A pharmaceutical composition comprising a NARS2 inhibitor for the prevention or treatment of cancer

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of cancer comprising an asparaginyl tRNA synthase 2 (NARS2) inhibitor. More specifically, the pharmaceutical composition of the present invention can prevent or treat cancer by including a NARS2 inhibitor, thereby inhibiting the transcription of mitochondria within cancer cells and impairing their function.

Description

Technology Field

[0001] The present invention relates to an expression inhibitor of NARS2 and a pharmaceutical composition for the prevention or treatment of cancer containing the same. Background Technology

[0003] Conventional cancer biomarker and anticancer drug target discovery technologies have attempted to discover new anticancer drugs by identifying biomarkers and drug targets based on biological hypotheses obtained through experiments. However, due to the inherent characteristics of cancer, namely drug resistance resulting from metabolism reprogramming, the therapeutic effect of anticancer drugs significantly decreases over time after administration.

[0004] Recently, a system has been developed to predict the metabolism of cancer tissue based on genome-scale metabolic models and protein profile data.

[0005] Unlike biomarker and drug target discovery methodologies based on biological hypotheses, methods and systems have been developed to identify novel cancer biomarkers and anticancer drug targets by utilizing genome-scale metabolic models to identify metabolic processes specifically expressed in cancer. Recently, various techniques for utilizing genome-scale metabolic models have been developed, and research is being conducted to identify significant drug candidates that are relevant to biological hypotheses, particularly when using models related to biological hypotheses.

[0006] Meanwhile, aminoacyl-tRNA synthetase (ARS) is attracting attention for performing essential functions in protein translation within cells, as well as being involved in 'extra-protein translation functions' in the pathogenesis of various diseases. Prior art literature

[0008] Korean Patent Publication No. 10-2023-0072259 The problem to be solved

[0009] The present invention aims to provide a pharmaceutical composition for the prevention or treatment of cancer.

[0010] The present invention aims to provide a health functional food for the prevention or improvement of cancer. means of solving the problem

[0012] 1. A pharmaceutical composition for the prevention or treatment of cancer comprising an asparagineyl tRNA synthase 2 (NARS2) inhibitor.

[0013] 2. A pharmaceutical composition for the prevention or treatment of cancer, wherein the inhibitor in 1 above is selected from the group consisting of siRNA, shRNA, miRNA, antisense oligonucleotides, aptamers, and antibodies.

[0014] 3. A pharmaceutical composition for the prevention or treatment of cancer, wherein the inhibitor in 1 above is an shRNA composed of the nucleic acid sequence of SEQ ID NO. 1.

[0015] 4. A pharmaceutical composition for the prevention or treatment of cancer, wherein the inhibitor in 1 above is a sense RNA composed of the nucleic acid sequence of SEQ ID NO. 2 and an antisense RNA composed of the nucleic acid sequence of SEQ ID NO. 3; or a sense RNA composed of the nucleic acid sequence of SEQ ID NO. 4 and an antisense RNA composed of the nucleic acid sequence of SEQ ID NO. 5.

[0016] 5. In the above 1, the cancer is selected from the group consisting of breast cancer, colorectal cancer, lung cancer, small cell lung cancer, gastric cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, eye tumor, peritoneal cancer, uterine cancer, ovarian cancer, rectal cancer, pro-anal cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, vaginal cancer, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, testicular cancer, oral cancer, gallbladder cancer, cholangiocarcinoma, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney cancer, ureteral cancer, renal cell carcinoma, renopelvic carcinoma, CNS tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma. A pharmaceutical composition.

[0017] 6. A health functional food for the prevention or improvement of cancer containing an aspartaginyl tRNA synthase 2 (NARS2) inhibitor. Effects of the invention

[0019] The pharmaceutical composition of the present invention can prevent or treat cancer by including a NARS2 inhibitor.

[0020] The health functional food of the present invention can prevent or improve cancer by including a NARS2 inhibitor. Brief explanation of the drawing

[0022] Figure 1 is a histogram of correlations analyzed using gene essentiality (DepMap) to construct a cancer dependency correlation network in colorectal cancer. Out of a total of 302,516,449 correlations, the threshold was defined as 0.65, and correlations lower than the threshold were removed. The thresholds (0.65 and -0.65) are indicated by red dotted lines in Figure 1. The cancer dependency correlation network was constructed using correlations that exceeded the threshold. Figure 2 shows the results of an analysis using a diffusion network algorithm to identify the genetic relationships of NARS2 within the cancer metabolic regulation network. It demonstrates that NARS2 is regulated in conjunction with other genes involved in mitochondrial regulation. Gene time-series information is indicated by color, and cancer-specific variations are represented by the size of the circles. Figure 3 shows the results of performing GSEA (gene set enrichment analysis) on the cancer metabolic regulatory network of NARS2 using gene ontology. It was confirmed that the cancer metabolic regulatory network of NARS2 is involved in the regulation of ribosomal and mitochondrial translation metabolism. Figure 4 shows the results of principal component analysis (PCA) on the gene expression profile of the NARS2 cancer metabolic regulatory network. The NARS2 cancer metabolic regulatory network shows cancer-specific changes in gene expression compared to normal tissue. Figure 5 shows the results of simulating the cancer metabolic regulatory network of NARS2 using a genome-level metabolic model. It was found that EARS2, ABCG1, MARS2, and NARS2 contribute significantly to cancer growth depending on mutation changes. Figure 6 illustrates the metabolic changes in the cancer metabolic regulatory network of NARS2. Reaction flux increased in glycolysis, glutathione metabolism, and propanoate metabolism, while reaction flux decreased in the TCA cycle. Figure 7 shows the change in reaction flux for each chemical reaction involved in the cancer metabolic regulatory network of NARS2. Depending on the cancer metabolic regulatory network of NARS2, the reaction flux of each chemical reaction shows a continuous upward or downward trend. Figure 8 shows cancer-specific chromatin accessibility in the promoter region of NARS2. Figure 9 shows gene essentiality in colorectal cancer by gene. It was confirmed that NARS2 has statistically significant essentiality compared to all genes. Figure 10a shows the results of confirming cell viability (MTT assay) by knocking down NARS2 with shRNA in the normal cell line HEK-293. In normal cells, there was no statistically significant change in cell viability when NARS2 was knocked down. Figure 10b shows the results of confirming the mRNA gene expression (left) and cell viability (MTT assay, right) of NARS2 after knockdown of NARS2 with shRNA in the cancer cell line Caco2. Figure 10c shows the results of a cell viability test (MTT assay) of NARS2KD after knockdown of NARS2 with siRNA in the cancer cell line Caco2. It was confirmed that NARS2 gene expression in NARS2KD was inhibited by siRNA-1 (siRNA composed of the sense strand of SEQ ID NO. 2 and the antisense strand of SEQ ID NO. 3), and NARS2 gene expression in NARS2KD-2 was inhibited by siRNA-2 (siRNA composed of the sense strand of SEQ ID NO. 4 and the antisense strand of SEQ ID NO. 5) (NARS2KD is hereinafter referred to as the "Caco2 NARS2KD model"). Figure 11 shows the difference in protein expression of the electron transport chain (ETC) in the Caco2 NARS2KD model. NARS2KD shows a decrease in the protein expression of ETC compared to the control. Figure 12 shows the results of a seahorse experiment comparing the Caco2 NARS2KD model with the control. It shows the reduction in oxygen consumption of NARS2KD compared to the control. Figure 13 is a microscopic image of the TMRM assay results of the Caco2 NARS2KD organoid model, showing a decrease in mitochondrial activity in the Caco2 NARS2KD model compared to the control. Figure 14 shows the results of analyzing the changes in the gene profiles of the Caco2 NARS2KD model and the Control using differential gene expression analysis. Figure 15 shows the results of confirming differential gene expression by performing gene set enrichment analysis. The NARS2KD model shows that DNA repair mechanisms, DNA replication, cell cycle, aminoacyl tRNA biosynthesis, and ribosome activity are reduced compared to the control. Figure 16 shows the results of EnrichmentMap analysis performed using RNAseq. Statistically significant increases are indicated in red, and decreases in blue. The NARS2KD model shows a decrease in DNA replication, mitochondrial translation, and protein folding. Specific details for implementing the invention

[0023] The present invention provides a pharmaceutical composition for the prevention or treatment of cancer comprising an asparaginyl-tRNA synthetase 2 (NARS2) inhibitor.

[0024] Asparaginyl tRNA synthetase 2 (mitochondrial, NARS2) is one of the aminoacyl-tRNA synthetase (ARS) family. This enzyme is involved in the metabolism of glutamate, alanine, and aspartate.

[0025] In this specification, asparagine tRNA synthase 2 may be used interchangeably with NARS2, DFNB94, FLJ23441, or SLM5.

[0026] The above inhibitors include all substances that inhibit the expression or activity of NARS2.

[0027] A substance that inhibits the expression of NARS2 can be used without limitation in form, such as a compound, nucleic acid, peptide, virus, or vector containing said nucleic acid, which can inhibit the expression of NARS2 by targeting NARS2. For example, it may be an antisense oligonucleotide (ASO), small hairpin RNA (shRNA), small interfering RNA (siRNA), or microRNA (miRNA) that specifically binds to the gene encoding NARS2.

[0028] It was confirmed that shRNA composed of the nucleic acid sequence of SEQ ID NO. 1 according to one embodiment of the present invention; siRNA composed of sense RNA composed of the nucleic acid sequence of SEQ ID NO. 2 and antisense RNA composed of the nucleic acid sequence of SEQ ID NO. 3; and siRNA composed of sense RNA composed of the nucleic acid sequence of SEQ ID NO. 4 and antisense RNA composed of the nucleic acid sequence of SEQ ID NO. 5 can inhibit the proliferation of cancer cells, and thus can be used for cancer prevention or treatment.

[0029] In this specification, the term "antisense oligonucleotide" refers to DNA or RNA, or a derivative thereof, containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and acts to inhibit the translation of the mRNA into a protein by binding to the complementary sequence within the mRNA. In the present invention, the oligonucleotide that inhibits the expression of the mRNA encoding NARS2 is DNA or RNA, or a derivative thereof, having a sequence complementary to the NARS2 mRNA, and may bind to the NARS2 mRNA to interfere with the translation, translocation into the cytoplasm, maturation, etc., of the NARS2 mRNA, or inhibit all other biological functions or activities of the NARS2 mRNA. The antisense oligonucleotide of the present invention may be used by binding complementarily to the NARS2 mRNA.

[0030] The length of the above antisense oligonucleotide is not particularly limited and may, for example, have 6 to 80 nucleotides or 10 to 40 nucleotides. The above antisense oligonucleotide may be synthesized in vivo or synthesized in vitro and administered into the body according to conventional methods used in the art. A non-limiting example of a method for synthesizing antisense RNA in vivo is a method in which antisense RNA is transcribed using a vector in which the origin of the multi-cloning site (MCS) is oriented in the opposite direction. A non-limiting example of a method for synthesizing antisense RNA in vitro is a method using RNA polymerase I.

[0031] The antisense oligonucleotide that inhibits the expression of NARS2 according to the present invention can be easily produced by a person with ordinary knowledge in the art by referring to the base sequence of NARS2 and following a known method.

[0032] In this specification, the term "siRNA" refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing. The length of siRNA is not particularly limited and may, for example, have 21 to 25 nucleotides. Since siRNA can inhibit the expression of target genes, it can be used as an efficient gene knockdown method or gene therapy method. siRNA can be produced by cleaving double-stranded RNA with a dicer and can specifically bind to mRNA having a complementary sequence to inhibit the expression of the corresponding mRNA. The siRNA of the present invention can be used to inhibit the expression of NARS2.

[0033] A substance that inhibits the expression of NARS2 according to one embodiment of the present invention may be an shRNA composed of the nucleic acid sequence of SEQ ID NO. 1.

[0034] A substance that inhibits the expression of NARS2 according to one embodiment of the present invention may be an siRNA composed of a sense RNA composed of the nucleic acid sequence of SEQ ID NO. 2 and an antisense RNA composed of the nucleic acid sequence of SEQ ID NO. 3; or an siRNA composed of a sense RNA composed of the nucleic acid sequence of SEQ ID NO. 4 and an antisense RNA composed of the nucleic acid sequence of SEQ ID NO. 5.

[0035] Substances that inhibit the activity of NARS2 can be used without restriction in their form, such as compounds, peptides, peptide mimics, substrate analogs, antibodies, or aptamers that reduce the activity of NARS2 proteins. For example, a substance that inhibits the activity of NARS2 may be an antibody or aptamer that specifically binds to the NARS2 protein.

[0036] In this specification, the term "aptamer" refers to a nucleic acid molecule having binding activity toward a specific target molecule. The aptamer may have various three-dimensional structures depending on its base sequence and may have a high affinity for a specific substance, such as in an antigen-antibody reaction. The aptamer may inhibit the activity of a specific target molecule by binding to the target molecule.

[0037] Aptamers may be RNA, DNA, modified nucleic acids, or mixtures thereof, and may be in a linear or cyclic form, but are not limited thereto. The aptamers of the present invention that inhibit the activity of NARS2 can be easily prepared by a person skilled in the art according to known methods by referring to the nucleotide sequence of NARS2.

[0038] In addition, in this specification, any compound that inhibits the activity of NARS2 is included without limitation within the scope of the invention as long as it is a compound that inhibits the activity of NARS2.

[0039] The above cancer may be any one selected from the group consisting of breast cancer, colorectal cancer, lung cancer, small cell lung cancer, gastric cancer, liver cancer, blood cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, eye tumor, peritoneal cancer, uterine cancer, ovarian cancer, rectal cancer, prostatic cancer, colon cancer, fallopian tube carcinoma, endometrial carcinoma, cervical cancer, vaginal cancer, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, testicular cancer, oral cancer, gallbladder cancer, cholangiocarcinoma, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney cancer, ureteral cancer, renal cell carcinoma, renopelvic carcinoma, CNS tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma, for example, the above cancer It could be colon cancer.

[0040] In one embodiment of the present invention, inhibition of asparagineil NARS2 in a colorectal cancer animal cell model resulted in reduced cancer growth, decreased mitochondrial function, reduced DNA replication, and reduced mitochondrial transcription (Figs. 10, 11, and 15).

[0041] In the present invention, the pharmaceutical composition may be prepared using a pharmaceutically suitable and physiologically acceptable adjuvant in addition to an inhibitor of NARS2 (active ingredient), or administered to mammals. The adjuvant may include excipients, disintegrants, sweeteners, binders, coatings, expansion agents, lubricants, lubricants, or flavoring agents.

[0042] In addition, the pharmaceutical composition of the present invention can be preferably formulated into a pharmaceutical composition by including one or more pharmaceutically acceptable carriers in addition to the pharmaceutically effective amount of active ingredient described above for administration.

[0043] The above “pharmaceuticalally effective amount” refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient’s disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. Other pharmaceutical compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by considering all of the above factors, and this can be easily determined by a person skilled in the art.

[0044] Specifically, the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, gender, condition, body weight, absorption rate, inactivation rate, and excretion rate of the active ingredient in the body, the type of disease, and concomitant drugs. Generally, 0.001 to 150 mg, preferably 0.01 to 100 mg per kg of body weight, may be administered daily or every other day, or divided into 1 to 3 doses per day. However, since the dosage may be increased or decreased depending on the route of administration, severity of obesity, gender, body weight, age, etc., the above dosage does not limit the scope of the present invention in any way.

[0045] In addition, the term "pharmaceuticalally acceptable" refers to a composition that is physiologically acceptable and, when administered to humans, does not typically cause allergic reactions or similar reactions such as gastrointestinal disorders or dizziness.

[0046] Examples of the above carrier, excipient, and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. Additionally, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included.

[0047] Additionally, the composition of the present invention may be formulated using methods known in the art so as to provide rapid, sustained, or delayed release of the active ingredient after administration to an individual requiring the pharmaceutical composition of the present invention, including humans. The formulation may be a powder, granule, tablet, emulsion, syrup, aerosol, soft or hard gelatin capsule, sterile injectable solution, or sterile powder.

[0048] The present invention provides a health functional food for the prevention or improvement of cancer comprising an asparagine tRNA synthase 2 (NARS2) inhibitor.

[0049] The above asparagine tRNA synthase 2 (NARS2) inhibitor is the same as the one described above.

[0050] The health functional food of the present invention may include ordinary food additives in addition to the NARS2 inhibitor or its granules, and unless otherwise specified, whether it is suitable as a food additive is determined according to the specifications and standards for the relevant item in accordance with the general provisions and general test methods of the food additive code approved by the Ministry of Food and Drug Safety.

[0051] Items listed in the Food Additives Codex include, for example, chemically synthesized products such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon dye, licorice extract, crystalline cellulose, sorghum dye, and guar gum; mixed preparations such as L-sodium glutamate preparations, alkaline agents added to noodles, preservative preparations, and tar dye preparations, but are not limited thereto.

[0052] For example, a health functional food in tablet form may be produced by granulating a mixture of the above-mentioned NARS2 inhibitor with excipients, binders, disintegrants, and other additives using a conventional method, and then adding a lubricant or the like and compression molding, or by directly compression molding the mixture. In addition, the health functional food in tablet form may contain a binder or the like as needed.

[0053] Among the capsule-type health functional foods, hard capsules can be manufactured by filling a conventional hard capsule with a mixture of the above-mentioned NARS2 inhibitor mixed with additives such as excipients, and soft capsules can be manufactured by filling a capsule base such as gelatin with a mixture of the above-mentioned NARS2 inhibitor mixed with additives such as excipients. The soft capsules may contain plasticizers such as glycerin or sorbitol, coloring agents, preservatives, etc., as needed.

[0054] A health functional food in the form of a pill can be prepared by molding a mixture of the above-mentioned NARS2 inhibitor, excipients, binders, disintegrants, etc., using a previously known method, and if necessary, it can be coated with sucrose or other coating agents, or the surface can be coated with a substance such as starch or talc.

[0055] A health functional food in granular form can be manufactured into a granular form by a previously known method using a mixture of the above-mentioned NARS2 inhibitor, excipients, binders, disintegrants, etc., and may contain flavoring agents, synergists, etc. as needed.

[0056] Health functional foods may include beverages, meat, chocolate, food products, confectionery, pizza, ramen, other noodles, chewing gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

[0057] Health functional foods may be administered orally for use as nutritional supplements, and the form of administration is not particularly limited. For example, when administered orally, it is preferable that the daily intake be 5,000 mg or less, more preferable that the daily intake be 2,000 mg or less, and most preferable that the daily intake be 1,000 mg or less. When formulated as capsules or tablets, one tablet may be administered once a day with water.

[0058] The present invention will be explained in more detail below through examples.

[0061] Experimental Example 1. Cancer metabolic regulation network of NARS2

[0062] To identify the cancer metabolic regulatory network of NARS2 (asparagineyl tRNA synthase 2), a cancer dependency correlation network was constructed, and the metabolic regulatory network of NARS2 was analyzed. To reduce noise, correlations lower than 0.65 were removed (Fig. 1), and statistically significant genes were identified from RNAseq and ATACseq. Subsequently, the genetic relationships of the aminoacyl-tRNA biosynthesis subsystem were identified using a diffusion network algorithm (Fig. 2). As a result, it was discovered that NARS2 regulates cancer metabolism by participating in mitochondrial ribosomes and tRNA aminoacylation (Fig. 3). The cancer metabolic regulatory network of NARS2 identified in the cancer dependency correlation network showed a cancer-specific gene expression profile when compared to normal tissues (Fig. 4).

[0064] Experimental Example 2. Genome-scale metabolic model of NARS2

[0065] To investigate the role of NARS2 (Asparagine tRNA Synthase 2), a genome-scale cancer metabolic model was constructed, and constraint-bounded simulations were performed with the minimization of metabolic adjustment. As a result, it was confirmed that NARS2, along with EARS2, ABCG1, and MARS2, significantly contributes to cancer growth and cancer-specific energy metabolism (Fig. 5). It was observed that as cancer grows, the flux values ​​of chemical reactions involved in glycolysis increase, while the flux values ​​of major chemical reactions involved in the TCA cycle decrease. Additionally, an increase in the flux of glutathione metabolism was observed (Figs. 6 and 7).

[0067] Experimental Example 3. Cancer-specific expression of NARS2

[0068] To confirm the cancer-specific expression of NARS2, ATAC-seq results were compared between normal tissue and cancer tissue. As a result, compared to normal tissue, cancer tissue-specific expression patterns were identified in the binding motifs of SP4, SP1, and ZCDC among the gene expression regulatory regions of NARS2 (Fig. 8).

[0070] Experimental Example 4. Anticancer effect of NARS2

[0071] To confirm the anticancer effect of NARS2, the gene effect score was analyzed in the cancer dependency map. As a result, it was confirmed that NARS2 statistically significantly inhibited the growth of a cancer cell model when gene expression was suppressed. In addition, it was confirmed that NARS2 had a negative gene effect score similar to that of mTOR and SMAD4, which are known anticancer target proteins (Fig. 9).

[0073] Experimental Example 5. Cell growth inhibitory effect due to NARS2 inhibition

[0074] The degree of cell growth in a normal cell model (HEK-293) in which NARS2 was inhibited by shRNA and its control group was compared using an MTT assay (Fig. 10a). As a result, there was no statistically significant change in the growth of normal cells at 24, 48, and 72 hours following the inhibition of NARS2.

[0075] The degree of cell growth of a Caco2 cancer cell model in which NARS2 was inhibited by shRNA and its control model was compared using an MTT assay. shRNA consisting of the nucleic acid sequence of SEQ ID NO. 3 was used.

[0076] As a result, it was confirmed that the growth of cancer cells was statistically significantly reduced at 24, 48, and 72 hours following the inhibition of NARS2 (Fig. 10b).

[0077] In addition, the degree of cell growth of a Caco2 cancer cell model in which NARS2 was inhibited by siRNA (Caco2 NARS2KD model) and its control model was compared using an MTT assay. Two sets of siRNAs were synthesized, and experiments were performed using siRNAs consisting of a sense RNA with the sequence of SEQ ID NO. 1 and an antisense RNA with the sequence of SEQ ID NO. 1.

[0078] As a result, it was confirmed that the growth of cancer cells was statistically significantly reduced at 24 and 72 hours following the inhibition of NARS2 (Fig. 10c).

[0079] Table 1 below shows the shRNA and siRNA nucleic acid sequences targeting NARS2 mRNA used in the experiment.

[0080] shRNA GCTGCTATTCATTCCTACTTTCTCGAGAAAGTAGGAATGAATAGCAGC(Sequence No. 1) siRNA-1 sense strand: CAGAUCGGGACUUACAGA(SEQ No. 2)Antisense strand: UUCUGUAAGUCCCGAUCUG(SEQ No. 3) siRNA-2 sense strand: CAUUAACACUCAAGCCUUU(Sequence No. 4)Antisense strand: AAAGGCUUGAGUGUUAAUG (Sequence No. 5)

[0082] Experimental Example 6. Decrease in mitochondrial activity due to NARS2 inhibition

[0083] In a cancer cell model, a decrease in mitochondrial activity upon NARS2 inhibition was confirmed by measuring mitochondrial complex expression levels and using an oxygen consumption rate assay (Figs. 11 and 12). Additionally, a decrease in mitochondrial activity was confirmed by measuring mitochondrial potential in a cancer organoid model. As a result, it was confirmed that mitochondrial activity significantly decreased with the inhibition of NARS2 (Fig. 13).

[0085] Experimental Example 7. Gene expression profile following NARS2 inhibition

[0086] RNA sequencing was performed to confirm the gene expression profile upon NARS2 inhibition. The RNA sequencing results were analyzed using differential gene expression analysis, gene set enrichment analysis, and reporter metabolite analysis. As a result, it was confirmed that NARS2 inhibits cell cycle regulatory genes, DNA replication, and mitochondrial transcription (Figs. 14 to 16).

Claims

Claim 1 A pharmaceutical composition for the prevention or treatment of colorectal cancer comprising an asparagineyl tRNA synthase 2 (NARS2) inhibitor, wherein the inhibitor comprises: shRNA consisting of the nucleic acid sequence of SEQ ID NO. 1; siRNA consisting of a sense RNA consisting of the nucleic acid sequence of SEQ ID NO. 2 and an antisense RNA consisting of the nucleic acid sequence of SEQ ID NO. 3; or siRNA consisting of a sense RNA consisting of the nucleic acid sequence of SEQ ID NO. 4 and an antisense RNA consisting of the nucleic acid sequence of SEQ ID NO.

5. Claim 2 delete Claim 3 delete Claim 4 delete Claim 5 delete Claim 6 A health functional food for the prevention or improvement of colorectal cancer comprising an asparagineyl tRNA synthase 2 (NARS2) inhibitor, wherein the inhibitor is an shRNA composed of the nucleic acid sequence of SEQ ID NO. 1; a siRNA composed of a sense RNA composed of the nucleic acid sequence of SEQ ID NO. 2 and an antisense RNA composed of the nucleic acid sequence of SEQ ID NO. 3; or a siRNA composed of a sense RNA composed of the nucleic acid sequence of SEQ ID NO. 4 and an antisense RNA composed of the nucleic acid sequence of SEQ ID NO. 5.

Images