A kit of oligonucleotides for accelerated identification of apple chlorotic leaf spot virus in apple plant material

Abstract

This utility model relates to the fields of phytopathology, molecular biology, and virology. A set of synthetic oligonucleotides is described for the detection of apple leaf spot virus using loop-mediated isothermal amplification (LAMP). The kit includes the following sequences of synthetic oligonucleotides: LAMP-AC-1 / 1CAGGTgTTGACAAGGTTCTT; LAMP-AC-1 / 2GAAGGGACTCACGTCAGA; LAMP-AC1 / 3TCGTCAGACAACCACTCAAGTTCCAAGCATCTG TTGAGgGGg; LAMP-AC-1 / 4GATGGCGATGATGATAAGGGGTCAgATTCTGGA GCTTTTCACC. During the design of synthetic oligonucleotides, highly conserved regions of the apple leaf spot virus genome were identified, followed by bioinformatic analysis of available nucleotide sequences and selection of primers optimized for use in the LAMP reaction. The loop-mediated isothermal amplification (LIA) method allows for the reaction to be carried out in a single test tube at a constant temperature without the use of thermal cyclers, making this approach a rapid, technologically simple, and cost-effective method for detecting viral phytopathogens. The developed set of synthetic oligonucleotides was tested in the study of apple plant samples, as well as using positive control samples, which confirmed its diagnostic suitability.