Method and primer set for detecting fungi present in particulate matter (PM) from environmental samples containing PM present in the atmosphere

Abstract

The present invention relates to a method and primer set for detecting fungi present in particulate matter (PM) from an environmental sample containing particulate matter in the atmosphere. According to one aspect, the method or primer set enables high-efficiency detection of fungi present in PM from an environmental sample, such as a filter that has captured PM. This overcomes the limitations of existing technologies, which had limitations in detecting microorganisms such as fungi present in PM due to significantly low efficiency in DNA extraction and PCR reactions caused by interfering factors based on the characteristics of the environmental sample.

Description

Technology Field

[0001] This invention relates to a method and a primer set for detecting fungi present in particulate matter (PM) from an environmental sample containing particulate matter in the atmosphere. Background Technology

[0002] Research on atmospheric particulate matter (PM) began with the analysis of chemical composition and has evolved to include bioaerosol analysis through culture methods, as well as, more recently, high-speed DNA sequencing based on Next Generation Sequencing (NGS). Fungi account for approximately 4 to 11% of particulate matter (PM 2.5) with a diameter of 2.5 μm or less; they cause diseases and allergies in humans and exhibit diverse community structures depending on the region and time. Atmospheric fungi can act as aggregation nuclei that trigger precipitation and rainfall, thereby influencing climate and water cycles. Accordingly, it is important to elucidate the community structure of atmospheric fungi and understand their relationships with influencing factors.

[0003] For the metagenomic analysis of fungi among these PMs, a polymerase chain reaction (PCR) process is performed first to extract DNA from PM 2.5 samples and amplify fungal genes. While commercial kits are commonly used to extract DNA from PM 2.5 samples, the PM and filter components act as obstacles during the extraction of fungi attached to the PM. Environmental samples, such as filters that have collected PM 2.5, tend to have lower biomass concentrations compared to other samples due to incidental substances like suspended dust and humic acid in addition to the target DNA to be extracted; these substances can also inhibit DNA extraction and the PCR reaction. Therefore, for successful PCR, it is crucial that the DNA extract used as a template is free of substances that interfere with the PCR, and that the cell walls of the target microorganisms are effectively lysed. Meanwhile, since fungal cell walls are more complexly structured and rigid compared to those of mammals or bacteria, they make cell lysis and nucleic acid recovery difficult, necessitating a method to efficiently lyse the cell walls. In summary, to efficiently detect microorganisms such as fungi present in PM from environmental samples, such as filters that have captured PM, it is necessary to consider interference factors in the PM sample, improve pretreatment and DNA extraction methods to lyse cells by isolating biological elements attached to the PM, and establish PCR conditions, such as primer combinations and temperature conditions, that enable gene amplification of fungi.

[0004] Accordingly, the inventors developed a method and a primer set for detecting mold present in PM from an environmental sample containing PM in the atmosphere, and completed the present invention by confirming the significantly superior ability of the method or primer set to detect mold in PM. The problem to be solved

[0005] One aspect provides a method for detecting fungi present in particulate matter (PM), comprising: (1) mixing a filter in which particulate matter (PM) present in the atmosphere is captured with a cell lysate; (2) removing the filter from the mixture obtained in step (1); (3) performing physical cell lysis on the sample from which the filter was removed in step (2); (4) extracting DNA from the cell lysate obtained in step (3); (5) amplifying nucleic acids using the DNA extracted in step (4) as a template and a primer set for detecting the Internal Transcribed Spacer 2 (ITS2) gene of fungi as primers; and (6) detecting the amplified product obtained in step (5).

[0006] Another aspect is to provide a set of primers for detecting mold present in particulate matter (PM).

[0007] Another aspect is to provide a kit for detecting mold present in particulate matter (PM), comprising a set of primers for detecting mold present in the PM.

[0008] Another aspect is to provide a primer set for detecting mold present in the above PM for use in detecting mold present in particulate matter (PM).

[0009] Another aspect is to provide a use for a primer set for detecting mold present in the above PM, for manufacturing a kit or composition for detecting mold present in particulate matter (PM).

[0011] Other objects and advantages of this application will become more apparent from the following detailed description, together with the appended claims and drawings. Anything not described in this specification is omitted, as it can be sufficiently recognized and inferred by those skilled in the art of this application or a similar art field. means of solving the problem

[0012] Each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.

[0014] One aspect provides a method for detecting fungi present in particulate matter (PM) (specifically, a sample containing particulate matter (PM) present in the atmosphere), comprising: (1) mixing a filter in which particulate matter (PM) present in the atmosphere is captured with a cell lysate; (2) removing the filter from the mixture obtained in step (1); (3) performing physical cell lysis on the sample from which the filter was removed in step (2); (4) extracting genetic material (e.g., DNA or RNA) from the cell lysate obtained in step (3); (5) amplifying nucleic acid using the genetic material (e.g., DNA or RNA) extracted in step (4) as a template and a primer set for detecting the Internal Transcribed Spacer 2 (ITS2) gene of fungi as primers; and (6) detecting the amplified product obtained in step (5).

[0015] Another aspect provides a method for extracting genetic material (e.g., DNA or RNA) of microorganisms (e.g., bacteria or fungi, etc.) present in particulate matter (PM) (specifically, a sample containing particulate matter (PM) present in the atmosphere), comprising the above step (1); the above step (2); the above step (3); and the above step (4).

[0016] Another aspect provides a method for amplifying genes (e.g., DNA or RNA) of microorganisms (e.g., bacteria or fungi, etc.) present in particulate matter (PM) (specifically, a sample containing particulate matter (PM) present in the atmosphere), comprising the above steps (1); (2); (3); (4); and (5).

[0017] The above mold is, Epicoccum inside, Alternaria inside, Cladosporium inside, Aureobasidium inside, Trametes inside, or Candida It may be a subordinate, but is not limited thereto.

[0018] The term "particulate matter (PM)" is a general term for fine solid or liquid substances suspended in the air, and the particulate matter includes not only inorganic and organic substances but also biological elements including cells, microorganisms, etc. The particulate matter may refer to fine dust and may be PM 2.5 with a particle size of 2.5 μm or less.

[0019] The above method may further include a step of collecting PM present in the atmosphere using a filter prior to step (1). The method of collecting PM present in the atmosphere using a filter can be performed through various methods or devices known in the art. For example, when air is introduced into an air sampler containing a filter, either naturally or by artificial induction, and passes through or comes into contact with the filter, PM present in the atmosphere may not pass through the filter and may be collected by the filter. According to one embodiment, the filter may be a quartz fiber filter, but is not limited thereto.

[0020] In step (1) of the above method, the mixing of the filter containing PM present in the atmosphere and the cell lysant may be performed in a container or tube of appropriate size. Accordingly, the filter containing PM present in the atmosphere may be cut to an appropriate size suitable for the size of the container or tube and used. Thus, the size of the filter is at least about 4 cm 2 Ideally, about 4 to 10 cm 2 , about 4 to 8 cm 2 , or about 5 to 7 cm 2 It may be possible. If the size of the filter is less than the above value, the amount of PM for DNA extraction may be significantly reduced, and if it exceeds the above value, the mixing between the filter and the cell lysant may not be smooth. Therefore, if the size of the filter deviates from the above value, the concentration of DNA extracted from the PM captured by the filter may decrease.

[0021] In step (1) of the above method, the cells present in the PM present in the atmosphere may be chemically dissolved by mixing the filter in which the PM present in the atmosphere is captured and the cell lysate. Specifically, in step (1), the cell walls of the cells present in the PM present in the atmosphere may be chemically dissolved by the cell lysate, thereby allowing intracellular substances to leak out of the cells. Additionally, in step (1), the PM present in the atmosphere may be separated from the filter by mixing the filter in which the PM present in the atmosphere is captured and the cell lysate. Specifically, the PM or cells contained within the PM (specifically, cells of microorganisms (e.g., fungi)) or microorganisms (e.g., fungi) may be separated from the filter. Therefore, the mixture obtained in step (1) may contain the filter, the PM separated from the filter or cells contained within the PM (specifically, cells of microorganisms (e.g., fungi)) or microorganisms (e.g., fungi), intracellular substances leaked from the cells or microorganisms (e.g., genetic material such as DNA), etc.

[0022] In step (1) of the above method, the mixing may be performed for about 15 to 35 minutes, about 20 to 30 minutes, about 15 to 25 minutes, about 15 to 20 minutes, or about 20 minutes. According to one embodiment, if the mixing time in step (1) is less than about 15 minutes, the concentration of DNA extracted from PM captured in the filter may be significantly reduced, and if it exceeds about 20 minutes, the DNA extraction concentration does not increase further, so the pretreatment time is unnecessarily long and the DNA extraction efficiency may be reduced.

[0023] In step (1) of the above method, the cell lysis solution may include, but is not limited to, NaOH, KOH, surfactants, or proteolytic enzymes. As the cell lysis solution, any substance capable of chemically lysing cells without damaging the genetic material of the cells (e.g., DNA) may be used without limitation, and, for example, commercially available cell lysis solutions or cell lysis buffers may be used.

[0024] Preferably, the cell lysate may be Proteinase K. According to one embodiment, when Proteinase K is used as the cell lysate in step (1), the DNA extraction concentration may be significantly increased compared to when other types of cell lysates are used, and as a result, the efficiency of detecting mold present in PM of the method may be significantly increased.

[0025] In step (2) of the above method, removing the filter from the mixture obtained in step (1) may be performed, for example, by filtering the mixture obtained in step (1) to obtain a filtered liquid from which the filter has been removed. The filtration may be vacuum filtration. According to one embodiment, in step (2), the mixture obtained in step (1) may be injected into a syringe, and then the piston of the syringe may be pushed to obtain a solution (or suspension) that has passed through the syringe (i.e., a filtered liquid from which the filter has been removed from the mixture obtained in step (1)). According to one embodiment, the filtered solution (or suspension) obtained in step (2) may contain the PM separated from the filter or cells that were contained within the PM (specifically, cells of microorganisms (e.g., fungi)) or microorganisms (e.g., fungi), intracellular substances (e.g., genetic material such as DNA) that have leaked from the cells or microorganisms.

[0026] In step (3) of the above method, the physical cell disruption may be performed using any one selected from the group consisting of a bead beating method, a high-pressure homogenizer method, and a ball mill method, but is not limited thereto. The above methods may be performed according to methods or apparatus known in the art.

[0027] The physical cell disruption described above involves physically disrupting or dissolving the cells of microorganisms (e.g., fungi) within the PM (or separated from the PM), specifically, physically disrupting or dissolving the cell walls of the cells, and through the physical cell disruption, intracellular substances (e.g., genetic material such as DNA) may leak out of the cells. According to one embodiment, in step (3), the physical cell disruption may be performed by mixing the filter-removed sample (e.g., solution or suspension) obtained in step (2) with beads and then performing bead beating. The bead beating is a method of breaking down or disrupting particles within a sample by mixing beads, which are small, hard microparticles, with the sample and homogenizing them, and can be performed mainly using a bead homogenizer device. When the above bead beating is performed using a bead homogenizer device, it can be performed at a speed of about 2 to 10 m / s, about 4 to 8 m / s, or about 5 to 7 m / s, and in this case, the effect of the above bead beating occurs most ideally, so that DNA extraction from PM captured in the filter can be achieved with excellent efficiency.

[0028] Accordingly, according to one embodiment, in step (3), cells (specifically, cells of microorganisms (e.g., fungi)) or microorganisms (e.g., fungi) that were not dissolved in step (1) and are contained in the filter-removed sample (e.g., solution or suspension) obtained in step (2) may be physically crushed or dissolved. As a result, in the cell lysate or cell lysate obtained in step (3), intracellular material (e.g., genetic material such as DNA) that has leaked out of the cells as microorganisms (e.g., fungi) or cells within the PM (or separated from the PM) are crushed or dissolved may be present at a higher concentration (e.g., a higher concentration compared to before step (3)).

[0029] In step (3) of the above method, the physical cell disruption or bead beating may be performed for about 50 seconds to 150 seconds, about 50 seconds to 90 seconds, about 70 seconds to 150 seconds, about 70 seconds to 90 seconds, about 90 seconds to 120 seconds, about 80 seconds to 100 seconds, about 80 seconds to 90 seconds, or about 90 seconds. According to one embodiment, if the physical cell disruption or bead beating time in step (3) is less than about 50 seconds, the concentration of extracted DNA may be significantly reduced, and if it exceeds about 90 seconds, the DNA extraction concentration does not increase further, so the pretreatment time is unnecessarily long and the DNA extraction efficiency may be reduced.

[0030] In step (4) of the above method, the method of extracting DNA from the cell lysate or cell lysate obtained in step (3) can be performed using a general method or device known in the art (e.g., a general commercial DNA extraction kit).

[0031] In step (5) of the above method, the primer set used as a primer to amplify nucleic acid using the DNA extracted in step (4) as a template may be a primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 9 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10. The primer set may detect the Internal Transcribed Spacer 2 (ITS2) gene of fungi (e.g., bind to the ITS2 gene of fungi).

[0032] According to one embodiment, in step (5) above, when amplifying nucleic acids using a primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 9 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10 as primers, the level of DNA amplification of fungi present in PM can be increased, and as a result, fungi present in PM can be detected with high efficiency.

[0033] In the above method, the step of amplifying the nucleic acid may be performed by a polymerase chain reaction (PCR), real-time PCR, multiplex PCR, ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification, or amplification via Qβ replicase, or any other suitable method known in the art for amplifying nucleic acid molecules.

[0034] In one embodiment, the step of amplifying the nucleic acid may utilize a polymerase chain reaction (PCR). The PCR may refer to a method of amplifying a target nucleic acid from primers that specifically bind to the target nucleic acid using a polymerase, and such a PCR method is well known in the art and may utilize commercially available mix compositions or kits.

[0035] For example, the above PCR may be performed using a reaction solution containing various components known in the art to be necessary for a PCR reaction. The reaction solution may include, for example, a sample to be analyzed (e.g., template DNA), the primer set, DNA polymerase, a dNTP mixture, PCR buffer solution, a DNase inhibitor, sterile water, etc. The DNA polymerase may be, for example, E. coli The "Klenow fragment" of DNA polymerase I, heat-stable DNA polymerase, Taq polymerase, or bacteriophage T7 DNA polymerase may be, but is not limited thereto. Additionally, the reaction solution may additionally include a primer set of a control marker in addition to the primer set. The PCR buffer solution may contain buffer components such as KCl, Tris-HCl, or MgCl2, and may, for example, include a PCR buffer.

[0036] In the above method, the PCR can be performed under general PCR reaction conditions in which the template DNA is initially denatured at 94-95°C, followed by cycles of denaturation, annealing, and extension, and finally elongation at 72°C. In the above, denaturation and amplification can be performed at 94-95°C and 72°C, respectively, and the temperature during annealing may vary depending on the type of primer. According to one embodiment, when a primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 9 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10 is used as a primer, and PCR is performed by attaching the primer set to the template under an annealing temperature condition of 57°C to 59°C (preferably 58°C), the level of DNA amplification of fungi present in the PM can be further increased, and thereby, fungi present in the PM can be detected with higher efficiency. The time and number of cycles of each step can be determined according to conditions generally practiced in the art.

[0037] The nucleic acid amplified in the step of amplifying the nucleic acid of the above method may be the target sequence of the primer set, i.e., the DNA sequence of the fungal ITS2 gene region.

[0038] In the above method, the step of detecting the amplified product may be performed through one or more methods selected from the group consisting of DNA chips, gel electrophoresis, radiometric measurement, fluorescence measurement, and phosphorescence measurement. When detecting via gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis may be used depending on the size of the amplified product. When detecting via fluorescence measurement, PCR may be performed using the primer set labeled with a fluorescent substance, and then the fluorescence may be measured using a fluorescence detector. When detecting via radiometric measurement, a radioactive substance may be added to the PCR reaction solution to label the amplified product, and then the radioactivity may be measured using a radiometric detector such as a Geiger counter or a liquid scintillation counter. The detection or analysis of the obtained amplified product may be performed via restriction enzyme cleavage, fluorescence measurement, or phosphorescence measurement, but is not limited thereto.

[0039] The above method may further include a step of determining that mold present in PM in a filter sample in which PM present in the atmosphere has been captured has been detected if the amplified product is detected in the step of detecting the amplified product. For example, if gel electrophoresis is used to detect the amplified product, it can be determined that mold present in PM present in the atmosphere has been detected in a filter sample in which PM present in the atmosphere has been captured if a band is generated at a specific location on the gel. In other words, when a product obtained by amplifying nucleic acids using a primer set for detecting the ITS2 gene of mold as primers and using a sample derived from a filter sample in which PM present in the atmosphere has been captured as a template, is loaded onto a gel and electrophoresis is performed, if there is a gene region in the sample derived from the filter sample in which PM present in the atmosphere has been captured that binds to and amplifies the primer set, its amplified product may appear as a band on the gel. Through this, it can be determined that mold present in PM present in the atmosphere has been detected in the filter sample in which PM present in the atmosphere has been captured.

[0040] The above method may further include, prior to step (6), a step of amplifying nucleic acid using a primer set that binds to a base sequence within the amplification product as a primer, using the amplification product obtained in step (5) as a template (i.e., a secondary amplification step (e.g., secondary PCR or nested PCR)). In this case, the primer set may be a primer set suitable for re-amplifying the amplification product obtained in step (5) or the gene region within the amplification product.

[0041] According to one embodiment, the second amplification step may be performed using the same primer set and the same conditions and methods as the step (5) (i.e., the first amplification step (e.g., first PCR)). According to one embodiment, in the method, if the second amplification step is additionally performed, the ITS2 gene region of the fungus present in the PM can be amplified to a higher level, thereby enabling the detection of the fungus present in the PM with higher efficiency.

[0043] Another aspect is a first primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 1 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10; a second primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 1 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 11; a third primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 2 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 11; a fourth primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 4 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 12; a fifth primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 5 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 13; and a sixth primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 2 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10. A seventh primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 3 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10; an eighth primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 7 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10; a ninth primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 8 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10; and a tenth primer set comprising an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 9 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10;A primer set for detecting mold present in particulate matter (PM) (specifically, particulate matter present in the atmosphere) is provided, comprising one or more primer sets selected from the group consisting of

[0044] The above primer set may be a primer set for amplifying fungal genes (e.g., DNA or RNA) present in particulate matter (PM) (specifically, particulate matter present in the atmosphere).

[0045] According to one embodiment, the primer set for detecting mold present in the PM may include the 10th primer set, that is, an oligonucleotide composed of the nucleotide sequence of SEQ ID NO. 9 and an oligonucleotide composed of the nucleotide sequence of SEQ ID NO. 10. According to one embodiment, the 10th primer set can amplify the DNA of mold present in the PM to a superior level compared to the other primer sets, and thereby, the mold present in the PM can be detected with higher efficiency.

[0046] The term "primer" refers to a single-stranded oligonucleotide sequence capable of forming a hybrid complex with the nucleic acid strand to be copied, and can act as a starting point to initiate template-directed DNA synthesis under suitable conditions (e.g., the presence of four different nucleoside triphosphates (NTPs) and a polymerase such as DNA or RNA polymerase), a suitable temperature, and a suitable buffer.

[0047] The length and sequence of the above primers should allow the synthesis of the extension product to begin, and the specific length and sequence of the primers can be determined based on the complexity of the required DNA or RNA target, as well as usage conditions such as temperature and ionic strength, and the characteristics of the primers to be used. For example, the specific length and sequence of the primers can be determined by considering various conditions such as the GC contents, GC array, annealing temperature, and ionic strength.

[0048] Specifically, the length of the primer may be 10 to 60 nt, 15 to 50 nt, or 15 to 30 nt. The primer does not need to be exactly complementary to the sequence of the template, but may be complementary enough to form a hybrid complex with the template.

[0049] The above nucleotide sequence includes not only the nucleotide sequences composed of each of SEQ ID NOs 1 to 13, but also any nucleotide sequences that exhibit homology of 80% or more, specifically 90% or more, more specifically 95% or more, even more specifically 98% or more, and most specifically 99% or more, and which exhibit substantially the same or corresponding efficacy as the above nucleotide sequence without limitation. Furthermore, it is obvious that any nucleotide sequence having such homology, in which some sequences are deleted, modified, substituted, or added, is also included within the scope of the present invention.

[0050] The term "homology" refers to the degree of similarity of nucleotide sequences, which may be expressed as a percentage according to the degree of correspondence with a given nucleotide sequence. In this specification, a homologous sequence having the same or similar activity as a given nucleotide sequence is indicated as "% homology." For example, this can be verified by using standard software, specifically BLAST 2.0, to calculate parameters such as score, identity, and similarity, or by comparing sequences through hybridization experiments performed under defined stringent conditions, and the defined appropriate hybridization conditions may be determined by methods within the scope of the art and well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0051] The above primer set can be used for gene detection or amplification, and preferably for the detection or amplification of the ITS2 gene of fungi present in PM. Accordingly, the above primer set can be used to detect fungi present in PM.

[0052] The oligonucleotide of the primer may include nucleotide analogs such as phosphorothioates, alkylphosphorothioates, peptide nucleic acids, or intercalations. The oligonucleotide may further include a labeling material that emits fluorescence, phosphorescence, or radioactivity.

[0053] The above labeling material may be labeled at the 5' end of the oligonucleotide. The fluorescent labeling material may be VIC, NED, FAM, PET, or a combination thereof. In addition, the radioactive labeling material is, 32 P or 35 Radioactive isotopes such as S can be incorporated into the amplification product through a PCR reaction using a PCR reaction solution added thereto.

[0054] In one embodiment, the presence or absence, clarity, size, etc. of an amplification product generated by a polymerase chain reaction (PCR) using the primer set can be determined, and the amount, etc., of fungi or genes derived therefrom within the PM can be determined.

[0055] Among the terms or elements mentioned in the above primer set, those that are the same as those mentioned in the description of the above method are understood to be the same as those mentioned above in the description of the above method.

[0057] Another aspect provides a kit for detecting mold present in particulate matter (PM) (specifically, particulate matter present in the atmosphere), comprising a primer set for detecting mold present in PM, comprising one or more primer sets selected from the group consisting of the first primer set; the second primer set; the third primer set; the fourth primer set; the fifth primer set; the sixth primer set; the seventh primer set; the eighth primer set; the ninth primer set; and the tenth primer set.

[0058] The above kit may be a kit for amplifying the genes (e.g., DNA or RNA) of fungi present in particulate matter (PM) (specifically, particulate matter present in the atmosphere).

[0059] According to one embodiment, the primer set for detecting mold present in the PM may include the tenth primer set. Additionally, the kit may further include a primer set of a control marker in addition to the primer set.

[0060] The above kit may be a PCR kit. Accordingly, in addition to the primer set, the above kit may additionally include components necessary for PCR or verification of the amplification product, such as DNA polymerase, a dNTP mixture (dATP, dCTP, dGTP, and dTTP), PCR buffer solution, a DNase inhibitor, or sterile water, but is not limited thereto.

[0061] The above DNA polymerase is, for example, E. coli The "Klenow fragment" of DNA polymerase I, heat-stable DNA polymerase, reverse transcriptase such as RNA-dependent DNA polymerase, Taq polymerase, or bacteriophage T7 DNA polymerase may be, but is not limited thereto. The PCR buffer solution may contain buffer components such as KCl, Tris-HCl, or MgCl2, and may, for example, contain a PCR buffer.

[0062] According to one embodiment, the kit may include a composition for detecting mold present in the PM, comprising a primer set for detecting mold present in the PM. In addition to the primer set, the detection composition may further include components necessary for the identification of PCR or amplification products as described above.

[0063] Additionally, the kit may further include the cell lysate (or a composition for cell lysation containing the same), a vacuum filtration tool (e.g., a syringe) for removing a filter (i.e., a filter from which PM has been separated or removed) from a mixture after mixing the sample with the cell lysate when the sample is a filter in which PM has been captured, a tube or composition for bead beating, or a composition or tool for DNA extraction, etc.

[0064] The above kit may include a guide. The guide is a printed document explaining the use of the kit, for example, methods for cell lysis or disruption, methods for DNA extraction, methods for preparing PCR buffer solutions, presented reaction conditions, etc. The guide includes instructions in the form of a pamphlet or leaflet, a label attached to the kit, and on the surface of a package containing the kit. Additionally, the guide includes information disclosed or provided through an electronic medium, such as the Internet.

[0065] Another aspect provides a method for detecting fungi present in particulate matter (PM) (specifically, particulate matter present in the atmosphere), comprising the steps of: using a gene (e.g., DNA or RNA) isolated from particulate matter (PM) (specifically, particulate matter present in the atmosphere or a sample containing the same) as a template and using the primer set (specifically, the 10th primer set) as a primer to amplify a nucleic acid; and detecting the amplified product.

[0066] Another aspect provides a method for amplifying a gene (e.g., DNA or RNA) of a fungus present in particulate matter (PM) (specifically, particulate matter present in the atmosphere) comprising the step of using a gene (e.g., DNA or RNA) isolated from particulate matter (PM) (specifically, particulate matter present in the atmosphere or a sample containing the same) as a template and using the primer set (specifically, the 10th primer set) as a primer to amplify the nucleic acid.

[0067] The gene isolated from the above PM may be a gene of microbial origin present in the PM.

[0068] Among the terms or elements mentioned in the above kit and method, those that are the same as those mentioned in the description of the above-described method or the above-described primer set are understood to be the same as those mentioned in the description of the above-described method or the above-described primer set.

[0070] Another aspect provides the use of the primer set for detecting mold present in the above PM for detecting mold present in particulate matter (PM).

[0071] Another aspect provides a use for a primer set for detecting mold present in PM, for manufacturing a kit or composition for detecting mold present in particulate matter (PM).

[0072] Among the terms or elements mentioned in the above uses, those mentioned in the description of the above method, the above primer set, or the above kit are understood to be the same as those mentioned above in the description of the above method, the above primer set, or the above kit. Effects of the invention

[0073] According to a method or primer set based on one aspect, fungi present in PM can be detected with high efficiency from environmental samples, such as filters that capture PM present in the atmosphere. This can resolve the problems of existing technologies, which had limitations in detecting microorganisms such as fungi present in PM due to significantly low efficiency in DNA extraction and PCR reactions caused by interfering factors depending on the characteristics of the environmental sample. Brief explanation of the drawing

[0074] FIG. 1 is an image showing a pretreatment method for extracting DNA from a filter sample that has captured PM according to one embodiment (a: Slicing; b: Complex; c: Bead beating). FIG. 2 is a blank filter sample (Sterilized) according to one embodiment, Bacillus subtilis Filter sample inoculated with strain culture ( Bacillus A (OD 2.324): Dispensing of OD 2.324 stock culture; Bacillus B (OD 0.639): A graph showing the DNA concentration extracted from each of the culture dilution of OD 0.639, the filter sample that collected PM 2.5, and the filter sample that collected TSP. Figure 3 is a graph comparing the DNA extraction concentration when DNA is extracted from a filter sample that has collected PM by applying a Soil kit according to one embodiment and a pretreatment method (Slicing, Complex, or Longer lysis). Figure 4 is a graph comparing the DNA extraction concentration when DNA is extracted from a filter sample that has collected PM by applying a Water kit according to one embodiment and a pretreatment method (Longer lysis or Longer lysis + Bead beating). FIG. 5 is a graph comparing DNA extraction concentrations according to combinations of methods for extracting DNA from a filter sample that has captured PM according to one embodiment ((a): use of a water kit; (b): longer lysis; (c): bead beating). FIG. 6 is a graph comparing the DNA extraction concentration according to the chemical cell lysis time in a method for extracting DNA from a filter sample that has captured PM according to one embodiment. FIG. 7 is a graph comparing the DNA extraction concentration according to the physical cell lysis time in a method for extracting DNA from a filter sample that has captured PM according to one embodiment. FIG. 8 is a graph showing the DNA concentration extracted from each of 15 types of filter samples that collected PM 2.5 by applying a method for extracting DNA from filter samples that collected PM according to one embodiment (using a water kit, performing longer lysis, and performing bead beating). FIG. 9 is a figure showing the results of performing PCR using a primer set (ITS3tagmix3 / ITS4) for detecting mold present in PM according to one embodiment, wherein the amplification product obtained after performing primary PCR (Primary amplification) using DNA extracted from each of 15 types of filter samples that captured PM 2.5 as a template; and the amplification product obtained by performing secondary PCR (Nested amplification) using the amplification product as a template (a: graph showing the result of converting the relative abundance of the gel-phase amplification product into numerical values; b: gel electrophoresis result image showing the amplification product). Specific details for implementing the invention

[0075] The present invention will be explained in more detail below through experimental examples and embodiments. However, these experimental examples and embodiments are intended to illustrate the present invention, and the scope of the present invention is not limited to these experimental examples and embodiments.

[0076] Furthermore, unless otherwise specifically defined in this specification, all scientific and technical terms used herein may have the same meaning as commonly understood by those skilled in the art to which the present invention pertains.

[0078] Reference Example

[0079] 1. Sample

[0080] Filters that collected PM were used to extract DNA from atmospheric particulate matter (PM) for metagenomic analysis. Total suspended particles (TSP) or PM 2.5 (atmospheric particulate matter with a particle size of 2.5 μm or less) were collected using a high-volume air sampler (SIBATA HV-RW, Japan) in a quartz fiber filter (2500QAT 8 x 11 in., Pall, USA) at a flow rate of approximately 1000 L / min for about 23 hours. To find the optimal DNA extraction method and base sequence amplification conditions, TSP was collected in a quartz fiber filter (2500QAT-UP 8 x 10, PALL, USA) and used. TSP was collected in March 2021 from the rooftop of the Asan Engineering Building (5 stories high) at Ewha Womans University in Seoul.

[0081] To evaluate the reproducibility of the optimized DNA extraction method and PCR conditions, DNA extraction and PCR were performed on 15 PM 2.5 collection filters collected on different days. PM 2.5 was collected onto quartz fiber filters using a high-volume air sampler at the Metropolitan Air Quality Monitoring Station located in Bulgwang-dong, Eunpyeong-gu, Seoul. Information on the collection date, PM 2.5 concentration, temperature, average wind speed, and average relative humidity is summarized in Table 1 below. To verify whether the optimized method is effectively applied to various PM 2.5 samples, PM 2.5 samples obtained over a four-month period from January to April 2018 were used. The PM 2.5 concentration of the samples was approximately 46 ± 28 μg / m³. 3 (approx. 7 to 108 μg / m² 3 The temperature was approximately 5.8±9.6℃ (approx. -8 to 15.6℃), the average wind speed was approximately 1.9±0.8 m / s (approx. 0.7 to 3.8 m / s), and the relative humidity was approximately 55.1±11.3% (approx. 34.9 to 68.8%).

[0082] All quartz fiber filters used in the experiment were individually wrapped in aluminum foil before PM collection and sterilized at approximately 550°C for about 12 hours, and after PM collection, were frozen at approximately -20°C or below until DNA extraction.

[0083] PM 2.5 sampleNo. Sampling date PM 2.5 (µg / m³) Temperature (°C) Wind speed (m / s) Relative humidity (%) 1 15 / Jan. / 2018 45 4.7 1.4 63.9 2 January 16, 2018 81 3.5 0.7 59.1 3 26 / Jan. / 2018 21 -14.8 2.6 34.9 4 3 / Feb. / 2018 20 -7.3 3.8 47 5 Feb. 7, 2018 24 -8 1.5 39.8 6 Feb. 9, 2018 44 0.4 1.1 43.9 7 20 / Mar. / 2018 7 4.7 3.4 39.9 8 24 / Mar. / 2018 89 7.6 2.1 61.9 9 25 / Mar. / 2018 108 9.6 1.7 65.6 10 27 / Mar. / 2018 63 13.3 1.6 61.1 11 28 / Mar. / 2018 38 14 2.2 66.4 12 29 / Mar. / 2018 46 15.4 1.6 66.3 13 March 30, 2018 39 14.8 1.7 55.6 14 March 31, 2018 28 14 1.9 52.9 15 1 / Apr. / 2018 35 15.6 1.5 68.8

[0085] 2. DNA Extraction and Pretreatment Methods

[0086] Since DNA extraction from PM samples is the first step required for metagenomic analysis, various pretreatment methods were applied to extract high-yield DNA. To investigate the interference effect of filters containing PM from which DNA was to be extracted, experimental and control groups were established, and the concentration of the extracted DNA product was measured. A sterilized filter without PM was used as the negative control, and a filter cultured in liquid medium was used as the positive control. Bacillus subtilis Filters dispensed with approximately 1 mL each of the stock culture and the diluted culture were used. The experimental groups were set as filters that collected PM 2.5 and filters that collected TSP, and DNA was extracted from each filter. At this time, DNA was extracted using a soil kit (Nucleospin soil kit, Macherey-Nacel, Germany), and no pretreatment was performed.

[0087] Since DNA was extracted from the positive control, various pretreatment steps were added while using the same soil kit. The pretreatment methods applied included slicing the filter containing the captured PM, vacuum filtration on a glass fiber filter after centrifugation (complex), and longer lysis. To minimize filter interference, the slicing or complex method was applied to remove the filter and utilize only the captured PM. The slicing method is a technique for separating PM from a filter by peeling off only the filter layer containing the captured PM from a layered filter, as shown in Fig. 1a. The complex method involves placing the filter containing the captured PM (approx. 9 x 12 cm) into a 50 mL conical tube from which DNA had been removed. 2 This method separates PM from the filter by rolling up the slicing sheet, injecting approximately 45 mL of phosphate-buffered saline (PBS) solution, centrifuging at a low speed of approximately 200 relative centrifugal force at approximately 4°C for about 3 hours, and then vacuum filtering through a glass fiber filter to obtain a filtrate containing PM (Fig. 1b). The filter used to capture PM in the slicing and complex method is a quarter sheet (approx. 10 x 11 cm). 2 ) and 1 sheet (approx. 20 x 22 cm 2A cell lysate (Soil kit: Buffer SL1 (Macherey-Nagel, Germany)) was injected into the PM samples separated from the filter by the above slicing or complex method, and the samples were allowed to stand to induce chemical cell lysis. At this time, a longer lysis pretreatment was performed by increasing the chemical cell lysis time from 10 minutes to 20 minutes or more to ensure sufficient chemical lysis of the cells. Subsequently, the samples were placed in bead tubes, and a bead beating process was performed using a bead homogenizer (FastPrep-24, MP Biomedicals, USA) (Fig. 1c).

[0088] DNA extraction using the Water kit (Nucleospin eDNA water kit, Macherey-Nagel, Germany) differs from the Soil kit method in that it uses a different type of cell lysant (Water kit: Proteinase K (Macherey-Nagel, Germany)); and since it uses a 5 mL tube, it allows for the use of larger filter samples (whereas the Soil kit uses a 2 mL tube); and it differs from the pretreatment methods of the slicing and complex in that it does not separate PM from the filter that collected PM, but rather mixes the cell lysant with the filter that collected PM itself. Specifically, the filter that collected PM is approximately 2 x 3 cm 2The PM collection surface was cut in half and rolled tightly against the wall of a 5 mL tube, and a cell lysant (Proteinase K (Macherey-Nagel, Germany)) was injected. The cell lysis reaction was performed using a stirrer (RS-100 Rocker shaker, Bioand Corp., South Korea) while stirring sufficiently to avoid damaging the filter. Here, a pretreatment method for longer lysis was applied by increasing the stirring time from 10 minutes to 20 minutes or more. After stirring, the mixture of the PM collection filter and the cell lysant (i.e., the reactant) was transferred to a 5 mL syringe, and the piston of the syringe was pushed to collect the solution (or reactant, or suspension) that passed through the syringe (i.e., the filtrate from which the filter was removed) into a 2 mL bead tube. Afterward, a pretreatment was performed by bead beating a 2 mL bead tube containing the solution (or reactant, or suspension) at about 6 m / s for about 1 minute 30 seconds or more using a bead homogenizer (FastPrep-24, MP Biomedicals, USA) (Fig. 1 c). The bead beating method is a method of physically rupturing or lysing cells using beads, and can be performed using general methods or devices known in the art.

[0089] Subsequently, DNA was extracted from the solution (or lysate, or suspension) after bead beating was completed. DNA extraction was performed according to the manual of the Soil kit or Water kit, and approximately 45 μL of elution buffer was used for DNA elution. The method for DNA extraction can be performed using general methods or devices known in the art (e.g., general commercial DNA extraction kits, etc.).

[0090] The concentration of the extracted final DNA product was measured as DNA mass per volume of elution buffer solution using a spectrometer (QuickDrop Spectrophotometer, Molecular Devices, USA) and converted to DNA mass per filter area. The method for measuring the DNA concentration above can be performed using general methods and devices known in the art.

[0092] 3. PCR Conditions and Primer Combinations

[0093] To analyze the atmospheric fungal metagenome, PCR was performed using the primers in Table 2 below to amplify the nucleotide sequences of the Internal Transcribed Spacer 2 (ITS2) gene region of the fungi. The master mix solution for PCR was prepared by mixing approximately 35.95 μL of double distilled water, approximately 5 μL of PCR buffer solution containing MgCl2, approximately 1 μL of dNTPs (approx. 2.5 mM), approximately 0.8 μL of BSA, and approximately 2 μL each of forward and reverse primers to a total volume of approximately 50 μL. The time and temperature conditions were set as follows: 3 minutes at 95°C for initial denaturation; 30 seconds at 95°C for DNA denaturation; and 30 seconds at 72°C for DNA extension. Primer annealing, performed prior to DNA extension, was conducted for 30 seconds in separate tubes at 52°C, 56°C, and 58°C for each primer combination, and then compared.

[0094] Approximately 5 μL of the PCR product was mixed with approximately 1 μL of loading dye (Dyne Bio Inc., South Korea), dispensed onto an approximately 1.5% agarose gel, and subjected to electrophoresis at approximately 100 V for about 33 minutes. The gel obtained from electrophoresis was Gel DocTM After imaging with XR+ (BIO-RAD, USA), the concentration of the PCR product was quantified relatively using the Quantity Tool function of the Image Lab (BIO-RAD, USA) software. The clarity of the 500 bp band of approximately 5 μL of a 1.5kb DNA ladder (Dyne Bio Inc., South Korea), which was used to verify the base pair position and amplification status of DNA bands during electrophoresis, was set to a reference of 1.0, and the band clarity of the PCR product amplified in the ITS2 region was measured as relative abundance.

[0095] Direction Primer name Nucleotide sequences (5'-> 3') Sequence number Forward ITS3 GCATCGATGAAGAACGCAGC 1 5.8SR TCGATGAAGAACGCAGCG 2 ITS86F GTGAATCATCGAATCTTTGAA 3 gITS7 GTGARTCATCGARTCTTTG 4 rD5-ITS2 TCCTCCGCTTATTGATATGC 5 ITS3-R ATCGATGAAGAACACAG 6 ITS3tagmix1 CTAGACTCGTCATCGATGAAGAACGCAG 7 ITS3tagmix2 CTAGACTCGTCAACGATGAAGAACGCAG 8 ITS3tagmix3 CTAGACTCGTCACCGATGAAGAACGCAG 9 Reverse ITS4 TCCTCCGCTTATTGATATGC 10 ITS4-B CAGGAGACTTGTACACGGTCCAG 11 ITS4ngs TTCCTSCGCTTATTGATATGC 12 rb1-ITS2f CGATACTTGGTGTGAATTGCAG 13

[0097] Example 1. Comparison of DNA extraction concentrations according to the use of soil kit and pretreatment method

[0098] First, the negative control is a sterilized blank filter sample, and the positive control is Bacillus subtilis Filter sample inoculated with strain culture (stock culture with OD 2.324 ( Bacillus A (OD 2.324)) or culture dilution of OD 0.639 ( Bacillus DNA was extracted from filter samples collected from B (OD 0.639) aliquot), and the experimental groups PM 2.5 and TSP, respectively, and DNA extraction concentration (DNA mass per volume of elution buffer solution (ng / μL)) and DNA mass per filter area (ng / cm²) were measured. 2)) was compared. At this time, no special pretreatment was performed on each of the above filter samples. Using a Soil kit (Nucleospin soil kit, Macherey-Nagel, Germany), each of the above filter samples and a cell lysate (Soil kit: Buffer SL1 (Macherey-Nagel, Germany)) were mixed in a 2 ml tube, and chemical cell lysis was performed for about 10 minutes, followed by bead beating to obtain cell lysates. DNA was extracted from the cell lysates according to the Soil kit manual, and specific experimental methods, such as the bead beating method and the method for measuring the concentration of extracted DNA, are as described in Reference Example 2.

[0099] As a result, as shown in Figure 2, no DNA was extracted from the sterile blank filter sample, which is the negative control. In addition, the positive control Bacillus subtilis DNA was extracted from filter samples dispensed with strain culture medium, and the extracted DNA concentration was measured to be approximately 28 ng / μL when the stock culture medium with an OD of 2.324 was dispensed, and approximately 7 ng / μL when the diluted culture medium with an OD of 0.639 was dispensed. However, the concentration of the extracted DNA product in filter samples that collected the experimental groups, PM 2.5 and TSP, was measured to be 0.0 ng / μL. Through this, it was found that it is very difficult to extract DNA from microorganisms, such as fungi, present in particulate matter from filters that collect particulate matter present in the atmosphere using general DNA extraction methods.

[0100] Therefore, to increase the efficiency of DNA extraction from microorganisms, such as fungi, present in the PM from the filter that collected the PM, pretreatment was performed on the filter sample containing the PM. Specifically, additional sample pretreatment was performed using the same Soil kit used above. Specifically, to reduce the interference effect of the filter, the filter was removed and only the collected PM was used; thus, a filter sample containing PM 2.5 (1 / 4 sheet (approx. 10 x 11 cm) 2 ) or 1 sheet (approx. 20 x 22 cm) 2 Pretreatment by slicing or complex methods was performed on the sample. After removing the filter, a cell lysate (Soil kit: Buffer SL1 (Macherey-Nagel, Germany)) was injected into the sample containing PM, and chemical cell lysis was performed for approximately 10 minutes. Additionally, a pretreatment (longer lysis) was performed to increase the chemical cell lysis time to approximately 20 minutes or more. Cell lysates were obtained by bead beating the reaction mixtures after chemical cell lysis, and DNA was extracted from each cell lysate. DNA extraction concentrations (DNA mass per volume of elution buffer solution (ng / μL)) and DNA mass per filter area (ng / cm²) were measured. 2 )) was compared. In this case, DNA was extracted using a soil kit (Nucleospin soil kit, Macherey-Nacel, Germany) according to the manual, and the aforementioned pretreatment methods (slicing, complex, and longer lysis), bead beating method, and method for measuring extracted DNA concentration were as described in Reference Example 2. The specific experimental groups are as follows:

[0101] (1) Soil kit: DNA extraction after chemical cell lysis and bead beating by mixing the filter sample itself, which has captured PM, with a cell lysate (Buffer SL1 (Macherey-Nagel, Germany));

[0102] (2) Slicing (1 / 4): Filter sample with collected PM (1 / 4 sheet (approx. 10 x 11 cm) 2 After isolating only PM from )) by a slicing method, DNA extraction was performed on the isolated PM after chemical cell lysis and bead beating;

[0103] (3) Slicing (1): Filter sample with collected PM (1 sheet (approx. 20 x 22 cm) 2 After isolating only PM from )) by a slicing method, DNA extraction was performed on the isolated PM after chemical cell lysis and bead beating;

[0104] (4) Complex (1 / 4): Filter sample with captured PM (1 / 4 sheet (approx. 10 x 11 cm) 2 After isolating only PM from )) by a complex method, DNA extraction was performed on the isolated PM after chemical cell lysis and bead beating;

[0105] (5) Complex (1): Filter sample that captured PM (1 sheet (approx. 20 x 22 cm) 2 After isolating only PM from )) by a complex method, performing chemical cell lysis and bead beating on the isolated PM, and then extracting DNA; and

[0106] (6) Longer lysis: In the above '(2) Slicing (1 / 4)', the chemical cell lysis time is increased to about 20 minutes.

[0107] As a result, as shown in Fig. 3, when slicing pretreatment was performed to remove only the PM portion from the filter, the concentration of the extracted DNA was approximately 2 ng / μL (approximately 0.9 ng / cm²).2 ) (Slicing (1 / 4)) and about 6 ng / μL (about 0.7 ng / cm²) 2 It was measured as ) (Slicing (1)). It was determined that the influence of the filter could not be avoided even though only the dust-covered layer was cut and peeled off to minimize filter interference. Furthermore, it was determined that when a single PM collection filter was used, too many PM particles acted as a hindering factor in the DNA extraction process, preventing proper lysis of microbial cells. In the case of the quartz fiber filter, the material had the characteristics of tearing easily, scattering, and not settling well even after centrifugation. Considering that these filter characteristics may have interfered with DNA extraction, when the complex pretreatment to completely separate only PM from the filter was performed instead of the slicing pretreatment, the concentration of the extracted DNA was approximately 2 ng / μL (approximately 0.9 ng / cm²). 2 ) (Complex (1 / 4)) and about 10 ng / μL (about 1.1 ng / cm²) 2 ) (Complex (1)) was measured. Thus, it was found that there is no significant difference in DNA extraction efficiency between the slicing and complex pretreatment methods, and both exhibit relatively low levels of DNA extraction efficiency. In addition, when a longer lysis pretreatment was performed by increasing the chemical cell lysis time to about 20 minutes (Longer lysis), the concentration of extracted DNA was about 3 ng / μL (about 1.4 ng / cm²). 2 It was measured as ), confirming that there was no significant change in DNA extraction efficiency.

[0108] Through this example, it was confirmed that when using a Soil kit that uses Buffer SL1 (Macherey-Nagel, Germany) as a cell lysant to extract DNA from a filter sample containing particulate matter present in the atmosphere, the DNA extraction efficiency is not high, and even if the sample pretreatment processes of slicing, complex, and longer lysis are additionally performed, the DNA extraction efficiency does not increase significantly.

[0110] Example 2. Comparison of DNA extraction concentrations according to the use of the water kit and pretreatment method

[0111] For filter samples containing captured PM, a water kit (Nucleospin eDNA water kit, Macherey-Nacel, Germany) was used, and an additional pretreatment process was performed to extract DNA from the samples. The DNA extraction concentration (DNA mass per volume of elution buffer solution (ng / μL)) and DNA mass per filter area (ng / cm²) were then determined. 2 DNA extraction using a Water kit on a filter sample that has captured PM is different from the Soil kit method of Example 1 in that it uses a different type of cell lysate (Water kit: Proteinase K (Macherey-Nagel, Germany)); and since it uses a 5 mL tube, it allows for the use of a larger size filter sample; and it is different from the slicing and complex pretreatment method of Example 1 in that it does not separate PM from the filter that has captured PM, but mixes the filter that has captured PM with the cell lysate itself.

[0112] Specifically, the filter that captured PM is approximately 2 x 3 cm 2After cutting the filter and rolling it tightly against the wall of a 5 mL tube with the PM collection surface facing inward, a cell lysate (Proteinase K (Macherey-Nagel, Germany)) was injected, and a cell lysis reaction was performed by stirring with a stirrer (RS-100 Rocker shaker, Bioand Corp., South Korea) for about 10 minutes without damaging the filter. Here, a pretreatment for longer lysis was performed by increasing the stirring time from 10 minutes to 20 minutes or more. After stirring, the mixture of the PM collection filter and the cell lysate (i.e., the reactant) was transferred to a 5 mL syringe, and the piston of the syringe was pushed to collect the solution (or reactant, or suspension) that passed through the syringe (i.e., the filtrate from which the filter was removed) into a 2 mL bead tube. Subsequently, a pretreatment was performed using a bead homogenizer (FastPrep-24, MP Biomedicals, USA) by bead beating a 2 mL bead tube containing the solution (or reactant, or suspension) at approximately 6 m / s for at least 1 minute and 30 seconds. Afterward, DNA was extracted from the solution (or lysate, or suspension) after bead beating was completed, and the concentration of the extracted DNA was measured. The DNA extraction was carried out according to the manual of the water kit, and approximately 45 μL of elution buffer was used for DNA elution. The method for DNA extraction and measurement of the extracted DNA concentration is as described in Reference Example 2 and can be performed using general methods known in the art. The specific experimental groups are as follows:

[0113] (1) Water kit: DNA extraction after chemical cell lysis is performed by mixing the filter sample itself, which has captured PM, with a cell lysate (Proteinase K (Macherey-Nagel, Germany));

[0114] (2) Longer lysis: In the above '(1) Water kit', the chemical cell lysis time is increased to about 20 minutes; and

[0115] (3) Longer lysis and bead beating: In the above '(2) Longer lysis', after performing chemical cell lysis, additional bead beating (physical cell lysis) is performed, and then DNA is extracted.

[0116] As a result, as shown in Fig. 4, when the Water kit alone was performed without the pretreatment of Longer lysis and bead beating, the concentration of the extracted DNA was approximately 27 ng / μL (approximately 80.0 ng / cm²). 2 It was measured as ), and it was found that this value increased by approximately 2 to 40 times or more compared to the experimental group of Example 1 above. In addition, when the above Longer lysis pretreatment was additionally performed, the concentration of extracted DNA was approximately 46 ng / μL (approximately 613.3 ng / cm²). 2 It further increased to ), and when the bead beating pretreatment was additionally performed in addition to the Longer lysis pretreatment, the concentration of the extracted DNA was approximately 77 ng / μL (approximately 1026.7 ng / cm²). 2 It was confirmed that it is the highest level.

[0117] In this embodiment, it was confirmed that when extracting DNA from a filter sample that has captured particulate matter present in the atmosphere, using Proteinase K as a cell lysator; and / or using a Water kit that undergoes a chemical cell lysis process by mixing (e.g., stirring) the filter itself that has captured particulate matter present in the atmosphere with the cell lysator, the DNA extraction efficiency is significantly increased, and furthermore, when the pretreatment of Longer lysis and / or bead beating is additionally performed, the DNA extraction efficiency is further increased.

[0119] Example 3. Comparative experiment under different conditions for extracting DNA from filter samples capturing PM.

[0120] Comparative experiments were conducted under different conditions to extract DNA from filter samples that had captured PM.

[0121] First, from the results of Example 2 above, it can be seen that when extracting DNA from a filter sample containing PM, the following conditions significantly affect the DNA extraction efficiency: (a) using Proteinase K as a cell lysator and using a Water kit that mixes the filter containing PM with the cell lysator (e.g., stirring) to undergo a chemical cell lysis process; (b) increasing the chemical cell lysis time (about 20 minutes); and (c) performing bead beating (physical cell disruption). Therefore, the DNA extraction efficiency for each experimental group was compared when DNA was extracted using various methods combining two or more conditions selected from conditions (a) to (c). The methods for performing each of the above conditions, and the methods for DNA extraction and measuring the concentration of the extracted DNA, are as described in Reference Example 2, Example 1, and Example 2 above. The specific experimental groups are as shown in Table 3 below.

[0122] mixture DNA extraction concentration (ng / μL) (a) Use of Water kit (b) Increase in chemical cell lysis time (approx. 20 minutes) (c) Performance of bead beating (physical cell disruption) o o X 46 o X Chemical cell lysis time (approx. 10 minutes) o 35 X (Use soil kit and perform slicing pretreatment) o o 3 o o o 77

[0124] As a result, as shown in Table 3 and Figure 5, it was confirmed that when extracting DNA from a filter sample that has captured PM, if any of the conditions (a) to (c) above are not satisfied, the DNA extraction concentration decreases significantly, and if all of the conditions (a) to (c) above are satisfied, the DNA extraction concentration increases significantly.

[0125] In addition, to analyze the effect of condition (b), i.e., chemical cell lysis time, on DNA extraction efficiency when extracting DNA from filter samples that have captured PM, the DNA extraction efficiency for each experimental group was compared when DNA was extracted by maintaining condition (a), setting the chemical cell lysis time for condition (b) to various levels (about 10 minutes, about 20 minutes, about 30 minutes), and not performing condition (c). The method of performing each of the above conditions, and the method for DNA extraction and measuring the concentration of the extracted DNA, are as described in Reference Example 2, Example 1, and Example 2 above.

[0126] As a result, as shown in Figure 6, when extracting DNA from a filter sample that has captured PM, the DNA extraction concentration was highest under the condition of (b), that is, when the chemical cell lysis time was about 20 minutes, whereas the DNA extraction concentration decreased significantly when the time was about 10 minutes, and it was confirmed that the DNA extraction concentration did not increase further even when the chemical cell lysis time was increased beyond about 20 minutes.

[0127] In addition, to analyze the effect of the bead beating (physical cell disruption) performance time, which is the condition of (c) above, on DNA extraction efficiency when extracting DNA from a filter sample that has captured PM, the conditions of (a) and (b) above were maintained, and the DNA extraction efficiency for each experimental group was compared when DNA was extracted by setting the bead beating time to various (about 40 seconds, about 90 seconds, about 120 seconds) under the condition of (c). The method of performing each of the above conditions, and the method for DNA extraction and measuring the concentration of the extracted DNA, are as described in Reference Example 2, Example 1, and Example 2 above.

[0128] As a result, as shown in Figure 7, when extracting DNA from a filter sample that has captured PM, the DNA extraction concentration was highest when the condition of (c), i.e., the bead beating (physical cell disruption) time was about 90 seconds, whereas the DNA extraction concentration decreased significantly when the time was about 40 seconds, and it was confirmed that the DNA extraction concentration did not increase further even when the physical cell disruption time was increased beyond about 90 seconds.

[0130] Example 4. Discovery of primer set and establishment of annealing temperature conditions

[0131] A primer set for detecting fungal DNA present in PM was discovered, and annealing temperature conditions for the said primer set for polymerase chain reaction (PCR) were established.

[0132] To detect fungal DNA present in PM, primers capable of amplifying the nucleotide sequence of the Internal Transcribed Spacer 2 (ITS2) gene region of the fungus via PCR were selected and are shown in Table 2 above. In addition, a total of 10 primer sets were selected by combining the forward primers and reverse primers listed in Table 2 above, and PCR was performed using each of the selected primer sets with DNA extracted from a filter that collected PM by the method described in Example 2 above (using a water kit, performing longer lysis, and performing bead beating) as a template. For the PCR, three experimental groups using the same primer set were prepared. For each group, the time and temperature conditions for initial denaturation, DNA denaturation, and DNA extension were applied identically, while only the temperature conditions for primer annealing performed prior to DNA extension were varied (52°C, 56°C, and 58°C; the primer annealing time was applied identically (30 seconds)). After the PCR, the amplified products were verified using gel electrophoresis. The total of 10 selected primer sets and the results of the PCR performed using them are shown in Table 4 below. The specific conditions, methods, and materials for performing PCR and gel electrophoresis are as described in Reference Example 3 above.

[0133]

[0135] As a result, as shown in Table 4, when PCR was performed using each of the primer sets 1 to 7 in Table 4 as primers, no band appeared or only a faint band appeared under all primer binding temperature conditions. Consequently, it was confirmed that all of the primer sets 1 to 7 in Table 4 were unsuitable for amplifying the nucleotide sequence of the fungal ITS2 gene region present in PM. On the other hand, when PCR was performed using each of the primer sets 8 to 10 in Table 4 as primers, it was confirmed that the clarity of the band increased under all primer binding temperature conditions. In particular, it was confirmed that the clarity of the band increased the most when using the primer set 10 in Table 4 as primers and performing PCR under a primer binding temperature of 58°C. Through this, it was confirmed that when PCR is performed at a primer binding temperature of 58°C using the 10th primer set of Table 4, with DNA extracted from a filter sample that has captured PM as a template, the level of DNA amplification of fungi present in PM can be increased, and as a result, fungi present in PM can be detected with high efficiency.

[0136] In addition, nested PCR was performed to further increase the level of DNA amplification of fungi present in PM during PCR. Nested PCR is a method introduced to raise the efficiency and sensitivity of PCR to a high level; it involves using the product amplified by the first PCR as a template and conducting a second PCR using a primer set capable of detecting the region within the amplified product. Specifically, a first PCR was performed at a primer binding temperature of 58°C using the primer set No. 10 of Table 4 (refer to Reference Example 3 for specific PCR execution methods and materials), and a second PCR was repeated using the same primer set as the first PCR and under the same conditions and methods, using the amplified product obtained therefrom as a template. At this time, since a product that has already been amplified once is used as template DNA, the volume of the master mix solution (refer to Reference Example 3) was reduced to 2 / 3 of that of the first PCR to reduce the template concentration, and the second PCR (nested PCR) was performed. After performing a second PCR (nested PCR), the amplified products were verified using gel electrophoresis.

[0137] As a result, it was confirmed that the relative abundance of the bands appearing on the electrophoresis gel after nested PCR increased by more than 10 times compared to the relative abundance of the bands (around 0.5) that appeared during the first PCR. Through this, it was confirmed that when a first PCR is performed using DNA extracted from a filter sample containing PM as a template and the primer set of 10 of Table 4 at a primer binding temperature of 58°C, and then a second PCR (nested PCR) is performed using the obtained amplification product as a template to amplify the gene region within the amplification product (e.g., applying the same primer set and conditions as the first PCR), the level of DNA amplification of fungi present in PM can be significantly increased, thereby enabling the detection of fungi present in PM with higher efficiency.

[0139] Example 5. Evaluation of DNA extraction method and PCR conditions

[0140] For a total of 15 filter samples containing PM 2.5, DNA was extracted using the DNA extraction method derived from Example 2 (using a water kit, performing longer lysis, and performing bead beating), and PCR was performed using the extracted DNA as a template under the PCR conditions derived from Example 4 (using the 10th primer set of Table 4, applying a primer binding temperature of 58°C, and performing nested PCR). Afterward, the amplified products were verified by gel electrophoresis to evaluate the reproducibility of the DNA extraction method and the PCR conditions. The collection method and information for the total of 15 filter samples containing PM 2.5 are as described in Reference Example 1 and Table 1.

[0141] As a result, as shown in Fig. 8, the average concentration of DNA extracted from a total of 15 types of filter samples that captured PM 2.5 was approximately 46±10 ng / μL (approximately 342±73 μg / cm³).3 It was confirmed that when the DNA extraction method derived from Example 2 above (using a water kit, performing longer lysis, and performing bead beating) was performed, a high average DNA extraction efficiency was observed. Samples 1, 2, 5, and 6, which showed relatively low DNA concentrations, were collected in an environment with a relatively low temperature of less than approximately 5°C and a wind speed of approximately 1.5 m / s or less; regarding the concentration of PM 2.5 in the samples, samples 1 and 6 were approximately 45 μg / m³ 3 and approximately 44 μg / m² 3 They were similar, but Sample 2 was very high. Through this, it was confirmed that the DNA extraction concentration is not determined solely by the PM 2.5 concentration within the sample. In the case of Sample 12, which had the highest DNA concentration, the PM 2.5 concentration within the sample was approximately 46 μg / m³. 3 The wind speed was about 1.6 m / s, which is an average level, and the temperature and relative humidity were about 15.4℃ and 66.3%, respectively, which were suitable conditions for microorganisms to survive.

[0142] In summary, it was confirmed that when extracting DNA from filter samples capturing PM using the DNA extraction method derived from Example 2 (using a water kit, performing longer lysis, and performing bead beating), variations in the extracted DNA concentration may occur depending on the complex characteristics of various gaseous elements, but on average, high DNA extraction efficiency was observed, with DNA concentrations of approximately 25 ng / μL (approximately 187.5 ng / cm²) in all samples. 2 It was confirmed that the DNA extraction method derived from Example 2 (using a Water kit, performing Longer lysis, and performing bead beating) exhibits reproducibility, as it was extracted above.

[0143] In addition, as shown in Fig. 9, when a first PCR was performed using the extracted DNA as a template under the PCR conditions derived from Example 4 (using the 10th primer set of Table 4 and applying a primer binding temperature of 58°C), it was confirmed that the relative abundance varied depending on the sample, ranging from approximately 0.02 to 6.41 based on the DNA ladder 500 bp band. Samples 7, 12, 13, and 14 were well amplified with only the first PCR, and their respective relative abundance values ​​were 6.41, 5.32, 1.29, and 4.05. Although the template DNA concentration in these samples was relatively high at approximately 39 ng / μL or higher, when considering the entire experimental group, samples with higher template DNA concentrations did not exhibit better PCR amplification reactions. Meanwhile, for samples with a relative abundance of 1.0 or less, a second PCR (nested PCR) was performed using the same primer set as the first PCR and the amplification product of the first PCR as a template, under the same conditions and method (however, the volume of the master mix solution for the second PCR (refer to Reference Example 3) was reduced to 2 / 3 of that of the first PCR). As a result, as confirmed by the band clarity, the relative abundance of the amplification product of the second PCR (nested PCR) was approximately 7.68±2.45, which was confirmed to be more than 10 times higher.

[0144] In summary, when a first PCR is performed using DNA extracted from a filter sample that collected PM as a template under the PCR conditions derived from Example 4 (using the 10th primer set of Table 4 and applying a primer binding temperature of 58°C), the degree of amplification may vary depending on the sample; however, when a second PCR (nested PCR) is performed using the amplification product of the first PCR as a template to amplify the gene region within the amplification product again (e.g., applying the same primer set and conditions as the first PCR), it was confirmed that the ITS2 gene region of the fungus in all samples can be amplified to a significantly high level, thereby enabling the detection of fungus present in PM with higher efficiency.

Claims

Claim 1 (1) a step of mixing a filter containing particulate matter (PM) present in the atmosphere with a cell lysate; (2) a step of removing the filter from the mixture obtained in step (1); (3) a step of performing physical cell lysis on the sample from which the filter was removed in step (2); (4) a step of extracting DNA from the cell lysate obtained in step (3); (5) a step of amplifying nucleic acids using the DNA extracted in step (4) as a template and a primer set for detecting the Internal Transcribed Spacer 2 (ITS2) gene of fungi as primers; A method for detecting fungi present in particulate matter (PM), comprising: (6) a step of detecting an amplification product obtained in step (5); wherein the cell lysate comprises a proteolytic enzyme, and in step (5), the primer set comprises an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 9 and an oligonucleotide consisting of the nucleotide sequence of SEQ ID NO. 10, and wherein step (5) comprises a step of annealing the primer set to the template at 57°C to 59°C. Claim 2 A method according to claim 1, wherein in step (1), the cells present in the particulate matter are chemically dissolved. Claim 3 A method according to claim 1, wherein in step (1), the mixing is performed for 15 to 35 minutes. Claim 4 A method according to claim 1, wherein the cell lysate of step (1) comprises proteinase K. Claim 5 A method according to claim 1, wherein in step (3), the physical cell disruption is performed by mixing the filter-removed sample obtained in step (2) with a bead and bead beating. Claim 6 A method according to claim 1, wherein in step (3), the physical cell lysis is performed for 50 to 150 seconds. Claim 7 delete Claim 8 delete Claim 9 The method of claim 1, wherein the method further comprises, prior to step (6), a step of amplifying a nucleic acid using a primer set that binds to a base sequence in the amplification product obtained in step (5) as a template and as primers, amplifying the nucleic acid. Claim 10 A method according to claim 1, wherein the step of amplifying the nucleic acid utilizes a polymerase chain reaction (PCR). Claim 11 A method according to claim 1, wherein the step of detecting the amplified product is performed through one or more methods selected from the group consisting of DNA chips, gel electrophoresis, radiometric measurement, fluorescence measurement, and phosphorescence measurement. Claim 12 delete Claim 13 delete

Images