A thermostable and long-acting human basic fibroblast growth factor mutant and use thereof

Abstract

The present invention relates to a highly stable, sustained-release basic fibroblast growth factor mutant and its uses. More specifically, the invention provides a highly stable, sustained-release basic fibroblast growth factor (bFGF) mutant comprising the amino acid sequence of SEQ ID NO. 1, a DNA base sequence encoding said bFGF mutant (TS-bFGF), an expression vector comprising said DNA base sequence, a transformant transformed by said expression vector, a method for producing said bFGF mutant (TS-bFGF), and a composition comprising said bFGF mutant (TS-bFGF) as an active ingredient. According to the present invention, the bFGF mutant (TS-bFGF) of the present invention exhibits excellent thermal stability and stability in an aqueous solution, making it possible to produce functional cosmetics and skin wound treatments that do not lose activity during production, distribution, and storage processes, unlike existing natural bFGF products.

Description

Technology Field

[0001] The present invention relates to a highly stable, sustained-activity basic fibroblast growth factor variant and its uses. Background Technology

[0002] Growth factors play a crucial role in regulating cell growth, proliferation, and differentiation. Consequently, our bodies possess a natural repair system for skin damage and aging caused by internal and external factors, such as injuries and surgery, and growth factors play a vital role in this process. Various growth factors are produced to maintain the function of each tissue, performing their functions while being maintained at specific concentrations. As we age, the concentration of growth factors in tissues, including the skin, decreases; consequently, the regenerative and division functions of cells weaken, leading to the progression of aging, such as the formation of wrinkles and a loss of elasticity.

[0003] Among them, bFGF is composed of 154 amino acids and is a polypeptide with a molecular weight of 17,123 Daltons. It plays an important role in development, angiogenesis, and wound healing. As a mitogen and chemotactic factor, bFGF is known as a powerful mediator in wound healing, angiogenesis, and the growth of the nervous system.

[0004] However, it is known that the half-life of these growth factors present in blood and tissues is very short, typically only a few minutes. In particular, bFGF has a problem in that its stability is significantly affected because it has four cysteine ​​residues that do not form disulfide bonds in its structure.

[0005] Furthermore, the bioavailability of protein therapeutics such as bFGF is often limited by their short blood half-life and sensitivity to proteases, hindering maximum clinical efficacy. To improve the effective applications of bFGF, it is necessary to enhance its physicochemical stability in vitro, in addition to its stability in vivo, in order to increase its use in the manufacturing, storage, and distribution processes of pharmaceuticals and cosmetics.

[0006] To address these issues, PNP Biopharmaceuticals has developed a highly stable bFGF (named HsbFGF) (Republic of Korea Patent Application No. 10-2015-0078930 / WO2016195157, named 'St-bFGF' in the specification of the present invention). The problem to be solved

[0008] The present invention was conceived in response to the above necessity, and the objective of the present invention is to provide a basic fibroblast growth factor variant (TS-bFGF) that exhibits superior thermal stability and stability in aqueous solution compared to existing basic fibroblast growth factors.

[0009] In addition, another objective of the present invention is to provide a DNA base sequence encoding a bFGF variant (TS-bFGF).

[0010] In addition, another objective of the present invention is to provide an expression vector comprising the above DNA base sequence.

[0011] In addition, another objective of the present invention is to provide a transformant transformed by the expression vector.

[0012] In addition, another objective of the present invention is to provide a method for producing a highly stable bFGF variant (TS-bFGF). means of solving the problem

[0014] To achieve the above objective, the present invention provides a highly stable basic fibroblast growth factor (bFGF) variant (TS-bFGF) composed of the amino acid sequence of SEQ ID NO. 1.

[0015] In one embodiment of the present invention, all mutants capable of achieving the intended effect of the present invention through one or more mutations, such as substitutions, deletions, inversions, or translocations in the amino acid sequence, are also included in the scope of the variants of the present invention.

[0016] In addition, the present invention provides a gene encoding a variant of the present invention.

[0017] In one embodiment of the present invention, the gene is preferably the gene described in SEQ ID NO. 2, but all mutants capable of achieving the intended effect of the present invention through one or more mutations such as substitutions, deletions, inversions, or translocations in the gene sequence are also included in the scope of the variants of the present invention.

[0018] In addition, the present invention provides an expression vector comprising the gene of the present invention.

[0019] In addition, the present invention provides a transformant transformed by the expression vector of the present invention.

[0020] The present invention also provides a method for producing a highly stable basic fibroblast growth factor variant (TS-bFGF) comprising the following steps:

[0021] (a) a step of culturing the transformant of the present invention; and

[0022] (b) A step of isolating the variant (TS-bFGF) from the culture medium obtained in step (a) above.

[0023] In one embodiment of the present invention, step (b) is,

[0024] (c) a step of cell lysis of the above-mentioned transformant and removal of aggregates;

[0025] (d) a step of separating and purifying the supernatant from which the aggregates have been removed using ion exchange resin chromatography; and

[0026] (e) It is preferable, but not limited to, to further include the step of separating and purifying a highly stable basic fibroblast growth factor variant (TS-bFGF) after ion exchange resin using heparin affinity chromatography.

[0027] In addition, the present invention provides a cosmetic composition for improving skin condition comprising the highly stable basic fibroblast growth factor variant (TS-bFGF) of the present invention as an active ingredient.

[0028] In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of skin diseases comprising the highly stable basic fibroblast growth factor variant (TS-bFGF) of the present invention as an active ingredient.

[0029] The present invention will be described below.

[0030] As used in this specification, the term bFGF refers to a basic protein (pI 9.58) with a molecular weight of approximately 18 kDa that is primarily secreted by the pituitary gland and is known to promote the growth of various mesenchymal-derived cells. In addition, it is known to be a protein that promotes the growth of vascular endothelial cells and smooth muscle cells, exhibiting excellent efficacy in trauma treatment and angiogenesis, maintaining skin elasticity by increasing the synthesis of collagen and elastin, aiding the growth of normal cells, promoting recovery from wounds, and performing healing functions.

[0031] The variant of the present invention (TS-bFGF) is a variant produced through mutation experiments by selecting a site unrelated to the active site of bFGF through the tertiary structure of bFGF, interspecies homology alignment method, and computer-aided protein molecular modeling.

[0032] The bFGF variant of the present invention (TS-bFGF) maintains protein activity while increasing heat stability compared to the natural form (WT-bFGF) composed of 146 amino acid or 154 amino acid residues (146 aa or 154 aa, respectively) and the existing bFGF variant (St-bFGF) composed of 146 amino acid residues (146 aa).

[0033] According to another aspect of the present invention, the present invention provides a DNA base sequence (Sequence No. 2) encoding the bFGF variant (TS-bFGF) and an expression vector comprising the same.

[0034] The expression vector of the present invention can be prepared by inserting the bFGF gene into a general expression vector, and any generally available cell expression vector can be used.

[0035] According to another aspect of the present invention, the present invention provides a transformant which is a host cell transformed by the expression vector.

[0036] The bFGF variant (TS-bFGF) of the present invention can be produced by transforming a host cell with a vector containing a gene encoding a bFGF variant (TS-bFGF) produced by a site-specific mutation induction method, etc., to express the bFGF variant (TS-bFGF), and can also be produced by a chemical amino acid synthesis method.

[0037] Meanwhile, it is a well-known fact that due to the degeneracy of codons, there are multiple codons coding for a single amino acid, so even DNA coding for the same amino acid sequence may have different nucleotide sequences.

[0038] DNA encoding such a bFGF variant (TS-bFGF) can be produced by chemically synthesizing it or by manufacturing natural bFGF cDNA and using methods such as site-specific mutation induction based on it.

[0039] The DNA encoding the bFGF variant (TS-bFGF) of the present invention prepared above can be expressed using any one of a suitable prokaryotic or eukaryotic expression system well known in the art (Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, USA, 1989).

[0040] Expression of the non-glycosylated bFGF variant (TS-bFGF) is preferably performed in Escherichia coli, e.g., Escherichia coli BL21(DE3), Escherichia coli JM109(DE3), Escherichia coli NM522, etc. Suitable vectors that can be used for expression in Escherichia coli are mentioned in the literature of Sambrook et al. (ibid.) and the paper by Fiers et al. ("Proced. 8th Int. Biotechnology Symposium", Soc. Frac. de Microbiol., Paris, (Durand et al., eds.), pp. 680-697, 1988).

[0041] Transformation of host cells by the vector described above can be performed by any of the conventional methods (Sambrook et al., Molecular Cloning, A Laboratory Manual, 1989; Ito et al., J. Bacteriol. 153:263, 1983).

[0042] When transforming E. coli, competent cells capable of absorbing DNA can be prepared, and then treated according to known methods.

[0043] According to another aspect of the present invention, the present invention provides a method for producing a highly stable bFGF variant (TS-bFGF) comprising the following steps:

[0044] (a) a step of culturing the above-mentioned transformant; and

[0045] (b) A step of isolating the variant (TS-bFGF) from the culture medium obtained in step (a) above.

[0046] According to a preferred embodiment of the present invention, step (b) of the method is,

[0047] (c) a step of cell lysis of the above-mentioned transformant and removal of aggregates;

[0048] (d) a step of separating and purifying the supernatant from which the aggregates have been removed using ion exchange resin chromatography; and

[0049] (e) A step of separating and purifying the highly stable bFGF variant (TS-bFGF) after the ion exchange resin using heparin affinity chromatography.

[0050] Generally, host microorganisms containing a target expression vector are cultured under their optimal growth conditions to maximize the production of the target protein. For example, E. coli BL21(DE3) cells transformed with a vector containing an ampicillin resistance gene as a selectable label are cultured at 37°C in LB medium containing ampicillin.

[0051] The recovery and purification of the bFGF variant (TS-bFGF) produced after culturing the transformed host cells can be carried out by using various methods known in the art or combinations thereof. For example, the bFGF variant (TS-bFGF) expressed in transformed E. coli cells can be recovered by extraction from the cell culture or by a suitable method known in the field of protein chemistry after cell lysis.

[0052] Preferably, to purify the bFGF variant (TS-bFGF), the culture medium of recombinant E. coli cells is centrifuged to harvest the cells, the harvested cells are suspended in a buffer solution containing lysozyme, and the cells are lysed by ultrasound. The cell lysate is centrifuged to remove insoluble granular aggregates. The supernatant from which the aggregates have been removed is separated and purified using ion exchange resin chromatography, and then separated and purified using heparin affinity chromatography to obtain the resulting high-stability bFGF variant (TS-bFGF).

[0053] According to another aspect of the present invention, the present invention provides a pharmaceutical composition for the prevention or treatment of skin diseases comprising the above-mentioned high-stability bFGF variant (TS-bFGF) as an active ingredient.

[0054] As demonstrated in the following examples, the highly stable bFGF variant (TS-bFGF) of the present invention possesses the same activity as natural bFGF and exhibits excellent thermal stability and stability in aqueous solutions. Therefore, the composition of the present invention is highly effective for the prevention or treatment of skin diseases.

[0055] Preferably, the composition of the present invention is used for the prevention or treatment of skin diseases such as skin inflammation, acute and chronic eczema, contact dermatitis, atopic dermatitis, seborrheic dermatitis, chronic lichen simplex, intertrigo, exfoliative dermatitis, papular urticaria, psoriasis, photodermatitis, and acne.

[0056] In addition, the composition of the present invention may provide a composition for treating wounds. Preferably, the composition of the present invention is used for treating closed wounds and open wounds. Examples of closed wounds include contusions or bruises, and examples of open wounds include abrasions, lacerations, avulsions, penetrating wounds, and gunshot wounds.

[0057] The composition of the present invention is a pharmaceutical composition comprising (a) a pharmaceutically effective amount of the bFGF variant (TS-bFGF) of the present invention described above; and (b) a pharmaceutically acceptable carrier.

[0058] As used herein, the term "pharmaceutical effective amount" means an amount sufficient to achieve the efficacy or activity of the bFGF variant described above.

[0059] Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in manufacturing and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0060] The pharmaceutical composition of the present invention may additionally include, in addition to the above components, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0061] The pharmaceutical composition of the present invention may be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, may be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, local administration, transdermal administration, etc.

[0062] Suitable dosages of the pharmaceutical composition of the present invention may be prescribed in various ways depending on factors such as the formulation method, mode of administration, patient's age, body weight, sex, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity. Meanwhile, the preferred daily dosage of the pharmaceutical composition of the present invention is 0.001-100 mg / kg body weight.

[0063] The pharmaceutical composition of the present invention may be prepared in a unit volume form or contained in a multi-volume container by formulation using a pharmaceutically acceptable carrier and / or excipient, according to a method that can be easily carried out by a person skilled in the art to which the invention belongs. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet, capsule, or gel (e.g., hydrogel), and may additionally include a dispersant or a stabilizer.

[0064] According to another aspect of the present invention, the present invention provides a cosmetic composition for improving skin condition comprising the above-mentioned high-stability bFGF variant (TS-bFGF) as an active ingredient.

[0065] As demonstrated in the following examples, the highly stable bFGF variant (TS-bFGF) of the present invention possesses the same activity as natural bFGF and exhibits excellent thermal stability and stability in aqueous solutions. Therefore, the composition of the present invention is highly effective for improving skin condition.

[0066] Preferably, the composition of the present invention is used to improve skin conditions such as wrinkle reduction, skin elasticity improvement, prevention of skin aging, prevention of hair loss or promotion of hair growth, improvement of skin hydration, removal of age spots, or treatment of acne.

[0067] The composition of the present invention is a cosmetic composition comprising (a) a cosmetically effective amount of the bFGF variant (TS-bFGF) of the present invention described above; and (b) a cosmetically acceptable carrier.

[0068] As used in this specification, the term "cosmetic effective amount" means an amount sufficient to achieve the skin-improving efficacy of the composition of the present invention described above.

[0069] The cosmetic composition of the present invention may be prepared in any formulation conventionally manufactured in the industry, for example, as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited thereto. More specifically, it may be prepared in the form of a softening lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.

[0070] In the case where the formulation of the present invention is a paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide may be used as a carrier component.

[0071] In the case where the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.

[0072] When the formulation of the present invention is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan.

[0073] In the case where the formulation of the present invention is a suspension, liquid diluents such as water, ethanol, or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used as carrier components.

[0074] In the case where the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester, etc. may be used as a carrier component.

[0075] In addition to the bFGF variant (TS-bFGF) as an active ingredient and the carrier component, the ingredients included in the cosmetic composition of the present invention include ingredients commonly used in cosmetic compositions, such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances.

[0076] Since the compositions of the present invention contain the above-described high-stability bFGF variant (TS-bFGF) of the present invention as an active ingredient, the common details between the two are omitted to avoid excessive complexity in this specification. Effects of the invention

[0078] According to the present invention, the bFGF variant (TS-bFGF) of the present invention has excellent thermal stability and stability in an aqueous solution, making it possible to produce functional cosmetics and skin wound healing agents that do not lose activity during production, distribution, and storage processes, unlike existing natural bFGF products. Brief explanation of the drawing

[0080] Figure 1A shows the Alphafold2 structural modeling results of natural bFGF [WT-bFGF (146 aa and 154 aa)], the bFGF variant St-bFGF (Korean Patent Application No. 10-2015-0078930), and the bFGF variant TS-bFGF. Figure 1B is the result of complex structure modeling of WT-bFGF (154 aa) and TS-bFGF receptors using Alphafold2. Figure 2 is a schematic diagram of the construction of an expression vector for producing a bFGF variant (TS-bFGF) in E. coli using the self-cleavage activity of the SortaseA enzyme. Figure 3 is a schematic diagram of the process for producing a bFGF variant (TS-bFGF) in E. coli transformed with a bFGF variant (TS-bFGF) expression vector. Figure 4 shows the SDS-PAGE results after cell lysis to confirm the expression of the bFGF variant (TS-bFGF) and autocleavage in E. coli transformed with a bFGF variant (TS-bFGF) expression vector. A culture without IPTG (IPTG-) was used as a negative control. Figure 5 shows the results of purifying the bFGF variant (TS-bFGF) using nickel column and heparin column chromatography and then analyzing it by SDS-PAGE. Figure 6 shows the results of measuring the thermal stability (Tm) of natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF) using circular dichroism (CD). Figure 7A is a schematic diagram of a luciferase assay that measures growth factor activity through the degree of luciferase expression using a luciferase expression system whose expression is regulated by the SRE (serum response element) in HEK 293 cells, and Figure 7B shows the results of measuring the activity of natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF) after 12 and 24 hours of incubation, respectively, using a luciferase assay, and Figure 7C shows the results of measuring the activity of natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF) after storing them at 37°C for 3 days, and then measuring the activity of natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF) after 12 and 24 hours of incubation, respectively, using a luciferase assay. Figure 8 compares the cell activity of natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF) at a concentration of 0.1 mg / mL in 20 mM sodium phosphate buffer (pH 7.0), respectively, while storing them at room temperature (25℃) for 12 months. Specific details for implementing the invention

[0081] The present invention will be described in more detail below through non-limiting examples. However, the following examples are described for the purpose of illustrating the present invention, and the scope of the present invention shall not be interpreted as being limited by the following examples.

[0082] DNA construction

[0083] BL21(DE3) was purchased from Novagen as the protein expression vector and expression E. coli strain, while Top10 was used for cloning. All restriction enzymes used for gene recombination were products of NEB (New England Biolabs), and the ligase was Roche's T4 DNA ligase. The Taq DNA polymerase and PCR mix used for PCR were products of Macrogen. The DNA gel extraction kit and plasmid mini prep kit were products of Cosmojintech Co., Ltd. In addition, the primers were designed by Cosmojintech Co., Ltd., and DNA sequencing was also commissioned to Cosmojintech Co., Ltd.

[0084] Protein expression

[0085] IPTG (isopropyl-1-thio-β-D-galactopyranoside), an expression inducer, and kanamycin, used as an antibiotic, were both purchased from Sigma. Bacto tryptone and yeast extract used to prepare the LB medium for E. coli culture were purchased from BD (Becton Dicknson), and NaCl was purchased from Duksan.

[0086] Protein purification

[0087] The reagents used in the purification process were of the highest possible purity, and the reagents used in the purification process are as follows: sodium phosphate monobasic (Sigma), sodium phosphate dibasic (Sigma), and sodium chloride (Sigma).

[0088] The column used in FPLC was a Ni-sepharose, heparin affinity column.

[0089] FPLC

[0090] The FPLC used the GE UPC-800.

[0091] CD (Circular dichroism)

[0092] The CD used a Jasco J-810 spectropolarimeter.

[0094] Example 1: Structural modeling of a highly stable, sustained-release bFGF variant

[0095] Structural modeling of the natural form (WT-bFGF (146 aa and 154 aa)) and variants (St-bFGF (146 aa) and TS-bFGF (154 aa)) was performed using AlphaFold2 (https: / / colab.research.google.com / github / sokrypton / ColabFold / blob / main / AlphaFold2.ipynb).

[0096] Figure 1A shows the structural modeling of the natural form (WT-bFGF (146 aa and 154 aa)) and variants (St-bFGF (146 aa) and TS-bFGF (154 aa)), and Figure 1B shows the binding structure modeling and dynamic structure of TS-bFGF and WT-bFGF (154 aa) with their receptors. The right figure of Figure 1B shows the average structure of TS-bFGF (black) and WT-bFGF (154 aa) (gray) bound to the receptor (surface structure), indicating that the N-terminus of TS-bFGF is located close to the receptor. The left figure of Figure 1B shows the dynamic structure of TS-bFGF (black) and WT-bFGF (154 aa) (gray), indicating that the N-terminus of TS-bFGF does not show significant structural variation, but WT-bFGF(154 aa) shows very large variability, which appears to be the cause of the structural stability of TS-bFGF.

[0097] Example 2: Construction of a highly stable sustained-release bFGF variant (TS-bFGF) E. coli expression vector and production of the variant protein

[0098] TS-bFGF (SEVENTEEN NO. 1) DNA and Sortase A (SortA) enzyme DNA were each used as templates, and TS-bFGF (A1) variants were produced by PCR using Taq DNA polymerase, in which alanine, the first amino acid of the N-terminus of SortA and TS-bFGF, respectively, were removed. Then, pPnP TS-bFGF plasmid DNA was constructed by fusing SortA and TS-bFGF (A1) (Fig. 2).

[0099] The nucleotide sequences of the primers used in PCR are as follows:

[0100] Sense Primer F0 5'-AACTTTAAGAAGGAGATATACATATGGCGAGCAGCCATCATCATCAT-3' (Sequence No. 3)

[0101] Sense Primer

[0102] F1 5'-GCGAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCACATGCAAGCTAA ACCTCAAATTCCG-3' (SEQ ID NO: 4)

[0103] Sense Primer R1 5'-TCCGGTTTCCGGCAGTTTTTTGACTTCTGTAGCTACAA-3'(Sequence No. 5)

[0104] Sense Primer F2 5'-ACAGAAGTCAAAAAACTGCCGGAAACCGGAGCGGGATCCATTACCACCCTGCC-3'(Sequence No. 6)

[0105] Sense Primer R2 5'-GGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGTTATCAGCTCTTAGCAGACATTGG-3'(Sequence No. 7)

[0106] PCR was performed using SortA DNA as a template with primers F1 and R1 to create a 6xHis-SortA-LPETG DNA fragment having an NdeI restriction enzyme cleavage site and 6xHis at the 5' end and an LPETG sequence at the 3' end, and using TS-bFGF DNA as a template with primers F2 and R2 to create an LPETG-TS-bFGF(A1) DNA fragment with LPETG and XhoI restriction enzyme sites added to the 5' and 3' ends, respectively.

[0107] 1 µg each of 6xHis-SortA-LPETG DNA and LPETG-TS-bFGF(A1) DNA were mixed and PCR was performed using primers F0 and R2. The resulting SortA TS-bFGF DNA fragment was cleaved with NdeI and XhoI restriction enzymes and then ligated by mixing it with an expression vector cleaved with the same restriction enzymes. After ligation, E. coli Top10 were transformed by heat shock.

[0108] After transformation, kanamycin-resistant colonies formed on the solid medium were selected and inoculated into 10 ml of LB medium (LB / kanamycin). After incubation at 37°C for 16 hours, DNA prep was performed, and the obtained DNA was identified as pPnP TS-bFGF plasmid DNA through sequencing.

[0109] E. coli BL21(DE3) was transformed with pPnP TS-bFGF plasmid DNA by heat shock. After transformation, kanamycin-resistant colonies formed on solid media were selected and inoculated into 10 ml of LB medium (LB / kanamycin). After incubation at 37°C for 12 hours, the stock was mixed with 100% glycerol in a 1:1 ratio and stored at -70°C.

[0110] The production of TS-bFGF was carried out according to the sequence and method shown in the schematic diagram of Figure 3. The stock prepared above was inoculated into 10 ml of LB medium (LB / kanamycin) and cultured for at least 12 hours. Then, it was transferred to 500 ml of LB medium (LB / kanamycin), and when the absorbance at 600 nm was OD 0.4–0.5, IPTG (isopropyl-1-thio-β-D-galactopyranoside) was added to reach a final concentration of 0.5 mM. At this time, culture without IPTG was also conducted and used as a control to determine the presence or absence of expression.

[0111] After incubating with shaking at 200 rpm for 4 hours at 37°C, an E. coli pellet was obtained by centrifuging at 8000 rpm for 10 minutes. This pellet was suspended in 25 ml of 100 mM Tris, 150 mM NaCl, pH 8.0 buffer, and the cells were lysed using sonication. The cell lysate lysed by sonication was centrifuged at 13000 rpm for 15 minutes at 4°C.

[0112] When the supernatant and pellet were analyzed separately using SDS-PAGE, no expression was observed in the culture medium without IPTG (IPTG-), while a 17 kDa TS-bFGF band was detected in the supernatant of the culture medium with IPTG (IPTG+) (Fig. 4). The supernatant was collected and filtered using a 0.45 mm filter. This solution was loaded at 3 mL / min using FPLC (Fast Performance Liquid Chromatography) and a His Trap FF (5 mL) column. The flow-through solution that did not bind to the column and the wash-out solution obtained by washing the column with the buffer used for cell lysis were collected together. The flow-through and wash-out solutions were analyzed by SDS-PAGE to confirm the presence of TS-bFGF protein (Fig. 5A).

[0113] The solution collected from the flow-through and wash-out was dialyzed with 20 mM sodium phosphate, 2 mM EDTA, pH 6.0 buffer and then purified using a heparin column. The dialyzed protein solution was loaded at 3 mL / min onto a heparin column prepared with 20 mM sodium phosphate, 2 mM EDTA (pH 6.0) buffer (buffer A), washed with 50% buffer (buffer B) mixed with 2M NaCl, and the fraction containing the bound TS-bFGF protein was eluted and collected using 100% buffer B (Fig. 5B). At this stage, the fraction containing TS-bFGF was analyzed by SDS-PAGE, confirming a TS-bFGF band with a purity of over 95% (Fig. 5C). TS-bFGF protein purified from a heparin column was oxidized with cysteine ​​and cystine, followed by buffer exchange via dialysis in citrate (pH 5.0) buffer. The buffer-exchanged TS-bFGF was freeze-dried using a freeze-dryer.

[0114] Experimental Example 1: Thermal Stability Analysis of Natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF Variants (St-bFGF and TS-bFGF) Using Circular Dichroism

[0115] The structure and thermal stability of the purified TS-bFGF variant of Example 2 were measured through circular dichroism (CD) analysis using a J-810 spectropolarimeter (JASCO).

[0116] WT-bFGF (154 aa) was purchased from Peprotech and used, while WT-bFGF (146 aa) and St-bFGF (146 aa) used previously purified bFGF. Each bFGF was prepared to a constant concentration of 0.2 mg / ml using 20 mM sodium phosphate (pH 7.0) buffer. The samples were placed in a 0.1 cm cell, and their structures were analyzed in the 190 nm–250 nm region under conditions of band width 1 nm, response 0.25 sec, data pitch 0.1 nm, scanning speed 20 nm / min, pathlength 1 cm, accumulation 8 times, and a temperature of 20 ℃.

[0117] To analyze temperature stability, the melting temperature was tested at 20 ℃ and 95 ℃ at a wavelength of 200 nm in a 0.1 cm cuvette at a concentration of 0.2 mg / ml. The conditions were measured from 20 ℃ to 95 ℃ under a 1 ℃ condition.

[0118] As can be seen in Fig. 6, regarding Tm, which indicates thermal stability, WT-bFGF (146 aa) showed 57°C, WT-bFGF (154 aa) showed 58°C, and St-bFGF (146 aa) showed 64°C, whereas it was confirmed that the TS-bFGF (154 aa) of the present invention increased up to 66°C. Based on these experiments, it was confirmed that the TS-bFGF (154 aa) of the present invention has improved thermal stability.

[0119] Experimental Example 2: Luciferase activity assay comparing natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF)

[0120] To confirm the activity of each bFGF (WT-bFGF (146 aa), WT-bFGF (154 aa), St-bFGF (146 aa), TS-bFGF (154 aa)), luciferase activity was measured in HEK293 cells according to the manufacturer's protocol (Promega) (Fig. 7A).

[0121] To obtain HEK293 cells transformed with the luciferase vector (pGL4.44[luc2p / SRE / Hygro]), the luciferase vector (pGL4.44[luc2p / SRE / Hygro]) was transfected into HEK293 cells using Polyjet™ in vitro DNA transfection reagent (SignaGen®). Transfected HEK293 cells were selected for 24 hours using 200 μg / mL hygromycin B (Thermo Fisher Scientific). Luciferase activity analysis using the selected HEK293 cells was performed using the Dual-Luciferase®Assay System (Promega), and luciferase activity was measured using SpectraMax iD3 (Molecular Devices, LLC.). Figure 7B shows the luciferase after incubation for 12 hours (left figure of Figure 7B) and 24 hours (right figure of Figure 7B) following the addition of each bFGF. This is the result of measuring activity.

[0122] As can be seen in Fig. 7, TS-bFGF exhibited higher luciferase activity (i.e., higher cellular activity) than WT-bFGF and also showed statistically significantly higher activity when compared to St-bFGF (146 aa). Fig. 7C shows the results of measuring luciferase activity after storing each bFGF at 37°C for 3 days, adding each to a medium, and incubating for 12 hours (left figure of Fig. 7C) and 24 hours (right figure of Fig. 7C).

[0123] As shown in Fig. 7C, WT-bFGF lost activity and exhibited reduced luciferase activity at 12 hours and 24 hours, similar to the negative control, whereas TS-bFGF was found to maintain activity. In addition, when TS-bFGF was compared with St-bFGF (146 aa), a statistically significant difference in activity was observed. Based on these experiments, it was confirmed that the TS-bFGF (154 aa) of the present invention maintains cell proliferation activity due to improved thermal stability.

[0124] Experimental Example 3: Long-term storage stability of a highly stable, sustained-activity bFGF variant

[0125] To confirm the long-term stability of natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF), an incubation test was conducted at 37°C for 360 days. Natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF) were prepared at 0.1 mg / mL in 20 mM sodium phosphate buffer (pH 7.0) and stored at 25°C for 12 months. Cell proliferation assays were performed using NIH-3T3 cells at regular intervals to evaluate the cell proliferation activity of natural bFGF (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF).

[0126] The NIH-3T3 cells used in the experiment were maintained in DMEM complete medium containing 10% heat-inactivated fetal bovine serum, 100 units / ml penicillin, and 100 mg / ml streptomycin. 2 x 10⁶ cells were placed in a 96-well culture plate. 3NIH-3T3 cells were seeded into cells / well. NIH-3T3 cells cultured for 24 hours were starvated in serum-free DMEM medium, then treated with the sample solution at various concentrations in DMEM medium containing 0.5% FBS, and cultured for 72 hours. After culture, 10 µl of MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide] solution was added and reacted for 2 hours; subsequently, formazan crystals were dissolved in 100 µl of DMSO. Absorbance was measured at a wavelength of 540 nm using a spectrophotometer. The values ​​at each point were normalized by setting the values ​​of the control group (fresh natural bFGF not stored at 25°C (WT-bFGF (146 aa and 154 aa)) and bFGF variants (St-bFGF and TS-bFGF)) to 100%.

[0127] As shown in Figure 8, in the case of natural bFGF (WT-bFGF (146 aa and 154 aa)), cell proliferation activity converges to 0% after 30 days, but in the case of TS-bFGF of the present invention, it was confirmed that it has stability even during long-term storage, as it has about 90% activity after 30 days and about 70% activity after 360 days. In addition, when comparing TS-bFGF with St-bFGF (146 aa), St-bFGF had about 70% and 50% activity after 30 and 360 days, respectively, confirming that the cell activity of TS-bFGF lasts longer even during long-term storage at room temperature in a liquid formulation.

[0128]

[0129] Table 1 shows the amino acid and base sequences of the highly stable sustained-activity bFGF variant (TS-bFGF).

Claims

Claim 1 A basic fibroblast growth factor (bFGF) mutant consisting of the amino acid sequence of SEQ ID NO.

1. Claim 2 The gene encoding the variant of claim 1. Claim 3 An expression vector containing the gene of claim 2. Claim 4 Isolated transformed cells, excluding cells within the human body transformed by the expression vector of claim 3. Claim 5 A method for producing a highly stable basic fibroblast growth factor variant comprising the following steps: (a) culturing the isolated transformed cells of claim 4; and (b) isolating the variant from the culture medium obtained in step (a). Claim 6 A method according to claim 5, wherein step (b) further comprises: (c) a step of cell lysis of the separated transformed cells and removal of aggregates; (d) a step of separating and purifying the supernatant from which aggregates have been removed using ion exchange resin chromatography; and (e) a step of separating and purifying the highly stable basic fibroblast growth factor variant after ion exchange resin using heparin affinity chromatography. Claim 7 A cosmetic composition for improving wrinkles, skin elasticity, or skin moisture, comprising a basic fibroblast growth factor variant of claim 1 as an active ingredient. Claim 8 delete

Images