A method for detecting bovine leukemia provirus by real-time PCR (RT-PCR)

Abstract

The invention relates to the field of veterinary diagnostics, in particular the detection of the bovine leukemia virus provirus by the real-time polymerase chain reaction (RT PCR) method. The method for detecting bovine leukemia provirus using real-time polymerase chain reaction (RT-PCR) is distinguished by the fact that two sets of primers and fluorescent probes are proposed for detecting bovine leukemia provirus and assessing the efficiency of the PCR reaction in one reaction mixture: The primer pair BLV_ENV_5461_F – GCCTTCCCAGACTGYGCYATATG, BLV_ENV_5600_R AGGACGTGTTGACCCAGAAGAT and the fluorescent probe BLV_ENV_PROBE 5494R – FAM-TTCCCCTCCCTGGGCTCCCGA-BHQ1 are used to detect the bovine LV provirus, and the primers AGGTCATCACCATCGGCAAT, BETA_ACTIN_2266_R – GCCTTCTCACTCACCCAGGA and the fluorescent probe and BETA_ACTIN_2215_Probe – HEX-GCCTTCTCACTCACCCAGGA BHQ1 are used to detect the bovine endogen and serve as an internal control for the PCR reaction. Results are calculated based on real-time fluorescence measurements of specific amplification of the corresponding genetic targets. The proposed primers and fluorescent probes exhibit high specificity and sensitivity and are capable of detecting up to 20 copies of bovine leukemia provirus DNA per reaction. The proposed method for detecting bovine leukemia provirus using real-time PCR is superior to its analogues in sensitivity, and the bovine beta-actin gene is used as an internal control to ensure the reliability and accuracy of the results. The technical result consists in providing the ability to amplify and detect with high specificity the proviral DNA of bovine leukemia using primers specific to the nucleotide sequences of the env gene fragment, which allows for the effective diagnosis of bovine leukemia; the use of beta-actin as an internal control ensures the reliability and accuracy of the results in RT-PCR.