may be used in combination with the chemotherapy agents provided herein. For example, additional pharmaceutical agents used in the treatment of multiple myeloma may include, without limitation, melphalan, melphalan plus prednisone [MP], doxorubicin, dexamethasone, and Velcade (bortezomib). Other additional agents used in the treatment of multiple myeloma include Bcr-Abl, Flt-3, RAF, and FAK kinase inhibitors. In some embodiments, the agents are alkylating agents, proteasome inhibitors, corticosteroids, or immunomodulators. Examples of alkylating agents include cyclophosphamide (CY), melphalan (MEL), and bendamustine. In some embodiments, the proteasome inhibitor is carfilzomib. In some embodiments, the corticosteroid is dexamethasone (DEX). In some embodiments, the immunomodulator is lenalidomide (LEN) or pomalidomide (POM). Additive or synergistic effects are desirable results of using the CDK2 inhibitor of the present invention in combination with additional agents.

[0569] These agents may be used in combination with the compounds of the present invention in a single or consecutive drug form, or these agents may be administered simultaneously or sequentially as separate drug forms.

[0570] The compound of the present invention may be used in combination with one or more other inhibitors or one or more therapies for the treatment of an infection. Examples of infections include viral infections, bacterial infections, fungal infections, or parasitic infections.

[0571] In some embodiments, a corticosteroid, such as dexamethasone, is administered to a patient in combination with the compound of the present invention, wherein the dexamethasone is administered intermittently rather than continuously.

[0572] Compounds as described herein, compounds as mentioned in any claim, or salts thereof may be used in combination with other immunogenic agents, such as cancer cells, purified tumor antigens (including recombinant proteins, peptides, and carbohydrate molecules), cells, and cells transfected with genes encoding immunostimulating cytokines. Unlimited examples of tumor vaccines that may be used include tumor cells transfected to express peptides of melanoma antigens, such as peptides of gp100, MAGE antigens, Trp-2, MARTI and / or tyrosinase, or the cytokine GM-CSF.

[0573] Compounds as described herein, compounds as mentioned in any claim, or salts thereof may be used in combination with a vaccination protocol for the treatment of cancer. In some embodiments, tumor cells are transduced to express GM-CSF. In some embodiments, the tumor vaccine comprises proteins derived from viruses implicated in human cancer, such as human papillomavirus (HPV), hepatitis viruses (HBV and HCV), and Kaposi's herpes sarcoma virus (KHSV). In some embodiments, compounds of the present invention may be used in combination with tumor-specific antigens, such as heat shock proteins isolated from the tumor tissue itself. In some embodiments, compounds as described herein, compounds as mentioned in any claim, or salts thereof may be used in combination with dendritic cell immunization to activate a potent anti-tumor response.

[0574] The compound of the present invention may be used in combination with a bispecific macrocyclic peptide that targets Fe alpha or Fe gamma receptor-expressing effector cells to tumor cells. The compound of the present invention may also be used in combination with a macrocyclic peptide that activates host immune responsiveness.

[0575] In some additional embodiments, the compound of the present invention may be administered to a patient prior to, during, and / or after a bone marrow transplant or stem cell transplant in combination with other therapeutic agents. The compound of the present invention may be used in combination with a bone marrow transplant for the treatment of various tumors of hematopoietic origin.

[0576] Compounds as described herein, compounds as mentioned in any claim, or salts thereof may be used in combination with vaccines to stimulate an immune response against pathogens, toxins, and autoantigens. Examples of pathogens for which such a therapeutic approach may be particularly useful include pathogens for which there is currently no effective vaccine, or pathogens for which traditional vaccines are not entirely effective. These include, but are not limited to, HIV, hepatitis (types A, B, and C), influenza, herpes, Giardia, malaria, Leishmania, Staphylococcus aureus, and Pseudomonas aeruginosa.

[0577] Viruses causing infection treatable by the method of the present invention include, but are not limited to, human papillomavirus, influenza, hepatitis A, B, C or D virus, adenovirus, poxvirus, herpes simplex virus, human cytomegalovirus, severe acute respiratory syndrome virus, Ebola virus, measles virus, herpes virus (e.g., VZV, HSV-1, HAV-6, HSV-II and CMV, Epstein-Barr virus), flavivirus, echovirus, rhinovirus, coxsackievirus, cornovirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, softball virus, poliovirus, rabies virus, JC virus and arbovirus encephalitis virus.

[0578] Pathogenic bacteria causing an infection treatable by the method of the present invention include, but are not limited to, Chlamydia, Rickettsia, Mycobacterium, Staphylococcus, Streptococcus, Pneumococcus, Meningococcus and Conococcus, Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, Diphtheria, Salmonella, Bacillus, Cholera, Tetanus, Botulism, Anthrax, Plague, Leptospirosis, and Lyme disease bacteria.

[0579] The pathogenic fungi causing infections treatable by the method of the present invention are Candida (albicans, krusei, glabrata, tropicalis, etc.), Cryptococcus neoformans, Aspergillus (fumigatus, niger, etc.), Mucorales (mucor, absidiaria, rhizophus), Sporothrix schenkii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis, and Histoplasma capsulatum Includes (Histoplasma capsulatum), but is not limited to these.

[0580] Pathogenic parasites causing an infection treatable by the method of the present invention include, but are not limited to, Entamoeba histolytica, Balantidium coli, Naegleria fowleri, Acanthamoeba species, Giardia lambia, Cryptosporidium species, Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Toxoplasma gondii, and Nippostrongylus brasiliensis. does not.

[0581] When one or more pharmaceutical agents are administered to a patient, they may be administered simultaneously, separately, sequentially, or in combination (e.g., in the case of two or more agents).

[0582] Methods for the safe and effective administration of most of these chemotherapy agents are known to those skilled in the art. In addition, their administration is described in standard literature. For example, the administration of most of these chemotherapy agents is described in the Physicians' Desk Reference (PDR, e.g., 1996 edition, Medical Economics Company, Montvale, NJ), the disclosure of which is incorporated herein by reference as if stated in its entirety.

[0583] II. Immune Checkpoint Therapy

[0584] The compounds of the present invention may be used in combination with one or more immune checkpoint inhibitors for the treatment of diseases, such as cancer or infection. Exemplary immune checkpoint inhibitors include inhibitors against immune checkpoint molecules such as CBL-B, CD20, CD28, CD40, CD70, CD122, CD96, CD73, CD47, CDK2, GITR, CSF1R, JAK, PI3K delta, PI3K gamma, TAM, arginase, HPK1, CD137 (also known as 4-1BB), ICOS, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, LAG3, TIM3, TLR (TLR7 / 8), TIGIT, CD112R, VISTA, PD-1, PD-L1, and PD-L2. In some embodiments, the immune checkpoint molecule is a stimulating checkpoint molecule selected from CD27, CD28, CD40, ICOS, OX40, GITR, and CD137. In some embodiments, the immune checkpoint molecule is an inhibitory checkpoint molecule selected from A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, LAG3, PD-1, TIM3, TIGIT, and VISTA. In some embodiments, the compounds provided herein may be used in combination with one or more agents selected from KIR inhibitors, TIGIT inhibitors, LAIR1 inhibitors, CD160 inhibitors, 2B4 inhibitors, and TGFR beta inhibitors.

[0585] In some embodiments, the compound provided herein may be used in combination with one or more agonists of immune checkpoint molecules, e.g., OX40, CD27, GITR, and CD137 (also known as 4-1BB).

[0586] In some embodiments, the inhibitor of the immune checkpoint molecule is an anti-PD1 antibody, an anti-PD-L1 antibody, or an anti-CTLA-4 antibody.

[0587] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of PD-1 or PD-L1, for example, an anti-PD-1 or anti-PD-L1 monoclonal antibody. In some embodiments, the anti-PD-1 or anti-PD-L1 antibody is nivolumab, pembrolizumab, atezolizumab, durvalumab, avelumab, cemiflimab, atezolizumab, avelumab, tislerizumab, spartalizumab (PDR001), setrelimab (JNJ-63723283), toripalimab (JS001), camrelizumab (SHR-1210), syntilimab (IBI308), AB122 (GLS-010), AMP-224, AMP-514 / MEDI-0680, BMS936559, JTX-4014, BGB-108, SHR-1210, MEDI4736, FAZ053, BCD-100, KN035, CS1001, BAT1306, LZM009, AK105, HLX10, SHR-1316, CBT-502 (TQB2450), A167 (KL-A167), STI-A101 (ZKAB001), CK-301, BGB-A333, MSB-2311, HLX20, TSR-042, or LY3300054. In some embodiments, inhibitors of PD-1 or PD-L1 are US Patent No. 7,488,802, 7,943,743, 8,008,449, 8,168,757, 8,217,149, or 10,308,644; USPublication Number 2017 / 0145025, 2017 / 0174671, 2017 / 0174679, 2017 / 0320875, 2017 / 0342060, 2017 / 0362253, 2018 / 0016260, 2018 / 0057486, 2018 / 0177784, 2018 / 0177870, 2018 / 0179179, 2018 / 0179201, 2018 / 0179202, 2018 / 0273519, 2019 / 0040082, 2019 / 0062345, 2019 / 0071439, 2019 / 0127467, 2019 / 0144439, 2019 / 0202824, 2019 / 0225601, 2019 / 0300524, or 2019 / 0345170; or PCT publication number WO 03 / 042402, WO 2008 / 156712, WO 2010 / 089411, WO 2010 / 036959, WO 2011 / 066342, WO 2011 / 159877, WO 2011 / 082400, WO 2011 / 161699, or WO 2019 / 246110, each incorporated herein by reference in its entirety. In some specific examples, the PD-L1 inhibitor is INCB086550.

[0588] In some embodiments, the antibody is an anti-PD-1 antibody, e.g., an anti-PD-1 monoclonal antibody. In some embodiments, the anti-PD-1 antibody is nivolumab, pembrolizumab, cemiflimab, spartalizumab, camrelizumab, setrelimab, toripalimab, syntilimab, AB122, AMP-224, JTX-4014, BGB-108, BCD-100, BAT1306, LZM009, AK105, HLX10, or TSR-042. In some embodiments, the anti-PD-1 antibody is nivolumab, pembrolizumab, cemiflimab, spartalizumab, camrelizumab, setrelimab, toripalimab, or syntilimab. In some embodiments, the anti-PD-1 antibody is pembrolizumab. In some embodiments, the anti-PD-1 antibody is nivolumab. In some embodiments, the anti-PD-1 antibody is cemiflimab. In some embodiments, the anti-PD-1 antibody is spartalizumab. In some embodiments, the anti-PD-1 antibody is camrelizumab. In some embodiments, the anti-PD-1 antibody is setrelimab. In some embodiments, the anti-PD-1 antibody is toripalimab. In some embodiments, the anti-PD-1 antibody is syntilimab. In some embodiments, the anti-PD-1 antibody is AB122. In some embodiments, the anti-PD-1 antibody is AMP-224. In some embodiments, the anti-PD-1 antibody is JTX-4014. In some embodiments, the anti-PD-1 antibody is BGB-108. In some embodiments, the anti-PD-1 antibody is BCD-100. In some embodiments, the anti-PD-1 antibody is BAT1306. In some embodiments, the anti-PD-1 antibody is LZM009. In some embodiments, the anti-PD-1 antibody is AK105. In some embodiments, the anti-PD-1 antibody is HLX10. In some embodiments, the anti-PD-1 antibody is TSR-042. In some embodiments, the anti-PD-1 monoclonal antibody is nivolumab or pembrolizumab. In some embodiments, the anti-PD-1 monoclonal antibody is MGA012 (INCMGA0012; retipanlimab). In some embodiments, the anti-PD-1 antibody is SHR-1210.Other anticancer agent(s) include antibody therapies such as 4-1BB (e.g., urelumab, utomilumab).

[0589] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of PD-L1, e.g., an anti-PD-L1 monoclonal antibody. In some embodiments, the anti-PD-L1 monoclonal antibody is atezolizumab, avelumab, durvalumab, tislerizumab, BMS-935559, MEDI4736, atezolizumab (MPDL3280A; also known as RG7446), avelumab (MSB0010718C), FAZ053, KN035, CS1001, SHR-1316, CBT-502, A167, STI-A101, CK-301, BGB-A333, MSB-2311, HLX20, or LY3300054. In some embodiments, the anti-PD-L1 antibody is atezolizumab, avelumab, durvalumab, or tislerizumab. In some embodiments, the anti-PD-L1 antibody is atezolizumab. In some embodiments, the anti-PD-L1 antibody is avelumab. In some embodiments, the anti-PD-L1 antibody is durvalumab. In some embodiments, the anti-PD-L1 antibody is tislerizumab. In some embodiments, the anti-PD-L1 antibody is BMS-935559. In some embodiments, the anti-PD-L1 antibody is MEDI4736. In some embodiments, the anti-PD-L1 antibody is FAZ053. In some embodiments, the anti-PD-L1 antibody is KN035. In some embodiments, the anti-PD-L1 antibody is CS1001. In some embodiments, the anti-PD-L1 antibody is SHR-1316. In some embodiments, the anti-PD-L1 antibody is CBT-502. In some embodiments, the anti-PD-L1 antibody is A167. In some embodiments, the anti-PD-L1 antibody is STI-A101. In some embodiments, the anti-PD-L1 antibody is CK-301. In some embodiments, the anti-PD-L1 antibody is BGB-A333. In some embodiments, the anti-PD-L1 antibody is MSB-2311. In some embodiments, the anti-PD-L1 antibody is HLX20. In some embodiments, the anti-PD-L1 antibody is LY3300054.

[0590] In some embodiments, the inhibitor of the immune checkpoint molecule is a small molecule that binds to PD-L1, or a pharmaceutically acceptable salt thereof. In some embodiments, the inhibitor of the immune checkpoint molecule is a small molecule that binds to PD-L1 and internalizes it, or a pharmaceutically acceptable salt thereof. In some embodiments, the inhibitor of an immune checkpoint molecule is a compound selected from those in US 2018 / 0179201, US 2018 / 0179197, US 2018 / 0179179, US 2018 / 0179202, US 2018 / 0177784, US 2018 / 0177870, US Serial No. 16 / 369,654 (filed March 29, 2019), and US Serial No. 62 / 688,164, or a pharmaceutically acceptable salt thereof, each incorporated herein by reference in its entirety.

[0591] In some embodiments, the inhibitors of immune checkpoint molecules are inhibitors of KIR, TIGIT, LAIR1, CD160, 2B4, and TGFR beta.

[0592] In some embodiments, the inhibitor is MCLA-145.

[0593] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of CTLA-4, e.g., an anti-CTLA-4 antibody. In some embodiments, the anti-CTLA-4 antibody is iplimumab, tremelimumab, AGEN1884, or CP-675,206.

[0594] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of LAG3, e.g., an anti-LAG3 antibody. In some embodiments, the anti-LAG3 antibody is BMS-986016, LAG525, INCAGN2385, or efthilazimod alpha (IMP321).

[0595] In some embodiments, the immune checkpoint molecule inhibitor is a CD73 inhibitor. In some embodiments, the CD73 inhibitor is oleclumab.

[0596] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of TIGIT. In some embodiments, the inhibitor of TIGIT is OMP-31M32.

[0597] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of VISTA. In some embodiments, the inhibitor of VISTA is JNJ-61610588 or CA-170.

[0598] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of B7-H3. In some embodiments, the inhibitor of B7-H3 is enoblituzumab, MGD009, or 8H9.

[0599] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of KIR. In some embodiments, the inhibitor of KIR is rililumab or IPH4102.

[0600] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of A2aR. In some embodiments, the inhibitor of A2aR is CPI-444.

[0601] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of TGF-beta. In some embodiments, the inhibitor of TGF-beta is travedersen, galucertinib, or M7824.

[0602] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of PI3K-gamma. In some embodiments, the inhibitor of PI3K-gamma is IPI-549.

[0603] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of CD47. In some embodiments, the inhibitor of CD47 is Hu5F9-G4 or TTI-621.

[0604] In some embodiments, the immune checkpoint molecule inhibitor is a CD73 inhibitor. In some embodiments, the CD73 inhibitor is MEDI9447.

[0605] In some embodiments, the immune checkpoint molecule inhibitor is a CD70 inhibitor. In some embodiments, the CD70 inhibitor is cusatuzumab or BMS-936561.

[0606] In some embodiments, the inhibitor of the immune checkpoint molecule is an inhibitor of TIM3, e.g., an anti-TIM3 antibody. In some embodiments, the anti-TIM3 antibody is INCAGN2390, MBG453, or TSR-022.

[0607] In some embodiments, the inhibitor of the immune checkpoint molecule is a CD20 inhibitor, e.g., an anti-CD20 antibody. In some embodiments, the anti-CD20 antibody is obinutuzumab or rituximab.

[0608] In some embodiments, the agonists of immune checkpoint molecules are OX40, CD27, CD28, GITR, ICOS, CD40, TLR7 / 8 and CD137 (also known as 4-1BB).

[0609] In some embodiments, the agonist of CD137 is urelumab. In some embodiments, the agonist of CD137 is utomilumab.

[0610] In some embodiments, the agonist of the immune checkpoint molecule is an inhibitor of GITR. In some embodiments, the agonist of GITR is TRX518, MK-4166, INCAGN1876, MK-1248, AMG228, BMS-986156, GWN323, MEDI1873, or MEDI6469.

[0611] In some embodiments, the agonist of the immune checkpoint molecule is an agonist of OX40, e.g., an OX40 agonist antibody or an OX40L fusion protein. In some embodiments, the anti-OX40 antibody is INCAGN01949, MEDI0562 (tavolimab), MOXR-0916, PF-04518600, GSK3174998, BMS-986178, or 9B12. In some embodiments, the OX40L fusion protein is MEDI6383.

[0612] In some embodiments, the agonist of the immune checkpoint molecule is an agonist of CD40. In some embodiments, the agonist of CD40 is CP-870893, ADC-1013, CDX-1140, SEA-CD40, RO7009789, JNJ-64457107, APX-005M, or Chi Lob 7 / 4.

[0613] In some embodiments, the agonist of the immune checkpoint molecule is the agonist of ICOS. In some embodiments, the agonist of ICOS is GSK-3359609, JTX-2011, or MEDI-570.

[0614] In some embodiments, the agonist of the immune checkpoint molecule is the agonist of CD28. In some embodiments, the agonist of CD28 is teralizumab.

[0615] In some embodiments, the agonist of the immune checkpoint molecule is the agonist of CD27. In some embodiments, the agonist of CD27 is valillirumab.

[0616] In some embodiments, the agonist of the immune checkpoint molecule is the agonist of TLR7 / 8. In some embodiments, the agonist of TLR7 / 8 is MEDI9197.

[0617] The compound of the present invention may be used in combination with a bispecific antibody. In some embodiments, one of the domains of the bispecific antibody targets PD-1, PD-L1, CTLA-4, GITR, OX40, TIM3, LAG3, CD137, ICOS, CD3, or TGFβ receptors. In some embodiments, the bispecific antibody binds to PD-1 and PD-L1. In some embodiments, the bispecific antibody binding to PD-1 and PD-L1 is MCLA-136. In some embodiments, the bispecific antibody binding to PD-L1 and CTLA-4. In some embodiments, the bispecific antibody binding to PD-L1 and CTLA-4 is AK104.

[0618] In some embodiments, the compound of the present invention may be used in combination with one or more metabolic enzyme inhibitors. In some embodiments, the metabolic enzyme inhibitor is an inhibitor of IDO1, TDO, or arginase. Examples of IDO1 inhibitors include epacadstat, NLG919, BMS-986205, PF-06840003, IOM2983, RG-70099, and LY338196. Examples of arginase inhibitors include INCB1158.

[0619] As presented throughout, additional compounds, inhibitors, agents, etc., may be used in combination with the compound of the present invention in a single or consecutive drug form, or they may be administered simultaneously or sequentially as separate drug forms.

[0620] The following are examples of the practice of the invention. These should not be construed as limiting the scope of the invention in any way.

[0621] Examples

[0622] Example 1. Characterization of cyclin E1 in ovarian and endometrial cancer cell lines

[0623] The cyclin E1 ("CCNE1") gene was evaluated in various ovarian and endometrial cancer cell lines (Figs. 1a and 1b). CCNE1 was amplified in COV318, OVCAR3 ovarian, Fu-OV1, and KLE cells, which each exhibited copy number-based CCNE1 function gain (copy number > 2 ("CN")) (Fig. 1a). In contrast, CCNE1 was not amplified in COV504, OV56, or Igrov1 cells, which each exhibited copy neutrality (2) or loss of function (CN ≤ 2) of the gene. CN was obtained from the Broad Institute Cancer Cell Line Encyclopedia ("CCLE") database (Barretina, et al., NatureIt was obtained from , 2012. 483(7391): pp. 603-7, which is incorporated herein by reference in its entirety).

[0624] To evaluate CCNE1 protein levels, Western blot analysis was performed on protein samples obtained from COV318, OVCAR3 ovarian, Fu-OV1, KLE, COV504, OV56, and Igrov1 cells. CCNE1 protein levels were higher in cell lines with CCNE1 function acquired by copy number (CN > 2; i.e., COV318, OVCAR3 ovarian, Fu-OV1, and KLE cells) compared to cell lines with copy neutrality or loss of function of the gene (CN ≤ 2; i.e., COV504, OV56, and Igrov1 cells).

[0625] Example 2. CDK2-knockdown by siRNA inhibits proliferation in CCNE1-amplified human cancer cell lines, but not in CCNE1-non-amplified human cancer cell lines.

[0626] The effect of CDK2 knockdown was evaluated in CCNE1-amplified cell lines compared to CCNE1-non-amplified cell lines. CCNE1-amplified cell lines (Fu-OV1 and KLE) or CCNE1-non-amplified cell lines (COV504 and Igrov1) were treated with a control ("ctrl") or CDK2-specific short interfering RNAs ("siRNAs") ("CDK2 siRNA-1" and "CDK2 siRNA-2") (Figs. 2a and 2b and 3a and 3b). 72 hours after transfection with these siRNAs, these cells were harvested, and cell cycle analysis was performed by fluorescence-activated cell sorting ("FACS") (Figs. 2a and 3a). CDK2 knockdown was confirmed by Western blot (Figs. 2b and 3b). CDK2-knockdown inhibited proliferation in CCNE1-amplified cell lines but not in CCNE1-non-amplified cell lines (Figs. 2a and 3a).

[0627] Similar experiments were performed on additional CCNE1-amplified cell lines (COV318, OVCAR3, Fu-OV1, and KLE) and CCNE1-non-amplified cell lines (COV504, OV56, and Igrov1) (Fig. 4). On day 3 after treatment with CDK2-specific siRNAs, the percentage of cells in the S phase was significantly reduced in CCNE1-amplified cell lines compared to treatment with control siRNA (Fig. 4). Consistent with the results of Figs. 2a and 3a, the percentage of cells in the S phase on day 3 after treatment with CDK2-specific siRNAs was not significantly different in CCNE1-non-amplified cell lines compared to treatment with control siRNA (Fig. 4).

[0628] Example 3. Proliferation in CCNE1-amplified cell lines and CCNE-non-amplified cell lines upon CDK4 / 6 inhibition

[0629] The effect of CDK4 / 6 inhibition on CCNE1-amplified cell lines was evaluated in contrast to CCNE1-non-amplified cell lines. CCNE1-amplified cells (OVCAR3) or CCNE1-non-amplified cells (COV504) were treated with dimethyl sulfoxide ("DMSO") control or increasing concentrations of the CDK4 / 6 inhibitor palbociclib (Fig. 5). At 16 hours after treatment with DMSO or palbociclib, these cells were harvested, and cell cycle analysis by FACS was performed (Fig. 5). CDK4 / 6 inhibition caused dose-dependent inhibition of proliferation in CCNE1-non-amplified cells, but not in CCNE1-amplified cells (Fig. 5).

[0630] Similar experiments were performed on a larger set of CCNE1-amplified cell lines (COV318 and OVCAR3) and CCNE1-non-amplified cell lines (COV504, OV56, and Igrov1) (Fig. 6). At 16 hours after treatment with palbociclib, the percentage of cells in the S phase decreased in a dose-dependent manner in CCNE1-non-amplified cell lines compared to treatment with DMSO (Fig. 6). Consistent with the results in Fig. 5, the percentage of cells in the S phase at 16 hours after treatment with palbociclib was not significantly different in CCNE1-amplified cell lines compared to treatment with DMSO (Fig. 6).

[0631] Example 4. CDK2-knockdown blocks Rb phosphorylation at S780 in CCNE1-amplified cell lines but not in CCNE1-non-amplified cell lines.

[0632] The effect of CDK2-knockdown on Rb phosphorylation at Sequence No. 3 Ser-780 ("S780") in CCNE1-amplified cell lines was evaluated in contrast to CCNE1-non-amplified cell lines. CCNE1-amplified cell lines (COV318, Fu-OV1, and KLE) or CCNE1-non-amplified cell lines (COV504, OV56, and Igrov1) were treated with ctrl or CDK2-specific siRNAs (Figs. 7a and 7b). 72 hours after transfection with these siRNAs, these cells were harvested, and total proteins were extracted and analyzed by Western blot. CDK2 knockdown was confirmed by Western blot. CDK2-knockdown blocked Rb phosphorylation at S780 in CCNE1-amplified cell lines (Fig. 7a), but not in CCNE1-non-amplified cell lines (Fig. 7b).

[0633] Example 5. Palbociclib blocks Rb phosphorylation at S780 in CCNE1 non-amplified cell lines, but not in CCNE1-amplified cell lines.

[0634] The effect of CDK4 / 6 inhibition on Rb phosphorylation at S780 in CCNE1-amplified cell lines was evaluated compared to CCNE1-non-amplified cell lines. CCNE1-amplified cell lines (OVCAR3 and COV318) or CCNE1-non-amplified cell lines (COV504 and OV56) were treated with DMSO or various doses of palbociclib (Figs. 8a and 8b). At 1 or 15 hours after treatment, these cells were harvested, and total proteins were extracted and analyzed by Western blot (Fig. 8). Palbociclib treatment blocked Rb phosphorylation at S780 in CCNE1-non-amplified cell lines (Fig. 8b), but not in CCNE1-amplified cell lines (Fig. 8a).

[0635] Example 6. CDK2 degradation by dTAG reduces Rb phosphorylation at S780

[0636] To further confirm that CDK2 knockdown reduces Rb phosphorylation at S780 in CCNE1-amplified cells (see Example 4), a dTAG system was used to degrade CDK2, and the level of S780-phosphorylated Rb was evaluated (Erb et al., Nature, 2017, 543(7644):270-274, which is incorporated herein by reference in its entirety). Briefly, OVCAR3 cells were engineered to express Cas9 by lentiviral transduction of a Cas9 construct. OVCAR3-Cas9 cells were subsequently engineered to express a CDK2-FKBP12F36V-HA fusion protein by lentiviral transduction of a CDK2-FKBP12F36V-HA expression construct. Then, to engineer the cell line to inactivate endogenous CDK2, OVCAR3 (Cas9, CDK2-FKBP12F36V-HA) cells were transduced with CDK2 sgRNA ("CDK2-gRNA"); OVCAR3 (Cas9, CDK2-FKBP12F36V-HA) cells transduced with non-targeted sgRNA ("Ctl-gRNA"; Cellecta) served as a control cell line.

[0637] To degrade the CDK2-FKBP12F36V-HA protein by dTAG (Fig. 9a), cells were treated with DMSO or titrations of dTAG concentration for 14 hours. Cells were collected and processed for Western blot (Fig. 9b). After treatment with dTAG in both control and CDK2-gRNA-treated cells, dose-responsive degradation of CDK2-FKBP12 (F36V) was detected by Western blot (Fig. 9b). Degradation was further confirmed by Western blot for HA-Tag. Endogenous CDK2 protein was detected in OVCAR3 cells treated with control gRNA, but not in these cells treated with CDK2-gRNA (Fig. 9b). CDK2-FKBP12 (F36V) degradation inhibited Rb phosphorylation at S780 in CDK2 knockout OVCAR3 cells, but not in OVCAR3 cells with endogenous CDK2 expression.

[0638] Example 7. p-Rb S780 HTRF cell assay for confirmation of CDK2 inhibitor

[0639] In vitro CDK2 / CCNE1 enzyme activity assays were used to measure the phosphorylation of peptide substrates using uniform time-resolved energy transfer ("HTRF"). First, the specificity of 8-((1R,2R)-2-hydroxy-2-methylcyclopentyl)-2-((1-(methylsulfonyl)piperidin-4-yl)amino)pyrido[2,3-d]pyrimidin-7(8H)-one (Compound A) for CDK2 inhibition was confirmed by kinase activity assays (Fig. 10a). To this end, the LANCE® Ultra Kinase assay was used with ULight™-labeled EIF4E-binding protein 1 (Thr37 / 46) peptide (PerkinElmer, TRF0128-M) and europium-labeled anti-phospho-EIF4E-binding protein 1 (Thr37 / 46) antibody (PerkinElmer, TRF0216-M) as substrates. The ratio of fluorescence transferred to the labeled substrate (665 nm) to the fluorescence of the europium donor (620 nm) indicates the degree of phosphorylation. IC for Compound A 50 It was determined to be 1.1 nM (Fig. 10a). In contrast, the IC for the CDK4 / 6 inhibitor palbociclib 50 It was 10,000 nM (Fig. 10a).

[0640] Next, a CDK2 pRb (S780) HTRF cell assay was performed to enable the quantitative detection of phosphorylated Rb at serine 780 in CCNE1-amplified COV318 cells upon treatment with Compound A or palbociclib (Fig. 10b). Treatment with Compound A inhibited Rb phosphorylation on serine 780 in CCNE1-amplified cells, whereas treatment with palbociclib did not (Fig. 10b). In this assay, the IC50 for Compound A was calculated. 50 It was 37 nM, whereas the IC for palbociclib 50 It was > 3,000 nM (Fig. 10b).

[0641] Example 8. Bioinformatics analysis of the CCLE dataset reveals that sensitivity to CDK2 inhibition in CCNE1-amplified cells depends on functional p16.

[0642] In an attempt to identify biomarkers to predict sensitivity to CDK2 inhibition in CCNE1-amplified cells, 460 cell lines from CCLE were analyzed (Barretina, Same as above First, these cell lines were filtered based on CCNE1 copy number and expression and CDK2 sensitivity scores derived from shRNA knockdown data. A total of 41 cell lines had a CCNE1 copy number > 3 and a CCNE1 expression score (CCLE: > 3 ) It was confirmed that they possessed... Among these 41 cell lines, 18 (44%) were sensitive to CDK2 inhibition (CDK2 sensitivity score ≤-3), while 23 (56%) were insensitive to CDK2 inhibition (CDK2 sensitivity score >-3).

[0643] Next, p16 status was evaluated in these CDK2-sensitive and CDK2-insensitive cell lines (Fig. 11). Among the 18 cell lines sensitive to CDK2 inhibition, 100% expressed normal p16 genes (Fig. 11). In contrast, among the 23 CDK2-insensitive cell lines, only 4 expressed normal p16 genes (Fig. 11). The majority of the 23 CDK2-insensitive cell lines exhibited dysfunctional p16 gene expression: the p16 gene was deleted in 10 of the 23 cell lines; the p16 gene was silenced in 5 of the 23 cell lines; and the p16 gene was mutated in 4 of the 23 cell lines (Fig. 11).

[0644] A summary of CDK2 sensitivity and CDKN2A / p16 status in CCNE1-amplified cell lines is provided in Table 2 below.

[0645] Table 2Cell lines with a CDK2 sensitivity score of ≤ 3 were counted as CDK2-sensitive cell lines; those with ≥ 3 were counted as CDK2-insensitive cell lines. Cell lines demonstrated in the experiment are shown in bold. NCIN87_Stop did not show any CDKN2A / P16 protein expression in the Western blot. The copy numbers of CCNE1 and CDKN2A / P16 were calculated based on the CCLE dataset. Expression scores < 0 were counted as gene silencing.

[0646] cell line CDK2 sensitivity score CCNE1 copy count CDKN2A copy count CDKN2A / p16 mRNA expression score CDKN2a / p16 dysfunction HCC1569_Breast -9.6 16 2 5.11 OVISE_ovary -9.4 3 2 4.17 MKN1_Wi -8.9 5 1 4.28 EFE184_Endometrium -8.7 3 2 3.97 KURAMOCHI_ovary -8.2 3 2 3.60 MKN7_Wi -7.7 21 1 4.37 MDAMB157_Breast -7.6 6 2 5.01 HCC70_Breast -7.6 4 4 4.88 NIHOVCAR3_ovary -7.4 10 2 4.15 FUOV1_ovary -7 10 3 5.19 KLE_Endometrium -7 7 2 6.24 COV318_ovary -7 14 2 5.09 CAOV4_ovary -6.7 3 2 3.59 MFE280_Endometrium -6.3 4 2 4.97 NCIH661_lung -6.2 5 2 3.73 OVCAR4_ovary -4.3 4 1 4.77 SNU8_ovary -3.8 5 3 5.35 OVCAR8_ovary -3.7 3 2 5.21 RMUGS_ovary -2.8 4 1 -0.08 silence NCCSTCK140_Wi -2.7 3 0 -4.70 fruition NCIH2286_lung -1.6 3 1 3.63 Mutation HOP62_Waste -1.4 4 0 -1.21 fruition LN340_Central_Nervous_System -1.0 3 0 -5.47 fruition NCIH1339_Waste -0.8 3 2 2.42 Unidentified NCIN87_Wi 0.1 3 2 4.67 No protein U2OS_Goal 0.4 3 1 -5.72 silence SF172_Central_Nervous_System 0.5 3 0 -2.35 fruition CAL120_Breast 0.6 4 1 4.86 RMGI_ovary 0.9 3 0 -3.33 fruition OV90_ovary 0.9 3 1 3.95 Mutation SNU601_Wi 1.1 4 2 -3.79 silence EW8_Goal 1.5 5 1 3.11 JHESOAD1_esophagus 1.7 5 0 -5.52 fruition HCC1806_Breast 1.9 8 0 -4.61 fruition NCIH2170_Waste 2.0 3 0 -3.73 fruition HCC1428_Breast 2.3 3 2 2.28 A549_Waste 2.5 4 0 -6.13 fruition LXF289_Waste 2.6 4 3 4.10 Mutation AGS_Wi 3.0 3 2 -5.56 silence NCIH647_lung 3.0 4 0 -5.07 fruition HLF_gan 3.9 3 2 3.40

[0647] Example 9. CCNE1-amplified cells with dysfunctional p16 do not respond to CDK2 inhibition.

[0648] To further evaluate the role of p16 in CDK2 sensitivity in CCNE1-amplified cells, p16 protein expression in three gastric cell lines with CCNE1 amplification was assessed by Western blot. AGS and NCI-N87 cells showed the absence of p16 or dramatically reduced levels (Fig. 12a). In contrast, p16 protein was detected in MKN1 cell protein extracts (Fig. 12a).

[0649] Next, the effect of CDK2-knockdown on these cells was evaluated. Mkn1, Ags, and NCI-N87 cells were treated with control or CDK2-specific siRNA. Three days after siRNA transfection, the distribution of cell cycle phases in these cells was evaluated by FACS. In Mkn1 cells (CCNE1-amplified, p16 protein detected), the percentage of cells in the S phase was significantly reduced in CDK2 siRNA-treated cells compared to the control (Fig. 12b). In contrast, after treatment with CDK2 siRNA, in Ags and NCI-N87 cells (CCNE1-amplified, dysfunctional p16 protein levels), the percentage of cells in the S phase was not significantly reduced compared to the control (Fig. 12b).

[0650] Example 10. p16 knockdown by siRNA abolishes CDK2 inhibition-induced cell cycle inhibition in CCNE1-amplified cells.

[0651] To confirm the role of p16 in the CDK2 sensitivity of CCNE1-amplified cells, COV318 cells were treated with control or p16-specific siRNA. 72 hours after transfection, cells were treated with DMSO (control) or 100 nM of Compound A. 16 hours after treatment with DMSO or the CDK2 inhibitor, cells were harvested, and cell cycle analysis by FACS was performed. Consistent with the previously mentioned results, the percentage of S-phase cells was significantly reduced in control siRNA-treated cells treated with the CDK2 inhibitor (Compound A), but not in these cells treated with the DMSO control (Fig. 13). In contrast, after treatment with the CDK2 inhibitor (Compound A), the percentage of S-phase cells in p16-knockdowned cells was not significantly reduced compared to the DMSO control (Fig. 13).

[0652] Materials and methods used in Examples 1-10

[0653] Cell culture and transfection

[0654] Human cyclin E1 (CCNE1)-amplified ovarian cell lines OVCAR3, COV318, Fu-OV1, endometrial cell line KLE, gastric cell lines MKN1, AGS, NCIN87, and CCNE1-non-amplified ovarian cell lines COV504, OV56, and Igrov1 were cultured in RPMI 1640 medium. The complete growth medium was supplemented with 10% FBS, 0.1 mM non-essential amino acids, 2 mM L-glutamine, 100 units / mL penicillin G, and 100 μg / mL streptomycin in a humidified incubator at 37°C under an atmosphere of 5% CO2 in the air. The Fu-OV1 cell line was purchased from the Leibniz-Institute DSMZ-German Collection of Microorganisms and Cell Cultures; MKN1 was purchased from the Japanese Cancer Research Resources Bank; and the remaining cell lines were purchased from the American Type Culture Collection. For transfection, cells were seeded into 6-wells for 24 hours and transiently transfected with Lipofectamine 2000 reagent (Thermo Fisher, 11668027). ON-TARGETplus human CDK2 siRNAs (GE Healthcare Dharmacon, J-003236-11-0002 and J-003236-12-0002) and ON-TARGETplus human CDKN2A / p16 siRNAs (GE Healthcare Dharmacon, J-011007-08-0002) were used to knock down endogenous CDK2 and CDKN2A / p16. ON-TARGETplus non-targeting pool (GE Healthcare Dharmacon, D-001810-10-20) was used as a negative control.

[0655] Western blot analysis

[0656] Whole cell extracts were prepared using RIPA buffer (Thermo Scientific, 89900) containing a Halt protease and phosphatase inhibitor cocktail (Thermo Scientific, 78440). Protein concentrations were quantified using a BCA protein assay kit (Thermo Scientific, 23225), and 40 μg of protein lysate was loaded for SDS-PAGE using a precast gradient gel (Bio-Rad, Hercules, No. 456-1094). Samples were diluted in 5X Laemmli buffer (300 mM Tris-HCl pH 6.8, 10% SDS (w / v), 5% 2-mercaptoethanol, 25% glycerol (v / v), 0.1% bromphenol blue w / v) and boiled for 5 minutes. 35 μg of protein was separated by 8-15% SDS-PAGE and transferred onto a polyvinylidene fluoride (PVDF) membrane. Nonspecific binding sites on the PVDF membrane were blocked with 5% skim milk in TBST (20 mM Tris-HCl, pH 7.6, 137 mM NaCl, 1% Tween-20).The membrane was hybridized with antibodies against anti-CDKN2A / p16 (Cell Signaling Technology, 92803S), anti-Cas9 (Cell Signaling Technology, 97982S), anti-HA (Cell Signaling Technology, 3724S), anti-Rb (Cell Signaling Technology, 9309S), anti-phospho-Rb (Ser780) (Cell Signaling Technology, 8180S), anti-CDK2 (Cell Signaling Technology, 2546S), anti-CCNE1 (Cell Signaling Technology, 20808S), and anti-GAPDH (Cell Signaling Technology, 8884S) overnight at 4°C, and then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hour at room temperature. These films were subsequently developed using an Immobilon Western chemiluminescent HRP substrate (Millipore, WBKLS0500). Images were captured by the luminescence / fluorescence imaging system Odyssey CLx imaging device (LI-COR).

[0657] Cell cycle analysis

[0658] Cells were seeded into 6-well tissue culture plates and, after 24 hours, treated with titrations of palbociclib or Compound A. After overnight treatment, cells were exposed to 10 μM EdU for 3 hours prior to the detection of EdU-DNA by the Click-iT AlexaFluor® 647 Azide Kit (Life Technology, C10424), in accordance with the manufacturer's instructions. Bulk DNA was stained with DAPI. Compound-treated cells and DMSO-treated control cells were acquired using CytoFlex (Beckman Coulter) and analyzed using FlowJo software. For cell cycle analysis of cells with siRNA knockdown, 72 hours after siRNA transfection, cells were exposed to 10 μM EdU for 3 hours prior to the detection by the Click-iT AlexaFluor® 647 Azide Kit.

[0659] Plasmid

[0660] The LentiCas9 plasmid pRCCH-CMV-Cas9-2A (Cellecta, SVC9-PS) was used for Cas9 expression. An sgRNA-CDK2 lentiviral construct designed to target AAGCAGAGATCTCTCGGA (sequence number: 8) of CDK2 was cloned into the sgRNA expression vector pRSG-U6 and purchased from Cellecta (93661). For CDK2-FKBP12F36V-HA expression, a 1306-base-pair DNA fragment encoding the FKBP12F36V-2xHA tag at the CDK2 and C-terminus was synthesized and cloned into the EcoRI and BamHI-cleaved pCDH-EF1α-MCS-T2A-Puro lentivector (Systembio, CD527A-1).

[0661] Sequence of a 1306 bp DNA fragment:

[0662] CCTC GAATTC AGCTGC ATGGAGAACTTCCAAAAGGTGGAAAAGATCGGAGAGGGCACGTACGGAGTTGTGTACAAAGCCAGAAACAAGTTGACGGGAGAGGTGGTGGCGCTTAAGAAAATCCGCCTGGACACTGAGACTGAGGGTGTGCCCAGTACTGCCATCCGAGAGATCTCTCTGCTTAAGGAGCTTAACCATCCTAATATTGTCAAGCTGCTGGATGTCATTCACACAGAAAATAAACTCTA CCTGGTTTTTGAATTTCTGCACCAAGATCTCAAGAAATTCATGGATGCCTCTGCTCTCACTGGCATTCCTCTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTAGCTTTCTGCCATTCTCATCGGGTCCTCCACCGAGACCTTAAACCTCAGAATCTGCTTATTAACACAGAGGGGGCCATCAAGCTAGCAGACTTTGGACTAGCCAGAGCTTTTGGAGT A CCTGTTCGTACTTACACCCATGA A GTGGTGACCCTGTGGTACCGAGCTCCTGAAATCCTCCTGGGCTGCAAATATTATTCCACAGCTGTGGACATCTGGAGCCTGGGCTGCATCTTTGCTGAGATGGTGACTCGCCGGGCCCTATTCCCTGGAGATTCTGAGATTGACCAGCTCTT T CGGATCTTTCGGACTCTGGGGACCCCAGATGAGGTGGTGTGGCCAGGAGTTACTTCTATGCCTGATTACAAGCCAAGTTTCCCCAAGTGGGCCCGGCAAGATTTTAGTAAAGTTGTACCTCCCCTG GATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTACCCCATCTTCGA CTCGGAGTGCAGGTGGAAACCATCTCCCCAGGAGACGGGCGCACCTTCCCCAAGCGCGGCCAGACCTGCGTGGTGCACTACACCGGGATGCTTGAAGATGGAAAGAAAGTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGG TTGCCCAGATGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAAGGATACCCTTACGACGTTCCTGATTACGCTTACCCTTACGACGTTCCTGATTACGCT GGATCC TAA TTCGAA AGC (Sequence No.: 4)

[0663] The restriction enzyme sites for GAATTC (SEQ No. 5; EcoRI), GGATCC (SEQ No. 6; BamHI), and TTCGAA (SEQ No. 7; BstBI) are underlined. The sequence encoding CDK2 is shown in bold, and the sequence of FKBP12F36V-HA is shown in italics. Within the CDK2 sequence, the three underlined nucleic acids represent modifications that completely obliterate the PAM site to prevent the CRISPR knockout effect. These changes did not alter the encoded amino acids.

[0664] Lentivirus production

[0665] Lentivirus production was performed in 293T cells by co-transfection with a specific lentivirus expression plasmid using a lentivirus packaging mix (Sigma, SHP001) and Lipofectamine 2000. Viral supernatants were collected at 48 and 72 hours after transfection and filtered through a 0.22 μm membrane. All cell lines were transduced by spin inoculation with 8 μg / mL polybrene (Santa Cruz, sc-134220) at 2000 rpm for 1 hour at room temperature.

[0666] CDK2-dTAG cells

[0667] First, OVCAR3 cells were engineered to express Cas9 by lentiviral transduction of a Cas9 construct. Cells were selected, maintained at 100 μg / mL hygromycin (Life Technologies, 10687010), and their expression of Cas9 was demonstrated by immunoblotting. OVCAR3-Cas9 cells were subsequently engineered to express the CDK2-FKBP12F36V-HA fusion protein by lentiviral transduction of a CDK2-FKBP12F36V-HA expression construct and selection with 2 μg / mL puromycin bihydrochloride (Life Technologies, A1113803). The expression of CDK2-FKBP12F36V-HA was demonstrated by immunoblotting using anti-CDK2 and anti-HA antibodies. Next, to engineer the cell line to inactivate endogenous CDK2, OVCAR3 (Cas9, CDK2-FKBP12F36V-HA) cells were transduced with CDK2 sgRNA and selected by 50 μg / mL Zeosin (Life Technologies, R25001). Inactivated expression of endogenous CDK2 in enlarged clones was examined by immunoblotting. OVCAR3 (Cas9, CDK2-FKBP12F36V-HA) cells transduced with non-targeted sgRNA (Cellecta) served as a control cell line.

[0668] To degrade CDK2-FKBP12F36V-HA protein by dTAG, 200,000 cells were triple-seeded in 1 mL of medium within 24-well plates and treated for 14 hours with dimethyl sulfoxide (DMSO) or titration of dTAG concentrations. Cells were collected and processed for Western blot.

[0669] CDK2 / CCNE1 Enzyme Sampling

[0670] The in vitro CDK2 / CCNE1 enzyme activity assay measures the phosphorylation of peptide substrates using uniform time-resolved energy transfer (HTRF). The LANCE® Ultra Kinase assay utilized ULight™-labeled EIF4E-binding Protein 1 (Thr37 / 46) peptide (PerkinElmer, TRF0128-M) and europium-labeled anti-phospho-EIF4E-binding Protein 1 (Thr37 / 46) antibody (PerkinElmer, TRF0216-M) as substrates. The ratio of fluorescence transferred to the labeled substrate (665 nm) to the fluorescence of the europium donor (620 nm) indicates the degree of phosphorylation. The ratio to the treated wells is normalized against DMSO alone (100% activity) and enzyme-free (0% activity) controls. The normalized data represent the IC50s for each compound. 50 To determine, it is analyzed using a dose-response curve with four parameters.

[0671] CDK2 pRb (S780) HTRF cell assay

[0672] The CDK2 pRb (S780) HTRF cell assay enables the quantitative detection of Rb phosphorylated at serine 780 in CCNE1-amplified COV318 cells. The assay involved two antibodies: a europium cryptate-labeled anti-phospho-Rb S780 antibody (donor) and a d2-labeled anti-Rb antibody (recipient). Briefly, COV318 cells were seeded into the wells of a 96-well plate at a density of 25,000 cells per well with 9-point, 3-fold serially diluted compounds and incubated overnight at 37°C and 5% CO2. The final concentration of the compounds started at 3 μM. The next day, cells were lysed in 70 μL of 1X Phospho-Whole Protein Lysis Buffer #2 (Cisbio) and supplemented with 0.7 μL of Blocking Buffer (Cisbio) and 1.4 μL of Protease Inhibitor Cocktail Set III, EDTA-free (Calbiochem, 539134). 16 μL of cell lysate was mixed with 4 μL of fluorophore-conjugated antibodies to a final concentration of 0.188 nM cryptate-labeled anti-phospho-Rb S780 antibody and 0.14 nM d2-labeled anti-Rb antibody. After 2 hours of incubation at room temperature, HTRF signals were measured on a PHERAstar microflatboard reader (BMG Labtech) using 340 nm as the excitation wavelength, a 620 nm filter for europium donor fluorescence, and a 665 nm filter for acceptor fluorescence detection. The HTRF signal was calculated as the HTRF ratio (ratio of fluorescence measured at 665 nm and 620 nm) x 10000.

[0673] Example A1. 4-((8-cyclopentyl-6,6-dimethyl-7-oxo-5,6,7,8-tetrahydropyrido[2,3-d]pyrimidine-2-yl)amino)benzenesulfonamide

[0674]

[0675] Step 1. 5-Bromo- N -Cyclopentyl-2-methoxypyrimidine-4-amine

[0676]

[0677] Cyclopentanamine (2.62 mL, 26.5 mmol) was added to a solution of 5-bromo-2,4-dichloropyrimidine (3.08 mL, 24.05 mmol) in THF (80 mL), and the reaction mixture was stirred at room temperature for 2 hours and subsequently filtered. The filtrate was concentrated, dissolved in sodium methoxide (21% w / w, 3 mL) in MeOH, and then heated under reflux for 2 hours. The mixture was diluted with water and ethyl acetate, and the layers were separated. The organic layer was washed with water and brine, dried over sodium sulfate, and concentrated. The residue was placed in Biotage Isolera. TM Purified by 0-50% ethyl acetate (in hexane), the desired product was provided as a white solid (4.7 g, 72%). C 10 H 15 BrN3O (M+H) + LCMS calculated for: m / z = 272.0 / 274.0; observed: 272.0 / 274.0.

[0678] Step 2. Ethyl 3-(4-(cyclopentylamino)-2-methoxypyrimidine-5-yl)propanoate

[0679]

[0680] 5-Bromo- NDMF (6 mL) was added to a mixture of cyclopentyl-2-methoxypyrimidine-4-amine (500 mg, 1.837 mmol), triethylamine (512 μL, 3.67 mmol), ethyl acrylate (300 μL, 2.76 mmol), and tetrakis(triphenylphosphine)palladium (0) (212 mg, 0.184 mmol), and the reaction flask was evacuated, refilled with nitrogen, and stirred overnight at 120 °C. The mixture was then poured into ethyl acetate / water, and the layers separated. The aqueous layer was extracted with ethyl acetate, and the collected organic material was washed with water and brine, dried over sodium sulfate, and concentrated. The raw product was purified by Biotage Isolera™ (0-100% ethyl acetate in hexane). The intermediate was dissolved in EtOH (6 mL), and carbonaceous palladium (10%, 391 mg, 0.367 mmol) was added. The reaction flask was evacuated and subsequently refilled with hydrogen gas from a balloon. The reaction mixture was stirred at room temperature for 3 hours, then diluted with ethyl acetate and filtered through a Celite plug. The filtrate was concentrated, and the raw product was used in the next step without further purification (340 mg, 63%). C 15 H 24 N3O3(M+H) + LCMS calculated for: m / z = 294.2; observed: 294.2.

[0681] Step 3. 8-cyclopentyl-2-methoxy-5,8-dihydropyrido[2,3- d ]Pyrimidine-7(6 H )-on

[0682]

[0683] Lithium hydroxide hydrate (1.073 g, 25.6 mmol) was added to a solution of ethyl 3-(4-(cyclopentylamino)-2-methoxypyrimidine-5-yl)propanoate (5.0 g, 17.04 mmol) in THF (28 mL) / water (28 mL), and the reaction mixture was stirred at room temperature for 30 minutes, then quenched with HCl (12 N, 2.13 mL, 25.6 mmol) and concentrated. The raw product was dissolved in DMF (4 mL) and HATU (7.13 g, 18.75 mmol), and Hunig base (5.95 mL, 34.1 mmol) was added. The reaction mixture was then stirred at room temperature for 2 hours, quenched with water, and extracted with ethyl acetate. The organic layer was washed with water and brine, dried over sodium sulfate, and concentrated. The raw product was purified with Biotage Isolera™ (20-100% ethyl acetate in hexane), providing the desired product (2.01 g, 48%). C 13 H 18 N3O2(M+H) + LCMS calculated for: m / z = 248.2; observed: 248.2.

[0684] Step 4. 8-cyclopentyl-2-methoxy-6,6-dimethyl-5,8-dihydropyrido[2,3- d ]Pyrimidine-7(6 H )-on

[0685]

[0686] 8-cyclopentyl-2-methoxy-5,8-dihydropyrido[2,3- in DMF (10 mL) d ]Pyrimidine-7(6 HMethyl iodide (380 μL, 6.08 mmol) and sodium hydride (60% from mineral oil, 284 mg, 7.09 mmol) were added to a solution of )-one (501 mg, 2.026 mmol), and the reaction mixture was heated to 65 °C for 2 hours. The mixture was quenched with water and extracted with ethyl acetate. The organic layer was washed with water and brine, dried over sodium sulfate, and concentrated. The raw residue was purified by Biotage Isolera™ (0-100% ethyl acetate in hexane), providing the desired product as a colorless oil (303 mg, 54%). C 15 H 22 N3O2(M+H) + LCMS calculated for: m / z = 276.2; observed: 276.2.

[0687] Step 5. 8-cyclopentyl-6,6-dimethyl-7-oxo-2,3,5,6,7,8-hexahydropyrido[2,3- d ]pyrimidine-2-yl trifluoromethanesulfonate

[0688]

[0689] 8-cyclopentyl-2-methoxy-6,6-dimethyl-5,8-dihydropyrido[2,3- in acetonitrile (2.4 mL) d ]Pyrimidine-7(6 HSodium iodide (143 mg, 0.952 mmol) and TMS-Cl (122 μL, 0.952 mmol) were added to a solution of )-on (131 mg, 0.476 mmol), and the reaction mixture was stirred overnight at room temperature, then quenched with water and extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium thiosulfate, water, and brine, dried over sodium sulfate, and concentrated. The raw product was dissolved in DCM (2.5 mL), and pyridine (42.3 μL, 0.523 mmol) was added. The reaction mixture was cooled to 0 °C, and trifluoromethanesulfonic acid anhydride (96 μL, 0.571 mmol) was added dropwise. The reaction mixture was then heated to room temperature and stirred for 2 hours, then quenched with saturated sodium bicarbonate and extracted with DCM. The organic layer was dried and concentrated over sodium sulfate. The raw product was used in the next step without further purification (141 mg, 75%). C 15 H 21 F3N3O4S (M+H) + LCMS calculated for: m / z = 396.2; observed: 396.2.

[0690] Step 6. 4-((8-cyclopentyl-6,6-dimethyl-7-oxo-5,6,7,8-tetrahydropyrido[2,3- d ]pyrimidine-2-yl)amino)benzenesulfonamide

[0691] 1,4-dioxane (508 μL) was added to a mixture of 8-cyclopentyl-6,6-dimethyl-7-oxo-5,6,7,8-tetrahydropyrido[2,3-d]pyrimidine-2-yl trifluoromethanesulfonate (20 mg, 0.051 mmol), 4-aminobenzenesulfonamide (17.51 ​​mg, 0.102 mmol), XantPhos Pd G2 (4.52 mg, 5.08 μmol), and potassium carbonate (70.3 mg, 0.508 mmol), and the reaction flask was evacuated, refilled with nitrogen, and then stirred at 100 °C for 2 hours. The mixture was subsequently diluted with MeOH and purified using pre-LCMS (XBridge C18 column eluted by a water gradient containing acetonitrile / 0.1% TFA at a flow rate of 60 mL / min). C 20 H 26 N5O3S (M+H) + LCMS calculated for: m / z = 416.2; observed: 416.2.

[0692] Example A2. 8-cyclopentyl-6,6-dimethyl-2-((1-(methylsulfonyl)piperidin-4-yl)amino)-5,8-dihydropyrido[2,3-d]pyrimidin-7(6H)-one

[0693]

[0694] These compounds utilize 1-(methylsulfonyl)piperidine-4-amine instead of 4-aminobenzenesulfonamide and RuPhos Pd G2 instead of XantPhos Pd G2, Example A1, Step 6 It was manufactured in a manner similar to C. 20 H 32 N5O3S (M+H) + LCMS calculated for: m / z = 422.2; observed: 422.2. 1 H NMR (600 MHz, DMSO) δ 8.01 (s, 1H), 5.44 - 5.22 (m, 1H), 3.85 (bs, 1H), 3.59 (d, J = 12.3 Hz, 1H), 2.9 (s, 3H), 2.85 (t, J= 12.2, 2.6 Hz, 1H), 2.60 (s, 2H), 2.05 (s, 1H), 1.98 (d, J = 16.3 Hz, 1H), 1.93 - 1.87 (m, 1H), 1.74 (s, 1H), 1.59 (m, 2H), 1.09 (s, 6H).

[0695] Example A3. 6,6-dimethyl-2-((1-(methylsulfonyl)piperidin-4-yl)amino)-8-phenyl-5,8-dihydropyrido[2,3-d]pyrimidin-7(6H)-one

[0696]

[0697] Step 1. Dimethyl 2,2-dimethylpentanedioate

[0698]

[0699] 3,3-dimethyldihydro-2 in methanol (100 mL) H -Evacuation-2,6(3 H Ten drops of concentrated sulfuric acid were added to a solution of )-dione (10 g, 70.3 mmol), and the reaction mixture was heated to 60 °C overnight. The mixture was subsequently concentrated. The residue was diluted with ethyl acetate, washed with saturated sodium bicarbonate and brine, and then dried and concentrated over sodium sulfate. The raw product was used in the next step without further purification.

[0700] Step 2. Methyl 3-(2-amino-6-oxo-1,6-dihydropyrimidine-5-yl)-2,2-dimethylpropanoate

[0701]

[0702] In a solution of diisopropylamine (5.32 mL, 37.4 mmol) in THF (12 mL) at -78 ℃ n-BuLi (2.5 M in hexane, 14.94 mL, 37.4 mmol) was added dropwise, and the reaction mixture was stirred at -78 °C for 1 hour. Subsequently, a solution of dimethyl 2,2-dimethylpentanedioate (5.86 g, 31.1 mmol) in THF (20 mL) was added dropwise, and the reaction mixture was stirred at -78 °C for an additional 1.5 hours. Methyl formate (2.88 mL, 46.7 mmol) was then added, and the reaction mixture was stirred at -78 °C for 1 hour, followed by quenching with saturated ammonium chloride. After heating to room temperature, the mixture was diluted with ethyl acetate / water, and the layers were separated. The organic layer was washed with water and brine, dried over sodium sulfate, and concentrated. The residue was dissolved in MeOH (10 mL), and guanidine carbonate (5.61 g, 31.1 mmol) was added. The reaction mixture was heated at 60 °C overnight, subsequently concentrated, and purified by Biotage Isolera™ (2-12% methanol in dichloromethane), providing the desired product as a white solid (2.45 g, 35%). C 10 H 16 N3O3(M+H) + LCMS calculated for: m / z = 226.2; observed: 226.2.

[0703] Step 3. Methyl 3-(4-chloro-2-((1-(methylsulfonyl)piperidine-4-yl)amino)pyrimidine-5-yl)-2,2-dimethylpropanoate

[0704]

[0705] Methyl 3-(2-amino-6-oxo-1,6-dihydropyrimidine-5-yl)-2,2-dimethylpropanoate (2.45 g, 10.88 mmol) was dissolved in POCl3 (10 mL) and heated to 100 °C overnight, then slowly added to saturated sodium bicarbonate. The mixture was extracted with DCM, and the organic layer was washed with saturated sodium bicarbonate and brine, dried over sodium sulfate, and concentrated. DMF (36.3 mL), 1-(methylsulfonyl)piperidin-4-one (2.506 g, 14.14 mmol), TFA (5.03 mL, 65.3 mmol), and sodium triacetoxybohydride (5.76 g, 27.2 mmol) were added to the intermediate, and the reaction mixture was stirred at room temperature for 5 hours, then quenched with saturated sodium bicarbonate and extracted with DCM. The organic layer was washed with water and brine, dried over sodium sulfate, and concentrated. The residue was purified by Biotage Isolera™ (2-12% methanol in DCM), providing the desired product as a yellow solid (2.2 g, 50%). C 16 H 26 ClN4O4S (M+H) + LCMS calculated for: m / z = 404.2 / 406.2; observed: 404.2 / 406.2.

[0706] Step 4. 6,6-dimethyl-2-((1-(methylsulfonyl)piperidine-4-yl)amino)-8-phenyl-5,8-dihydropyrido[2,3- d ]Pyrimidine-7(6 H )-on

[0707] 1,4-dioxane (519 μL) was added to a mixture of methyl 3-(4-chloro-2-((1-(methylsulfonyl)piperidin-4-yl)amino)pyrimidine-5-yl)-2,2-dimethylpropanoate (21 mg, 0.052 mmol), aniline (9.47 μL, 0.104 mmol), Ruphos Pd G2 (4.03 mg, 5.19 μmol), and cesium carbonate (50.7 mg, 0.156 mmol); the reaction flask was then evacuated, refilled with nitrogen, and stirred overnight at 100 °C. The reaction mixture was diluted with MeOH and purified using pre-LCMS (XBridge C18 column eluted with a water gradient containing acetonitrile / 0.1% TFA at a flow rate of 60 mL / min). C 21 H 28 N5O3S (M+H) + LCMS calculated for: m / z = 430.2; observed: 430.2.

[0708] Example A4. 8-(1,1-difluorobutane-2-yl)-6,6-dimethyl-2-((1-(methylsulfonyl)piperidine-4-yl)amino)-5,8-dihydropyrido[2,3- d ]Pyrimidine-7(6 H )-on

[0709]

[0710] These compounds utilize 1,1-difluorobutane-2-amine as a linking partner, Example A3, Step 4 It was manufactured in a manner similar to . The product was isolated as a racemic mixture. C 19 H 30 F2N5O3S (M+H) + LCMS calculated for: m / z = 446.2; observed: 446.2.

[0711] Example A5. 6,6-dimethyl-8-((1-methyl-1 H -pyrazol-5-yl)methyl)-2-((1-(methylsulfonyl)piperidine-4-yl)amino)-5,8-dihydropyrido[2,3- d ]Pyrimidine-7(6 H )-on

[0712]

[0713] These compounds are (1-methyl-1H -Using -pyrazol-5-yl)methaneamine as a linking partner, Example A3, Step 4 It was manufactured in a manner similar to C. 20 H 30 N7O3S (M+H) + LCMS calculated for: m / z = 448.2; observed: 448.2.

[0714] Example A6. 6,6-dimethyl-2-((1-(methylsulfonyl)piperidine-4-yl)amino)-8-(tetrahydrofuran-3-yl)-5,8-dihydropyrido[2,3- d ]Pyrimidine-7(6 H )-on

[0715]

[0716] These compounds utilize tetrahydrofuran-3-amine as a linking partner, Example A3, Step 4 It was manufactured in a manner similar to . The product was obtained in the form of a racemic mixture. C 19 H 30 N5O4S (M+H) + LCMS calculated for: m / z = 424.2; observed: 424.2.

[0717] Example B1. 7'-cyclopentyl-2'-((2-methyl-1-(methylsulfonyl)piperidin-4-yl)amino)spiro[cyclopropane-1,5'-pyrrolo[2,3-d]pyrimidine]-6'(7'H)-one

[0718]

[0719] Step 1. 5-Bromo-2-Chloro- N -Cyclopentylpyrimidine-4-amine

[0720]

[0721] Cyclopentanamine (9.56 mL, 97 mmol) was added to a solution of 5-bromo-2,4-dichloropyrimidine (20 g, 88 mmol) and Hunig base (22.99 mL, 132 mmol) in THF (219 mL), and the reaction mixture was stirred overnight at room temperature, then quenched with water and extracted with ethyl acetate. The organic layer was washed with water and brine, dried over sodium sulfate, and concentrated. The residue was purified by Biotage Isolera™ (0-40% ethyl acetate in hexane), providing the desired product as a yellow solid (21.1 g, 87%). C9H 12 BrClN3(M+H) + LCMS calculated for: m / z = 276.0 / 278.0; observed: 276.0 / 278.0.

[0722] Step 2. (2-( tert -butoxy-2-oxoethyl)zinc(II) bromide

[0723]

[0724] The zinc powder was washed in 2% HCl ...

Claims

Claim 1 A method for assessing the cyclin-dependent kinase inhibitor 2A (CDKN2A) gene and the cyclin E1 (CCNE1) gene, comprising the steps of: (i) determining the nucleotide sequence of the CDKN2A gene or the presence of the CDKN2A gene lacking one or more inactivated nucleic acid substitutions and / or deletions from a biological specimen obtained from a human individual suffering from a disease or disorder associated with cyclin-dependent kinase 2 (CDK2), and (ii) determining the copy number of the CCNE1 gene, wherein the disease or disorder is cancer. Claim 2 A method for measuring the level of retinoblastoma (Rb) protein phosphorylation in a sample, the method comprising: (a) providing a biological sample obtained from a human individual suffering from a disease or disorder associated with cyclin-dependent kinase 2 (CDK2), wherein said disease or disorder associated with CDK2 is cancer; and (b) measuring the level of Rb protein phosphorylation at a serine corresponding to amino acid position 780 of SEQ ID NO: 3 within the biological sample. Claim 3 In claim 2, the biological specimen comprises a blood specimen or a tumor biopsy specimen. Claim 4 In claim 1, (i) the cancer is a pulmonary squamous cell carcinoma, pulmonary adenocarcinoma, pancreatic adenocarcinoma, breast invasive carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, gastric adenocarcinoma, esophageal carcinoma, bladder urothelial carcinoma, mesothelioma, or sarcoma; (ii) the cancer is a pulmonary adenocarcinoma, breast invasive carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, or gastric adenocarcinoma; (iii) the cancer is an adenocarcinoma, carcinoma, or cystadenocarcinoma; (iv) the cancer is uterine cancer, ovarian cancer, gastric cancer, esophageal cancer, lung cancer, bladder cancer, pancreatic cancer, or breast cancer; (v) the cancer is ovarian cancer, uterine carcinosarcoma, or breast cancer; and (vi) the cancer comprises p27 inactivation; or (vii) the cancer is an N-myc-amplified neuroblastoma, a K-Ras mutant lung cancer, or a cancer having an FBW7 mutant and CCNE1 overexpression, method. Claim 5 In claim 2, (i) the cancer is a pulmonary squamous cell carcinoma, pulmonary adenocarcinoma, pancreatic adenocarcinoma, breast invasive carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, gastric adenocarcinoma, esophageal carcinoma, bladder urothelial carcinoma, mesothelioma, or sarcoma; (ii) the cancer is a pulmonary adenocarcinoma, breast invasive carcinoma, uterine carcinosarcoma, ovarian serous cystadenocarcinoma, or gastric adenocarcinoma; (iii) the cancer is an adenocarcinoma, carcinoma, or cystadenocarcinoma; (iv) the cancer is uterine cancer, ovarian cancer, gastric cancer, esophageal cancer, lung cancer, bladder cancer, pancreatic cancer, or breast cancer; (v) the cancer is ovarian cancer, uterine carcinosarcoma, or breast cancer; and (vi) the cancer comprises p27 inactivation; or (vii) the cancer is an N-myc-amplified neuroblastoma, a K-Ras mutant lung cancer, or a cancer having an FBW7 mutant and CCNE1 overexpression, method. Claim 6 delete Claim 7 delete Claim 8 delete Claim 9 delete Claim 10 delete Claim 11 delete Claim 12 delete Claim 13 delete Claim 14 delete Claim 15 delete Claim 16 delete Claim 17 delete Claim 18 delete Claim 19 delete Claim 20 delete Claim 21 delete Claim 22 delete Claim 23 delete Claim 24 delete Claim 25 delete Claim 26 delete Claim 27 delete Claim 28 delete Claim 29 delete Claim 30 delete Claim 31 delete Claim 32 delete Claim 33 delete Claim 34 delete Claim 35 delete Claim 36 delete Claim 37 delete Claim 38 delete Claim 39 delete Claim 40 delete Claim 41 delete Claim 42 delete Claim 43 delete Claim 44 delete Claim 45 delete Claim 46 delete Claim 47 delete Claim 48 delete Claim 49 delete Claim 50 delete Claim 51 delete Claim 52 delete Claim 53 delete Claim 54 delete Claim 55 delete Claim 56 delete

Images