Hairpin structure nucleic acid molecules capable of modulating target gene expression and uses thereof

Abstract

The present application relates to a nucleic acid molecule having a hairpin structure capable of regulating target gene expression and the use thereof. A nucleic acid molecule according to one example can regulate the expression of a target gene specifically in cells where a miRNA capable of binding is present, and can be usefully utilized as a composition for regulating target gene expression or a pharmaceutical composition for treating diseases.

Description

Technology Field

[0001] The present application relates to a hairpin-structured nucleic acid molecule capable of regulating target gene expression and its uses. Background Technology

[0002] MicroRNA (miRNA) is a non-coding RNA composed of about 20 to 25 nucleotides, recorded in the genomes of higher animal and plant cells, and is known to play a key role in regulating cell metabolism and functions, including cell generation, growth, differentiation, and death, and to inhibit gene expression at the transcriptional and post-transcriptional stages.

[0003] Pri-miRNA (primary microRNA) is produced from the genome by RNA polymerase, and Pri-miRNA is edited into Pre-miRNA (precursor microRNA) by RNA cutting enzymes (RNases) such as Drosha in the nucleus. Pre-miRNA forms an RNA hairpin structure and consists of approximately 70-80 nucleotides. Pre-miRNA inside the cell nucleus is transported from the nucleus to the cytoplasm by proteins such as exportin, and within the cytoplasm, it is secondary processed by another RNA cutting enzyme (RNase) called Dicer to generate mature miRNA (mature microRNA). One strand of RNA among the double-stranded miRNA is selectively chosen and binds to the aforementioned ribonucleoprotein complex, RISC, to become active, and uses the miRNA sequence to bind to target mRNA and regulate the expression of the target gene.

[0004] Recently, it has been reported that miRNAs act as important regulatory factors in various diseases, such as cancer, cardiovascular disease, and autoimmune disease. Accordingly, disease treatments that inhibit miRNAs themselves are being developed; however, there have been many cases where inhibiting the disease-related miRNAs alone has not clearly demonstrated therapeutic effects. Therefore, to enable more effective and stable treatment of diseases, the inventors have developed a novel nucleic acid molecule capable of regulating the expression of target genes that are not complementary to the miRNAs in a site-specific manner where the disease-related miRNAs are present. Prior art literature

[0005] Republic of Korea Published Patent No. 10-2020-0085801 The problem to be solved

[0006] One example of the present application provides a nucleic acid molecule having a stem-loop structure that can bind to miRNA and mRNA of a target gene.

[0007] Another example of the present application provides a composition for regulating target gene expression comprising the nucleic acid molecule.

[0008] Another example of the present application provides a pharmaceutical composition for the prevention or treatment of cancer comprising the nucleic acid molecule. means of solving the problem

[0009] In this specification, it is proposed that by providing a nucleic acid molecule capable of simultaneously binding to a miRNA and a target gene, the expression of a target gene can be specifically regulated in a cell, tissue, and / or organ in which a miRNA capable of binding to the nucleic acid molecule is present (and / or overexpressed).

[0010] The technology provided in this specification relates to a nucleic acid molecule capable of regulating a target gene and its uses, and more specifically, it can regulate the expression of a target gene specifically at the site where the miRNA is expressed (cell, tissue, and / or organ), while also regulating the expression of a target gene that has no complementarity to the nucleic acid sequence of the miRNA.

[0011] Furthermore, the present specification proposes that by imparting a stem-loop structure to a nucleic acid molecule capable of simultaneously binding to miRNA and the mRNA of a target gene, the stability of the nucleic acid molecule and / or the ability to regulate target gene expression specifically in the environment where miRNA is present can be enhanced. A nucleic acid molecule according to one example has a stem-loop structure in an environment where the miRNA capable of binding is not present, and in an environment where miRNA is present, the stem-loop structure specifically opens to bind to the mRNA of the target gene.

[0012] In this specification, “nucleic acid” or “polynucleotide” means deoxyribonucleotides, ribonucleotides, or modified nucleotides in single or double-stranded form, and polymers thereof, and includes nucleic acids containing known nucleotide analogs or modified backbone residues or linkages. For example, nucleic acids or polynucleotides include single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0013] In this specification, “miRNA (microRNA)” may mean short strands of RNA that mediate RNAi (RNA interference) and / or RNA silencing.

[0014] In this specification, "nucleotide" is used as is recognized in the art. A nucleotide generally comprises a base, a sugar, and a phosphate moiety. The base may be a natural base (standard) or a modified base widely known in the art. Such a base is generally located at the 1' position of the nucleotide sugar moiety. Additionally, the nucleotide may be unmodified or modified in the sugar, phosphate, and / or base moiety.

[0015] In this specification, “hybridizable,” “complementary,” or “substantially complementary” means comprising a sequence of nucleotides in which a nucleic acid (e.g., RNA, DNA) can be non-covalently bound to another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid) under appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength, i.e., to form Watson-Crick base pairs and / or G / U base pairs, or to be “annealed” or “hybridized.” Standard Watson-Crick base pairings include: a pairing of adenine (A) and thymidine (T), a pairing of adenine (A) and uracil (U), and a pairing of guanine (G) and cytosine (C) [DNA, RNA]. Additionally, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization between a DNA molecule and an RNA molecule: guanine (G) can also form base pairs with uracil (U). For example, G / U base pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of base pairing between mRNA codons and tRNA anticodons. The “hybridization” of the present invention refers to complementary single-stranded nucleic acids forming a double-stranded nucleic acid. Hybridization may occur when the complementarity between the two nucleic acid strands is perfect match, or it may occur even if some mismatched bases are present. The degree of complementarity required for hybridization may vary depending on the hybridization conditions and, in particular, may be controlled by the binding temperature.

[0016] In this specification, "homology" refers to the degree of agreement with a given nucleic acid sequence or amino acid sequence and may be expressed as a percentage (%). For example, homology may be determined by aligning sequence information and using an readily available computer program to directly align parameters such as score, identity, and similarity between two polynucleotide molecules or two polypeptide molecules. The computer program may be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc), etc.

[0017] In the present specification, the phrase “comprising a specific nucleic acid sequence (base sequence)” in a nucleic acid molecule, X region, Y region, and / or Y* region, etc., may mean that the nucleic acid molecule, X region, Y region, Y* region, etc., is composed of or essentially comprises the specific nucleic acid sequence, and may be interpreted as comprising (or not excluding) a “substantially equivalent sequence” in which a variation (deletion, substitution, modification, and / or addition) is applied to the specific base sequence within the scope of maintaining the original function and / or intended function of the nucleic acid molecule, X region, Y region, and / or Y* region, etc.

[0018] In this specification, the term "stem-loop" structure may refer to a structure having a double-stranded portion (stem; branch, stem) and a single-stranded loop portion (loop; loop, loop) in which no hydrogen bonds are formed between sequences present in a single-stranded nucleic acid molecule through the formation of base pairs via hydrogen bonds, and the term "stem-loop" may be used interchangeably with the term "hairpin" or the term "hairpin loop." A nucleic acid molecule according to one example has a stem-loop structure in an environment where miRNA is absent or expression is low, and can be activated (the hairpin structure opens) in an environment where miRNA is present or overexpressed to regulate the expression of a target gene.

[0020] One aspect provides a nucleic acid molecule capable of simultaneously binding to miRNA and the mRNA of a target gene, and

[0021] The above nucleic acid molecule is

[0022] X region capable of binding to miRNA; and

[0023] A Y region capable of binding to the mRNA of a target gene; and

[0024] It includes a Y* region that can be combined with the above Y region, and

[0025] The above Y region and the above Y* region may be a nucleic acid molecule having a stem-loop structure by complementarily binding.

[0026] In this specification, “target gene” is a gene intended to regulate mRNA and / or protein expression by a nucleic acid molecule according to one example, said target gene may be an endogenous gene or a transgene expressed in a cell using an expression vector, etc., and may be, for example, a gene that causes (or induces) a disease.

[0027] In one example, the nucleic acid molecule may be represented by the following general formula 1 or general formula 2:

[0028] 5' - Y region - X region - Y* region -3' (General Formula 1)

[0029] 5' - Y* region - X region - Y region -3' (General Formula 2).

[0030] The above “binding” means hybridizing to form a double-stranded nucleic acid by including mutually complementary nucleic acid sequences, and hybridization may occur even when the complementarity between the nucleic acid strands is complete or when some mismatched bases are present. A nucleic acid molecule according to one example may include a portion that forms a double strand by hybridizing with miRNA and a portion that forms a double strand by hybridizing with target mRNA in an environment (cell, tissue, and / or organ) where miRNA is present or overexpressed, and may form a triple structure in which miRNA-nucleic acid molecule-target mRNA are combined through said nucleic acid molecule.

[0031] The above nucleic acid molecule may include an X region capable of binding (hybridizing) with miRNA, and in one example, the X region may include a nucleic acid sequence that is 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, 99.8% or more, 99.9% or more, or 100% complementary to all or part of the miRNA to be bound, so as to be able to bind (hybridize) with miRNA.

[0032] In one example, the X region may be included in the loop structure of the nucleic acid molecule or may include a loop structure.

[0033] In one example, the nucleic acid molecule may include 1 to 10, 2 to 10, 3 to 10, 1 to 8, 2 to 8, 3 to 8, 1 to 6, 2 to 6, 3 to 6, 1 to 5, 2 to 5, 3 to 5, 1 to 4, 2 to 4, or 3 to 4 X regions.

[0034] In one example, the X region is a plurality of X m It may include a region, and the above X m A region refers to a part capable of binding to a single miRNA. For example, the X region includes X1, X2, … , and X n It may include (the above X m The region is X1, X2, … , and X n (and), the nucleic acid molecule may be represented by the following general formula 3 or general formula 4:

[0035] 5' - Y region - X1 - X2 - … - X n - Y* region - 3' (General formula 3)

[0036] 5' - Y* region - X1 - X2 - … - X n - Y region - 3' (General Formula 4).

[0037] The above X1, X2, … , or X n Each represents a portion capable of binding to one miRNA, and n or m is a natural number and may be selected from, for example, 1 to 10 (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10).

[0038] In one example, the nucleic acid molecule is a plurality of X m If regions are included, different X regions can each bind to miRNAs that are identical or different from each other, and may consist of nucleic acid sequences that are identical or different from each other.

[0039] In one example, if the nucleic acid molecule comprises a plurality of Xm regions, it may additionally include spacers (nucleic acid sequences such as T, A, TT, AA, TTT, and / or AAA) between different Xm regions.

[0040] In one example, the nucleic acid molecule has multiple X molecules that bind to different miRNAs. m Multiple (e.g., 2 to 4) X regions that may include a region and bind to different miRNAs m Nucleic acid molecules containing the region are activated (the hairpin structure opens) only in an environment where all different miRNAs capable of binding are present, thereby regulating the expression of target mRNA.

[0041] In one example, the X region or the X m The region may consist of the same number of nucleotides as the miRNA to which the nucleic acid molecule can bind, or a smaller number of nucleotides than the miRNA, for example, 15 to 30nt, 15 to 28nt, 15 to 27nt, 15 to 26nt, 15 to 25nt, 16 to 30nt, 16 to 28nt, 16 to 27nt, 16 to 26nt, 16 to 25nt, 17 to 30nt, 17 to 28nt, 17 to 27nt, 17 to 26nt, 17 to 25nt, 18 to 30nt, 18 to 28nt, 18 to 27nt, 18 to 26nt, 18 to 25nt, 19 to 30nt, 19 to 28nt, 19 to 27nt, 19 to It may consist of 26nt, 19 to 25nt, 20 to 30nt, 20 to 28nt, 20 to 27nt, 20 to 26nt, or 20 to 25nt nucleotides.

[0042] In one example, the X region or the Xm region may have the 10th and 11th nucleotides from the 3' end that are not complementary to miRNA.

[0043] The above nucleic acid molecule may include a Y region capable of binding (hybridizing) with the mRNA of a target gene, and in one example, the Y region may include a nucleic acid sequence that is 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, 99.8% or more, 99.9% or more, or 100% complementary to the nucleic acid sequence of all or part of the mRNA of the target gene to be bound, so as to be able to bind (hybridize) with the mRNA of the target gene.

[0044] In one example, the Y region may include a nucleic acid sequence that can bind (hybridize) with a nucleic acid sequence of part of the target gene, and, for example, may include a nucleic acid sequence that is complementary to a sequence of part of the 3'-untranslated region (UTR) of the target gene.

[0045] In one example, the Y region may include a nucleic acid sequence capable of binding (hybridizing) with a nucleic acid sequence of part of the target gene, for example, a nucleic acid sequence complementary to a part of the 3'-untranslated region (UTR) and 5'-untranslated region of the target gene. In one example, target region selection may first obtain a list of siRNA candidates for the target gene using an online siRNA design tool (e.g., GenScriptr, Eurofins Genomics, siRNA Wizard, Block-iT RNAi Designer, etc.), and among these, utilize the RNA binding protein recognition region obtained from the eCLIP data analysis of ENCODE and the region nearby (e.g., within about 20 nucleotides).

[0046] In one example, the Y region may be composed of nucleotides less than or equal to the number of nucleotides of mRNA to which the nucleic acid molecule can bind, for example, 5 to 30nt, 5 to 28nt, 5 to 25nt, 5 to 23nt, to 20nt, 5 to 18nt, 5 to 16nt, 5 to 15nt, 5 to 14nt, 5 to 12nt, 6 to 30nt, 6 to 28nt, 6 to 25nt, 6 to 23nt, 6 to 20nt, 6 to 18nt, 6 to 16nt, 6 to 15nt, 6 to 14nt, 6 to 12nt, 7 to 30nt, 7 to 28nt, 7 to 25nt, 7 to 23nt, 7 to 20nt, 7 to 18nt, 7 to 16nt, 7 to 15nt, 7 to 14nt, 7 to 12nt, 8 to 30nt, 8 to 28nt, 8 to 25nt, 8 to 23nt, 8 to 20nt, 8 to 18nt, 8 to 16nt, 8 to 15nt, 8 to 14nt, 8 to 12nt, 9 to 30nt, 9 to 28nt, 9 to 25nt, 9 to 23nt, 9 to 20nt, 9 to 18nt, 9 to 16nt, 9 to 15nt, 9 to 14nt, 9 to 12nt, 10 to 30nt, 10 to 28nt, 10 to 25nt, 10 to 23nt, 10 to 20nt, 10 to 18nt, 10 It may consist of nucleotides of 16 to 16 nt, 10 to 15 nt, 10 to 14 nt, 10 to 12 nt, 12 to 30 nt, 12 to 28 nt, 12 to 25 nt, 12 to 23 nt, 12 to 20 nt, 12 to 18 nt, 12 to 16 nt, 12 to 15 nt, or 12 to 14 nt.

[0047] The nucleic acid molecule may include a Y* region capable of binding (hybridizing) with the Y region, and in one example, the Y* region may include a nucleic acid sequence that is 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.5% or more, 99% or more, 99.5% or more, 99.8% or more, 99.9% or more, or 100% complementary to the nucleic acid sequence of all or part of the Y region so as to be able to bind (hybridize) with the Y region.

[0048] In one example, the Y region and the Y* region may include sequences that are complementary to each other and form a double strand by forming base pairs through hydrogen bonding to form a stem structure. In one example, the Y region and the Y* region are regions that form a stem structure and may include sequences that are antiparallel and complementary to each other (for example, the sequence in the 5' to 3' direction of the Y region and the sequence in the 3' to 5' direction of Y* are complementary to each other).

[0049] The above stem structure may include a double-stranded nucleic acid sequence and may include a blunt end, a 3' end, a 5' end, or an overhang of 1 to 4 nt in length at both ends. When including an overhang within the above range, it may have a superior effect as it does not cause strand displacement by mRNA compared to when including an overhang with a length exceeding the above range.

[0050] In this specification, “protrusion” or “overhang” may refer to a terminal portion of a nucleotide sequence where no base pair is formed between the two strands of a double-stranded nucleic acid molecule.

[0051] The nucleic acid molecule may have a stem-loop structure and may include a portion capable of binding to miRNA. In one example, the complementary binding of the Y region and the Y* region of the nucleic acid molecule may be separated by binding to miRNA. Specifically, in an environment where miRNA is present (or an environment where miRNA is overexpressed), miRNA binds to the X region, thereby separating the complementary binding of the Y region and the Y* region, and the Y region becomes capable of binding to the mRNA of a target gene.

[0052] In one example, the nucleic acid molecule may include one or more modified nucleotides or backbone modifications, and

[0053] The above modified nucleotide is modified into one or more types selected from the group consisting of residues 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridge, 4'-(CH2)2-O-2'-bridge, 2'-LNA, 2'-amino, and 2'-O-(N-methylcarbamate).

[0054] The above backbone modification may be one or more selected from the group consisting of phosphonates, phosphorothioates, and phosphotriesters.

[0055] A nucleic acid molecule according to one example may bind to miRNA, and the miRNA may be a non-coding RNA that regulates gene expression after transcription by binding to the 3'UTR (non-translation region) of a target RNA (target of miRNA) to promote its degradation or inhibit their translation.

[0056] In one example, the miRNA may refer to a guide RNA of mature miRNA prepared by cleaving a hairpin-structured precursor called Pre-miRNA (precursor-microRNA) by the RNAse III enzyme Dicer.

[0057] In one example, the miRNA may bind to (or load to) RISC (RNA-induced silencing complex) and form a ribonucleotide complex. A nucleic acid molecule according to one example may bind to the mRNA of the miRNA and the target gene, and the miRNA may be bound to RISC, and RISC may induce degradation (cleavage) and / or repression of translation of the mRNA to which the nucleic acid molecule is bound.

[0058] In one example, the miRNA may be present or overexpressed in disease cells (or tissues, organs) and may not be present or have reduced expression in normal cells (or tissues, organs). The disease may be cancer and the disease cells may be cancer cells.

[0059] In the above, "miRNA is present in disease cells and is absent or has reduced expression in normal cells" may mean that miRNA is present in disease cells (abnormal cells) or its expression is increased (overexpressed) compared to normal cells, and is absent in normal cells or its expression is reduced compared to disease cells. A nucleic acid molecule according to one example may bind to miRNA present or overexpressed in disease cells, thereby regulating (e.g., reducing) the expression of a target gene specifically in disease cells, and may not affect the expression of the target gene in normal cells. The above normal cells (or tissues, organs) may refer to wild-type cells (or tissues, organs) and / or cells (or tissues, organs) isolated from an individual without disease, or cells (or tissues, organs) present in an individual without disease.

[0060] A nucleic acid molecule according to one example can specifically regulate the expression of a target gene in a cell (or tissue, organ) where miRNA is present or overexpressed, and, for example, a nucleic acid molecule that can bind to (i) miRNA present in disease cells but not in normal cells and / or (ii) miRNA that is expressed at a higher level in disease cells than in normal cells can specifically regulate the expression of a target gene in a disease cell (or tissue, organ) and may not affect the expression of a target gene in normal cells.

[0061] In one example, the miRNA may be present in or overexpressed in disease cells (or tissues, organs), and e.g., miR-141, miR-21, miR-200c, miR-222, let-7f, miR-155, miR-24, miR-29a, miR-27 (e.g., miR-27a), miR-200a, miR-200b, miR-429, miR-205, miR-30a, miR-34, miR-203, miR-10b, miR-31, miR-9, miR-490, miR-29a, miR-204, miR-221, miR-138, miR-17, miR-19, miR-569, miR-9, miR-22, miR-29b, It may be one or more selected from the group consisting of miR-125b, miR-126, miR-146a, miR-193a, miR-196b, miR-223, miR-492, miR-135b, miR-331, miR-374a, miR-519a, miR-191, miR-210, miR-24, miR-9, miR-103, and miR-107.

[0062] A nucleic acid molecule according to one example may regulate the expression of a target gene, and in one example, the target gene may be one or more selected from the group consisting of a pro-apoptotic gene, an oncogene, a proto-oncogene, and an EMT-promoting gene. The pro-apoptotic gene Mcl-1, Bcl-2 , and / or Bcl-xL It may be, and the above tumor gene is Raf, EGFR, c-Sis, and / or Ras It can be, and proto-oncogenes Ras, CYCD, Her2, and / or Myc It could be, and the neovascularization gene is Twist1, Snail1, SLUG, Zeb1, TCF4, and / or TCF3 It may be. In one example, the target gene is mcl-1, bcl-xL, bcl-2 , Snail1, Twist1, SLUG, Zeb1, TCF4, TCF3, FLT3, STAT3, c-Sis, EGFR, Ras, CYCD, Her2, Myc, Raf, VIM , CDH2 , FN1 , ACTA2 , COL1A1 , and SNAI2 It may be one or more types selected from the group consisting of

[0063] Another aspect provides a composition for regulating target gene expression, wherein the composition for regulating target gene expression comprises a nucleic acid molecule according to one example, and thus can specifically regulate the expression of a target gene in a cell, tissue, organ, etc. where a specific miRNA capable of binding is present.

[0064] In one example, the composition for regulating target gene expression may reduce the mRNA expression and / or protein expression of the target gene.

[0065] A composition for regulating target gene expression according to one example may additionally include a carrier in addition to the nucleic acid molecule, and the carrier may be one or more selected from the group consisting of lipid molecules, liposomes, micelles, cationic lipids, protein particles, inorganic nanoparticles, and / or viruses.

[0066] In one example, the nucleic acid molecule may be delivered by direct processing, forming a complex with cationic lipids, or packaging into liposomes, and may be administered to cells and / or subjects by various methods known to those skilled in the art, including, for example, encapsulation within liposomes, iontophoresis, or incorporation into other vehicles such as biodegradable polymers, hydrogels, cyclodextrins, poly(lact-co-glycol) acid (PLGA) and PLGA microspheres, biodegradable nanocapsules and biocompatible microspheres.

[0067] The term "liposome" refers to a vehicle composed of amphiphilic lipids arranged in one or more bilayers, for example, a single bilayer or multiple bilayers. Liposomes include single-membrane and multi-membrane vehicles having a membrane formed from a lipophilic substance and an aqueous interior. The aqueous region contains nucleic acid molecules. The lipophilic substance separates the aqueous interior from the aqueous exterior, which typically does not contain nucleic acid molecules, but may contain them in some examples. Liposomes are useful for transporting and delivering active ingredients to a site of action. Because the liposome membrane is structurally similar to a biological membrane, when liposomes are applied to tissues, the liposome bilayer fuses with the bilayer of the cell membrane. As the fusion of the liposome and the cell proceeds, the internal aqueous contents containing nucleic acid molecules are delivered into the cell, where the nucleic acid molecules can specifically bind to target genes to mediate RNAi. In one example, the liposome is specifically targeted to direct nucleic acid molecules to a specific type of cell.

[0068] The above "micelle" is defined as a specific type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure, with all hydrophobic parts of the molecule facing inward and the hydrophilic parts in contact with the surrounding aqueous phase. When the environment is hydrophobic, the opposite arrangement exists.

[0070] Another aspect provides a pharmaceutical composition for the prevention or treatment of cancer comprising the above nucleic acid molecule.

[0071] In one example, the above pharmaceutical composition may induce apoptosis of cancer cells or inhibit metastasis of cancer cells.

[0072] In one example, the cancer is one or more solid tumors selected from the group consisting of liver cancer, lung cancer (e.g., non-small cell lung cancer), pancreatic cancer, breast cancer, colon cancer, pancreatic cancer, ovarian cancer, endometrial cancer, cervical cancer, gallbladder cancer, stomach cancer, biliary tract cancer, colorectal cancer, head and neck cancer, esophageal cancer, thyroid cancer, brain tumor, malignant melanoma, prostate cancer, testicular cancer, and tongue cancer, or

[0073] It may be one or more types of blood cancer selected from the group consisting of lymphomas such as chronic lymphocytic leukemia (like chronic lymphocytic leukemia, CLL), acute lymphocytic leukemia (ALL), non-Hodgkin lymphomas (NHL), acute myeloid leukemia (AML), and leukemia.

[0074] The above pharmaceutical composition may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents.

[0075] In one example, the pharmaceutical composition may additionally include an anticancer agent in addition to the nucleic acid molecule, and the additionally included anticancer agent may not reduce the expression of miRNA to which the nucleic acid molecule can bind. For example, the pharmaceutical composition may additionally include an anticancer agent selected from the group consisting of cytarabine, azacitidine, decitabine, paclitaxel, adriamycin, and tamoxifen.

[0076] The above pharmaceutical composition may be formulated and used in the form of oral formulations such as powders, granules, capsules, tablets, and aqueous suspensions, as well as topical preparations, suppositories, and sterile injectable solutions, according to conventional methods. A pharmaceutical composition according to one example may include a pharmaceutically acceptable carrier. For oral administration, the pharmaceutically acceptable carrier may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavors, etc.; for injectable preparations, it may include buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc., in combination; and for topical administration, a base, excipients, lubricants, preservatives, etc. may be used. The formulations of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with the pharmaceutically acceptable carriers described above. For example, for oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injectables, it can be manufactured in the form of unit dosing ampoules or multiple dosing ampoules. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained-release formulation, etc.

[0077] Meanwhile, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil. Additionally, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be additionally included.

[0078] In this specification, "pharmaceuticalally acceptable" means not significantly stimulating a living organism and not impairing the biological activity and properties of the administered active substance. According to one example, the pharmaceutical composition comprising a pharmaceutically acceptable carrier may have any one formulation selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquids, emulsions, syrups, sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories.

[0079] The above pharmaceutical composition may be in various oral or parenteral formulations. When formulating, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

[0080] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms may be prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc., with one or more compounds. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid dosage forms for oral administration include suspensions, liquid formulations, emulsions, syrups, etc., and may include various excipients, such as humectants, sweeteners, flavorings, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.

[0081] Preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, witepsol, macrogol, tween 61, cocoa paste, laurin paste, glycerogelatin, etc. may be used.

[0082] In one example, the above pharmaceutical composition may be administered to a subject through various routes. In this specification, "administration" means providing a specific substance to an individual (patient) by any appropriate method, and the route of administration of the above pharmaceutical composition may be oral or parenteral through any general route that can reach the target tissue. The mode of administration may be by any commonly used route, for example, oral administration, or parenteral administration such as intravenous administration, intramuscular administration, subcutaneous administration, intraperitoneal administration, or local administration to the lesion site. Additionally, the composition according to one example may be administered using any device capable of delivering the active ingredient to target cells.

[0083] Routes of administration of the pharmaceutical composition according to one example include, but are not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, local, sublingual, or rectal. Oral or parenteral administration is preferred. As used herein, the term "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intradural, intralesional, and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.

[0084] A pharmaceutical composition according to one example may vary depending on several factors including the activity of the specific compound used, age, body weight, general health, gender, diet, time of administration, route of administration, release rate, drug combination, and the severity of the specific disease to be prevented or treated, and the dosage of the pharmaceutical composition and / or the effective amount of the active ingredient (the nucleic acid molecule) in the pharmaceutical composition may be appropriately selected by a person skilled in the art, depending on the patient's condition, body weight, age, degree of disease, drug form, route of administration, and duration, and may be administered at a dose of 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. Administration may be administered once a day or divided into several doses (e.g., 2 to 4 times, or 3 times).

[0086] Another aspect provides a method for suppressing the expression of a target gene, comprising the step of administering the nucleic acid molecule and / or the composition for suppressing gene expression to a subject in an effective amount. The method for suppressing the expression of a target gene may further include the step of identifying a subject (individual) requiring suppression of gene expression prior to the administration step. In one example, the individual may include a miRNA to which the nucleic acid molecule can bind.

[0087] In one example, the method for inhibiting the expression of the target gene may be to inhibit the expression of the target gene in a target cell in vitro. The target cell may be a cell in which a miRNA capable of binding to the nucleic acid molecule is present or overexpressed.

[0088] Another aspect may provide a method for the prevention or treatment of cancer or proliferative disease, comprising the step of administering the nucleic acid molecule, the composition for inhibiting target gene expression, and / or the pharmaceutical composition to a subject in a pharmaceutically effective amount. The treatment method may further comprise the step of identifying an individual requiring prevention or treatment of cancer or proliferative disease prior to the step of administration.

[0089] The method of administration, route of administration, and dosage of a composition for inhibiting nucleic acid molecules and / or target gene expression in a method of regulating gene expression according to one example or a method of preventing or treating cancer or proliferative diseases are as described above.

[0090] In this specification, "pharmaceutical effective amount" or "effective amount" means an amount of the active ingredient (a nucleic acid molecule according to one example) capable of producing a desired effect (e.g., an effect of inhibiting the expression of a target gene or preventing and / or treating cancer or proliferative diseases), and may be prescribed in various ways depending on factors such as the method of formulation, mode of administration, age, weight, sex, pathological condition of the patient, food, time of administration, route of administration, excretion rate, and response responsiveness.

[0091] In this specification, “subject,” “individual,” or “patient” means an organism capable of administering a nucleic acid molecule according to one example. The subject may be a mammal (e.g., a primate such as a human or monkey, or a mammal other than a human), an organism that is a donor or recipient of an in vitro transplant cell, or a cell or tissue isolated from said mammal or a culture thereof.

[0093] In one embodiment, when the cancer to be prevented and / or treated by the pharmaceutical composition is breast cancer, the nucleic acid molecule included in the pharmaceutical composition may bind to one or more selected from the group consisting of miR-222, miR-141, miR-21, miR-200c, miR-222, let-7f, miR-492, miR-135b, miR-331, miR-374a, miR-519a, miR-191, miR-210, and miR-24, and the nucleic acid molecule mcl-1, bcl-xL, and bcl-2 It can bind to one or more target genes selected from a group consisting of

[0094] In one embodiment, when the cancer to be prevented and / or treated by the pharmaceutical composition is acute myeloid leukemia (AML), the nucleic acid molecule included in the pharmaceutical composition may bind to one or more selected from the group consisting of miR-155, miR-21, miR-9, miR-490, miR-29a, miR-204, miR-221, miR-138, miR-17, miR-19, miR-569, miR-9, miR-10b, miR-22, miR-29b, miR-125b, miR-126, miR-146a, miR-193a, miR-196b, and miR-223, and the nucleic acid molecule mcl-1, bcl-xL , and bcl-2 It can bind to one or more target genes selected from a group consisting of

[0095] In one embodiment, when the cancer to be prevented and / or treated by the pharmaceutical composition is cervical cancer, the nucleic acid molecule included in the pharmaceutical composition may bind to one or more selected from the group consisting of miR-141 and miR-200c, and the nucleic acid molecule mcl-1, bcl-xL, and bcl-2 It can bind to one or more target genes selected from a group consisting of Effects of the invention

[0097] A nucleic acid molecule according to one example can specifically regulate the expression of a target gene in cells where a miRNA capable of binding is present, and can be usefully utilized as a composition for regulating target gene expression or as a pharmaceutical composition for treating diseases. Brief explanation of the drawing

[0099] Figure 1 shows the PAGE gel loading results indicating whether miRNAs bind to hairpin miRNA triggers of various lengths. Figure 2 shows the predicted results of miRNA-miRNA trigger-mRNA triple structure formation through NUPACK simulation. The graph on the left in Figure 2 represents the binding of miRNA, miRNA trigger, and mRNA base pairs, and the graph on the right in Figure 2 visualizes the graph on the left to show the miRNA-miRNA trigger-mRNA triple structure. In Figure 2, the red bar represents the concentration of the triple structure formed when thermodynamic equilibrium is reached after placing an aqueous solution containing 100 nM each of miRNA, mRNA trigger, and mRNA at 37 degrees, indicating that most of the miRNA, trigger, and mRNA form a triple structure. Figure 3 shows the results regarding the binding of a hairpin-structured miRNA trigger to miRNA and / or target mRNA depending on the presence of miRNA and / or target mRNA. In Figure 3, (A) is a hairpin miRNA trigger (HP), (B) is a form in which the miRNA trigger and miRNA are bound (the trigger may exist in an open form due to binding with miRNA), and (C) is a form in which the miRNA, target mRNA, and miRNA trigger are all bound. Figure 4 shows the results of binding between the trigger and the miRNA and / or target mRNA depending on the presence of miRNA and / or target mRNA of a hairpin miRNA trigger capable of binding to various types of miRNA (miR-21, miR-200a, miR-200b, and miR-200c). Figure 5a shows the results of loading miRNA triggers onto a PAGE gel after adding cell lysate or human serum to hairpin miRNA triggers with chemical modifications (LNA HP, PS4HP, PS8 HP, FPS HP, 2'-O-Me HP) or hairpin miRNA triggers without chemical modifications (DNA HP), and Figure 5b shows a graph quantifying the size of the bands appearing on the gel. In Figure 5a, the parts marked in green in the hairpin miRNA trigger structure represent nucleotides modified with LNA, the parts marked in red represent nucleotides modified with PS, and the parts marked in blue represent nucleotides modified with 2'-OMe. Figure 6 shows the results of cytotoxicity experiments on miRNA triggers with introduced chemical modifications. In Figure 6, NT refers to the non-transfected group, and Figure 7a is a schematic diagram illustrating the mechanism of action of a 2-seed hairpin miRNA trigger (2SD HP) containing two portions capable of binding to miRNA in the loop to suppress the expression of a target gene. Figure 7b shows the PKR expression levels measured after transfection of the hairpin miRNA trigger (HP) and 2SD HP into Hela-141 cell lines. Figure 8 is a graph showing the fluorescence intensity measured after transfection of a miRNA trigger (GFP_141_141) into GFP-expressing Hela-141 cells. Figures 9a and 9b show the results of measuring the expression levels of PKR mRNA after transfection of linear miRNA triggers (PKR-141-141, PKR-200c-200c) and, as a control, linear miRNA triggers (Luc-141-141, PKR-200c-200c) and probes (Luc-Luc-Luc) in Hela, Hela-141, Hela-200c, and MCF-7 cell lines. Specifically, Figure 9a shows the results using PS-modified linear miRNA triggers and probes, and Figure 9b shows the results using 2'-OMe-modified linear miRNA triggers and probes. Figure 10 shows the results of measuring the expression levels of PKR mRNA after transfection of the hairpin miRNA trigger (PKR-141) into Hela, Hela-141, and MCF-7 cell lines. Figure 11 shows the regulatory effect of miRNA triggers on target gene expression in the presence of miRNA. Specifically, the left figure of Figure 11 is a schematic diagram showing whether miRNA triggers are active in the presence of miRNA, and the right graph shows the results of transfecting Hela cells in the presence or absence of the hairpin miRNA trigger (PKR-141) and miR141, and measuring the expression level of the target PKR mRNA after transfecting Hela-141 cells with the hairpin miRNA trigger (PKR-141) in the presence or absence of miR-141*. Figures 12a and 12b are experimental results confirming whether the mRNA of a miRNA trigger and a target gene bind. Specifically, Figure 12a is a schematic diagram of an RNA pull-down assay experiment to confirm whether the miRNA trigger and the target gene bind according to one example, and Figure 12b is a result showing the amount of PKR mRNA bound to the miRNA trigger complex separated using a streptavidin-coated magnetic bead as a relative amount compared to before separation. Figures 13a and 13b are experimental results confirming whether the action of a miRNA trigger according to one example is associated with the AGO protein. Specifically, Figure 13a is a schematic diagram of inhibiting the action of a miRNA trigger through the inhibition of AGO protein expression by siRNA, and Figure 13b shows transfecting Hela-141 cells with a hairpin miRNA trigger together with siAGO1, siAGO2, or a combination thereof (siAGO1 + siAGO2) and PKR This shows the results of measuring the expression level of mRNA. In Figure 13b, MM represents the results of the experimental group transfected only with the hairpin miRNA trigger. Figures 14a and 14b show the experimental results of selecting target genes efficient in inducing apoptosis in cancer cells. Specifically, Figure 14a shows the results of measuring cell viability after transfecting breast cancer cell line MCF-7 with siMcl-1, siBcl-xL, and / or siBcl-1, and Figure 14b shows the results of measuring cell viability after transfecting pancreatic cancer cell line PANC1 with siMcl-1, siBcl-xL, and / or siBcl-1, with siLuc used as a control. Figure 14c shows the results of measuring protein expression by Western blot after transfecting breast cancer cell line MCF-7 with siBcl-2, siMcl-1, siBcl-xL, and siMcl-1+siBcl-xL. siLuc was used as a control. When siMcl-1 and siBcl-xL are transfused simultaneously, a strong cleaved PARP band, a marker of apoptosis, can be observed. Figure 15 shows the results of a miRNA trigger according to one example having cell line differentiation performance and regulating the expression of a target gene. Specifically, it shows the cell viability measured after transfecting Hela, Hela-141, and Hela-200c cells, respectively, with a linear miRNA trigger (Mcl-1-141-141, Mcl-1-200c-200c) according to one example. Figure 16 shows the results of a miRNA trigger (Mcl-1-141-141) according to one example reducing the protein expression of the target Mcl-1 in Hela-141 cells. In Figure 16, Luc refers to Luc-141-141, and Mcl-1 represents the miRNA trigger (Mcl-1-141-141) administration group. Figure 17 shows the cell viability (%) measured after transfection of Hela and Hela-141 cells, respectively, with hairpin miRNA triggers (Mcl-1(1)-141, Mcl-1(3)-141) according to one example. In Figure 17, siMcl-1 was used as a positive control. Figure 18 shows the results of in vivo imaging performed on day 1, day 2, and day 4, respectively, after injecting a fluorescently linked linear miRNA trigger (5'-Cy5.5-PKR-miR-155-miR-155-3') into mice. Figures 19a and 19b show the results of analyzing the distribution of cells using FSC-A / SSC-A of a FACS instrument in blood extracted from mice injected with a fluorescently linked linear miRNA trigger (5'-Cy5.5-PKR-miR-155-miR-155-3'). Figure 20 shows the results of identifying miRNA triggers delivered to peripheral blood cells using a FACS device. Figure 21 shows the results of identifying miRNA triggers delivered to spleen-derived hematopoietic cells using a FACS device. Figure 22 shows the results of confirming miRNA triggers delivered to bone marrow hematopoietic cells using a FACS device. Figure 23 shows the results of measuring the expression levels of miR-155 in MV4-11 and MOLM-14, which have FLT3-ITD mutations, and NB4 and HL60, which have FLT3-WT as controls. FIG. 24 shows the results of confirming whether hairpin miRNA triggers (2'-O-Me-PKR(2)_PM_S14_155 and 2'-O-Me-PKR(3)_PM_S14_155) according to one example bind to miRNA and / or mRNA. Figure 25 shows the results of measuring the apoptosis markers and the protein levels of the Bcl-2 family after transfection with siRNA (siMcl-1, siBcl-2, and siBcl-xL) against the Bcl-2 family in blood cancer cell lines. Figure 26 shows the results of measuring miR-155 expression after treatment with AML therapeutics (cytarabine, azacitidine, decitabine, venetoclax, and gilteritinib) in AML cell lines (MV4-11 and NOLM-14) with FLT3-ITD mutations. *: p-value < 0.05, **: p-value < 0.01, ***: p-value<0.001. Fig. 27 shows the linear miRNA trigger (PKR-155-155) transfection in MV-11 and HL60 cells according to one example. PKR This shows the results of measuring mRNA expression levels. Figure 28 shows the results of measuring the expression levels of various miRNAs (miR-9, miR-10b, miR-17, miR-22, miR-125b, miR-126, miR-155) in blood samples taken from the bone marrow of AML patients. Figure 29 shows the PKR expression levels measured after injecting a linear miRNA trigger (PKR-155-155) according to one example into 6528 samples taken from FLT3-WT patients and 6562 samples taken from FLT3-ITD mutant patients. Figures 30a and 30b show the results of transfecting AML cell lines with a linear miRNA trigger capable of binding to miR-155 and various sites of Bcl-2. Specifically, Figure 30a shows the results of measuring cell viability (%) after transfecting MOLM-14 with a linear miRNA trigger according to one example, and Figure 30b shows the Western blot results of measuring protein expression of Bcl-2 and apoptosis marker (cleaved PARP) after transfecting MOLM-14 with a linear miRNA trigger according to one example. Figure 31a shows the results of measuring cell viability after transfection of MV4-11 cell lines with a linear miRNA (Mcl-1-155) targeting Mcl-1, and Figure 31b shows the results of measuring cell viability after transfection of MV4-11 cell lines with a linear miRNA (Mcl-1-155) targeting Bcl-2. Figures 32a and 32b show the results of transfecting breast cancer cell lines with a linear miRNA trigger capable of binding to miR-222 and to various sites on Bcl-xL. Specifically, Figure 32a shows the results of measuring cell viability (%) after transfecting MDA-MB-231 with a linear miRNA trigger according to one example, and Figure 32b shows the Western blot results of measuring protein expression of Bcl-xL and apoptosis marker (cleaved PARP). Figures 33a to 33c show the results of transfecting a linear miRNA trigger capable of binding to miR-222 and targeting Bcl-xL into breast cancer cell lines with relatively low miR-222 expression. Specifically, Figure 33a shows the results of measuring cell viability (%) after transfecting MDA-MB-453 with a linear miRNA trigger according to one example, and Figure 33b is Bcl-xLFigure 33c shows the results of measuring mRNA expression levels, and is a Western blot result of measuring protein expression of Bcl-xL and apoptosis marker (cleaved PARP). Figure 34 shows the results of transfecting the breast cancer cell line MCF-7 with a linear miRNA trigger that can bind to miR-141 or let7f and targets Bcl-xL or Mcl-1, either alone or in combination, and measuring cell viability. Figure 35 shows the results of transfecting the breast cancer cell line MDA-MB-231 with a linear miRNA trigger that can bind to miR-222 or let7f and targets Bcl-xL or Mcl-1, either alone or in combination, and measuring cell viability. Figures 36 and 37 show the results for a hairpin miRNA trigger capable of binding to two types of miRNA. Specifically, Figure 36 is a schematic diagram of the process in which the hairpin structure is opened and the expression of a target gene is regulated only when both types of miRNA are present, and Figure 37 shows the cell viability measured after transfecting MDA-MB-231 and MDA-MB-453 cells with the hairpin miRNA trigger capable of binding to two types of miRNA. Figure 38 shows the results of measuring the degree of apoptosis after transfection of the breast cancer cell line MDA-MB-231 with a hairpin miRNA trigger alone or in combination thereof, which can bind to miR-222 and let-7f and targets Mcl-1 or Bcl-xL. Figure 39a shows a dumbbell-shaped miRNA trigger with the mRNA-binding portion increased to 20 nucleotides. Figure 39b shows a ternary complex in which the trigger opens and binds to the target mRNA only at site 4, where both miRNA and mRNA are present, when the dumbbell miRNA trigger (DB_HP) is incubated alone (site 1), with miRNA (site 2), mRNA (site 3), and miRNA+mRNA (site 4). Figure 40 shows the mechanism of action and application methods of a hairpin-structured miRNA trigger. Specific details for implementing the invention

[0100] The present invention will be described more specifically below with reference to examples, but these are merely illustrative and are not intended to limit the scope of the invention. It is obvious to those skilled in the art that the examples described below can be modified without departing from the essential essence of the invention.

[0102] Reference Example 1. Preparation of miRNA Trigger

[0103] A polynucleotide (hereinafter referred to as 'miRNA trigger') containing a portion capable of binding to miRNA and a portion capable of binding to the mRNA of a target gene was synthesized by Bionia and purified using HPLC for subsequent experiments. To ensure intracellular stability, chemical modifications such as LNA (locked nucleic acid), PS (phosphorothioate), or 2'-O-Me (2'-O-Methyl) were introduced into the nucleotides during the production of the polynucleotide.

[0105] Reference Example 1-1. Preparation of a linear miRNA trigger

[0106] The structure of the miRNA trigger prepared in this example is as follows:

[0107] [5'- part that can bind to miRNA(1) (mi(1)*) - part that can bind to miRNA(2) (mi(2)*) - part that can bind to the mRNA of the target gene (T*) -3'].

[0108] The length of the region capable of binding to miRNA was equal to the length of the miRNA being bound, and was 20 to 25 nt depending on the type of miRNA. The region capable of binding to miRNA was designed so that the 10th to 11th nucleotide from the 3' end was mismatched with the miRNA, and otherwise contained a sequence complementary to the sequence of the miRNA.

[0109] A portion capable of binding to the mRNA of a target gene (hereinafter, target mRNA) was designed to be 14 to 20 nt long and included a sequence complementary to the sequence of the target mRNA.

[0110] The miRNA trigger prepared in this example includes two portions capable of binding to miRNA, capable of binding to two miRNAs, and the sequences of the portions capable of binding to two miRNAs were either identical or not identical to each other.

[0111] In order to distinguish the miRNA trigger prepared in this example from the miRNA trigger prepared in Example 1-2 below, it is hereinafter referred to as a 'Linear miRNA trigger (Linear miRNA trigger, Linear probe (LP))', and each specific name of the linear miRNA trigger is described as [name of a target gene that can bind_name of a miRNA that can bind (2)_name of a miRNA that can bind (1)].

[0113] Reference Example 1-2. Preparation of a hairpin-structured miRNA trigger

[0114] The structure of the miRNA trigger prepared in this example is as follows:

[0115] [5'-part of the target gene that can bind to mRNA (T*) -part of the miRNA that can bind to miRNA (mi*) -part of the T* that can bind to T* (T)- 3'].

[0116] The miRNA trigger prepared in this embodiment includes sequences capable of binding complementarily to each other (T and T* in the structure above), so the two side portions (T and T*) of the mi* portion hybridize with each other to exist in the form of a hairpin miRNA trigger having a stem-loop structure. The stem structure of the hairpin miRNA trigger includes a structure in which the T and T* portions are hybridized with each other, and the loop structure includes the mi* portion. A miRNA trigger having such a hairpin structure is hereinafter referred to as a 'hairpin miRNA trigger (Hairpin miRNA trigger, Hairpin probe (HP))', etc. Each specific name of the hairpin miRNA trigger is described as [HP_name of target gene capable of binding_name of miRNA capable of binding].

[0117] The length of the region capable of binding to miRNA (mi*), (i.e., the part corresponding to the loop of the hairpin), was equal to the length of the miRNA capable of binding complementarily, and was 20 to 25 nt depending on the miRNA type. In the case where the region capable of binding to miRNA was designed such that the 10th and 11th nucleotides from the 3' end were mismatched with the miRNA (M2) and all nucleotides at positions other than the 10th and 11th contained sequences complementary to the miRNA sequence, it was named [HP_bindable target gene name_M2_bindable miRNA name]. An HP designed such that the region capable of binding to miRNA had no mismatch was named [HP_bindable target gene name_bindable miRNA name]. The length of the portion capable of binding to the mRNA of the target gene (hereinafter, target mRNA) (i.e., the stem of the hairpin) was designed to be 12 to 22 nt and included a sequence complementary to the sequence of the target mRNA.

[0119] Reference Example 2. Design and Performance Evaluation of miRNA Triggers

[0120] Thermodynamic analysis was performed using NUPACK (California Institute of Technology, http: / / www.nupack.org / ) to determine whether the miRNA trigger (M2_S12_miR141: 5'- CAAGAGGATTATCCATCTTTACCTCACAGTGTTAATAATCCTCTTG-3'; SEQ NO. 18), miRNA (miR-141: 5'-UAACACUGUCUGGUAAAGAUGG-3'; SEQ NO. 17), and mRNA (Mcl-1 mRNA 5'-GCAAGUGGCAAGAGGAUUAU-3'; SEQ NO. 131) hybridize as intended. This analysis was conducted at 37 °C using components (miRNA trigger, miRNA, mRNA) at a concentration of 100 nM and Na₂O₃ at a concentration of 1.0 M. +The procedure was performed under conditions of an aqueous solution containing ions. The melting temperature (Tm) was analyzed using Oligo Analyzer version 3.1 from the IDT (Integrated DNA Technologies) website (http: / / www.idtdna.com). The reaction products were separated on a 20% polyacrylamide gel in 1x TBE buffer (Tris base 89 mM, Boric acid 89 mM, EDTA 20 mM) at a constant voltage of 120 V for 180 minutes. After staining with GelRed, gel images were obtained using a Gel Doc EZ Imager (Bio-rad, Hercules, USA).

[0122] Reference Example 3. Analysis of resistance to biological degradation

[0123] Human serum was purchased from Sigma-Aldrich. Hela cell lysates were prepared using RIPA buffer (NaCl 150 mM, EDTA 5 mM, Tris 50 mM, NP-40 1.0%, sodium deoxycholate 0.5%, SDS 0.1%). Oligonucleotides were mixed with human serum, cell lysates, or distilled water and reacted at 37 °C for 24 hours. The final concentrations of human serum and cell lysates were 80% and 5 mg / mL, respectively. The mixture was then placed in a centrifugation filter (MWCO = 30 kDa, Millipore) and centrifuged at 14,000 g for 30 minutes. Finally, a filter permeate containing oligonucleotides (~15 kDa) was obtained and separated on a 15% polyacrylamide gel using 1x TBE buffer at a constant voltage of 120 V for 120 minutes. After staining with EtBr, a gel image was obtained using the Gel Doc EZ Imager (Bio-rad, Hercules, USA).

[0125] Reference Example 4. Cell culture and preparation of stable cell lines

[0126] A total of ten cancer cell lines (HeLa, HeLa-141, HeLa-200c, MCF-7, MDA-MB-231, MDA-MB-453, HL-60, MV4-11, NB-4, MOLM-14) were cultured according to recommended cell culture conditions. The cell lines were purchased from the Antican Type Culture Collection (ATCC; Manassas, VA, US). Hela-141 and Hela-200c cell lines were genetically transformed by adenovirus-induced genetic recombination. The transformed Hela cell lines were provided by Professor Bit-Naeri Kim's laboratory at Seoul National University, and Hela-141 cells overexpressing miR-141 relative to the parent cell line and Hela-200c cells overexpressing miR-200c were produced using a tetracycline-off system. Each cell was maintained at 37°C at a 5% CO2 concentration and subcultured every 3-4 days when the cells reached saturation. In all experiments, cells were stabilized after culture at least 18 hours prior to the experiment. All cells used in this study were cultured in DMEM (Dulbecco's Modified Eagle Media) or RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS).

[0128] Reference Example 5. miRNA-triggered transfection

[0129] Transfection of adherent cells (HeLa, HeLa-141, HeLa-200c, MCF-7, MDA-MB-231, MDA-MB-453) was performed using Lipofectamine 3000 (Thermo Fisher Scientific) as directed by the manufacturer. Transfection of suspension cells (HL-60, MV4-11, NB-4, MOLM-14) was performed using the Neon transfection system (Thermo Fisher Scientific) as directed by the manufacturer.

[0131] Reference Example 6. Evaluation of miRNA Triggers in AML Patient Samples

[0132] Peripheral blood samples were collected from seven AML patients. All patient information and samples were obtained from Seoul National University Hospital (SNUH) in compliance with the Institutional Review Board (IRB) requirements for the use of research samples. After thawing, cells were placed in DMEM (Dulbecco's Modified Eagle Media) supplemented with 10% fetal bovine serum (FBS), sodium pyruvate, and L-glutamine (GIBCO; Grand Island, NY, US) at a concentration of 1 x 10⁶ 6 cells were cultured at a density of greater than 1 / ml.

[0134] Reference Example 7. Western Blot

[0135] As in the method of Reference Example 4 above, the miRNA trigger was transfected into the cells, and after 72 hours, the cells were collected using a cell scraper and lysed using RIPA buffer (NaCl 150 mM, EDTA 5 mM, Tris 50 mM, NP-40 1.0%, sodium deoxycholate 0.5%, SDS 0.1%). The cells were sonicated 15 times with a rest period of 30 seconds each, and then centrifuged at 15,000 g for 5 minutes. The supernatant was collected and the protein was extracted. A total of 30–40 µg of protein samples were separated onto a 10–15% SDS-PAGE gel and then transferred to a PVDF membrane via a semi-dry blotting system. After blocking the membrane with 5% skim milk for 1 hour, it was reacted with a primary antibody diluted 1000-fold in 1% skim milk for 2 hours. The primary antibodies used were PKR (#12297S, Cell Signaling Technology, MA, US), Mcl-1 (#5453S, Cell Signaling Technology, MA, US), Bcl-2 (#4223S, Cell Signaling Technology, MA, US), Bcl-xl (#2764S, Cell Signaling Technology, MA, US), and B-tublin (#2148, Cell Signaling Technology, MA, US). After reacting the membranes with the primary antibodies, the membranes were washed three times for 10 minutes each with 1X PBST (NaCl 137 mM, KCl 2.7 mM, Na2HPO4 10 mM, KH2PO4 1.8 mM, Tween 20 0.1%) buffer solution, and then reacted for 1 hour with secondary antibodies diluted 1000-fold in 1% skim milk. The secondary antibody used for Western blotting was Goat Anti-Rabbit IgG (H+ The antibodies were L)-HRP Conjugate (#1706515, Bio-Rad) and Goat Anti-Mouse IgG (H + L)-HRP Conjugate (#1706516, Bio-Rad). After washing the membrane reacted with the secondary antibody three times for 10 minutes each with 1X PBST buffer, Clarity Western ECL Substrate (#1705061, Bio-Rad) was added, and images were obtained and analyzed using ChemiDoc (Bio-Rad, Hercules, USA).

[0137] Reference Example 8. Real-time Polymerase Chain Reaction Quantitative Test

[0138] As in the method of Reference Example 4 above, the miRNA trigger was transfected into cells, and after 48 hours, total RNA was extracted using TRIzol (Thermo Fisher Scientific) as directed by the manufacturer. The purified RNA was reverse transcribed using RevertAid reverse transcriptase (Thermo Fisher Scientific) and random hexamer (Thermo Fisher Scientific) after DNase I treatment. The target gene was amplified by adding the primers and cDNA of the target gene to SYBR Green PCR master mix (Thermo Fisher Scientific), and the Cq value was obtained using the StepOnePlus real-time PCR system and then 2 -ΔΔC(t) Quantitative analysis was performed based on the method. The sequences of the primers used in the experiment are listed in Table 1.

[0139] Target name Primer name Sequence (5'-> 3') Sequence number GAPDH GAPDH-Forward CTC CTC CAC CTT TGA CGC TG Sequence No. 1 GAPDH-Reverse TCC TCT TGT GCT CTT GCT GG Sequence No. 2 PKR PKR-Forward GAG GGG AAT GAT GTG ATT GG Sequence No. 3 PKR-Reverse CTG GGC TGT CAC TTC TAG CC Sequence No. 4 Mcl-1 Mcl-1-Forward CTC TCA TTT CTT TTG GTG CCT Sequence No. 5 Mcl-1-Reverse ATT CCT GAT GCC ACC TTC TA Sequence number 6 Bcl-xL Bcl-xL-Forward TCC CCA TGG CAG CAG TAA AG Sequence number 7 Bcl-xL-Reverse TCC ACA AAA GTA TCC TGT TCA AAG C Sequence No. 8 Bcl-2 Bcl-2-Forward GAG AGT GCT GAA GAT TGA T Sequence number 9 Bcl-2-Reverse ATC AAT CTT CAG CAC TCT C Sequence number 10

[0141] Reference Example 9. Analysis of cytotoxicity and cell viability ( CCK -8 Analysis)

[0142] The cytotoxicity and apoptosis-inducing ability of miRNA triggers were analyzed using the CCK-8 (Cell Counting Kit-8) assay (Dojindo, Kumamoto, Japan) as directed by the manufacturer. Cells were cultured in 96-well plates at 5% CO2 concentration and 37°C (5 x 10⁶ 3 Transfection was performed 24 hours after cells / well. Three days after transfection, the culture medium was removed, a CCK-8 solution diluted 10-fold with DMEM was added, and the reaction was carried out at 37°C for two hours. After the reaction, the optical density at 450 nm was measured using a Tecan Infinite M200 pro microplate reader (Mnnedorf, Switzerland).

[0144] Example 1. Optimization of miRNA trigger structure

[0146] Example 1-1. Confirmation of binding with miRNA depending on the length of the loop of the hairpin miRNA trigger

[0147] In this embodiment, the stem length of a suitable hairpin-structured miRNA trigger (hereinafter referred to as a hairpin miRNA trigger) that can easily open its hairpin structure by binding to miRNA and also bind to a target mRNA was examined.

[0148] Hairpin miRNA triggers (HPs) having stems of various lengths (12 to 22 nt) were prepared as in Reference Examples 1-2 above. The hairpin miRNA triggers used in this example can bind to miR-141 and target random sequences, and specific sequences are listed in Table 2 below. The HPs and miRNAs used in this example were not chemically modified.

[0149] Oligo name Sequence (5'-> 3') Sequence number 12nt stem_HP TGCATCGTCCATCCATCTTTACCAGACAGTGTTAATGGACGATGCA Sequence number 11 14nt stem_HP GTTGCATCGTCCATCCATCTTTACCAGACAGTGTTAATGGACGATGCAAC Sequence No. 12 16nt stem_HP TGGTTGCATCGTCCATCCATCTTTACCAGACAGTGTTAATGGACGATGCAACCA Sequence No. 13 18nt stem_HP CATGGTTGCATCGTCCATCCATCTTTACCAGACAGTGTTAATGGACGATGCAACCATG Sequence No. 14 20nt stem_HP ACCATGGTTGCATCGTCCATCCATCTTTACCAGACAGTGTTAATGGACGATGCAACCATGGT Sequence number 15 22nt stem_HP TGACCATGGTTGCATCGTCCATCCATCTTTACCAGACAGTGTTAATGGACGATGCAACCATGGTCA Sequence number 16 miR-141 UAACACUGUCUGGUAAAGAUGG Sequence number 17

[0150] Since the hairpin miRNA trigger contains mutually complementary sequences that hybridize to form a stem-loop structure, and the loop portion includes a region capable of binding to miRNA, we aimed to verify whether the hairpin structure could be opened by binding the miRNA trigger to the miRNA through miRNA addition.

[0151] The hairpin miRNA trigger and miRNA capable of binding to it were each added at a concentration of 100 nM to a buffer (1X PBS, 137 mM NaCl, 10 mM PO4, 2.7 mM KCl, 5 mM MgCl2; pH 7.4) for low cytotoxicity and stable hairpin structure formation, incubated for 1 hour at 37°C, and loaded onto a PAGE (Polyacrylamide gel electrophoresis) gel, and the results are shown in Figure 1.

[0152] As shown in Figure 1, when the stem length of the miRNA trigger was 14nt or less, a band of 150 bp was observed upon the addition of miRNA, indicating that HP and miRNA were binding; however, when the stem length was 16nt or more, it was confirmed that the binding of HP and miRNA was significantly reduced. Since target specificity decreases as the stem length of HP decreases because the region capable of binding to the target mRNA is shorter, subsequent experiments were conducted with the stem length of the hairpin miRNA trigger set to 12 to 14nt so that it could specifically bind to the target mRNA while the hairpin structure could be easily opened by binding with miRNA.

[0154] Example 1-2. Confirmation of binding between the hairpin miRNA trigger, miRNA, and target mRNA

[0155] Whether the hairpin miRNA trigger binds to miRNA and target mRNA to form a miRNA-miRNA trigger-mRNA triple structure was primarily verified using the NUPACK program as in the method of Reference Example 2 above, and the simulation results are shown in Fig. 2. The sequences of each hairpin miRNA trigger, miRNA, and target mRNA used are listed in Table 3 below. The graph on the left in Fig. 2 represents the binding of base pairs of miRNA, mRNA, and miRNA trigger, showing strong binding between miRNA and miRNA trigger (HP) (red diagonal) and strong binding between mRNA and miRNA trigger (HP) (red diagonal). It was observed that unintended non-specific binding was rarely observed, and even when observed, it showed a very low probability (blue diagonal). The graph on the right in Fig. 2 visualizes the graph on the left and represents the intended miRNA-miRNA trigger-mRNA triple structure. In Figure 2, the graph on the left represents the probability of each strand binding to which base of another strand, and the figure on the right shows the predicted triple structure formed when miRNA, HP, and mRNA are inserted. In Figure 2, Equilibrium concentrations represent the amount of triple structure formed when miRNA, HP, and mRNA are inserted (since the concentration of all components is 100 nM, 97% of the corresponding miRNA, HP, and mRNA exist in a triple structure). As shown in Figure 2, computer modeling results confirmed that a hairpin miRNA trigger according to one example can bind to miRNA and target mRNA to form a miRNA-miRNA trigger-mRNA triple structure. Each sequence listed in Table 3 was not chemically modified.

[0156] Oligo name Sequence (5'->3') Sequence number HP (HP-Mcl1-141) CAAGAGGATTATCCATCTTTACCTCACAGGTGTTAATAATCCTCTTG Sequence number 18 miRNA (miR-141) UAACACUGUCUGGUAAAGAUGG Sequence number 17 mRNA (Mcl1) GCAAGUGGCAAGAGGAUUA Sequence No. 19

[0157] miRNA and / or target mRNA were each added at 100 nM to a buffer (1X PBS + 137 mM NaCl, 10 mM PO4, 2.7 mM KCl, 5 mM MgCl2; pH 7.4) containing the hairpin miRNA trigger (HP) verified by computer modeling above, and after incubation at 37°C for 1 hour, each sample was loaded onto a PAGE gel, and the results are shown in Figure 3.

[0158] As shown in Fig. 3, it was confirmed that a hairpin-structured miRNA trigger according to one example can bind to miRNA and / or target mRNA when miRNA is added (results in columns 2 and 4 of the gel image in Fig. 3), and that when miRNA is not present, the hairpin-structured miRNA trigger does not bind to the target mRNA even when target mRNA is added (result in column 3 of the gel image in Fig. 3). From this, it was found that the hairpin miRNA trigger can bind to mRNA only when miRNA is essentially present.

[0160] Examples 1-3. Hairpin miRNA triggers capable of binding to various miRNAs

[0161] A hairpin miRNA trigger capable of binding to the miRNA-200 family (miR-200a, miR-200b, miR-200c) or miR-21 and targeting Mcl-1 mRNA was prepared. MiRNA and / or target mRNA were added to a buffer containing the hairpin miRNA trigger (HP), and after incubation at 37°C for 1 hour, each sample was loaded onto a PAGE gel, and the results are shown in Fig. 4. In the case of the HP used in this example, the portion capable of binding to miRNA was designed such that the 10th to 11th nucleotides from the 3' end were mismatched with the miRNA (M2), and the stem length was 12 nt (S12). The sequences of the HP, miRNA, and target mRNA used in this example are listed in Table 4, and each sequence listed in Table 4 was not chemically modified.

[0162] Oligo name Sequence (5'-> 3') Sequence number HP_Mcl1_M2_S12_miR-21 CAAGAGGATTATTCAACATCAGATTGATAAGCTATAATCCTCTTG Sequence number 20 HP_Mcl1_M2_S12_miR-200a CAAGAGGATTATACATCGTTACCGTACAGTGTTAATAATCCTCTTG Sequence number 21 HP_Mcl1_M2_S12_miR-200b CAAGAGGATTATTCATCATTACCGAGCAGTATTAATAATCCTCTTG Sequence number 22 HP_Mcl1_M2_S12_miR-200c CAAGAGGATTATTCCATCATTACCTTGCAGTATTAATAATCCTCTTG Sequence number 23 miR-21 UAGCUUAUCAGACUGAUGUUGA Sequence No. 24 miR-200a UAACACUGUCUGGUAACGAUGU Sequence number 25 miR-200b UAAUACUGCCUGGUAAUGAUGA Sequence number 26 miR-200c UAAUACUGCCGGGUAAUGAUGGA Sequence number 27 Mcl-1 mRNA ACCCUAGCAACCUAGCCAGAAAAGCAAGUGGCAAGAGGAUUAUGGCUAACAAGAAUAAAU Sequence number 28

[0163] As shown in Figure 4, it was confirmed that the hairpin miRNA trigger, which can bind to various types of miRNAs, can bind to miRNA and / or target mRNA when miRNA is added (results in columns 2 and 4 of the gel image in Figure 4), and that when miRNA is not present, the hairpin miRNA trigger does not bind to the target mRNA even when target mRNA is added (results in column 3 of the gel image in Figure 4).

[0165] Examples 1-4. Verification of the stability of a trigger with introduced chemical modification

[0166] In vitro miRNA trigger ( in vitro) and in vivo ( in vivo For experimental application, HP was constructed in a manner similar to the method of Reference Example 1 by introducing chemical modifications such as LNA (locked nucleic acid), PS (phosphorothioate), or 2'-O-Me (2'-O-Methyl) into the nucleotides of the miRNA trigger to ensure stability for biological samples. The sequences of the HP used in this example and the types and locations of chemical modifications in each sequence are listed in Table 5.

[0167] Oligo name Sequence (5'-> 3') Types of chemical modifications Sequence number DNA HP TATTTCTCATTCCCCCATCTTTACCAGACAGTGTTAGGGAATGAGAAATA - Sequence number 29 LNA HP [LNA T][LNA A][LNA T][LNA T]TCTCATTCCCCCATCTTTACCAGACAGTGTTAGGGAATGAGA[LNA A][LNA A][LNA T][LNA A] LNA Sequence number 30 PS4 HP T*A*T*T*TCTCATTCCCCCATCTTTACCAGACAGTGTTAGGGAATGAGA*A*A*T*A PS Sequence No. 31 PS8 HP T*A*T*T*T*C*T*C*ATTCCCCCATCTTTACCAGACAGTGTTAGGGAAT*G*A*G*A*A*A*T*A PS Sequence No. 32 FPS HP T*A*T*T*T*C*T*C*A*T*C*C*C*C*C*A*T*C*T*T*T*A*C*C*A*G*A*C*A*G*T*G*T*T*A*G*G*G*A*A*T*G*A*G*A*A*A*T*A PS Sequence number 33 2'-O-Me HP mUmAmUmUmUmCmUmCmAmUmUmCmCmCmCmCmAmUmCmUmUmUmAmCmCmAmGmAmCmAmGmUmGmUmUmAmGmGmGmAmAmUmGmAmGmAmAmUmA 2'-O-Me Sequence No. 34

[0168] Cell lysates or human serum were added to chemically modified hairpin miRNA triggers (LNA HP, PS4HP, PS8 HP, FPS HP, 2'-O-Me HP) or to hairpin miRNA triggers without chemical modification (DNA HP) as a control, and an analysis of resistance to biological degradation was performed as in the method of Reference Example 3 above, and the results are shown in Figures 5a and 5b.

[0169] As shown in Figures 5a and 5b, in the case of DNA HP containing un-chemically modified nucleotides, degradation occurred upon 24 hours of exposure to cell lysate or human serum, leaving only 34% and 85%, respectively; however, in the case of miRNA triggers with introduced chemical modifications, degradation was generally inhibited compared to miRNA triggers without introduced chemical modifications. In particular, when 8 nucleotides from both ends of the hairpin miRNA trigger (stem) were modified to PS (PS8 HP), when all nucleotides of the miRNA trigger were modified to PS (FPS), and when all nucleotides of the miRNA trigger were modified to 2'-O-Me, almost no degradation occurred, confirming that the degradation of miRNA triggers by biological samples can be effectively inhibited.

[0170] In addition, to confirm the cytotoxicity of FPS HP and 2'-OMe HP, which showed the best degradation inhibitory effect on biological samples, HP in which the entire sequence of the miRNA trigger (LP) was modified to PS (indicated as PS in Table 6 and Fig. 6), LP in which the entire sequence of the miRNA trigger was modified to 2'-O-Me (indicated as 2'O-Me in Table 6 and Fig. 6), DNA LP as a control (indicated as DNA in Table 6 and Fig. 6), and siRNA were each transfected into cells, and cell viability was measured using the method of Reference Example 9, and the results are shown in Fig. 6. The sequences of each HP or siRNA used to measure cell viability, as well as the positions and types of chemical modifications in each sequence, are listed in Table 6.

[0171] Oligo name Sequence (5'-> 3') Types of chemical modifications Sequence number siRNA UCGAAGUACUCAGCGUAAGU - Sequence number 35 DNA TCGAAGTACTCAGCGTAAGTTCGAAGTACTCAGCGTAAGTTCGAAGTACTCAGCGTAAGT - Sequence number 36 PS T*C*G*A*A*G*T*A*C*T*C*A*G*C*G*T*A*A*G*T*T*C*G*A*A*G*T*A*C*T *C*A*G*C*G*T*A*A*G*T*T*C*G*A*A*G*T*A*C*T*C*A*G*C*G*T*A*A*G*T *: phosphorothioate linkage (PS) Sequence number 37 2'-O-Me mUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmGmUmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmGmUmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmGmU m: 2'-O-Methyl (2'-O-Me) Sequence number 38

[0172] As shown in Figure 6, the miRNA trigger modified with 2'-OMe did not show a significant difference from the negative control (NT; non-transfected) in which HP was not transfected; however, in the case of the PS miRNA trigger, even though it was constructed with an arbitrary sequence, the cell viability was measured to be less than 40%, confirming that it exhibited high cytotoxicity. When combining the results of Figures 5a, 5b, and 6, it was confirmed that the miRNA trigger containing the nucleotide modified with 2'-OMe exhibited high stability and low cytotoxicity.

[0174] Example 2. Search for a construct to enhance the efficiency of miRNA triggers

[0175] In this embodiment, to increase the inhibitory effect of the miRNA trigger on target gene expression, a miRNA trigger capable of binding to multiple miRNAs was prepared.

[0176] A miRNA trigger (2-seed hairpin probe; hereinafter 2SD HP) with a 2-seed hairpin structure capable of binding two miRNAs to the loop was designed. The structure of the 2SD HP is as follows:

[0177] [5'-part that can bind to mRNA of the target gene (T*) -part that can bind to miRNA(1) (mi(1)*) -spacer(TT) -part that can bind to miRNA(2) (mi(2)*)-part that can bind to T* (T)-3'].

[0178] 2SD HP contains sequences (T and T* in the above structure) that can bind complementarily to each other, similar to HP, and thus exists in the form of a hairpin miRNA trigger having a stem-loop structure, and the loop of 2SD HP included a portion (mi(1)*) that can bind to miRNA (1) and a portion (mi(2)*) that can bind to miRNA (2). mi(1)* and mi(2)* included in 2SD HP each consisted of a sequence that can bind complementarily to a sequence of 10 nt from the 5' end of the miRNA to be bound. 2SD HP included a spacer (TT) between mi(1)* and mi(2)*. FIG. 7a is a schematic diagram showing the mechanism of action of 2SD HP in inhibiting the expression of a target gene.

[0179] Specifically, it can combine with miR-141, and pkr Targeting ( pkr By binding to mRNA, pkr A hairpin miRNA trigger (HP) capable of regulating the expression of, and can bind to two miR-141s per trigger, and pkr 2SD HP targeting [the target] was synthesized by Bionia and purified via HPLC for use. The sequences of HP and 2SD HP and the type of chemical modification (*; phosphorothioate linkage) are listed in Table 7 below.

[0180] Oligo name Sequence (5'->3') Sequence number HP_PKR(3)_miR141 TAGCTGTACTTCAACCATCTTTACCAGACAGTGTTATTGAAGTACAGCTA Sequence number 39 2SD HP_PKR(3)_ miR141 T*A*G*C*T*G*T*A*C*T*T*C*A*A*G*A*C*A*G*T*G*T*T*A*T*T*G*A*C*A*G*T*G*T*T*A*T*T*G*A*A*G*T*A*C*A*G*C*T*A Sequence number 40

[0181] The HP and 2SD HP prepared above were transfected into a Hela-141 cell line overexpressing miR-141, and the target as in the method of Reference Example 8 above pkr The expression levels were measured and are shown in Figure 7b. As shown in Figure 7b, when 2SD HP, which can bind to two miRNAs in the loop portion compared to HP, was transfected, the expression level of the target gene was significantly reduced compared to HP.

[0182] From the above results, it was confirmed that including two regions capable of binding to miRNA can increase the effect of suppressing the expression of target genes. This principle was applied to a linear miRNA trigger, and subsequent experiments were conducted by designing the linear miRNA trigger to include two regions containing sequences complementary to miRNA so that it could bind to two miRNAs.

[0184] Example 3. In vitro efficacy evaluation of miRNA trigger

[0185] Examples 3-1. miRNA Regulation of fluorescent protein expression using triggers

[0186] GFP-expressing Hela-141 cells were prepared by transfecting Hela-141 cells with a plasmid expressing GFP fluorescent protein (plasmid used in Chen LL, DeCerbo JN, Carmichael GG. 2008. Alu element-mediated gene silencing. EMBO J 27: 1694-1705). According to the method of Reference Example 1 above, a linear miRNA trigger (LP; GFP_141_141) capable of targeting GFP mRNA (= binding complementarily to GFP mRNA to regulate GFP expression) and binding complementarily to miR-141, and siRNAs (siLuc and siGFP) targeting GFP and Luc (Luciferase), respectively, were synthesized by Bionia. The LP and siRNA sequences used in this example, as well as the types and locations of chemical modifications in each sequence, are listed in Table 8 below.

[0187] Oligo name Sequence (5'->3') modification Sequence number GFP(1)_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmC mUmCmAmCmAmGmUmGmUmUmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmA m; 2'-OMe Sequence number 41 GFP(2)_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmAmAmUmUmUmGmUmGmAmUmGmCmUmAmUmUmGmCmU m; 2'-OMe Sequence No. 42 siLuc UCGAAGUACUCAGCGUAAG None Sequence No. 43 siGFP UUAUGUUUCAGGUUCAGGG None Sequence No. 44

[0188] First, GFP-expressing Hela-141 cells were transfected with siLuc and siGFP, and fluorescence intensity was measured using an ELISA reader. As a result, it was confirmed that the experimental conditions of this example worked well, as fluorescence was significantly reduced in the siGFP-treated group compared to the siLuc-treated group. Additionally, the linear miRNA trigger (GFP(1)_141_141) prepared above was transfected into GFP-expressing Hela-131 cells, and fluorescence intensity was measured, the results of which are shown in Fig. 8. The concentration of the GFP plasmid was 0.5 to 1 μg / ml, and GFP_141_141 was transfected at 30 to 60 nM. As shown in Fig. 8, GFP fluorescence in cells was reduced in a concentration-dependent manner by the linear miRNA trigger according to one example.

[0190] Example 3-2. Confirmation of Cell Line Differentiation Performance of Linear miRNA Trigger

[0191] A linear miRNA trigger (LP; PKR-141-141, PKR-200c-200c) targeting PKR and capable of binding to miR-141 or miR-200c, a linear miRNA trigger (LP; Luc-141-141, PKR-200c-200c) targeting Luc and capable of binding to miR-141 or miR-200c as a control, and a probe (Luc-Luc-Luc) containing three regions capable of binding to Luc were prepared in the manner of Reference Example 1. The sequences of the prepared miRNA triggers and probes, as well as the locations and types of chemical modifications (m; 2'-O-Me), are listed in Table 9 below.

[0192] Oligo name Sequence (5'-3') Sequence number PKR(1)_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmUmAmUmGmUmGmAmGmGmCmAmGmAmGmAmAmCmGmA Sequence number 45 PKR(2)_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmUmAmUmUmUmCmUmCmAmUmUmCmCmCmUmUmCmCmU Sequence number 46 PKR(1)_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmCmGmCmGmCmAmGmUmAmUmUmAmUmAmUmGmUmGmAmGmGmCmAmAmGmAmGmAmAmCmGmA Sequence number 47 PKR(2)_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmUmAmUmUmUmCmUmCmAmUmUmCmCmCmUmUmCmCmU Sequence number 48 Luc_Luc_Luc mUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmGmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmGmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmG Sequence number 49 Luc_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmG Sequence number 50 Luc_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmCmGmCmGmCmAmGmUmAmUmUmAmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmG Sequence number 51

[0193] A linear miRNA trigger was prepared that has the same sequence as the above linear miRNA trigger (Table 9, PKR(1)_141_141, PKR(1)_200c_200c and control) and has PS (Phosphorothioate) bonds added between all nucleotides, and This was transfected into Hela, Hela-141, Hela-200c, and MCF-7 cell lines, respectively, and real-time PCR was performed. pkr mRNA expression levels were measured and shown in Fig. 9a.

[0194] In addition, the linear miRNA triggers and probes chemically modified with the above 2'-OMe (Table 9, PKR(1)_141_141, PKR(1)_200c_200c, and control) were prepared, transfected into Hela, Hela-141, Hela-200c, and MCF-7 cell lines, respectively, and real-time PCR was performed. pkr mRNA expression levels were measured and shown in Fig. 9b.

[0195] As shown in Figures 9a and 9b, when PS was modified or chemically modified with 2'-OMe, (1) in Hela-141 cells, PKR mRNA expression was reduced by about 50 to 70% by the PKR-141-141 miRNA trigger but did not change by miRNA triggers of other sequences, (2) in Hela-200c cells, PKR mRNA expression was reduced by about 60 to 80% by the PKR-200c-200c miRNA trigger but did not change by miRNA triggers of other sequences, and (3) in Mcf-7 cells, PKR mRNA expression was significantly reduced by about 60 to 70% and about 70 to 85% by the PKR-141-141 and PKR-200c-200c miRNA triggers, respectively, confirming that the cell line differentiation performance was significantly superior.

[0196] Meanwhile, when cells were transfected with a PS-modified miRNA trigger, as shown in Figure 6, it was observed that approximately 70% of the cells died due to cytotoxicity, regardless of the miRNA trigger sequence. However, It was confirmed that when a 2'-OMe modified miRNA trigger was transfected into cells, the cells did not die, thus confirming that the 2'-OMe modified miRNA trigger exhibits excellent cell line differentiation performance, cell stability, and low cytotoxicity.

[0198] Example 3-3. Confirmation of cell line differentiation performance of hairpin miRNA trigger

[0199] It can bind to miRNA-141, and pkr A hairpin miRNA trigger (HP_PKR(3)_141) targeting a gene was prepared in the same manner as in Reference Example 1-2. The sequences and chemical modification locations of the HP used in this example are listed in Table 10, and all nucleotides of each sequence were chemically modified to 2'-OMe.

[0200] Oligo name Sequence (5'-3') Sequence number HP_PKR(3)_141 mUmUmGmAmAmGmUmAmCmAmGmCmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmUmAmGmCmUmGmUmAmCmUmUmCmAmA Sequence No. 52

[0201] After transfecting Hela, Hela-141, and MCF-7 cells, respectively, with the hairpin miRNA trigger prepared above, real-time PCR was performed. pkr mRNA expression levels were measured and are shown in Fig. 10. As shown in Fig. 10, selectively via hairpin miRNA triggers only in Hela-141 and MCF-7 cell lines expressing miR-141 pkr mRNA expression decreased.

[0202] Through these results, it was confirmed that hairpin miRNA triggers can distinguish cell lines based on the type of miRNA expressed, and that hairpin miRNA triggers can sufficiently regulate the expression of target genes not only at the level of artificially overexpressed miRNAs but also at the level of miRNAs intrinsically expressed in the cells themselves.

[0204] Example 4. miRNA Trigger Mechanism of Action

[0205] Examples 4-1. miRNA According to existence Target Verification of gene expression regulation effects

[0206] In this embodiment, we aimed to verify whether the reduction in mRNA expression levels of target genes triggered by miRNA depends on miRNA.

[0207] It can combine with miR-141, and pkr A hairpin miRNA trigger (HP_PKR(3)_141; Table 10) targeting a gene was prepared as in Reference Example 1 and Examples 3-3. miR-141* and miR-141, which bind complementarily to miR-141 and can competitively inhibit the binding of miRNA and miRNA trigger, were synthesized by Bionia. The sequence of the hairpin miRNA trigger (HP_PKR(3)_141) used in this example is listed in Table 10 above, and the sequences of miR-141 and miR-141* are listed in Table 11 below, and each sequence listed in Table 11 was not chemically modified.

[0208] Oligo name Sequence (5'-3') Sequence number miR-141 UAACACUGUCUGGUAAAGAUGG Sequence number 17 miR-141* CCAUCUUUACCAGACAGUGUUA Sequence number 53

[0209] (1) Hela-141 cells are transfected with (i) only the hairpin miRNA trigger, or (ii) the miRNA trigger and miR-141* together, and (2) Hela cells are transfected with (i) only the miRNA trigger, or (ii) the miRNA trigger and miR-141 capable of binding to it together, and in each case pkr mRNA expression levels were measured and are shown in Fig. 11.

[0210] As shown in Fig. 11, when a hairpin miRNA trigger is transfected together with miR-141* in Hela-141 cells containing miR-141, compared to the case where the hairpin miRNA trigger is transfected alone pkr Expression increased significantly. From this, it was confirmed that miR-141* hybridizes with miR-141 within the cell, thereby preventing the opening of the hairpin structure of the hairpin miRNA trigger and inhibiting the target expression suppression effect.

[0211] In addition, as shown in Fig. 11, when a hairpin miRNA trigger is transfected into Hela cells in which miR-141 is absent, by the addition of miR-141 pkr Expression was significantly reduced. From this, it was confirmed that when synthesized miR-141 was added externally, miR-141 and the hairpin miRNA trigger combined (hybridized) to induce structure opening, thereby inhibiting target expression.

[0212] Through the above results, it was confirmed that the hairpin miRNA trigger acts as an inhibitor of target gene expression in the presence of miRNA.

[0214] Example 4-2. Confirmation of binding between miRNA trigger and target gene

[0215] In this embodiment, an RNA pull-down assay using streptavidin-coated magnetic beads was designed to demonstrate that the miRNA trigger actually binds to the mRNA of the target gene. A schematic diagram of the RNA pull-down assay experiment is shown in Fig. 12a.

[0216] It can combine with miR-141, and pkrAfter designing a miRNA trigger (HP_PKR_141) targeting [specific group] and a control (HP_luc-141) capable of binding to miR-141 and targeting luc, respectively, biotin was labeled on the 3' end of the oligo at Bionia Inc. The biotin-labeled hairpin miRNA trigger was transfected into cells, and after 48 hours, the cells were lysed by adding lysis buffer (LB-A; 100 mM Tris-HCl, pH 7.5, 500 mM LiCl, 10 mM EDTA, 1% Triton X-100, 5 mM DTT, 20 U / ml DNase I, 100 U / ml RNasin, complete EDTA-free protease-inhibitor cocktail). Cell lysates were sonicated for 20 seconds and rested for 30 seconds, repeated three times using a sonicator, then transferred to a 2 ml tube and centrifuged at 15,000 g for 10 minutes at 4°C. Afterward, the supernatant was collected and transferred to a new tube, from which RNA was extracted. The sequences of the trigger and control used in this example are listed in Table 12 below, and were modified by adding PS (phosphorothioate) bonds (indicated by * in Table 12 below) between all nucleotides of the miRNA trigger and control.

[0217] Oligo name Sequence (5'->3') Sequence number HP_PKR(2)_141 T*A*T*T*T*C*T*C*A*T*C*C*C*C*C*A*T*C*T*T*T*A*C*C*A*G*A*C*A*G*T*G*T*T*A*G*G*G*A*A*T*G*A*G*A*A*A*T*A-Biotin Sequence number 54 HP_PKR(3)_141 T*A*G*C*T*G*T*A*C*T*T*C*A*A*C*C*A*T*C*T*T*T*A*C*C*A*G*A*C*A*G*T*G*T*T*A*T*T*G*A*A*G*T*A*C*A*G*C*T*A-Biotin Sequence number 55 HP_Luc-141 T*C*G*A*A*G*T*A*C*T*C*A*G*C*C*C*A*T*C*T*T*T*A*C*C*A*G*A*C*A*G*T*G*T*T*A*G*C*T*G*A*G*T*A*C*T*T*C*G*A-Biotin Sequence number 56

[0218] Prior to the experiment, the streptavidin-coated magnetic beads were washed three times with 750 µl of B&W buffer (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5 mM EDTA, pH 8.0), and then the beads were resuspended with 300 µl of B&W buffer. Afterwards, 0.1 mg mL-1 Escherichia coliThe sample was placed in 1 µl of B&W buffer containing transfer RNA (tRNA) at room temperature for 1 hour. Subsequently, to bind the target RNA to the beads, 30 µl of streptavidin-coated magnetic beads were incubated with the cell lysate at 25°C at 950 rpm for 3 hours. Afterward, 750 µl of B&W buffer was used to wash the sample three times at 55°C to remove non-specifically bound RNAs. Then, the sample was heated to 90°C and mixed at 950 rpm for 10 minutes using Elution buffer (10 mM Tris-HCl, pH 7.5) to rapidly separate the target RNA bound to the miRNA trigger complex from the cell lysate. The separated RNA was amplified via RT-PCR, and the relative amount of target PKR mRNA was measured by comparing it to the amount before separation using magnetic beads; the results are shown in Figure 12b.

[0219] As shown in Fig. 12b, the amount of PKR mRNA bound to the miRNA trigger was significantly increased in Hela-141 and MCF-7 cell lines, which express miR-141, and in Hela cells, which do not express miR-141, even after pull-down pkr The amount of mRNA did not increase.

[0220] From these results, it was found that when miRNA capable of binding to the miRNA trigger is present in the cell, the miRNA trigger binds to the mRNA of the target gene.

[0222] Example 4-3. Whether the action of the miRNA trigger is associated with the Ago protein

[0223] In this embodiment, to investigate whether the action of miRNA triggers is associated with Ago (Argonaute), a protein that mediates the function of miRNA, siAGO, which can suppress AGO expression, was transfected into cells along with miRNA triggers to determine whether siAGO inhibits the action of miRNA triggers.

[0224] Transfect Hela-141 cells with a hairpin miRNA trigger (HP_PKR(3)_141) along with siAGO1, siAGO2 (using a mixture of siAGO2-1 to siAGO2-4 in equal proportions (1:1:1:1)), or a combination thereof, and target pkr The expression level of mRNA was measured and is shown in Fig. 13b. As a control, siRNA (siLuc) targeting the Luc (luciferase) gene was transfected with HP_PKR(3)_141. The sequence of HP_PKR(3)_141 used in this embodiment is listed in Table 12 above, and the sequences of siAGO1 and siAGO2 are listed in Table 13 below.

[0225] Oligo name Sequence (5'->3') Sequence number siLuc(MM) UCGAAGUACUCAGCGUAAG Sequence No. 43 siAGO1 GGAGUUACUUUCAUAGCAU Sequence number 57 siAGO2-1 GCACGGAAGUCCAUCUGAA Sequence number 58 siAGO2-2 GCAGGACAAAGAUGUAUUA Sequence number 59 siAGO2-3 GGGUCUGUGGUGAUAAAUA Sequence number 60 siAGO2-4 GUAUGAGAACCCAAUGUCA Sequence number 61

[0226] As shown in Fig. 13b, in the negative control (MM) with siLuc added without the addition of siRNA capable of inhibiting AGO expression, approximately 30% was triggered by miRNA. pkr Expression decreased. On the other hand, when miRNA triggers were transfected with siAGO1, siAGO2, or a combination thereof, the inhibitory effect on PKR expression was significantly inhibited compared to the negative control (MM) (consequently, PKR expression increased compared to the negative control). From these results, it was found that the inhibitory effect of miRNA triggers on target mRNAs is associated with AGO1 and AGO2, which are proteins that mediate miRNA function.

[0228] Example 5. Confirmation of the cancer therapeutic effect of miRNA trigger

[0229] Examples 5-1. Selection of Target Genes for Apoptosis Induction

[0230] Bcl-2 family genes, which are anti-apoptotic genes, to induce the death of cancer cells ( bcl-2 , bcl-xL , mcl-1 ) was selected as the target gene for the miRNA trigger.

[0231] To examine the effects of Bcl-2 family gene regulation on apoptosis, Bcl-2 family genes ( bcl-2 , bcl-xL , mcl-1 We prepared siRNA capable of regulating the expression of ). . The sequences of the siRNA used are listed in Table 14 below.

[0232] Oligo name Sequence (5'->3') Sequence number siBcl-2 AUCAAUCUUCAGCACUCUC Sequence number 62 siBcl-xL UUGGUCCCUCAGUAUGGUC Sequence number 63 siMcl-1 AAAUUCGAUACUUCCUUCG Sequence number 64 siLuc UCGAAGUACUCAGCGUAAG Sequence No. 43

[0233] bcl-2 , bcl-xL , and mcl-1 siRNA targeting [specific gene] was transfected into MCF-7 breast cancer cells and PANC-1 pancreatic cancer cells, respectively, and conditions were established using qRT-PCR to reduce the expression of each target gene by more than 80% (transfection was performed using Lipofectamine at a concentration of 60 nM). siLuc targeting Luc (Luciferase) was used as a negative control. Under the same conditions of reducing the expression of each target gene by more than 80%, the degree of apoptosis in each siRNA-transfected cell was measured, and the results are shown in Figures 14a and 14b.

[0234] As shown in Fig. 14a, in MCF-7 breast cancer cells mcl-1 When gene expression was suppressed, cell viability decreased, and additionally, bcl-2 Genes and / or bcl-xL When gene expression was suppressed, the degree of apoptosis increased. In addition, as shown in Figure 14b, in PANC1, a pancreatic cancer cell mcl-1 Genes and bcl-xL It was confirmed that cell survival rate decreased significantly when gene expression was simultaneously suppressed.

[0235] Additionally, in PANC1 cells bcl-xL class mcl-1 Western blot confirmed that the expression of cleaved-PARP1, a cell death marker, increased when inhibited simultaneously, and the results are shown in Fig. 14c.

[0237] Example 5-2. Induction of apoptosis using a linear miRNA trigger

[0238] Based on the results of Example 5-1 above, a linear miRNA trigger (hereinafter Mcl-1-141-141, Mcl-1-200c-200c) capable of binding to the miR-200 family (miR-141, miR-200c) and regulating the Mcl-1 gene, and a linear miRNA trigger (hereinafter Luc-Luc-Luc, Luc-141-141, Luc-200c-200c) targeting the Luc(luciferase) gene as a control were prepared in a manner similar to Reference Example 1-1.

[0239] The sequences of the linear miRNA triggers used are listed in Table 15 below, the sequences of the control group are listed in Table 9 above, and the sequences of siLuc and siMcl-1 are listed in Table 14 above.

[0240] Oligo name Sequence (5'->3') Sequence number Mcl-1_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmGmAmAmCmUmAmCmGmUmAmGmC Sequence number 65 Mcl-1_200c_200c UmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmCmCmGmAmAmCmUmAmCmGmUmAmGmCm Sequence number 66

[0241] The linear miRNA trigger or siRNA (siLuc and siMcl-1) prepared above was transfected into Hela, Hela-141, and Hela-200c cells, respectively, and the degree of cell death was measured and is shown in Fig. 15.

[0242] As shown in Figure 15, in the case of siRNA (siMcl-1), cells died in all Hela, Hela-141, and Hela-200c cell lines, indicating a lack of cell line differentiation performance; this is because the Mcl-1 gene was regulated via the siRNA mechanism regardless of miRNA expression or the type of miRNA expressed. In the case of Mcl-1-141-141, it induced up to approximately 40% apoptosis in Hela-141 cells, showing a similar apoptotic effect to siRNA, while it did not significantly affect cell viability in Hela-200c cells. Additionally, in the case of Mcl-1-200c-200c, it induced up to approximately 40% apoptosis in Hela-200c cells, The apoptotic effect was similar to that of siRNA and did not significantly affect cell viability in Hela-141 cells. From this, it was confirmed that the linear miRNA trigger according to one example exhibits cell line differentiation performance depending on the type of miRNA it can bind to.

[0244] Example 5-3. Confirmation of inhibition of target protein expression using a linear miRNA trigger

[0245] It can combine with miR-141, and mcl-1 A miRNA trigger targeting [the gene] (Mcl-1-141-141; Table 15) and a linear miRNA trigger targeting the Luc(luciferase) gene (Luc-141-141; Table 9) were prepared as a control and transfected into Hela-141 cell lines at various concentrations (5 to 120 nM). . Afterwards, proteins were extracted from Hela-141 cells, and the expression level of Mcl-1 protein was measured by Western blot, and the results are shown in Figure 16.

[0246] As shown in Fig. 16, when compared to the control group Luc-141-141, mcl-1It was confirmed that the expression of the Mcl-1 protein was significantly reduced in the group transfected with Mcl-1-141-141, which regulates the gene. From this, it was confirmed that the linear miRNA trigger according to one example reduces the protein expression of the target gene.

[0248] Example 5-4. Induction of apoptosis using a hairpin miRNA trigger

[0249] It can combine with miR-141, and mcl-1 We prepared hairpin miRNA triggers (Mcl-1(1)-141, Mcl-1(3)-141) targeting [the target] and intended to confirm their apoptosis-inducing effect. The sequences of the hairpin miRNA triggers used in this example are listed in Table 16, and all nucleotides were modified to 2'-OMe, and the sequence of siMcl-1 used as a control is listed in Table 14 above.

[0250] Oligo name Sequence (5'->3') Sequence number HP_Mcl-1(1)_141 mGmCmUmAmCmGmUmAmGmUmUmCmGmGmCmCmAmUmCmUmUmUmAmCmCmAmGmAmCmAmGmUmGmUmUmAmCmCmGmAmAmCmUmAmCmGmUmAmGmC Sequence number 67 HP_Mcl-1(3)_141 mCmGmAmAmGmGmAmAmGmUmAmUmCmGmCmCmAmUmCmUmUmUmAmCmCmAmGmAmCmAmGmUmGmUmUmAmCmGmAmUmAmCmUmUmCmCmUmUmCmG Sequence number 68

[0251] Hela and Hela-141 cells were transfected with the hairpin miRNA trigger prepared above, and the degree of apoptosis was measured and is shown in Fig. 17. As a control, mcl-1 The apoptotic effect was measured by transfecting Hela and Hela-141 cells with siRNA (siMcl-1; Table 14) capable of inhibiting the expression of [specific synth].

[0252] As shown in Figure 17, transfection with siMcl-1 produced apoptotic effects in both Hela and Hela-141 cells; however, when transfection with the hairpin miRNA trigger occurred, approximately 40% of Hela-141 cells present with miR-141 died, while Hela cells did not die at all, which indicates that the target gene is mcl-1The same results were obtained in the HP_Mcl-1(1)_141 and HP_Mcl-1(3)_141 administration groups, which have different complementary binding sites. From this, it was confirmed that the hairpin miRNA trigger according to one example exhibits a cell-specific apoptotic effect on cells expressing miRNA (miR-141) to which it can bind.

[0254] Example 6. In vivo delivery of miRNA trigger ( in vivo Check delivery possibility

[0255] Examples 6-1. fluorescent material connected miRNA Production of triggers and cell transformation

[0256] A linear miRNA trigger (5'-Cy5.5-PKR-miR-155-miR-155-3') capable of binding to miR-155, targeting PKR, and having a Cy5.5 fluorescent dye linked to the 5' end was prepared in the manner of Reference Example 1 above. The sequence of the prepared trigger is listed in Table 17.

[0257] Oligo name Sequence (5'-3') Sequence number Cy5.5_PKR-155_155 Cy5.5-mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmAmUmGmUmGmAmGmGmCmAmGmAmGmAmAmCmGmA Sequence List 69

[0258] Linear miRNA trigger (5'-Cy5.5-miR-155-miR-155-PKR-3') transfection was performed on FLT3-ITD mutant AML cell lines MOLM-14 and MV4-11 and solid tumor cell line Hela using Lipofectamine, and using IVIS 100 (PerkinElmer) Upon observation, it was confirmed that fluorescence was detected in all NOML-14, MV4-11, and Hela cells transfected with the aforementioned linear miRNA trigger, and animal experiments were subsequently conducted.

[0260] Example 6-2. Confirmation of in vivo delivery of miRNA trigger

[0261] 200 µl of the linear miRNA trigger (5'-Cy5.5-PKRmiR-155-miR-155-PKR-3') prepared in Example 8-1 was injected into 8-week-old C57BL / 6 (B6) mice via tail vein injection using invivofectamine (Thermo Fisher Scientific) to a final concentration of 120 nM, and 200 µl of PBS was injected into the mice in the same manner as a negative control.

[0262] In vivo imaging was performed using IVIS 100 (PerkinElmer) on days 1, 2, and 4, respectively, following miRNA trigger injection, and the results are shown in Fig. 18. As shown in Fig. 18, it was confirmed that Cy5.5 linked to the miRNA trigger was detected in major organs and hematopoietic organs of mice, including the liver, spleen, bone marrow, and heart. Cy5.5 fluorescence showed a pattern of gradually decreasing intensity over time and was detected in the mice's bodies until 4 days later. No particular toxicity was observed in any of the mice during the in vivo imaging period.

[0264] Example 6-3. Confirmation of intracellular delivery of miRNA triggers in mouse blood cells (hematopoietic origin cells)

[0265] On day 4 after administration of the miRNA trigger in Example 6-2 above, mice from the experimental group (N = 4) administered with the miRNA trigger and the control group (N = 4) administered with PBS were sacrificed, and specimens (blood cells) were obtained from peripheral blood, spleen, and bone marrow (femoral bone cell extract). Red blood cells were removed using RBC lysis buffer.

[0266] The results of analyzing cell distribution using the FSC-A / SSC-A of the FACS instrument are shown in Figures 19a and 19b. As shown in Figures 19a and 19b, while no fluorescence was observed in the control group (PBS injected), Cy5.5 was measured in blood cells, particularly in groups of lymphocytes and monocytes, in mice administered a miRNA trigger.

[0267] Blood cells from acquired peripheral blood were gated in three stages (Stage 1: removal of debris, Stage 2: selection of single blood cell population, Stage 3: detection of Cy5.5) to select high-quality single blood cells, and blood cells in which Cy5.5 was detected were identified using a FACS instrument, and the results are shown in Fig. 20. As shown in Fig. 20, the miRNA trigger administered to the in vivo system was delivered into the actual blood cells, and the rate of Cy5.5 detection was measured to be 6.2–15.9% based on the total single blood cells.

[0268] Spleen-derived hematopoietic cells and bone marrow hematopoietic cells of mice were gated in the same manner as above to confirm the detection of Cy5.5, and the results are shown in Figures 21 and 22. As shown in Figure 21, Cy5.5 was expressed in 8.7–13.7% of the total spleen-derived hematopoietic cells, and Cy5.5 was detected mainly in lymphocytes and monocytes, similar to peripheral blood.

[0269] In addition, as shown in Figure 22, the percentage of cells expressing Cy5.5 in the bone marrow was relatively low at 1.0–2.0%, but it was confirmed that the expression of Cy5.5 was relatively high in the lymphocyte region. As a result of gating mainly lymphocytes in four stages, Cy5.5 was detected in 5.4–9.6% of the cells.

[0270] From these results, it was confirmed that when miRNA triggers were intravenously injected into B6 mice, the miRNA triggers were detected in major organs and hematopoietic organs in vivo even after 4 days, and were delivered into blood cells such as lymphocytes and monocytes.

[0271] As shown in Figures 21 and 22, the miRNA trigger according to one example was able to be delivered to a single cell in peripheral blood.

[0273] Example 7. Confirmation of the therapeutic effect of miRNA trigger on blood cancer

[0274] Examples 7-1. AML unique miRNA Selection

[0275] In this embodiment, to apply miRNA trigger technology to the treatment of AML (acute myeloid leukemia), various AML cell lines were secured, and miRNAs specifically expressed in AML cells were selected. The FLT3-ITD mutation, observed in approximately 25% of AML patients, was selected as the target disease group, and MV4-11 and MOLM-14, which are cells with the FLT3-ITD mutation, and NB-4 and HL60, which are cells with the FLT3-WT mutation, were secured as controls. To examine whether the expression of miR-155 increases in AML cells with the FLT3-ITD mutation, qRT-PCR was performed to quantify miR-155, and the results are shown in Fig. 23. As shown in Fig. 23, it was confirmed that the expression of miR-155 increased in both MV4-11 and MOLM-14, which are AML cells with the FLT3-ITD mutation.

[0277] Examples 7-2. miR -155 Specific Trigger Manufacturing

[0278] Similar to Reference Example 1-2 above, it can be combined with miR-155, and pkr Hairpin miRNA triggers HP_PKR(2)_155(2'-O-Me-PKR(2)_PM_S14_155) and HP_PKR(3)_155(2'-O-Me-PKR(3)_PM_S14_155) targeting genes were prepared. The HP used in this example was chemically modified so that all nucleotides were 2'-OMe, all nucleotides included in the portion capable of binding to miRNA were perfect match (PM) with the miRNA sequence, and the stem length was 14 nt (S14). The sequences of the HP, miRNA, and mRNA used in this example are listed in Table 18 below.

[0279] Oligo name Sequence (5'->3') Sequence number HP_PKR(2)_155 mUmAmUmUmUmCmUmCmAmUmUmCmCmCmAmAmCmCmCmCmUmAmUmCmAmCmGmAmUmUmAmGmCmAmUmUmAmAmGmGmGmAmAmUmGmAmGmAmAmUmA Sequence number 70 HP_PKR(3)_155 mUmAmGmCmUmGmUmAmCmUmUmCmAmAmAmAmCmCmCmCmUmAmUmCmAmCmGmAmUmUmAmGmCmAmUmUmAmAmUmUmGmAmAmGmUmAmCmAmGmCmUmA Sequence number 71 miR-155 UUAAUGCUAAUCGUGAUAGGGGUU Sequence number 72 PKR mRNA (2) CAAUAAUGGGAAGGAAGGGAAUGAGAAAUAUUAAAUUCUG Sequence number 73 PKR mRNA (3) GUAUUGAAAACAAUUGAAGUACAGCUAAAUGUAAUAACG Sequence number 74

[0280] In buffer (1X PBS, 137 mM NaCl, 10 mM PO4, 2.7 mM KCl, 5 mM MgCl2; pH 7.4), the hairpin miRNA trigger prepared above and miR-155 and / or pkr After adding mRNA at a concentration of 100 nM each and incubating at 37°C for 1 hour This was loaded onto a PAGE gel to determine whether the hairpin miRNA trigger binds to miRNA and mRNA, and the results are shown in Fig. 24. As shown in Fig. 24, bands with increased size appeared either with miRNA alone or with the addition of miRNA and mRNA; thus, it was confirmed that in the presence of miRNA, the miRNA and the miRNA trigger bind to open the hairpin structure, and subsequently bind to mRNA upon the addition of mRNA. On the other hand, when only mRNA was added in the absence of miRNA, no band with increased size appeared, confirming that when miRNA and the hairpin miRNA trigger do not bind, mRNA and the hairpin miRNA trigger do not bind.

[0282] Example 7-3. Selection of AML Death-Inducing Genes

[0283] To select target genes for miRNA triggers to induce apoptosis in hematological cancer cell lines, siRNAs (siMcl-1, siBcl-2, and siBcl-xL; Table 14) targeting anti-apoptotic Bcl-2 family genes were administered to HL-60 cells. When Bcl-2 family genes were inhibited by transfection, the protein level of the cell death marker (cleaved PARP) was measured by Western blot, and the results are shown in Figure 25.

[0284] As shown in Fig. 25, among the Bcl-2 family genes in the blood cancer cell line HL-60, bcl-2 It was confirmed that when gene expression was inhibited (siBcl-2), the expression of cleaved PARP, a cell death marker, significantly increased, strongly inducing apoptosis.

[0286] Example 7-4. Search for miRNA-triggered combination formulations

[0287] In this embodiment, we intended to investigate what combination agent can exhibit an excellent AML therapeutic effect when used in combination with a miRNA trigger capable of binding to miR-155.

[0288] In FLT3-ITD mutant AML cell lines (NOLM-14), cytarabine, azacitidine, decitabine, venetoclax, and gilteritinib, which are used as standard treatments for AML, were treated at their respective IC50 concentrations for 72 hours at 37°C, and subsequently, the expression level of miR-155 was measured and is shown in Fig. 26. As shown in Fig. 26, the cytotoxic agent cytarabine and the hypomethylating agents azacitidine and decitabine Although the decrease in miR-155 expression was not significant, it was confirmed that the FLT3 inhibitor gilteritinib and the Bcl-2 inhibitor venetoclax showed a significant decrease in miR-155 expression.

[0289] From the above results, it was found that cytarabine, azacitidine, and decitabine, which do not deplete miR-155, can be used as combination agents capable of exhibiting excellent AML therapeutic effects when used in combination with miRNA triggers capable of binding to miR-155.

[0291] Example 7-5. Action of linear miRNA triggers in AML cell lines

[0292] It can be combined with miR-155, and pkr A linear miRNA trigger (PKR-155-155) targeting a gene was prepared, transfected into MV4-11 cells with the FLT3-ITD mutation and HL60 cells with the FLT3-WT mutation as a control, respectively, and the target gene ( pkr The expression levels of ) were measured, and the results are shown in Fig. 27. The sequence of the linear miRNA trigger prepared above is listed in Table 19, and the sequence of Luc-Luc-Luc used as a control is listed in Table 9. All nucleotides of the trigger and control were chemically modified to 2'-OMe.

[0293] Oligo name Sequence (5'-3') Sequence number PKR(1)-155-155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmAmUmGmUmGmAmGmGmCmAmGmAmGmAmAmCmGmA Sequence number 75 PKR(2)-155-155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmAmUmUmUmCmUmCmAmUmUmCmCmCmUmUmCmCmU Sequence number 76 luc_155-155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmG Sequence number 77

[0294] As shown in Figure 27, PKR-155-155 successfully inhibited PKR in MV4-11, but no miRNA trigger effect was observed in HL60. This confirmed that the expression of target genes by miRNA triggers can be successfully regulated in AML cell lines.

[0296] Example 7-5. Verification of miRNA Trigger Efficacy in AML Patient-Derived Primary Cells

[0297] Blood samples collected from the bone marrow of AML patients were obtained, and the expression levels of various types of miRNAs were measured and compared. Among the 10 samples obtained from 10 patients, myeloblasts, including monocytes present in the buffy coat layer isolated from the blood, were transferred to a culture system simulating cell line culture conditions and cultured at a lab scale. RNA was extracted from 7 patient samples exhibiting high cellular activity (cells that continued to grow without dying), and the expression levels of miR-9, miR-10b, miR-17, miR-22, miR-125b, miR-126, and miR-155 were measured using Stem loop qRT-PCR. Measurements were taken, and the results are shown in Fig. 28. Stem loop qRT-PCR involves extracting total RNA from cells and then performing a ramping process to create stem loop primers that specifically amplify miRNA. After synthesizing cDNA from the extracted RNA using stem loop primers or U6 primers, qPCR is performed using gene-specific primers. U6 was used as a control group. The gene-specific stem loop reverse transcription (RT) primers and qPCR primers used for stem loop qRT-PCR are as follows.

[0298] Target name Primer name Sequence (5'-> 3') Sequence number U6 RT Primer CGCTTCACGAATTTGCGTGTCAT Sequence number 78 Forward Primer GCTTCGGCAGCACATATACTAAAAT Sequence number 79 Reverse Primer CGCTTCACGAATTTGCGTGTCAT Sequence number 80 miR-9 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGAAGACGGAAGAATGTGCGTCTCGCCTTCTTTCTCATACAG Sequence number 81 Forward Primer GCGTCTTTGGTTATCTAGCTG Sequence number 82 Reverse Primer CGAGGAAGAAGACGGAAGAAT Sequence number 83 miR-10b RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGAAGACGGAAGAATGTGCGTCTCGCCTTCTTTCCACAAATT Sequence number 84 Forward Primer GCTACCCTGTAGAACCGAAT Sequence number 85 Reverse Primer CGAGGAAGAAGACGGAAGAAT Sequence number 86 miR-17 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGAAGACGGAAGAATGTGCGTCTCGCCTTCTTTCCTACCTGC Sequence number 87 Forward Primer GCCAAAGTGCTTACAGTGCA Sequence number 88 Reverse Primer CGAGGAAGAAGACGGAAGAAT Sequence number 89 miR-22 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGAAGACGGAAGAATGTGCGTCTCGCCTTCTTTCACAGTTCT Sequence number 90 Forward Primer GCAAGCTGCCAGTTGAAGAA Sequence number 91 Reverse Primer CGAGGAAGAAGACGGAAGAAT Sequence number 92 miR-125b RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGAAGACGGAAGAATGTGCGTCTCGCCTTCTTTCTCACAAGT Sequence number 93 Forward Primer GCGTCGTACCGTGAGTAATAA Sequence number 94 Reverse Primer CGAGGAAGAAGACGGAAGAAT Sequence number 95 miR-126 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGAAGACGGAAGAATGTGCGTCTCGCCTTCTTTCCGCATTAT Sequence number 96 Forward Primer GTCCCTGAGACCCTAACTT Sequence number 97 Reverse Primer CGAGGAAGAAGACGGAAGAAT Sequence number 98 miR-155 RT Primer GAAAGAAGGCGAGGAGCAGATCGAGGAAGAAGACGGAAGAATGTGCGTCTCGCCTTCTTTCAACCCCTA Sequence number 99 Forward Primer GCGGTTAATGCTAATCGTGATA Sequence number 100 Reverse Primer CGAGGAAGAAGACGGAAGAAT Sequence number 101

[0299] As shown in Figure 28, three of the six patient samples were obtained from patients with confirmed FLT3-ITD mutations, and miR-155 expression was higher compared to AML patient samples from the FLT3-WT group.

[0300] 6,528 samples taken from FLT3-WT patients and 6,562 samples taken from FLT3-ITD mutant patients can bind to miR-155, and pkrA linear miRNA trigger targeting (PKR-155-155; Table 19) and, as a control, a linear miRNA trigger targeting Luc (Luc-155-155, Luc-luc-luc; Tables 9 and 19) were injected into 6528 and 6562 cells via electroporation, pkr The expression amount was measured and is shown in Fig. 29.

[0301] As shown in Fig. 29, PKR-155-155 in 6562 samples pkr The expression of was specifically reduced, and in sample 6528, which is FLT3-WT, it was confirmed that PKR decreased less due to the relatively low expression level of miR-155.

[0302] From these results, it was found that in a group of AML patients with FLT3-ITD mutations, applying a miRNA trigger capable of binding to miR-155 can regulate the expression of target genes specifically in AML patients with FLT3-ITD mutations.

[0304] Examples 7-6. bcl-2 Effects of miRNA triggers targeting

[0305] As with the method of Reference Example 1 above, it can be combined with miR-155, and bcl-2 We designed five linear miRNA triggers targeting the gene. All five linear miRNAs are bcl-2 It includes a portion capable of binding complementarily to the gene, but bcl-2 The binding sites are different from each other. The sequences of the linear miRNA triggers prepared above are listed in Table 21, the sequences of Luc-Luc-Luc and luc-155-155 used as controls are listed in Tables 19 and 9, and the siRNA sequences are listed in Table 13. All nucleotides of the triggers and controls were chemically modified to 2'-OMe.

[0306] Oligo name Sequence (5'-3') Sequence number Bcl-2(1)_155_155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmGmCmCmUmGmAmAmGmAmCmUmGmUmUmAmA Sequence No. 102 Bcl-2(2)_155_155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmAmUmGmCmCmAmCmAmGmAmGmUmUmAmUmUmCmC Sequence No. 103 Bcl-2(3)_155_155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmAmUmAmCmAmCmUmAmUmUmUmGmUmGmAmGmCmA Sequence No. 104

[0307] As the five linear miRNA triggers prepared above and a positive control bcl-2 Cell viability was measured after transfection of MOLM-14, an AML cell line with FLT3 mutation, with siRNA (siBcl-2) capable of binding to it, and this is shown in Fig. 30a.

[0308] Figure 30a shows the results of measuring cell viability (%) after transfection of the AML cell line MOLM-14 with a linear miRNA trigger that can bind to miR-155 and various sites of Bcl-2.

[0309] As shown in FIG. 30a, the target bcl-2 It was confirmed that the degree of apoptosis caused by miRNA triggers varied depending on the binding site with the gene, and in one example, when a linear miRNA trigger was transfected, a blood cancer cell apoptosis effect was observed.

[0310] In addition, protein expression of the target Bcl-2 and the apoptosis marker cleaved PARP in cells transfected with the miRNA trigger was measured by Western blot, and the results are shown in Fig. 30b. As shown in Fig. 30b, Bcl-2 protein expression was reduced by the miRNA trigger.

[0312] Example 7-7. mcl-1 Effects of miRNA triggers targeting

[0313] It can be combined with miR-155, and mcl -1 or bcl -2Linear miRNA triggers (Mcl-1_155_155 and Bcl-2_155_155) targeting [the target] were prepared, transfected into MV4-11, an AML cell line with FLT3 mutations, and cell viability was measured and is shown in Figures 31a and 31b. The sequences of the linear miRNA triggers prepared above are listed in Tables 20 and 22, and the sequences of Luc-Luc-Luc and luc-155-155 used as controls are listed in Tables 19 and 9. All nucleotides of the triggers and controls were chemically modified to 2'-OMe.

[0314] Oligo name Sequence (5'->3') Sequence number Mcl-1_155_155 mUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmUmUmAmUmGmUmUmUmCmAmGmGmUmUmCmAmGmGmGmGmGmAmCmCmGmAmAmCmUmAmCmGmUmAmGmC Sequence No. 105

[0315] As shown in FIGS. 31a and 31b, mcl-1 or bcl-2 It was confirmed that linear miRNAs targeting MV4-11 induce apoptosis.

[0317] Example 8. Confirmation of the therapeutic effect of miRNA trigger on breast cancer

[0318] Examples 8-1. Bcl - xL as a target linear miRNA Trigger effect

[0319] As with the method of Reference Example 1 above, it can be combined with miR-222, and bcl-xL Two linear miRNA triggers (Bcl-xL(1)-222-222 and Bcl-xL(2)-222-222) capable of regulating gene expression were prepared. The two linear miRNAs are all bcl-xL It includes a portion capable of binding complementarily to the gene, but bcl-xLThe binding sites are different from each other. The sequences of the linear miRNA triggers prepared above are listed in Table 23, and the sequences of Luc-Luc-Luc and luc-222-222 used as controls are listed in Tables 23 and 9. All nucleotides of the triggers and controls were chemically modified to 2'-OMe.

[0320] Oligo name Sequence (5'->3') Sequence number bcl-xL(1)_222_222 mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmUmCmUmCmCmUmUmCmCmUmGmCmCmCmUmUmCmCmU Sequence number 106 bcl-xL(2)_222_222 mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmUmAmCmCmUmGmCmCmAmGmCmCmUmCmCmUmU Sequence No. 107 luc_222-222 mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmG Sequence number 108

[0321] As the 7 linear miRNA triggers prepared above and a positive control bcL-xL Cell viability was measured after transfection of MDA-MB-231, a breast cancer cell line overexpressing miR-222, with siRNA (siBcl-xL) capable of binding to it, and is shown in Fig. 32a.

[0322] As shown in FIG. 32a, the target bcL-xL It was confirmed that the degree of apoptosis caused by miRNA triggers varied depending on the binding site with the gene, and two linear miRNA triggers capable of effectively killing breast cancer cells were selected (1 and (2) in Fig. 30a, which had better reproducibility).

[0323] Protein expression of the target Bcl-xL and the apoptosis marker cleaved PARP was measured by Western blot in cells transfected with the selected miRNA trigger, and the results are shown in Fig. 32b. As shown in Fig. 32b, Bcl-xL protein expression decreased in a concentration-dependent manner due to the miRNA trigger, and the protein expression of the apoptosis marker cleaved PARP increased.

[0324] Cell viability and target gene ( bcl-xLThe mRNA expression and protein expression of ) were measured, and the results are shown in Figs. 33a to 33c. Since the MDA-MB-453 cell line does not express miR-222, unlike the results from MDA-MB-231, cell viability and the target are also affected by a linear miRNA trigger according to one example. bcl-xL mRNA expression and protein expression did not change significantly.

[0326] Example 8-2. bcl-xL or mcl-1 Effects of linear miRNA triggers targeting

[0327] It can be combined with miR-222, and bcl-xL or mcl-1 Linear miRNA triggers targeting [specific target] were prepared, and these were individually or in combination transfected into the breast cancer cell line MDA-MB-231. Cell viability was measured and is shown in Fig. 34. As controls, siRNAs targeting Mcl-1 and Bcl-xL were used. The sequences of the linear miRNA triggers prepared above are listed in Table 24, the sequences of Luc-Luc-Luc and luc-222-222 used as controls are listed in Tables 23 and 9, and the siRNA sequences are listed in Table 13. All nucleotides of the triggers and controls were chemically modified to 2'-OMe.

[0328] Oligo name Sequence (5'->3') Sequence number Mcl-1_222_222 mAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmCmCmGmAmAmCmUmAmCmGmUmAmGmC Sequence number 109

[0329] As shown in FIG. 34, bcl-xL When gene-targeted miRNA triggers were introduced, the cell death effect was significantly superior, and additionally, mcl-1 Introducing a miRNA trigger targeting [the cell] did not further increase the degree of cell death.

[0331] Example 8-3. Effects of a miRNA trigger capable of binding to miR-141 or let7f

[0332] It can be combined with miR-141 or let7f, and bcl-xL or mcl-1 Linear miRNA triggers targeting [the target] were prepared, and these were individually or in combination transfected into the breast cancer cell line MCF-7, and cell viability was measured, as shown in Fig. 34. The sequences of the miRNA triggers and control groups used in this example are listed in Tables 25, 9, and 13. All nucleotides of the triggers and control groups were chemically modified to 2'-OMe.

[0333] Oligo name Sequence (5'->3') Sequence number Luc_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmG Sequence number 50 Mcl-1_141_141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmGmAmAmCmUmAmCmGmUmAmGmC Sequence number 110 Luc_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmCmGmCmGmCmAmGmUmAmUmUmAmUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmG Sequence number 51 Mcl-1_200c_200c mUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmUmCmCmAmUmCmAmUmUmAmCmCmGmCmGmCmAmGmUmAmUmUmAmCmCmGmAmAmCmUmAmCmGmUmAmGmC säköjboldeh 111 luc_let7f_let7f mAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAUmCmGmAmAmGmUmAmCmUmCmAmGmCmGmUmAmAmG 112 Mcl-1_let7f_let7f mAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmCmCmGmAmAmCmUmAmCmGmUmAmGmC sikkubodehmah 113 bcl-xL(1)_let7f_let7f mAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmUmCmUmCmCmUmUmCmCmUmGmCmCmCmUmUmCmCmU säkõmboledhma 114 bcl-xL(2)_let7f_let7f mAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmUmAmCmCmUmGmCmCmAmGmCmCmUmCmCmUmU 115 Bcl-xL(1)- 141-141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmUmCmUmCmCmUmUmCmCmUmGmCmCmCmUmUmCmCmU säköjboldeh 116 Bcl-xL(2)- 141-141 mCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmCmCmAmUmCmUmUmUmAmCmCmUmCmAmCmAmGmUmGmUmUmAmUmAmCmCmUmGmCmCmAmGmCmCmUmCmCmUmU Sequence number 117

[0334] As shown in Fig. 34, when treated with a miRNA trigger according to one example, the breast cancer cell apoptosis effect was excellent, and mcl-1 miRNA triggers targeting and bcl-xL It was found that the degree of apoptosis increased further in the group treated with all miRNA triggers targeting [the target].

[0336] Example 8-4. Effects of a miRNA trigger capable of binding to miR-222 and let7f

[0337] Linear miRNA triggers capable of binding to miR-222 or let7f and targeting Bcl-xL or Mcl-1 were prepared, and these were transfected into the breast cancer cell line MDA-MB-231, either individually or in combination, and cell viability was measured, as shown in Fig. 35. The sequences of the miRNA triggers and controls used in this example are listed in Tables 9 and 24. All nucleotides of the triggers and controls were chemically modified to 2'-OMe.

[0338] As shown in Fig. 35, the degree of MDA-MB-231 cell death was high when treated with a miRNA trigger according to one example, and mcl-1 When combined with a miRNA trigger targeting [it], the degree of apoptosis increased synergistically.

[0340] Example 9. Hairpin miRNA trigger capable of binding to two types of miRNA

[0341] Similar to Example 2 above, in this example, a hairpin-structured miRNA trigger that opens when bound to two miRNAs was prepared, and the types of miRNAs to which the trigger could bind were different. The hairpin miRNA trigger structure prepared in this example is as follows:

[0342] [5'-part that can bind to mRNA of the target gene (T*) -part that can bind to miRNA(1) (mi(1)*) -spacer(TT) -part that can bind to miRNA(2) (mi(2)*)-part that can bind to T* (T)-3'].

[0343] It can be combined with Let-7f and miR-222 simultaneously, and mcl-1 A hairpin miRNA trigger targeting [the target] was synthesized by Bionia and purified using HPLC for subsequent experiments. All nucleotides were modified to 2'-O-methyl groups. The sequences of the prepared miRNA triggers are listed in Table 26. In the table below, (10) indicates a hairpin in which only the 5' to 10 mer of the miRNA binds to the loop, and (full) indicates a hairpin in which the entire sequence of the miRNA binds to the loop.

[0344] Oligo name Sequence (5'->3') Sequence number HP_Luc_7f+222(10) mUmCmGmAmAmGmUmAmCmUmCmAmGmCmAmAmCmUmAmUmAmCmAmAmAmCmCmCmAmGmUmAmGmCmGmCmUmGmAmGmUmAmCmUmUmCmGmA Sequence number 118 HP_Mcl-1_7f+222(full) mCmCmGmAmAmCmUmAmCmGmUmAmGmCmAmAmCmUmAmUmAmCmAmAmUmCmUmAmCmUmAmCmCmUmCm AmAmCmCmCmAmGmUmAmGmCmCmAmGmAmUmGmUmAmGmCmUmGmCmUmAmCmGmUmAmGmUmUmCmGmG Sequence number 119 HP_Mcl-1_7f+222(10) mCmCmGmAmAmCmUmAmCmGmUmAmGmCmAmAmCmUmAmUmAmCmAmAmAmCmCmCmAmGmUmAmGmCmGmCmUmAmCmGmUmAmGmUmUmCmGmG Sequence number 120

[0345] The hairpin miRNA trigger prepared above is expected to be open only when both different types of miRNAs are present, thereby inhibiting the expression of the target gene, and a schematic diagram of the process in which the hairpin miRNA trigger capable of binding to two types of miRNAs can regulate the expression of the target gene is shown in Fig. 36.

[0346] The hairpin miRNA trigger prepared above was transfected into MDA-MB-231 and MDA-MB-453 cells, and cell viability was measured, with the results shown in Fig. 37. As shown in Fig. 37, the degree of apoptosis increased in the MDA-MB-231 cell line, in which both miR-222 and let-7f were overexpressed, compared to the MDA-MB-453 cell line, in which let-7f was overexpressed but miR-222 was not overexpressed.

[0348] Example 10. Effect of Hairpin miRNA Trigger on Breast Cancer Cell Apoptosis

[0349] It can be combined with miR-222 or let-7f, and mcl-1 or bcl-xL A hairpin miRNA trigger targeting [the target] was prepared, and cell viability was measured after transfection into the breast cancer cell line MDA-MB-231, and the results are shown in Fig. 38.

[0350] The hairpin miRNA triggers used in this example are listed in Table 27 below, and all nucleotides of the triggers were modified to 2'-O-methyl groups. In Table 27, the number (-1, -4, or -6) following the miRNA trigger name indicates the relative position selected among several possible cases where the stem becomes 14nt at the target site of each target gene.

[0351] Oligo name Sequence (5'->3') Sequence number HP_luc_let7 mUmCmGmAmAmGmUmAmCmUmCmAmGmCmAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmGmCmUmGmAmGmUmAmCmUmUmCmGmA Sequence number 121 HP_luc_222 mUmCmGmAmAmGmUmAmCmUmCmAmGmCmAmCmCmCmAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmGmCmUmGmAmGmUmAmCmUmUmCmGmA Sequence No. 122 HP_Mcl-1_let7 mCmCmGmAmAmCmUmAmCmGmUmAmGmCmAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmGmCmUmAmCmGmUmAmGmUmUmCmGmG Sequence No. 123 HP_Mcl-1_222 mCmCmGmAmAmCmUmAmCmGmUmAmGmCmAmCmCmCmAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmGmCmUmAmCmGmUmAmGmUmUmCmGmG Sequence No. 124 HP_bcl-xL(5)_222-1 mUmUmCmCmUmGmCmCmCmUmUmmCmCmUmAmCmCmCmAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmAmGmGmAmAmGmGmGmCmAmGmGmAmA Sequence number 125 HP_bcl-xL(6)_222-4 mUmAmCmCmUmGmCmCmAmGmCmCmUmCmAmCmCmCmAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmGmAmGmGmCmUmGmGmCmAmGmGmUmA Sequence number 126 HP_bcl-xL(5)_222-6 mUmCmUmCmCmUmUmCmCmUmGmCmCmCmAmCmCmCmAmGmUmAmGmCmGmUmGmAmUmGmUmAmGmCmUmGmGmGmCmAmGmGmAmAmGmGmAmGmA Sequence No. 127 HP_bcl-xL(6)_let7-1 mCmUmGmCmCmAmGmCmCmUmCmCmUmUmAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmAmAmGmGmAmGmGmCmUmGmGmCmAmG Sequence number 128 HP_bcl-xL(6)_let7-4 mUmAmCmCmUmGmCmCmAmGmCmCmUmCmAmAmCmUmAmUmAmCmAmAmUmGmAmAmCmUmAmCmCmUmCmAmGmAmGmGmCmUmGmGmCmAmGmGmUmA Sequence number 129

[0352] As shown in FIG. 38, it can combine with miR-222, and mcl-1 It can bind to let-7f and a hairpin miRNA trigger targeting, and bcl-xL It was confirmed that when a hairpin miRNA trigger targeting (6) was transfected into cells, the cell death effect was significantly increased.

[0354] Example 12. Preparation of a dumbbell-structured miRNA trigger

[0355] In order to increase the inhibitory effect of the miRNA trigger on target gene expression in this embodiment, the length of the portion complementary to the mRNA of a linear or hairpin miRNA trigger that recognizes 14 nt of mRNA was increased to 20 nt to produce a miRNA trigger with increased specific binding affinity to the mRNA of the target gene. To increase binding specificity to the target gene while maintaining the advantage of the hairpin miRNA trigger, which can inhibit the expression of the target gene only when a miRNA that can be recognized by the trigger is present, a dumbbell-structured miRNA trigger (hereinafter referred to as a dumbbell miRNA trigger) was produced by increasing the portion capable of binding complementarily to the mRNA of the target gene to approximately 20 nt. The sequence of the dumbbell miRNA trigger is listed in Table 28 below.

[0356] Oligo name Sequence (5'-3') Sequence number DB_PKR_S20_141 CCCCCCGAATGAGAAATACCATCTTTACCAGACAGTGTTATATTTCTCATTCCCTTCCTT(C12SPACER)AAGGAAGGGGGGGG Sequence number 130 miRNA-141 UAACACUGUCUGGUAAAGAUGG Sequence number 17 PKR mRNA (2) CAAUAAUGGGAAGGAAGGGAAUGAGAAAUAUUAAAUUCUG Sequence number 73

[0357] 100 nM miRNA and / or 100 nM target mRNA were added to a buffer containing 100 nM dumbbell miRNA trigger (DP) prepared above (1X PBS buffer, + 5 mM MgCl2, 137 mM NaCl, 10 mM PO4, 2.7 mM KCl, 5 mM MgCl2; pH 7.4), and after incubation at 37°C for 1 hour, each sample was loaded onto a PAGE gel, and the results are shown in Fig. 39b.

[0358] As shown in Fig. 39b, it was confirmed that a dumbbell miRNA trigger according to one example can bind to miRNA and / or target mRNA when miRNA is added (results for columns 2 and 4 in the gel image of Fig. 39b), and that when miRNA is not present, the dumbbell miRNA trigger does not bind to the target mRNA even when target mRNA is added (results for column 3 in the gel image of Fig. 39b). From this, it was found that the dumbbell miRNA trigger can bind to miRNA and mRNA when miRNA is present.

Claims

Claim 1 X region capable of binding to miRNA; Y region capable of binding to the mRNA of the target gene; and includes a Y* region capable of binding to the above Y region, and the miRNA comprises miR-141, miR-21, miR-200c, miR-222, let-7f, miR-155, miR-24, miR-29a, miR-27a, miR-200a, miR-200b, miR-429, miR-205, miR-30a, miR-34, miR-203, miR-10b, miR-31, miR-9, miR-490, miR-29a, miR-204, miR-221, miR-138, miR-17, miR-19, miR-569, miR-9, miR-22, miR-29b, miR-125b, miR-126, miR-146a, One or more selected from the group consisting of miR-193a, miR-196b, miR-223, miR-492, miR-135b, miR-331, miR-374a, miR-519a, miR-191, miR-210, miR-24, miR-9, miR-27, miR-103, and miR-107, wherein the X region is 15 to 30 nt long and comprises a nucleic acid sequence that is at least 85% complementary to the nucleic acid sequence of the miRNA, and the target gene Mcl-1 , Bcl-2 , Bcl-xL , Snail1 , Twist1 , SLUG, Zeb1, TCF4, TCF3, FLT3, STAT3, c-Sis, EGFR, Ras, CYCD, Her2, Myc , Raf, VIM , CDH2 , FN1 , ACTA2 , COL1A1 , and SNAI2 A nucleic acid molecule comprising one or more selected from the group consisting of, wherein the Y region has a length of 5 to 30 nt, and the Y region and the Y* region are complementarily bound to form a stem-loop structure. Claim 2 In claim 1, a nucleic acid molecule represented by the following general formula 1 or general formula 2: 5' - Y region - X region - Y* region - 3' (general formula 1) 5' - Y* region - X region - Y region - 3' (general formula 2). Claim 3 A nucleic acid molecule according to claim 1, wherein the X region comprises a nucleic acid sequence that is 90% or more complementary to the nucleic acid sequence of the miRNA. Claim 4 A nucleic acid molecule according to claim 1, wherein the Y region comprises a nucleic acid sequence that is at least 80% complementary to the nucleic acid sequence of the mRNA of the target gene. Claim 5 In claim 1, the X region is a nucleic acid molecule in which the 10th and 11th nucleotides from the 3' end are not complementary to the miRNA. Claim 6 A nucleic acid molecule according to claim 1, comprising 1 to 4 X regions. Claim 7 In paragraph 6, the different X regions are nucleic acid molecules capable of binding to the same or different miRNAs. Claim 8 In claim 1, the X region is a nucleic acid molecule composed of 20 to 25 nucleotides. Claim 9 In claim 1, the Y region is a nucleic acid molecule composed of 10 to 16 nucleotides. Claim 10 In claim 1, the Y* region is a nucleic acid molecule composed of 10 to 16 nucleotides. Claim 11 A nucleic acid molecule according to claim 1, wherein the complementary binding of the Y region and the Y* region is separated by binding with miRNA. Claim 12 The nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises one or more modified nucleotides or a backbone modification, wherein the modified nucleotide is modified by one or more residues selected from the group consisting of 2'-O-methyl, 2'-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridge, 4'-(CH2)2-O-2'-bridge, 2'-LNA, 2'-amino, and 2'-O-(N-methylcarbamate), and the backbone modification is one or more selected from the group consisting of phosphonates, phosphorothioates, and phosphotriesters. Claim 13 In claim 1, the above miRNA is a nucleic acid molecule that is bound to RISC (RNA-induced silencing complex). Claim 14 In claim 1, the miRNA is a nucleic acid molecule that is present in disease cells and is not present or has reduced expression in normal cells. Claim 15 In claim 1, the above-mentioned miRNA is a nucleic acid molecule, wherein the miRNA is one or more selected from the group consisting of miR-141, miR-21, miR-200c, miR-222, let-7f, miR-155, miR-200a, and miR-200b. Claim 16 delete Claim 17 In paragraph 1, the target gene is Mcl-1 , Bcl-2 , and Bcl-xL A nucleic acid molecule that is one or more selected from the group consisting of Claim 18 A composition for regulating target gene expression comprising a nucleic acid molecule according to any one of claims 1 to 15 and 17. Claim 19 A composition for regulating target gene expression according to claim 18, wherein the composition inhibits mRNA expression or protein expression of a target gene. Claim 20 A pharmaceutical composition for the prevention or treatment of cancer comprising a nucleic acid molecule of any one of claims 1 to 15 and 17, wherein the cancer is blood cancer or breast cancer. Claim 21 A pharmaceutical composition according to claim 20 that induces cancer cell death or inhibits cancer cell metastasis. Claim 22 A pharmaceutical composition according to claim 20, wherein the blood cancer is one or more selected from the group consisting of chronic lymphocytic leukemia (like chronic lymphocytic leukemia, CLL), acute lymphocytic leukemia (acute lymphocytic leukemia, ALL), non-Hodgkin lymphomas (NHL), acute myeloid leukemia (AML), and leukemia. Claim 23 A pharmaceutical composition according to claim 20, further comprising an anticancer agent selected from the group consisting of cytarabine, azacitidine, and decitabine. Claim 24 A pharmaceutical composition according to claim 20, wherein the cancer is breast cancer, and the nucleic acid molecule is capable of binding to one or more selected from the group consisting of miR 222, miR-141, miR-21, miR-200c, miR-222, let-7f, miR-492, miR-135b, miR-331, miR-374a, miR-519a, miR-191, miR-210, and miR-24. Claim 25 In paragraph 24, the above nucleic acid molecule mcl-1, bcl-xL , and bcl-2 A pharmaceutical composition capable of binding to one or more target genes selected from the group consisting of Claim 26 A pharmaceutical composition according to claim 20, wherein the cancer is acute myeloid leukemia (AML), and the nucleic acid molecule is capable of binding to one or more selected from the group consisting of miR 155, miR-21, and miR-9, miR-490, miR-29a, miR-204, miR-221, miR-138, miR-17, miR-19, miR-569, miR-9, miR-10b, miR-22, miR-29b, miR-125b, miR-126, miR-146a, miR-193a, miR-196b, and miR-223. Claim 27 In paragraph 26, the above nucleic acid molecule mcl-1, bcl-xL, and bcl-2 A pharmaceutical composition capable of binding to one or more target genes selected from the group consisting of Claim 28 delete Claim 29 delete

Images