A cell-based assay method for detecting or determining botulinum toxin activity using recombinant fluorescence proteins

Abstract

The present invention relates to a cell-based method for detecting or measuring the activity of botulinum toxin, and more specifically, to a recombinant cell in which a gene construct composed of a recombinant fluorescent protein coding sequence, a botulinum toxin recognition sequence, and a fluorescent protein expression inhibiting peptide coding sequence is introduced into the cell, and to the use thereof. According to the method of the present invention, botulinum toxin can be detected or its activity can be quantitatively analyzed through fluorescence measurement without using cell lines that are difficult to culture, such as stem cells.

Description

Technology Field

[0001] The present invention relates to a method for detecting or measuring the activity of cell-based botulinum toxin, and more specifically, to a recombinant cell in which a gene construct consisting of a recombinant fluorescent protein coding sequence, a botulinum toxin recognition sequence, and a fluorescent protein expression inhibiting peptide coding sequence is introduced into the cell, and to the use thereof. Background Technology

[0003] A generally accepted method for the detection of botulinum toxin (BoNT) present in food, clinical, or environmental samples is the mouse LD50. 50 It is a bioassay (mLD50). In particular, the pharmaceutical industry utilizes mLD50 as a standard analytical method to determine the activity of botulinum toxin used for aesthetic or medical purposes. However, since the verification of botulinum toxin activity using mLD50 is heavily influenced by the tester, testing institution, and facilities, it is currently difficult to quantify the biological efficacy of botulinum toxin accurately and reproducibly.

[0004] Accordingly, the ZEBET conference was held to minimize the number of animals used in experiments and their suffering, to standardize the determination of botulinum toxin activity—that is, the potency measurement method of botulinum toxin—and to encourage the development of alternative assays to mLD50 (Adler et al., ATLA Alternatives to Laboratory Animals, Vol. 38(4), pp. 315-330, 2010). Many laboratories and industries in various countries have embarked on various studies to develop cell-based potency assays (CBPAs) or cell-based bioassays (CBBs) that are satisfactory replacements for mLD50 in terms of specificity, sensitivity, and reproducibility. For the successful implementation of CBPAs or CBBs, (1) SNAP25 197It is required to obtain a monoclonal or polyclonal antibody specific to and (2) cells that exhibit high sensitivity to low concentrations (~pM) of botulinum toxin. In early 2004, Dr. Chapman and his colleagues invented a fluorescence reporter assay using botulinum toxin fused with two fluorescent proteins (Dong et al., PNAS Vol.101(41), pp. 14701-147062004), and BoCell TM It was named as an analytical method and commercialized (BioSentinel Inc).

[0005] As described above, as global efforts continue to develop CBPA to replace mLD50, it appears that animal-based analytical methods will ultimately be eliminated. The development of effective CBPA will enhance the competitiveness of botulinum toxin products by facilitating the expansion of their usability, improving quality control standards, and providing consumers with a higher level of trust.

[0006] BOTOX ® The manufacturer, Allergan, SNAP25 197 Human neuroblastoma SiMa cells, which are ideal host cells highly sensitive to botulinum toxin and a monoclonal antibody specific to [the substance], were successfully established (Fernandez-Salas et al., PLoS ONE 7(11): e49516, 2012). In 2010, Allergan developed a new CBPA assay using the aforementioned antibody and cells, and it was approved by the FDA as the first CBPA capable of replacing mLD50 (US8455213B2 and US2010 / 0204559A1). CBA-ELISA, developed in 2014 by Merz (Germany), another botulinum toxin manufacturer, is a differentiated neuronal cell fixation method ( in-situ It is characterized by using ) and penetrating the cell membrane to immunologically detect endogenous SNAP25.

[0007] Allergan's CBPA and Merz's CBA-ELISA at subpicomolar concentrations, equivalent to mouse-based analytical methods ( ie EC of <1.0U / well 50 It also exhibits excellent sensitivity. Allergan and Merz’s technology platforms detect SNAP25 under optimal conditions using a common commercial rabbit polyclonal antibody (Sigma S9684). Regarding cells, differentiated human neuroma cells SiMa are exclusively used in Allergan’s CBPA, whereas differentiated human induced pluripotent stem cells (hereinafter referred to as `iPS`) are used as standardized and optimized host cells in Merz’s CBA-ELISA.

[0008] However, the above-mentioned developed CBPAs use Western blotting analysis to SNAP25 197 and SNAP25 FL Since it determines the endogenous level, it is difficult to apply to high-throughput assays.

[0009] Under this technical background, the inventors of the present invention have made efforts to develop a cell-based analysis system capable of determining the activity of botulinum toxin regardless of the existing cell line. As a result, they confirmed that when botulinum toxin is treated in cells into which a gene construct consisting of a recombinant fluorescent protein, a botulinum toxin recognition sequence, and a fluorescent protein expression inhibitory peptide has been introduced, not only can the activity at concentrations below picomolar be detected as in existing analysis methods, but the activity can also be quantitatively analyzed, thereby completing the present invention. The problem to be solved

[0011] One objective of the present invention is to provide a recombinant cell for detecting botulinum toxin or measuring its activity using a fluorescence expression inhibitory peptide.

[0012] Another objective of the present invention is to provide a method for measuring the activity of botulinum toxin using the recombinant cells.

[0013] Another objective of the present invention is to provide a method for detecting or measuring the activity of botulinum toxin using the recombinant cells and a method for evaluating botulinum toxin inhibitors.

[0014] Another objective of the present invention is to provide a kit for detecting or measuring the activity of botulinum toxin. means of solving the problem

[0016] Specifically, the details are as follows. Meanwhile, each description and embodiment disclosed in the present invention may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in the present invention fall within the scope of the present invention. Furthermore, the scope of the present invention should not be considered limited by the specific descriptions provided below.

[0018] One aspect of the present invention relates to a recombinant cell for detecting or measuring the activity of botulinum toxin, into which a gene construct comprising a recombinant fluorescent protein coding sequence, a botulinum toxin recognition sequence, and a fluorescent expression inhibiting peptide coding sequence has been introduced.

[0019] The term “botulinum toxin” of the present invention refers to Clostridium botulinum ( Closrridium botulinumIt is a neurotoxic protein produced by bacteria. The genus Clostridium comprises over 127 species, classified according to their morphology and function. Clostridium botulinum, an anaerobic and Gram-positive bacterium, produces botulinum toxin, a potent polypeptide neurotoxin that causes botulism, a neuroparalytic disease, in humans and animals. Spores of Clostridium botulinum are found in soil and can be cultured in sealed food containers that are not properly sterilized; these factors are the cause of many cases of botulism. Symptoms of botulism typically appear 18 to 36 hours after consuming food contaminated with Clostridium botulinum cultures or spores. Botulinum toxin appears capable of penetrating the intestinal lining without reduced toxicity and exhibits a high affinity for cholinergic motor neurons. Symptoms of botulism can progress to gait disturbances, dysphagia, speech disorders, paralysis of respiratory muscles, and death. Botulinum toxin is used clinically for the treatment of neuromuscular disorders (i.e., movement disorders) characterized by hyperactive skeletal muscle.

[0020] In 1989, botulinum toxin type A complex was approved by the U.S. Food and Drug Administration for the treatment of essential blepharospasm, strabismus, and hemifacial spasm. Subsequently, botulinum toxin type A was also approved by the FDA for the treatment of cervical dystonia and glabellar lines, and botulinum toxin type B was also approved for the treatment of cervical dystonia. Botulinum toxin serotypes other than toxin type A appear to have lower efficacy and / or shorter duration of activity compared to botulinum toxin type A. The clinical effects of peripherally intramuscularly injected botulinum toxin type A usually appear within one week after injection. The typical duration of symptom relief from a single intramuscular injection of botulinum toxin type A is approximately three months on average, but therapeutic activity for significantly longer periods has been reported. Although all botulinum toxin serotypes appear to inhibit the release of the neurotransmitter acetylcholine at the neuromuscular junction, they act on different neurosecretory proteins and cleave these proteins at different sites. For example, botulinum types A and E both cleave the 25 kDa synaptosome-associated protein (SNAP-25), but target different amino acid sequences of this protein.

[0021] Botulinum toxin types B, D, F, and G act on vesicle-associated proteins (VAMP, synaptobrevin), and each chromosome type cleaves different sites of this protein.

[0022] Finally, botulinum toxin type C1 appears to cleave both syntactic acid and SNAP-25. These differences in mechanisms of action will affect the relative efficacy and / or duration of action of various botulinum toxin serotypes. In particular, botulinum toxin substrates can be found in several different cell types. Also in vitroIn studies, botulinum toxin was shown to inhibit potassium cation-induced release of acetylcholine and norepinephrine from primary cell cultures of brainstem tissue. Additionally, botulinum toxin has been reported to inhibit the induced release of glycine and glutamate from primary cultures of spinal cord neurons, and to inhibit the release of the neurotransmitters acetylcholine, dopamine, norepinephrine, CGRP, Substance P, and glutamate, respectively, in brain synaptosome specimens. Therefore, when used at appropriate concentrations, botulinum toxin inhibits the stimulus-induced release of most neurotransmitters.

[0023] In this invention, “toxin activity” refers to the mouse LD50, which is a standard testing method. 50 When measured by bioassay (mLD50), 1 unit of botulinum toxin exhibits a 50% lethality rate in rats weighing approximately 20g, which represents the inherent toxicity potency of the botulinum toxin. The above-mentioned botulinum toxin, particularly botulinum toxin serotype A, is manufactured and distributed in a frozen or vacuum-dried state, and the potency of the botulinum toxin may decrease due to the dilution process performed immediately before clinical application or the storage time of the diluted solution. Since it is difficult to achieve the expected effects of the botulinum toxin when its potency decreases in this manner, it is absolutely necessary to accurately predict the potency of the botulinum toxin.

[0024] In the present invention, the cell being recombined may be a prokaryotic cell, an animal cell, or a plant cell.

[0025] In the present invention, the prokaryotic cell is Escherichia coli, Rhizobium, Bifidobacterium, Rhodococcus, Candida, Erwinia, Enterobacter, Pasteurella, Mannheumia, Actinobacillus, Aggregatibacter, Xanthomonas, Vibrio, Pseudomonas, Azotobacter, Acinetobacter, Ralstonia, Agrobacterium, Rhizobium, Rhodobacter, Zymomonase, Bacillus, It may be selected from the group consisting of Staphylococcus, Lactococcus, Streptococcus, Lactobacillus, Clostridium, Corynebacterium, Streptomyces, Bifidobacterium, and Cyclobacterium, but is not limited thereto.

[0026] In the present invention, the animal cells may be derived from primary neurons, established neurons and human neurons, non-neuronal cells, neuroblastoma, spinal cord neuron, dosal root ganglion neuron, cerebral cortex neuron, cerebellar neuron, hippocampal neuron, or motor neuron, and more preferably may be selected from the group consisting of SiMa, N2042F clonal cell line, SH-SY5Y cell line, Neuro2A cell line, N1E-115 cell line, NG108-15 cell line, and SH-N-SH cell line, and may be selected from animal cancer cells used for general experimental research such as HeLa cell line, HEK293 cell line, A549 cell line, and U2OS cell line, but are not limited thereto.

[0027] In the present invention, any recombinant fluorescent protein that exhibits fluorescence through intracellular protein expression may be used without limitation, and any recombinant fluorescent protein capable of emitting light without affecting fluorescence expression may be used. Preferably, it may be selected from the group consisting of green fluorescent protein (GFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), and orange fluorescent protein (OFP), or recombinantly produced therefrom, but is not limited thereto.

[0028] In the present invention, the GFP may be AGFP (480, 505 nm), AzamiGreen (492, 505 nm), EGFP (484, 507 nm), Emeraid (487, 509 nm), GFP (475, 509 nm), GFP_uv (395, 509 nm), GFP_S65T (488, 510 nm), mWasabi (493, 509 nm), Stemmer (395, 509 nm), sfGFP (485, 510 nm), TagGFP (482, 505 nm), T-Sapphire (399, 511 nm), TurboGFP (482, 502 nm), or ZsGreen (493, 505 nm), but is not limited thereto, and the nm of each GFP represents the absorption wavelength and emission wavelength, respectively.

[0029] In the present invention, the BFP may be Azurite (384,459 nm), EBFP (383,445 nm), EBFP2 (383,448 nm), mTagBFP (399,456 nm) or Y66H (382,459 nm), but is not limited thereto, and the nm of each BFP represents the absorption wavelength and emission wavelength in order.

[0030] In the present invention, the CFP may be ECFP (439, 476 nm), AmCyanl (458, 489 nm), Cerulean (433, 475 nm), CyPet (435, 477 nm), mECFP (433, 475 nm), MidoriishiCyan (472, 495 nm), mTEP1 (462, 492 nm) or TagCFP (458, 480 nm), but is not limited thereto, and the nm of each CFP represents the absorption wavelength and emission wavelength in order.

[0031] In the present invention, the YFP may be EYFP (514,527 nm), mBanana (540,553 nm), mCitrine (516,529 nm), PhiYFP (525,537 nm), TagYFP (508,524 nm), Topaz (514,527 nm), Venus (515,528 nm), YPet (517,530 nm) or ZsYellow1 (529,539 nm), but is not limited thereto, and the nm of each YFP represents the absorption wavelength and emission wavelength in order.

[0032] In the present invention, the RFP may be AQ143 (595,655nm), AsRed2 (576,592nm), dKeima-Tandem (440,620nm), HcRed1 (588,618nm), tHcRed (590,637nm), JRed (584,610nm), mApple (568,592nm), mCherry (587,610nm), mPlum (590,637nm), mRaspberry (598,625nm), mRFP1 (584,607nm), mRuby (558,605nm), or mStrawberry (574,596nm), but is not limited thereto, and the nm of each REP represents the absorption wavelength and emission wavelength in order.

[0033] In the present invention, the OFP may be DsRed / RFP (558,583 nm), DsRed2 (563,582 nm), DsRed-Express (555,584 nm), DsRed-Monomer (556,586 nm), Tomato (554,581 nm), tdTomato (554,581 nm), Kusabira orange (548,559 nm), mKO2 (551,565 nm), mOrange (548,562 nm), mOrange2 (549,565 nm), mTangerine (568,585 nm), TagRFP (555,584 nm), or TagREP-T (555,584 nm), but is not limited thereto, and the nm of each OFP represents the absorption wavelength and emission wavelength in order.

[0034] In the present invention, the botulinum toxin recognition sequence refers to a sequence encoding a peptide that acts as a substrate for botulinum toxin and is degraded or cleaved by botulinum toxin. Preferably, it may be characterized by including an amino acid at the 197th position of the amino acid sequence represented by SEQ ID NO. 1 and including 6 to 56 adjacent amino acids, and in the case of the N-terminus, it may be characterized by including up to the 202nd amino acid, but is not limited thereto.

[0035] In the present invention, the botulinum toxin recognition sequence may be characterized by additionally including an amino acid at a position other than the amino acid at the 197th position and an adjacent amino acid of the amino acid sequence represented by SEQ ID NO. 1 and an adjacent amino acid.

[0036] The term “adjacent amino acids” above may mean that when six adjacent amino acids are included centered on the 197th position of the amino acid sequence represented by SEQ ID NO. 1, one amino acid is included towards the N-terminus and five amino acids are included towards the C-terminus, two amino acids are included towards the N-terminus and four amino acids are included towards the C-terminus, or three amino acids are included towards the N-terminus and three amino acids are included towards the C-terminus. For example, if 20 adjacent amino acids are included centered on the 197th position of the amino acid sequence represented by SEQ ID NO. 1, 1 amino acid may be included towards the N-terminus and 19 amino acids towards the C-terminus, 2 amino acids may be included towards the N-terminus and 18 amino acids towards the C-terminus, 3 amino acids may be included towards the N-terminus and 17 amino acids towards the C-terminus, 4 amino acids may be included towards the N-terminus and 16 amino acids towards the C-terminus, and 5 amino acids may be included towards the N-terminus and 15 amino acids towards the C-terminus.

[0037] Sequence No. 1 (SNAP25 full sequence):

[0038] MAEDADMRNELEEMQRRADQLADESLESTRRMLQLVEESKDAGIRTLVMLDEQGEQLDRVEEGMNHINQDMKEAEKNLKDLGKCCGLFICPCNKLKSSDAYKK AWGNNQDGVVASQPARVVDEREQMAISGGFIRRVTNDARENEMDENLEQVSGIIGNLRHMALDMGNEIDTQNRQIDRIMEKADSNKTRIDEANQRATKMLGSG

[0039] The botulinum toxin recognition sequence of the present invention may include a nucleic acid sequence encoding a SNARE protein, specifically a nucleic acid sequence encoding a part of a SNAP25 peptide, and more specifically a nucleic acid sequence represented by SEQ ID NO. 9, but is not limited thereto.

[0040] In the present invention, the fluorescence expression inhibiting peptide may be used without limitation as long as it is a peptide capable of quenching the recombinant fluorescent protein of the present invention. Preferably, it may be characterized as being a transmembrane domain (TMD) of influenza M2 or structurally structured as an α-helix to induce binding of identical domains, but is not limited thereto. Specifically, the fluorescence expression inhibiting peptide of the present invention may be a quencher peptide, and more specifically, may be a peptide expressed by the nucleic acid sequence indicated by SEQ ID NO. 10, but is not limited thereto.

[0041] In the present invention, the gene construct may be introduced using a cell-transportable peptide, a lipid gene carrier, or a combination thereof, or by a method of electroporation or magnetofection, and may also use a method known in the art.

[0042] The gene construct of the present invention may be characterized by including nucleic acid sequences represented by SEQ ID NOs 8 to 10, but is not limited thereto.

[0043] The gene construct of the present invention may be contained in a vector. The term "vector" in the present invention means a gene construct containing a gene sequence operably linked to a suitable regulatory sequence capable of expressing a gene within a suitable host. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. When transformed into a suitable host, the vector may replicate and function independently of the host genome, or in some cases, may be incorporated into the genome itself. Since plasmids are the most commonly used form of vector currently, "plasmid" and "vector" are sometimes used interchangeably in the specification of the present invention. However, the present invention includes other forms of vectors having equivalent functions known or to be known in the art.

[0044] To express the gene sequence of the present invention, any of the very diverse expression regulatory sequences may be used in the vector. Examples of useful expression regulatory sequences include early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, T3 and T7 promoters, the major operator and promoter regions of phage lambda, the regulatory regions of fd code proteins, promoters for 3-propoglycerate kinase or other glycolytic enzymes, promoters of the phosphatase, e.g., Pho5, promoters of the yeast alpha-mating system, and other sequences of configuration and induction known to regulate the expression of genes in prokaryotic or eukaryotic cells or viruses thereof, and various combinations thereof. The T7 RNA polymerase promoter Φ can be usefully used to express proteins in E. coli.

[0045] In the present invention, the term "expression vector" generally refers to a recombinant carrier into which a fragment of a heterogeneous gene is inserted, typically a double-stranded gene fragment. Here, a heterogeneous gene refers to a heterogene that is not naturally found in host cells. Once inside a host cell, the expression vector can replicate independently of the host chromosomal genes, and several copies of the vector and its inserted (heterogeneous) gene can be produced.

[0046] As is well known in the art, in order to increase the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression regulatory sequences that are functional within the selected expression host. Preferably, the expression regulatory sequences and the gene are contained within a single expression vector that includes both a bacterial selection marker and a replication origin. If the expression host is a eukaryotic cell, the expression vector must additionally include expression markers useful within the eukaryotic expression host.

[0047] Host cells transformed or transfected by the expression vector described above constitute another aspect of the present invention.

[0048] In the present invention, the term "transformation" refers to the introduction of a gene into a host so that the gene becomes replicable as an extrachromosomal factor or through the completion of chromosomal integration. The term "transfection" refers to the acceptance of an expression vector by a host cell, regardless of whether any coding sequence is actually expressed.

[0049] The host cell of the present invention may be a prokaryotic or eukaryotic cell. In addition, a host with high gene introduction efficiency and high expression efficiency of the introduced gene is typically used. Well-known eukaryotic and prokaryotic cells such as E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, and yeast are examples of host cells.

[0050] Of course, it must be understood that not all vectors and expression regulatory sequences function equally in expressing the gene sequence of the present invention. Likewise, it must be understood that not all hosts function equally. Likewise, not all hosts function equally in the same expression system. However, a person skilled in the art can make an appropriate selection among various vectors, expression regulatory sequences, and hosts without excessive experimental burden and without departing from the scope of the present invention. For example, when selecting a vector, the host must be considered, as the vector must be replicated within it. The copy number of the vector, the ability to control the copy number, and the expression of other proteins encoded by said vector, such as antibiotic markers, must also be considered. When selecting an expression regulatory sequence, various factors must also be considered. For example, the relative strength of the sequence, modulation capability, and compatibility with the gene sequence of the present invention, particularly in relation to potential secondary structures, must be taken into account. A unicellular host must be selected by considering factors such as the selected vector, the toxicity and secretion characteristics of the product encoded by the gene sequence of the present invention, the ability to accurately fold the protein, culture and fermentation requirements, and the ease of purifying the product encoded by the gene sequence of the present invention from the host.

[0051] In the present invention, botulinum toxin is Clotridium botulinum ( Clostridium botuliumAs a neurotoxic protein produced by ), it can be classified into a total of 7 serotypes: A, B, C (C1, C2), D, E, F, and G. The botulinum toxin acts on different neurosecretory proteins depending on the type of serotype and cleaves different sites. Specifically, botulinum toxin serotypes A and E both cleave SNAP25 (Synaptosomal nerve-associated protein 25), botulinum toxin serotypes B, D, F, and G cleave VAMP (Vesicle-associated membrane protein), and botulinum toxin serotype C1 causes neurotoxicity by cleaving Syntaxin and SNAP25.

[0052] In the present invention, the botulinum toxin recognition sequences for each longitudinal type are as shown in Table 1 below.

[0054] TYPE Sequence number Recognition sequence A 2 (SNAP25 protein) IMEKADSNKTRIDEANQ / RATKMLGSG B 3 (VAMP protein) LSELDDRADALQAGASQ / FETSAAKL C 2 (SNAP25 protein) IMEKADSNKTRIDEANQR / ATKMLGSG 4 (Syntaxin protein) EHAVDYVERAVSDTKK / AVKYQSKARRKKIM D 5 (VAMP protein) VNVDKVLERDQK / LSELDDRADALQAGASQFETSAAKL E 6 (SNAP25 protein) HMALDMGNEIDTQNRQIDR / IMEKADSNKTRIDEANQRATKMLGSG F 5 (VAMP protein) VNVDKVLERDQ / KLSELDDRADALQAGASQFETSAAKL G 7 (VAMP protein) DKVLERDQKLSELDDRADALQAGASQFESSA / AKLKRKYWW

[0056] In the amino acid sequence of Table 1 above, " / " indicates the site of action where botulinum toxin cleaves each longitudinal type.

[0057] In the present invention, the botulinum toxin may preferably be botulinum toxin serotype A, botulinum toxin serotype B, or botulinum toxin serotype E, and more preferably may be botulinum toxin serotype A, but is not limited thereto.

[0058] That is, a recombinant cell into which the gene construct of the present invention has been introduced can express a fusion protein in which a recombinant fluorescent protein, a botulinum toxin recognition peptide, and a fluorescence expression inhibitory peptide are sequentially linked. The expressed fusion protein may be characterized in that it does not exhibit fluorescence or color when botulinum toxin is not present, but exhibits fluorescence or color upon contact with botulinum toxin, as the botulinum toxin recognition peptide is cleaved and the fluorescent protein and the fluorescence expression inhibitory peptide are separated.

[0060] Another aspect of the present invention relates to a cell-based method for detecting or measuring the activity of botulinum toxin, comprising the steps of: culturing a recombinant cell of the present invention; treating the cultured recombinant cell with botulinum toxin; and measuring the intensity of fluorescence or the number of fluorescence-expressing cells in the recombinant cell treated with botulinum toxin.

[0061] Another aspect of the present invention relates to a method for evaluating a cell-based botulinum toxin inhibitor, comprising the steps of: culturing a recombinant cell of the present invention; treating the cultured recombinant cell with a botulinum toxin and a candidate inhibitor; and measuring the intensity of fluorescence or the number of fluorescence-expressing cells in the recombinant cell, and then determining the activity of the botulinum toxin by comparing it with a control.

[0062] In the present invention, the step of culturing recombinant cells can be carried out in a commonly used medium. For example, the medium that can be used in the present invention may be any medium commonly used for animal cell culture, e.g., Eagle's MEM (Eagle's Minimum Essential Medium, Eagle, H Science 130:432(1959)), α-MEM (Stanner, CP et al., Nat. New Biol. 230:52(1971)), Iscove's MEM (Iscove, N. et al., J Exp. Med. 147:923(1978)), 199 medium (Morgan et al., Proc Soc. Exp Bio Med., 73:1(1950)), CMRL 1066, RPMI 1640 (Moore et al., J. Amer. Med. Assoc. 199:519(1950)), F12 (Ham, Proc. Natl. Acad. Sci. USA 53:288(1965)), F10 (Ham, RG Exp. Cell Res. 29:515(1963)), DMEM (Dulbecco's Modification Eagle's Medium, Dulbecco, R. et al., Virology 8:396(1959)), a mixture of DMEM and F12 (Barnes, D. et al., Anal, Biochem. 102:255(1980)), Waymouth's MB752 / 1 (Waymouth, CJ Natl. Cancer Inst. 22:1003(1959)), McCoy's 5A (McCoy, TA, et al., Proc. Soc. Exp. Biol. Med. 100:115(1959)), and the MCDB series (Ham, RG et al., In Vitro 14:11(1978)) will be used. It is possible. For a description of the culture medium, see R. Ian Freshney, Culture of Animal Cells.A Manual of Basic Technique, Alan R. Liss, Inc., New York, is described in detail and is incorporated herein by reference.

[0064] Another aspect of the present invention relates to a kit for detecting or measuring the activity of botulinum toxin, comprising a probe comprising a fluorescent substance, a botulinum toxin recognition peptide, and a fluorescent expression inhibitor.

[0065] In the present invention, the fluorescent material may be one or more selected from the group consisting of FAM (6-carboxylfluorescein), HEX, Trxas red, JOE, CY5, CY3, and Alexa680, but is not limited thereto.

[0066] In the present invention, the botulinum toxin recognition peptide refers to a peptide expressed by the “botulinum toxin recognition sequence” of the present invention.

[0067] In the present invention, the fluorescence expression inhibitor may be TAMRA (6-carboxyltetramethyl-rhodamine), BHQ1, BHQ2, or Dabcyl, but is not limited thereto.

[0068] In the present invention, the probe may be a protein or chemical substance that comes into direct contact with the sample, but is not limited thereto.

[0069] In the present invention, the kit may take the form of a bottle, tub, sachet, envelope, tube, ampoule, etc., and may be formed partially or wholly from plastic, glass, paper, foil, wax, etc. The container may be fitted with a cap that is initially part of the container or may be attached to the container by mechanical, adhesive, or other means and may be fully or partially detachable. The container may also be fitted with a stopper that allows access to the contents by a syringe needle. The kit may include an outer package, and the outer package may include instructions for the use of the components.

[0070] In the present invention, the kit may be characterized in that when botulinum toxin is present in a sample, the botulinum toxin recognition peptide is degraded by the botulinum toxin, causing the fluorescent substance that was quenched to exhibit fluorescence.

[0071] In the present invention, the “specimen sample” includes various samples and, specifically, may be a sample collected from one or more of liquids, soil, air, food, waste, animal or plant intestines, and animal or plant tissues, but is not limited thereto. Specifically, the liquid may be characterized as water, blood, urine, tears, sweat, saliva, lymph, and cerebrospinal fluid, etc., and the water may include precipitation, seawater, lake water, and rainwater, etc., the waste may include sewage, wastewater, etc., and the animal or plant may include the human body. In addition, the animal or plant tissues may include tissues such as mucous membranes, skin, outer skin, hair, scales, eyeballs, tongues, cheeks, hooves, beaks, snouts, feet, hands, mouths, nipples, ears, and noses.

[0072] Meanwhile, when analyzing samples of mammalian or human origin, said samples may be derived from specific tissues or organs. Representative examples of tissues include connective tissue, skin, muscle, or nerve tissue. Representative examples of organs include the eye, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testis, ovary, uterus, rectum, nervous system, glands, and internal blood vessels. The biological samples to be analyzed include any cells, tissues, fluids, or any other medium that can be well analyzed by the present invention from biological sources, including samples obtained from human animals, or food prepared for human or animal consumption.

[0073] In addition, biological samples to be analyzed include body fluid samples, which include, but are not limited to, blood, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extracts (e.g., brain fragments), cerebrospinal fluid, appendix, spleen and tonsil tissue extracts. Effects of the invention

[0075] The present invention relates to a cell-based analysis system for determining botulinum toxin activity and a method for detecting botulinum toxin and measuring its activity using the same, which allows for the detection of botulinum toxin or the quantitative analysis of its activity through fluorescence measurement without using cell lines that are difficult to culture, such as stem cells. Brief explanation of the drawing

[0077] Figure 1 is a figure showing the results of performing gene sequence analysis and quantitative analysis using a vector containing the gene construct of the present invention. Figure 2 is the result of comparing the fluorescence expression levels of a cell into which the gene construct of the present invention was introduced and a control cell into which a general fluorescence expression gene construct was introduced. Figure 3 is the result of confirming the activity of botulinum toxin by treating cells into which the gene construct of the present invention has been introduced with botulinum toxin. Figure 4 shows the results of confirming the activity of botulinum toxin according to the concentration of culture medium serum (fetal bovine serum) in cells into which the gene construct of the present invention was introduced. Figure 5 is a figure illustrating an analysis process for verifying the efficacy evaluation of botulinum toxin using cells into which the gene construct of the present invention has been introduced. Figure 6 is the result of an analysis of the efficacy of botulinum toxin using cells into which the gene construct of the present invention has been introduced. Specific details for implementing the invention

[0078] In the present invention, we sought to determine whether the activity of botulinum toxin could be quantitatively measured using a cell line expressing a recombinant fusion protein that emits fluorescence when the quenched state of a recombinant fluorescent protein is released using the degradation effect of botulinum toxin.

[0079] Specifically, in one embodiment of the present invention, a gene construct encoding a recombinant fluorescent protein amino acid, a botulinum toxin A cleavage sequence of the SNAP25 protein, and a fluorescent protein expression inhibitory peptide sequence was prepared in a linear form as a vector insertable into cells, and then ligation was performed to recombine it into a circle form. Subsequently, whether the recombinant gene construct was ligated was confirmed by comparing it with a general fluorescent expression gene vector using a gene quantification method (see Fig. 1).

[0080] In another embodiment of the present invention, cells were heterogeneously transformed by injecting a gene construct encoding a general fluorescent protein expression sequence or a gene construct encoding a botulinum toxin A cleavage sequence of the recombinant fluorescent protein amino acid-SNAP25 protein and a fluorescent protein expression inhibitory peptide sequence. Subsequently, fluorescence expression was observed, and it was confirmed that fluorescence was expressed in cells injected with the gene construct encoding the general fluorescent protein expression sequence, whereas fluorescence expression was inhibited in cells injected with the gene construct encoding the botulinum toxin A cleavage sequence of the recombinant fluorescent protein amino acid-SNAP25 protein and a fluorescent protein expression inhibitory peptide sequence (see Fig. 2).

[0081] In another embodiment of the present invention, a gene construct encoding the botulinum toxin A cleavage sequence of the recombinant fluorescent protein amino acid-SNAP25 protein-fluorescent protein expression inhibitory peptide sequence was injected into cells to perform heterogeneous transformation, and then it was confirmed that the fluorescent expression that was inhibited within the cells was fluoresced when botulinum toxin was treated (see FIG. 3).

[0082] In another embodiment of the present invention, a gene construct encoding the botulinum toxin A cleavage sequence of the recombinant fluorescent protein amino acid-SNAP25 protein and the fluorescent protein expression inhibitory peptide sequence was injected into cells to perform heterogeneous transformation, and it was confirmed that fluorescence expression occurred in proportion to the activity of the botulinum toxin when treated with botulinum toxin. In addition, it was confirmed that fluorescence expression occurred in proportion to the activity of the botulinum toxin regardless of the serum concentration of the toxin treatment medium when treated with botulinum toxin (see Fig. 4).

[0083] In another embodiment of the present invention, an analysis process was established to confirm the efficacy evaluation of botulinum toxin through cells introduced with a gene construct encoding the botulinum toxin A cleavage sequence of the recombinant fluorescent protein amino acid-SNAP25 protein-fluorescent protein expression inhibitory peptide sequence (see Fig. 5). The results of analyzing the amount of fluorescence expression according to this analysis process are shown in Fig. 6.

[0085] The present invention will be described in more detail below through examples. These examples are intended solely to illustrate the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0087] Example 1. Preparation of Gene Construct

[0088] A plasmid of a gene construct containing the sequences in Table 2 below was constructed.

[0090] Sequence number name order 8 EGFP ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC CCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCC TGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTC GCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG 9 BoNT / A GATGAGGCCAACCAACGTGCAACAAAAGATG 10 Quencher TGCAATGATTCGTCAGACCCTCTGGTCGTGGCTGCCTCCATTATTGGTATTCTGCACCTGATCCTGTGGATTCTGGATCGTCTG

[0092] After synthesizing a gene with the sequence of recombinant fluorescent protein amino acid - botulinum toxin A cleavage sequence of SNAP25 protein - fluorescent protein expression inhibitory peptide sequence, sub-cloning was performed using a multi-cloning site (MCS). Subsequently, gene sequencing and gene quantification were performed using the constructed vector to confirm that the desired sequence had been inserted (Fig. 1).

[0093] The specific method is as follows.

[0094] Preparation of Bacterial Lysogenic Research Medium (LB) (per 1 liter (L): Place 25 grams (g) of the bacterial lysogenic research medium reagent and 1 liter of distilled water into a 2L glass bottle. Insert a magnetic stirrer and dissolve completely using a magnetic stirrer. Remove the magnetic stirrer and sterilize in an autoclave at 121°C for 15 minutes with the lid slightly ajar. After cooling the sterilized medium, portion it out and store it in the refrigerator. (Abandon the medium to room temperature before use.)

[0095] Preparation of Agar Plates for Bacterial Lysogenicity (LB) (Based on 1L): Add 25g of the bacterial lysogenicity reagent and 12g of agar to 1L of distilled water in a 2L glass bottle, cover with a lid, and sterilize in an autoclave at 121°C for 15 minutes. Add 25g of the bacterial lysogenicity reagent and 12g of agar to 1L of distilled water in a 2L glass bottle, insert a magnetic stirrer, and dissolve completely using a magnetic stirrer. Remove the magnetic stirrer, leave the lid slightly ajar, and sterilize in an autoclave at 121°C for 15 minutes. Once the sterilized medium has cooled to a warm temperature, add 1 mL of a 100 mg / mL ampicillin antibiotic solution to the sterilized medium and mix well. Add 20 mL of the medium mixed with the antibiotic ampicillin to each bacterial Petri dish and leave at room temperature until completely solidified. Once the agar plates for bacterial lysogenicity (LB) have completely solidified, place them upside down in a 37°C incubator to dry out moisture for 8 to 10 hours, then seal with Parafilm and refrigerate (place the plates in a 37°C incubator for at least 30 minutes prior to use).

[0096] Preparation of 0.1 molar concentration (M) calcium chloride: Put 1.11g of calcium chloride into a 200mL glass bottle, add 100mL of distilled water and mix, then sterilize in an autoclave at 121℃ for 15 minutes with the lid slightly open, and once cooled, close the lid and store in the refrigerator.

[0097] Preparation of 50 percent concentration (%) glycerol: Add 25 mL of glycerol and 25 mL of distilled water to a 100 mL glass bottle and mix. Then, sterilize in an autoclave at 121°C for 15 minutes with the lid slightly ajar. Once cooled, close the lid and store in the refrigerator.

[0098] Preparation of competent cell concentrate: Remove competent cells from -80°C and thaw them on ice for 5-10 minutes. Add 50 to 100 μL of the thawed competent cells to a 50 mL conical tube containing 10 mL of antibiotic-free bacterial lysogenic research medium, mix well, then slightly open the lid and incubate in a 37°C shaking incubator for at least 16 hours. After 16 hours of incubation, when the culture medium becomes cloudy, add 1 mL of the culture medium to a 250 mL Erlenmeyer flask containing 100 mL of pre-sterilized bacterial lysogenic research medium and incubate in a 37°C shaking incubator for 2 hours. After 2 hours, take 100 μL of the culture medium and measure bacterial cell concentration (OD600). At this time, the appropriate optical density (OD) value is 0.4 to 0.6 (if it is 0.4 or lower, measure it again every 30 minutes to 1 hour and culture until the optical density (OD) value reaches 0.4 to 0.6). Once the optical density (OD) meets the criteria, leave the culture medium on ice for 10 minutes. After 10 minutes, dispense 50 mL of the culture medium into pre-chilled and sterilized 5 mL conical tubes and centrifuge at 5,000 revolutions per minute (rpm) for 10 minutes. Discard the supernatant of the centrifuged culture medium, add 20 mL of cold 0.1 mol (M) calcium chloride, gently loosen the bacterial cells, leave on ice for 15 minutes, dispense the medium, and centrifuge at 5,000 revolutions per minute for 10 minutes. Discard the supernatant of the centrifuged culture medium, add 4 mL of cold 0.1 M calcium chloride, gently loosen the bacterial cells, and leave them on ice for 30 minutes. While the bacterial cells are left on ice for 30 minutes, dispense 100 μL of cold 50% glycerol into sterile microtubes kept cold on ice and refrigerate (perform under the coldest possible conditions). After 30 minutes, thoroughly mix the bacterial cells contained in 4 mL into the sterile e-tubes that were previously dispensed with 100 μL of 50% glycerol, dispense 100 μL into each tube, close the lids, and place them in liquid nitrogen.After dispensing all the bacterial cells, discard the liquid nitrogen and store the frozen bacterial cell concentrate at -80℃ for use when needed (when using, place it on ice to thaw).

[0099] Preparation of 1 molar concentration trisaminomethane (hydrogen ion concentration index pH 7.5): Place 12.11g of trisaminomethane in a beaker and dissolve it in 70mL of distilled water, then add hydrochloric acid to adjust the hydrogen ion concentration index pH to 7.5, make the final volume 100mL, filter, and store in the refrigerator.

[0100] Preparation of 1 molar concentration magnesium chloride: Put 2.03g of magnesium chloride into a 50mL Conicat tube, add 10mL of distilled water to dissolve it, filter, and store in the refrigerator.

[0101] Preparation of 0.5 molar concentration dithiothreitol: Place 0.7712g of dithiothreitol into a 50mL conical tube, dissolve it in 10mL of distilled water, filter, and store in the refrigerator.

[0102] Preparation of 5x T5 Exonuclease-Dependent Mixed Buffer Solution (1 mL): In a 1.5 mL conical tube, add 500 μL of 1 molar trisaminomethane (pH 7.5), 50 μL of 1 M magnesium chloride, and 100 μL of 0.5 M dithiothreitol. Add 0.25 g of polyethylene glycol 8000 and heat to completely dissolve. Place the completely dissolved solution on ice and add 350 μL of distilled water to make the final volume 1 mL. Add 1 μL of T5 exonuclease (final concentration unit per 10 mL (U / mL)), mix well, then aliquot the concentrated solution into 100 μL aliquots and store at -80°C for use as needed (keep on ice to thaw before use).

[0103] Method for preparing polymerase chain reaction products: Primers (forward and reverse) are prepared as picomolar concentration solutions (pmole / μL) per 100 microliters by adding distilled water. Each primer at 100 pmole / μL is diluted 10-fold with distilled water to create a 10 pmole / μL concentrated solution. The final volume of the template is diluted with distilled water to a nanogram concentration solution (ng / μL) per 1 microliter to make 5μL. 13μL of distilled water is added to a microtube containing 20μL of the polymerase chain reaction reagent mixture. 1μL each of the 10 pmole / μL concentrated primers (forward and reverse) is added to the polymerase chain reaction reagent mixture tube containing the distilled water. Add 5 μL of template diluted with a concentrated solution at a concentration of 1 ng / μL, tap the polymerase chain reaction mixture tube with your finger, and then settle the solution using a small centrifuge before placing it in the polymerase chain reaction apparatus. Make the final sample volume 20 μL and perform the polymerase chain reaction under the circulation conditions of the polymerase chain reaction reagent mixture as shown in Table 3 below.

[0105] step temperature Reaction time Number of cycles Transformation 95℃ 5 minutes 1 denaturalization 95℃ 30 seconds 30~35 Primer binding 55℃ 30 seconds renal response 72℃ For cases of 1,000 base pairs or less per minute Final renal response 72℃ 5 minutes 1 maintain 4℃ infinity infinity

[0107] Method for preparing the linear form of the pcDNA 3.1 vector: 700 to 800 nanograms (ng) of the circular form of the pcDNA 3.1 vector are placed in a sterile micropolymerase chain reaction tube. The mixture to be reacted is prepared as shown in Table 4 below.

[0109] Sample volume microliter (μl) PCDDNA 3.1 Vector (1000 nanograms (ng)) 0.8 10x Concentrated Quickcut Solution (Quickcut Buffer) 3 Nhe I (restriction enzyme) 1 Kpn I (restriction enzyme) 1 distilled water 24.2 Final volume 30

[0111] Add a final volume of 30 μL of the sample, mix well with a pipette, and allow the solution to settle using a centrifuge. React in a 37°C incubator for 15 minutes. Purify the cleaved vector reacted for 15 minutes using the DokdoPrep Gel / Polymerase Chain Reaction Purification Kit by proceeding in the following order.

[0112] Place 30 μL of the cleaved vector into a sterile microtube, add 150 microliters of polymerase chain reaction (PCR) binding solution, mix by gently tapping with a finger, and allow the solution to settle using a centrifuge (the ratio of the cleaved vector sample to the PCR binding solution is 1:5). Place 180 μL of the mixture into a spin column and centrifuge at 13,000 RPM for 1 minute at room temperature. Discard the pass-through collected in the spin column's recovery tube and re-insert the spin column into the recovery tube. Add 750 μL of the wash solution and centrifuge at 13,000 RPM for 1 minute at room temperature. Discard the pass-through collected in the spin column's recovery tube, re-insert the spin column into the recovery tube, and centrifuge at over 13,000 RPM for 1 minute at room temperature to remove the remaining wash solution. Insert a spin column into a sterile microtube, add 15-20 μL of distilled water, and leave at room temperature for 1 minute. After 1 minute, centrifuge at a speed of 13,000 revolutions per minute or higher for 1 minute to obtain a purified vector, and check the concentration with a nanodrop.

[0113] Cloning-Gibson Assembly Test Method (Standard Test Method): In a sterile micropolymerase chain reaction tube, react the linear cleaved vector, gene, and green fluorescent protein at a concentration ratio of 1:3:3, with a final sample volume of 20 μL, and add the reaction reagents as follows (at this time, use 5 times the T5 exonuclease-dependent mixed buffer solution, removed from -80°C and thawed on ice). Prepare the Gibson assembly reaction mixture as follows.

[0115] Sample volume microliter (μl) 5 times T5 exonuclease-dependent mixed buffer solution 4 PCDDNA 3.1 Vector (100 ng)(8.15 pM (1x), 27.34 ng / ml 3.66 Green fluorescent protein (24.45 pM (3x)) 1 Snap25 gene (24.45 pM (3x)) 1 distilled water 10.34 Final volume 20

[0117] Add the ingredients in the order of distilled water > green fluorescent protein > gene > vector > 5x buffer solution, mix gently with a pipette, and allow the solution to settle using a centrifuge. React in a polymerase chain reaction apparatus at 37°C for 40 minutes.

[0118] Transformation: Ten minutes before the Gibson Assembly reaction is complete, remove the bacterial cells from -80°C and thaw them on ice. After the reaction is finished, add 2 μL of the vector gene reacted with the Gibson Assembly to 200 μL of the thawed bacterial cells, mix with a pipette, centrifuge to settle the solution, and leave it on ice for 10 minutes. After 10 minutes, place it on a 42°C heating block for 1 minute and 30 seconds, then leave it on ice again for 5 minutes. After 5 minutes, add 800 μL of antibiotic-free bacterial lysogenic research medium to the 200 μL solution and incubate in a 37°C shaking incubator for 1 hour. After 1 hour, place the culture medium in a centrifuge and settle the solution at 5,000 RPM for 3 minutes. Discard 800 μL of the supernatant from the culture medium where the pellet has settled, and gently loosen the pellet with the remaining 200 μL. Add 200 μL of culture medium to an agar plate for studying bacterial lysogenicity containing the antibiotic ampicillin, spread it using a spreader, place the plate upside down in a 37°C incubator, and incubate for 16 hours. After 16 hours, check for colonies on the plate, seal the plate, and store it at 4°C.

[0119] Recombinant Vector Gene Culture and Purification: After confirming the colony, prepare antibiotic-containing bacterial lysogenic research medium by adding 5 μL of 100 mg / mL ampicillin antibiotic (micrograms per 100 ml for final concentration) to 10 mL of antibiotic-free bacterial lysogenic research medium. Add 5 mL of antibiotic-containing bacterial lysogenic research medium to a 14 mL round-bottom tube, pick up a single colony from the plated plate with a tip, add it to the medium, and mix with a pipette. Loosely close the lid of the medium tube inoculated with the colony and incubate in a 37°C shaking incubator for 16 hours. After 16 hours of incubation, completely close the lid of the 14 mL round-bottom tube and centrifuge at 5,000 rpm for 10 minutes. Purify the plasmid according to the test method of the Plasmid Mini Prep Kit. Refrigerated cell resuspension solution (Sol I) based on a 5 mL culture (+ addition of RNA A solution). Add 250 μL, gently mix the pellet with a pipette, and transfer it to a sterile microtube. Add 250 μL of cell lysis solution (Sol II) to the microtube, gently invert the tube 5 to 6 times, and then centrifuge to allow the solution to settle. Add 350 μL of neutralization solution (Sol III) to the settled tube, gently invert the tube 5 to 6 times, and then centrifuge at 13,000 RPM for 10 minutes to allow the solution to settle. After centrifugation, transfer only the supernatant to a spin column and centrifuge at 13,000 RPM for 1 minute. Discard the pass-through liquid in the recovery tube, reinsert it, add 75 μL of washing solution, and centrifuge at 13,000 RPM for 1 minute. Discard the pass-through liquid in the recovery tube, reinsert it, and centrifuge at 13,000 RPM for 1 minute to remove residues. Centrifuge. Transfer only the spin column to a sterilized microtube, open the column lid for 30 seconds to evaporate the ethanol, then add 25-30 μL of distilled water to the center of the spin column and leave it at room temperature for 1 minute.After 1 minute, add the sample and centrifuge at >13,000 RPM for 1 minute to recover the plasmid, and measure the concentration using NanoDrop. Transfer a portion of the recovered plasmid into a sterile microtube and verify the sequence information through sequencing analysis.

[0120] The method for producing genetically modified cell lines is as follows.

[0121] Preparation of cell culture medium: Add 50 mL of 10% fetal bovine serum (FBS) and 5 mL of 1% penicillin antibiotic to 500 mL of cell culture medium (MEM and DMEM) used for cell culture in a biosafety cabinet, close the lid, mix well, seal the lid with Parafilm, and store in a refrigerator at 4°C (use within one month of preparation and warm in a 37°C water bath before use).

[0122] Preparation of cell culture medium for transgenic purposes: Add 25 mL of 5% fetal bovine serum to 500 mL of Opti-MEM in a biosafety cabinet, mix well, seal the lid with Parafilm, and store in a refrigerator at 4°C (use within one month of preparation and warm in a 37°C water bath before use).

[0123] Preparation of extracellular matrix protein (fibronectin) coated plates: In a biosafety cabinet, dilute a 1 mg / ml solution of extracellular matrix protein with triple-distilled water at a 1:50 ratio, add 800 μL to each of six well plates, and leave at room temperature for one hour. After one hour, shake off the extracellular matrix protein solution, add 4 mL of phosphate-buffered saline to wash, and repeat the process of washing and discarding twice. Then, shake off the excess water with a towel and dry at room temperature for at least 45 minutes.

[0124] Preparation of culture medium for screening transformed cell lines: In a biosafety cabinet, add 50 mL of 10% fetal bovine serum to 500 mL of cell culture medium (MEM and DMEM) and 5 mL of 1% penicillin antibiotic. Add 5 mL of Geneticin (G418), an antibiotic resistant to the transformed plasmid, mix well, seal the lid with Parafilm, and store in a refrigerator at 4°C (use within one month of preparation and warm in a 37°C water bath before use).

[0125] Cell Thawing and Cell Culture: Rapidly thaw each frozen normal cell (HEK293, HEK293T, U2OS) in a water bath, then add 7 mL of warmed prepared cell culture medium to 25 cm of the thawed cell culture medium. 2 Place in a flask and culture in an incubator with 5% carbon dioxide at 37°C. After thawing the cells, check the growth status for 1-2 days, and when the cell density reaches 70–80%, check the 25 cm area where the cells are attached. 2 Remove all the cell culture medium from the flask using a pipette. The 25cm flask from which the cell culture medium has been removed 2 Slowly add 5 mL of phosphate-buffered saline to the flask, wash the cell culture medium from the surface where cells are attached, and remove it with a pipette. Then, add 1 mL of protease solution and incubate in a 5% carbon dioxide incubator at 37°C for 3–5 minutes. Remove the flask from the incubator, gently tap the side, and check under a microscope to ensure all attached cells have detached. Then, add 5 mL of the prepared cell culture medium and transfer the cell culture medium containing the cells to a 15 mL conical tube. 75 cm 2Add 12 mL of cell culture medium to the flask, add 2 mL of cell culture medium containing cells, close the flask lid to spread the medium evenly across the bottom, and incubate for 2-3 days in an incubator at 37°C with 5% carbon dioxide (the ratio can be adjusted from 1:2 to 1:5 depending on the cell growth rate, and it is recommended to use the cells for cell experiments after subculturing them at least twice for a minimum of 7 days after thawing).

[0127] Example 2: Production of Heterogeneous Transformed Cell Lines

[0128] Prepare a 6-well plate for culturing transgenic cells by encoding it with extracellular matrix proteins and drying it.

[0129] Preparation of Gene Sample for Transformation (Based on a 1-well plate): Place the gene and pre-OptimEM sample into sterile microtube 1 and react at room temperature for 5 minutes. Place Lipofectamine 3000 and pre-OptimEM sample into sterile microtube 2 and react at room temperature for 5 minutes. After the reaction in tube 2 is complete, add 125 μL of the solution from tube 2 into a sterile microtube, add 125 μL from tube 1, gently tap with a finger, allow the solution to settle using a centrifuge, and react at room temperature for 20 minutes. While the transformation sample mixture is reacting, the density of normal cells cultured in an incubator is 75 cm² 2When the flask reaches 80-90% capacity, slowly add 5 mL of phosphate-buffered saline, wash the cell culture medium on the surface where cells are attached, and remove it with a pipette. Then, add 1 mL of protease solution and incubate in a 5% carbon dioxide incubator at 37°C for 3-5 minutes. Remove the flask from the incubator, gently tap the side, and check under a microscope whether all attached cells have detached. Then, add 5 mL of the prepared transformation medium, Opti-MEM, and transfer the cell culture medium containing the cells to a 15 mL conical tube using a pipette. Mix 6 mL of Opti-MEM containing the cells thoroughly with a pipette, and add 100 μL to a sterile microtube. Add 100 μL of trypan blue stain to the microtube containing the cells in a 1:1 ratio and mix well. Then, add 10 μL to the groove between the hemocytometer and the glass cap, and count the number of cells under a microscope. After checking the cell count, place 1.0 x 10⁶ in a 1-well plate 6 Prepare to allow cells to attach. After the reaction of the transformed sample mixture is complete after 20 minutes, place 250 μL of the sample into a single well plate and 1.0 x 10⁶ 6Add 1750 μL of 5% Opti-MEM calculated based on the number of cells, spreading it evenly to a final volume of 2 mL on the plate, and incubate for 24–48 hours in a 5% CO2 incubator at 37°C (transformation time varies depending on the cell type). 16 hours after the transformation reaction, slowly remove the medium containing the transformed sample mixture from the 6-well plate using a pipette. To select only cells with the inserted gene vector, slowly add 2 mL of transformed cell line selection medium containing 0.1 mg / mL of the antibiotic Geneticin to each well plate, and incubate for 24–48 hours in a 5% CO2 incubator at 37°C (transformation time varies depending on the cell type). After culturing, select the transformed cells and, to remove dead cells, slowly pipette away the culture medium from the 6-well plate. Then, slowly add 2 mL of fresh transformed cell line selection medium and incubate in a 5% CO2 incubator at 37°C for 2–4 days (incubation time varies depending on the cell type). Next, when the density of transformed cells in the 6-well plate reaches 90% or higher, pipette away the medium from the well plates. Slowly add 1 mL of phosphate-buffered saline, wash the cell culture medium from the surface where cells are attached, add 1 mL of protease solution, and leave in a 5% CO2 incubator at 37°C for 3–5 minutes. Remove the flask, gently tap the side, and check under a microscope to ensure all attached cells have detached. Then, add 3 mL of transformed cell line selection medium and pipette to dilute the cells in the well plate. 75 cm 2Add 12 mL of cell culture medium to the flask, add 3 mL of cell culture medium from the well plate containing the cells, close the flask lid to spread the medium evenly across the bottom, and incubate for 2-3 days in a 5% carbon dioxide incubator at 37°C (the ratio can be adjusted from 1:2 to 1:5 depending on the cell growth rate). Confirm the fluorescence expression of the fluorescent gene insertion cell line or the recombinant fluorescent gene insertion cell line using an image analysis device (Fig. 2).

[0131] Example 3. Confirmation of Botulinum Toxin Activity at Different Fetal Bovine Serum Concentrations in Heterogeneous Transformed Cell Lines

[0132] In a biosafety cabinet, prepare cell culture media (MEM, DMEM) with a final volume of 50 mL for each fetal bovine serum concentration as shown in Table 6 below.

[0134] Fetal bovine serum concentration (%) Serum volume (mL) Cell culture medium (mL) (No antibiotics) 20 10 50 15 7.5 50 10 5 50 5 2.5 50 1 1 50 0 0 50

[0136] 75cm 2When the density of the prepared heterogeneous transformed cell lines cultured in two flasks reaches 80–90%, slowly add 5 mL of phosphate-buffered physiological saline to each flask. Wash the cell culture medium from the surface where cells are attached, remove it with a pipette, add 1 mL of protease solution, and incubate in a 5% carbon dioxide incubator at 37°C for 3–5 minutes. Remove the flasks from the incubator, gently tap the sides, and check under a microscope whether all attached cells have detached. Add 5 mL of the cell culture medium to each flask, transfer it to a 50 mL conical tube using a pipette, and centrifuge at 1500 rpm for 3 minutes. Remove only the supernatant from the centrifuged 15 mL conical tube using a pipette, gently tap with a finger to loosen it, and then add 5 mL of 10% fetal bovine serum cell culture medium to each tube to thoroughly loosen the pellet. Thoroughly mix 5 mL of cell culture medium containing cells at various fetal bovine serum concentrations using a pipette, then add 100 μL to a sterile microtube. Add 100 μL of trypan blue stain at a 1:1 ratio to the microtube containing the cells and mix well; then add 10 μL to the groove between the hemocytometer and the glass cap, and count the cell count under a microscope. After confirming the cell count in the culture medium for the selection of the transformed cell line containing cells, dilute the prepared cell culture medium at 20, 15, 10, 5, or 1 percent and place 8 x 10⁶ in a single well of a 96-well circular plate with a final volume of 90 μL. 3 Prepare 1 mL aliquots so that the cells can attach. Prepare serial concentration samples of botulinum toxin to be treated with the cells as shown in Table 7 below, with a final volume of 300 μL.

[0138] number density (μg / mL) stock solution to be serially diluted Botulinum toxin type A (μL) Cell culture medium (μL) at different fetal bovine serum concentrations Final volume (μL) 1 1000 - - - - 2 1 No. 1 concentrate 0.3 299.7 300 3 0.33 No. 2 concentrate 100 200 300 4 0.11 No. 3 concentrate 100 200 300 5 0.037 No. 4 concentrate 100 200 300 6 0.012 No. 5 concentrate 300 7 0 - 0 300 300

[0140] 10 μL of each concentration of the diluted botulinum toxin sample prepared in 96-well plates was dispensed into 2-well plates, and an additional 90 μL of cell culture medium containing the prepared cells at different concentrations of fetal bovine serum was dispensed into each well plate. The cells were then incubated in a 5% carbon dioxide incubator at 37°C for 48 hours, and the fluorescence expression upon treatment with botulinum toxin in recombinant gene cell lines and the effect of fetal bovine serum concentration were confirmed through fluorescence microscopy by the amount of fluorescence expression (Figs. 3 and 4).

[0142] Example 4. Expression analysis to confirm the evaluation of botulinum toxin efficacy in heterogeneous modified cell lines

[0143] 75cm from the biosafety cabinet 2 When the density of the prepared heterogeneous transformed cell lines being cultured in two flasks reaches 80–90%, slowly add 5 mL of phosphate-buffered physiological saline to each flask and wash the cell culture medium on the surface where cells are attached. Then, add 1 mL of protease solution and incubate in a 5% carbon dioxide incubator at 37°C for 3–5 minutes. Remove the flasks from the incubator, gently tap the sides, and check under a microscope whether all attached cells have detached. Then, add 5 mL to each flask, transfer the cell culture medium containing the cells from the flasks to a 50 mL conical tube using a pipette, and centrifuge at 1500 rpm for 3 minutes. Remove only the supernatant from the centrifuged 15 mL conical tube using a pipette, gently tap with a finger to loosen it, and then add 5 mL of 10% fetal bovine serum cell culture medium to each tube to thoroughly loosen the pellet. Thoroughly mix 5 mL of cell culture medium containing cells, then add 100 μL to a sterile microtube. Add 100 μL of trypan blue stain to the microtube containing cells in a 1:1 ratio and mix well; then, add 10 μL to the groove between the hemocytometer and the glass cap, and count the cell count under a microscope. After confirming the cell count in the cell culture medium, place 1.8 x 10⁶ cells in a single well of a 96-well circular plate with a final volume of 100 μL. 4Prepare a solution in 10 mL by diluting it with cell culture medium so that cells can attach. Prepare a series of concentration samples of botulinum toxin to be treated with the cells as shown in Table 7 above, with a final volume of 300 μL.

[0145] 10 μL of each of the previously prepared diluted botulinum toxin samples at each concentration was dispensed into two well plates of 96 well plates, and an additional 90 μL of cell culture medium at each concentration of fetal bovine serum was dispensed. The samples were then reacted in a 5% carbon dioxide incubator at 37°C for 48 hours, and the expression levels for evaluating the efficacy of botulinum toxin were confirmed using a fluorescence microscope and analyzed as in the analysis process (Figs. 5 and 6).

[0147] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Claim 1 A recombinant cell for detecting or measuring the activity of botulinum toxin, characterized in that a gene construct comprising a recombinant fluorescent protein coding sequence, a botulinum toxin recognition sequence, and a fluorescence expression inhibiting peptide coding sequence represented by SEQ ID NO. 10 is introduced, and the fluorescence expression inhibiting peptide is a quencher peptide. Claim 2 A recombinant cell according to claim 1, characterized in that the cell is a prokaryotic cell, an animal cell, or a plant cell. Claim 3 A recombinant cell according to claim 1, wherein the recombinant fluorescent protein is selected from the group consisting of green fluorescent protein (GFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP) and orange fluorescent protein (OFP), or is recombinantly produced therefrom. Claim 4 A recombinant cell according to claim 1, wherein the botulinum toxin recognition sequence is a sequence encoding a peptide that acts as a substrate for botulinum toxin and is degraded by botulinum toxin. Claim 5 A recombinant cell according to claim 4, wherein the botulinum toxin recognition sequence comprises the 197th amino acid of the amino acid sequence represented by SEQ ID NO. 1 and 6 to 15 adjacent amino acids. Claim 6 A recombinant cell according to claim 1, wherein the gene construct is introduced using a cell-transferable peptide, a lipid gene carrier, or a combination thereof, or by a method of electroporation or magnetofection. Claim 7 In paragraph 1, the botulinum toxin is a recombinant cell that is botulinum toxin serotype A. Claim 8 A method for detecting or measuring the activity of a cell-based botulinum toxin, comprising: a step of culturing a recombinant cell according to any one of claims 1 to 7; a step of treating the cultured recombinant cell with botulinum toxin; and a step of measuring the intensity of fluorescence or the number of fluorescence-expressing cells in the recombinant cell treated with botulinum toxin. Claim 9 A method for evaluating a cell-based botulinum toxin inhibitor, comprising: a step of culturing a recombinant cell according to any one of claims 1 to 7; a step of treating the cultured recombinant cell with a botulinum toxin and a candidate inhibitor; and a step of measuring the intensity of fluorescence or the number of fluorescence-expressing cells in the recombinant cell, and then determining the activity of the botulinum toxin by comparing it with a control. Claim 10 delete Claim 11 delete Claim 12 delete

Images