Nucleic acid regulation of MSH3 in repeat expansion disorders

Abstract

The present invention relates to nucleic acid molecules comprising nucleotide sequences encoding two or more RNAs, wherein at least one RNA comprises a guide sequence substantially complementary to a region within MutS Homolog 3 (MSH3) gene. The invention also relates to recombinant adeno-associated viral (rAAV) vectors, pharmaceutical compositions comprising such rAAV vectors, and their uses in the treatment of repeat expansion disorders.

Description

[0001] NUCLEIC ACID REGULATION OF MSH3 IN REPEAT EXPANSION DISORDERS

[0002] Field of the invention

[0003] The present invention relates to the fields of biotechnology, medicine, and gene therapy. Specifically, the invention relates to recombinant adeno-associated viral (rAAV) vectors comprising nucleic acid molecules capable of inhibiting genes, pharmaceutical compositions comprising such rAAV vectors, and their uses in the treatment of repeat expansion disorders.

[0004] Background of the invention

[0005] The age of onset of repeat expansion disorders is inversely correlated with the length of the nucleotide repeat expansion. However, the inherited repeat length does not explain all of the variation in age of onset. Somatic instability is the process in which the inherited length of a (tri)nucleotide repeats in a gene increases over time. This process has been identified as one of the additional key drivers in the age of onset of repeat expansion disorders, such as Huntington’s disease (HD), Spinocerebellar Ataxias (SCA1 , 2, 3, 6, 7, 8, 12 and 17), Myotonic Dystrophy Type 1 (DM1), Fragile X-associated tremor / ataxia syndrome (FXTAS), Friedreich’s Ataxia (FRDA), Dentatorubral pallidoluysian atrophy (DRPLA), C9ORF amyotrophic lateral sclerosis / frontotemporal dementia (C9ORF ALS / FTD), and many others.

[0006] Several genes have been identified to be associated with somatic instability. One example is the gene MutS Homolog 3 (MSH3), which encodes a protein that forms a heterodimer with the protein called MSH2 to form MutSp, which is part of the post-replicative DNA mismatch repair system. It has been shown that natural polymorphisms in the MSH3 coding region may alter the stability of the MSH3 protein directly or by altering its interaction with MSH2, leading to a loss of function of MSH3 and, as a consequence, reduced somatic instability (Tome S. etal. PLoS Genet. 2013;9(2):e1003280). Thus, MSH3 is a promising target for reducing somatic instability and means to halt or reduce the function of MSH3 would thus entail a therapeutic promise. However, there is still a need for an efficient therapeutic approach able to lower the MSH3 expression and, thereby, reduce somatic instability. The present invention is fulfilling such a need.

[0007] Summary of the invention

[0008] In one aspect, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a first RNA and a nucleotide sequence encoding a second RNA, wherein the first and second RNA each comprises a hairpin; and at least one of the first and second RNA comprises a first guide sequence of at least 19 nucleotides substantially complementary to a region within the human MSH3 gene. The invention also provides a nucleic acid molecule according to the invention with a second guide sequence that is substantially complementary to a region substantially complementary to a region within a human gene selected from HTT, ATXN1, A7 A / 2, ATXN3, DM1, FXTAS, DRPLA, or C9ORF72, preferably the human HTT gene. Furthermore, a nucleic acid molecule is provided by the invention that further comprises a third RNA.

[0009] A second aspect of the invention relates to expression cassette comprising a nucleic acid molecule according to the invention.

[0010] A third aspect of the invention relates to a recombinant adeno-associated virus (rAAV) vector comprising a nucleic acid or expression cassette of the invention.

[0011] A fourth aspect of the invention relates to pharmaceutical compositions comprising the nucleic acid molecule, the expression cassette, or the rAAV vector of the invention.

[0012] A fifth aspect of the invention relates to the use as a medicament of a nucleic acid molecule, an expression cassette, the rAAV vector or an pharmaceutical composition of the invention.

[0013] A sixth aspect of the invention relate to a kit comprising a nucleic acid molecule, an expression cassette, an rAAV vector, or a pharmaceutical composition of the invention.

[0014] A seventh aspect of the invention relates to a host cell comprising the expression cassette of the invention.

[0015] Description of the invention

[0016] General definitions

[0017] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention.

[0018] In this document and in its claims, the verb "to comprise" and its conjugations is used in its nonlimiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In contrast, the verb "to consist of and its conjugations is used in a more limiting sense to mean that items not specifically mentioned are excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one". As used herein, the term "and / or" indicates that one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.

[0019] As used herein, with "At least" a particular value means that particular value or more. For example, "at least 2" is understood to be the same as "2 or more" i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, ... ,etc.

[0020] The word "about" or "approximately" when used in association with a numerical value e.g., about

[0021] 10) preferably means that the value may be the given value (of 10) more or less 10% of the value (in this case a value of between 9 - 11).

[0022] The term "nucleic acid molecule" or "nucleic acid" as used herein, takes its regular meaning in the art and refers to a string of nucleotides, which can either be ribonucleotides or deoxyribonucleotides. Thus, the term "RNA" or "RNA molecule" or "ribonucleic acid molecule" as used herein refers to a polymer of ribonucleotides (e.g., 2, 3, 4, 5, 10, 15, 20, 25, 30, or more ribonucleotides) and the term "DNA" or "DNA molecule" or "deoxyribonucleic acid molecule" as used herein refers to a polymer of deoxyribonucleotides (e.g., 2, 3, 4, 5, 10, 15, 20, 25, 30, or more deoxyribonucleotides). Ribonucleotides and deoxyribonucleotides are both nucleotides that are composed of three subunit molecules: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates. The four nucleobases in DNA are guanine, adenine, cytosine and thymine; in RNA, uracil is used instead of thymine. DNA and RNA can be synthesized naturally (e.g., by DNA replication or transcription of DNA, respectively). RNA can be post-transcriptionally modified. DNA and RNA can also be chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double stranded, i.e., dsRNA and dsDNA, respectively).

[0023] "Sequence identity" is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In the art, when it comes to amino acid or nucleic acid sequences, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Sequence identity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using global alignment algorithms (e.g., Needleman Wunsch) which align the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using local alignment algorithms (e.g., Smith Waterman). Sequences may then be referred to as "substantially identical" when they (when optimally aligned by for example the programs GAP or BESTFIT using default parameters) share at least a certain minimal percentage of sequence identity (as defined below). Alternatively, percentage identity may be determined by searching against public databases, using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences.

[0024] The term "substantially complementary" in this context means that a given nucleic acid sequence is at least 85 %, for instance at least 90 %, and in some embodiments 95 % complementary to another nucleic acid sequence. It is not required to have all the nucleotides of the guide sequence and the target sequence to be base paired, i.e., to be fully complementary.

[0025] As long as the guide sequence is capable of inducing RNA interference by sequence-specifically target a sequence comprising the target RNA sequence, such substantial complementarity is contemplated in accordance with the invention. The term "complementary" or "complement" refers to two nucleotides that can form multiple favorable interactions with one another. Such favorable interactions include and may exclusively be Watson-Crick base pairing.

[0026] Within the context of the present invention, the term "variant thereof, when referring to a given sequence (SEQ ID NO.), includes any nucleic acids which retain at least some of the properties of the corresponding native nucleic. The term "variant" may include any nucleic acids with at least 50; 55; 60; 65; 70; 75; 80; 90; or 95% sequence identity with the native nucleic acid.

[0027] The use of a substance as a medicament as described in this document can also be interpreted as the use of said substance in the manufacture of a medicament. Similarly, whenever a substance is used for treatment or as a medicament, it can also be used for the manufacture of a medicament for treatment. Products for use as a medicament described herein can be used in methods of treatments, wherein such methods of treatment comprise the administration of the product for use.

[0028] Nucleic acid molecule

[0029] The present invention provides in a first aspect a nucleic acid molecule comprising a nucleotide sequence encoding a first RNA and a nucleotide sequence encoding a second RNA, wherein the first and second RNA each comprises a hairpin; and at least one of the first and second RNA comprises a first guide sequence of at least 19 nucleotides substantially complementary to a region within the human MSH3 gene.

[0030] RNA molecules described herein include RNA interference (RNAi) molecules. RNAi molecules are RNA molecules that are capable of RNA interference such as, siRNA (short or small interfering RNA) or micro RNAs (miRNAs) or short-hairpin RNAs (shRNAs). In general RNA molecules as used herein serve to silence, or negatively influence, or inhibit gene expression in a sequence-specific way. For example, RNA molecules, such as RNAi molecules, can be applied to suppress (or silence) the process of gene expression leading towards the production of the pathogenic or dysfunctional protein.

[0031] As used herein, the term "RNA interference" ("RNAi") refers to a selective intracellular degradation of RNA, pre-mRNA or mRNA. "mRNA" or "messenger RNA" is a single-stranded RNA that specifies the amino acid sequence of one or more polypeptide chains. This information is translated during protein synthesis when ribosomes bind to the mRNA. The pre-mRNA is the mRNA precursor that becomes a messenger RNA (mRNA) after processing. It contains both introns and exons. Pre-mRNA requires splicing (removal) of introns to produce the final mRNA molecule containing only exons.

[0032] RNAi occurs in cells naturally to remove foreign RNAs (e.g., viral RNAs) and to regulate gene expression. Natural RNAi proceeds via fragments cleaved from free dsRNA which direct the degradative mechanism to other similar RNA sequences. Alternatively, RNAi can be induced, for example, to silence the expression of target genes. Double stranded RNA structures that are suitable for inducing RNAi are well known in the art. For example, as mentioned above, siRNAs, miRNAs and shRNA can induce RNAi.

[0033] An siRNA comprises two separate RNA strands, one strand comprising a first RNA sequence and the other strand comprising a second RNA sequence, thus a first and a second strand. An siRNA design that is often used involves consecutive base pairs with a 3' overhang. The first and / or second strand(s) may comprise a 3'-overhang. The 3'-overhang preferably is a dinucleotide overhang on both strands of the siRNA.

[0034] Such a design is based on observed Dicer processing of larger double stranded RNAs that results in siRNAs having these features. The 3'-overhang may be comprised in the first strand. The 3'- overhang may be in addition to the first strand. The length of each of the two strands of which an siRNA is composed may, independently be 19, 20, 21 , 22, 23, 24, 25, 26 or 27 nucleotides or more.

[0035] Like the siRNA Dicer substrate described above, an shRNA can be processed by e.g., Dicer to provide for an siRNA having an siRNA design such as described above, having e.g., 19 consecutive base pairs and 2 nucleotide overhangs at both 3'-ends. In case the shRNA is to be processed by Dicer, it is preferred to have the first and second strands at the end of the shRNA, i.e., such that the putative strands of the siRNA are linked via a stem loop sequence: 5' - first strand - stem loop sequence - second strand - optional 2 nt overhang sequence - 3'. Or, conversely, 5' - second strand - stem loop sequence - first strand - optional 2 nt overhang sequence - 3'. Another shRNA design may be a shRNA structure that is processed by the RNAi machinery to provide for an activated RNA-induced silencing complex (RISC) that does not require Dicer processing (Liu et al. 2013 Nucleic Acids Res. 41 (6):3723-33, incorporated herein by reference), so called AgoshRNAs, which are based on a structure very similar to the miR-451 scaffold as described below. Such an shRNA structure comprises in its loop sequence part of the first RNA sequence. Such an shRNA structure may also consist of the first strand, followed immediately by the second strand. MicroRNAs, i.e., miRNA, are guide strands that originate from double stranded RNA molecules that are expressed e.g., in mammalian cells. A miRNA is processed from a pre-miRNA precursor molecule, similar to the processing of an shRNA or an extended siRNA as described above, by the RNAi machinery and incorporated in an activated RNA-induced silencing complex (RISC) (Tijsterman M, Plasterk RH. Dicers at RISC; the mechanism of RNAi. Cell. 2004 Apr 2; 117(1):1 -3). Without being bound by theory, a pre-miRNA is a hairpin molecule that can be part of a larger RNA molecule (pri-miRNA), e.g., comprised in an intron, which is first processed by Drosha to form a pre-miRNA hairpin molecule. The pre-miRNA molecule is an shRNA-like molecule that can subsequently be processed by Dicer to result in an siRNA-like double stranded duplex. The miRNA, i.e., the guide strand, that is part of the double stranded RNA duplex is subsequently incorporated in RISC.

[0036] An RNA molecule such as present in nature, i.e., a pri-miRNA, a pre-miRNA or a miRNA duplex, may be used as a scaffold for producing an artificial miRNA that specifically targets a gene of choice. Based on the predicted RNA structure, e.g., as predicted using e.g., m-fold software, the natural miRNA sequence as it is present in the RNA structure (i.e., duplex, pre-miRNA or pri-miRNA), and the sequence present in the structure that is complementary therewith are removed and replaced with a guide sequence and a complementary passenger sequence. The guide sequence and the complementary passenger sequence may be selected such that the RNA structures that are formed, i.e., pre-miRNA, pri-miRNA and / or miRNA duplex, resemble the corresponding predicted original sequences. pre-miRNA, pri-miRNA and miRNA duplexes (that consist of two separate RNA strands that are hybridized via complementary base pairing), as found in nature often are not fully base paired, i.e., not all nucleotides that correspond with the first and second strand as defined above are base paired, and the first and second strand are often not of the same length. How to use miRNA precursor molecules as scaffolds for any selected target sequence and substantially complementary first RNA sequence is described e.g., in Liu YP Nucleic Acids Res. 2008 May;36(9):2811-2.

[0037] As defined herein, a guide and a passenger RNA sequence might be incorporated in a pre-miRNA or pri- miRNA hairpin. In some embodiments, a nucleic acid of the invention encodes for a first RNA and a second RNA, wherein each RNA comprises a pre-miRNA or pri-miRNA hairpin. In some embodiments, a nucleic acid of the invention encodes for a first RNA, a second RNA, and, where applicable, a third RNA, wherein each RNA comprises a pre-miRNA or pri-miRNA hairpin. Alternative naming conventions for each RNA are within the scope of the invention.

[0038] The 5' to 3' design of the nucleic acid sequence

[0039] In an embodiment of the invention, the nucleotide sequence encoding the first RNA is followed by the nucleotide sequence encoding the second RNA in a 5' to 3' direction. In some embodiments, the nucleotide sequence encoding the first RNA is followed by a first spacer comprising at least 15 nucleotides, which is followed by the sequence encoding the second RNA. It is understood that the 5' to 3' direction refers to the coding strand in case of a double stranded (ds) nucleic acid.

[0040] In an embodiment of the invention, the nucleic acid further comprises a nucleotide sequence encoding a third RNA. Thus, in a 5' to 3' direction, the nucleotide sequence encoding the third RNA follows the nucleotide sequence encoding the second RNA, i.e., the nucleotide sequence encoding the second RNA is followed by a second spacer comprising at least 15 nucleotides, which is followed by the sequence encoding the third RNA.

[0041] In some embodiments of the invention, the first spacer comprises at least: 15; 20; 25; 30; 35; 40; 45; 50; 55; 60; 65; 70; 75; 80; 85; or 90 nucleotides. In some specific embodiments of the invention, the first spacer comprises 75; 76; 77; 78; 79; 80; 81 ; 82;83; 84; 85; 86; 87; 88; 89; 90; 91 ; or 92 nucleotides. In some embodiments of the invention, the first spacer comprises a sequence having SEQ ID NO. 194; or variants thereof.

[0042] In some embodiments of the invention, the second spacer comprises at least: 15; 20; 25; or 30 nucleotides. In some specific embodiments of the invention, the first spacer comprises 25; 26; 27; 28; 29; or 30 nucleotides. In a some embodiments of the invention, the second spacer comprises a sequence having SEQ ID NO. 195; or variants thereof.

[0043] Thus, in some specific embodiments of the invention, the sequence encoding the first RNA is followed by a first spacer of at least 75 nucleotides and by the sequence encoding the second RNA. In some embodiments of the invention, the sequence encoding the first RNA is followed by a first spacer comprising SEQ ID NO. 194; or a variant thereof, wherein the first spacer is followed by the sequence encoding the second RNA.

[0044] In some specific embodiments, the sequence encoding the first RNA is followed by a spacer of at least 75 nucleotides and the sequence encoding the second RNA is followed by a second spacer of at least 25 nucleotides, wherein the second spacer is followed by the sequence encoding the third RNA.

[0045] In some specific embodiments of the invention, the sequence encoding the first RNA is followed by a first spacer comprising SEQ ID NO. 194 ora variant thereof, wherein the first spacer is followed by the sequence encoding the second RNA, wherein the sequence encoding the second RNA is followed by a second spacer comprising or consisting of SEQ ID NO. 195 or a variant thereof, wherein the second spacer is followed by the sequence encoding the third RNA. Guide strands

[0046] The first, second and third RNA to be expressed in accordance with the invention may comprise, in whole or a substantial part thereof, a guide strand.

[0047] The term "guide strand" or "guide sequence" may also be referred to as "antisense strand" as it is complementary ("anti") to a target RNA sequence, i.e., the sense target RNA sequence that is comprised in a pre-mRNA encoded by a human gene. The RNA also comprises a "sense strand or sequence" also called "passenger sequence" or "passenger strand", that may have substantial sequence identity with, or be identical to, the target RNA sequence. Therefore, the RNA can be described as a hairpin or a double stranded RNA that is substantially complementary to itself. As defined herein, the guide sequence might be comprised in the 5p arm of the hairpin, also called herein first strand, or in the 3p arm of the hairpin, also called herein second strand. Thus, the passenger strand might be comprised in the 3p arm of the hairpin, also called herein second strand, or in the 5p arm of the hairpin, also called herein first strand. Such double stranded RNA is to induce RNA interference, thereby reducing expression of transcripts of a human gene. Transcripts that may be targeted may include mis-spliced, unspliced and spliced RNA. The double stranded RNA may also induce transcriptional silencing.

[0048] In one embodiment of the invention at least one of the first and second RNA comprises a first guide sequence of at least 19 nucleotides substantially complementary to a region within the human MSH3 gene. Thus, said double stranded RNA according to the invention is to induce RNA interference, thereby reducing expression of MSH3 transcripts. Said double stranded RNA according to the invention is reducing unspliced, mis-spliced and spliced transcript. In some further embodiments, said induction of RNA interference to reduce expression of RNA transcripts comprising the target RNA sequence means that it is to reduce MSH3 gene expression.

[0049] The substantial complementarity between the guide sequence and the target RNA sequence, preferably consists of at most three mismatched nucleotides, more preferably having two or one mismatched nucleotides. Most preferably the guide sequence and the target RNA sequence have no mismatches.

[0050] It is understood that having three mismatches means over the entire length of the guide sequence when base paired with the target RNA sequence, three nucleotides do not base pair with the target RNA sequence. Having two mismatches means two nucleotides of the guide sequence do not base pair with the target RNA sequence. One mismatched nucleotide means that one nucleotide of the guide sequence does not base pair with the target RNA sequence. Having no mismatches means that all nucleotides of the guide sequence do base pair with the target RNA sequence.

[0051] The guide sequence or the target sequence may also comprise additional nucleotides that do not have complementarity to the target RNA sequence or the guide sequence, respectively. In such a scenario, the substantial complementarity is determined over the entire length of the target RNA sequence. This means that, if there are at most three additional nucleotides in either sequence, the target RNA sequence in this embodiment has either no, one, two or three mismatches over its entire length when base paired with the guide sequence.

[0052] Nucleotides that do not base pair are A and A, G and G, C and C, U and U, A and C, C and U, or A and G. A mismatch may also result from a deletion of a nucleotide, or an insertion of a nucleotide. When the mismatch is a deletion in the strand sequence, this means that a nucleotide of the target RNA sequence is not base paired with the sequence when compared with the entire length of the guide sequence. Nucleotides that can base pair are A-U, G-C and G-U which is also referred to as a G-U wobble, or wobble base pair. In one embodiment the number of G-U base pairs between the strand sequence and the target RNA sequence is 0, 1 or 2.

[0053] In some embodiments, there are no mismatches between the strand RNA sequence and the target RNA sequence and a G-U base pair or G-U pairs are allowed. Preferably, there may be no G-U base pairs between the strand sequence and the target RNA sequence, or the strand sequence and the target RNA sequence only have base pairs that are A- U or G-C. Preferably, there are no G-U base pairs and no mismatches between the RNA strand sequence and the target RNA sequence. The strand sequence of the double stranded RNA as defined herein preferably is fully complementary to the target RNA sequence, said complementarity consisting of G-U, G-C and A-U base pairs. The strand sequence of the double stranded RNA as defined herein more preferably is fully complementary to the target RNA sequence, said complementarity consisting of G-C and A-U base pairs.

[0054] As said, it may be not required to have full complementarity ( / .e., full base pairing (no mismatches) and no G-U base pairs) between the first or second strand of the first RNA and the first strand of the second RNA, and the target RNA sequence as such a strand can still allow for sufficient suppression of gene expression. Also, not having full complementarity may be contemplated for example to avoid or reduce off-target RNA sequence specific gene suppression while maintaining sequence specific inhibition of transcripts comprising the target RNA sequence. However, it may be preferred to have full complementarity as it may result in more potent inhibition.

[0055] In a specific embodiment of the invention, the first guide sequence is comprised in the second RNA.

[0056] Preferably, said first guide sequence of the second RNA has a length of 19, 20, 21 , or 22 nucleotides. As shown in the Examples section, RNA comprising a guide strand of 22 nucleotides complementary to the target RNA sequence in the MSH3 gene were tested. These guide sequences had no mismatches and were fully complementary with the target RNA sequence. Having a few mismatches between the strand complementary to the target RNA and the target RNA sequence may however be allowed according to the invention, as long as the double stranded RNA according to the invention is capable of reducing expression of transcripts comprising the target RNA sequence, such as a luciferase reporter or a transcript comprising the target RNA sequence. As described in the Material and Methods, the guide sequences targeting MHS3 gene were designed to target MSH3 reference sequence NM_002439.5 [exons 2-10 (nt 314 - 1644) or exons 13-24 until the first major polyA site (nt 1840 - 3551); (SEQ ID NO. 2 and SEQ ID NO. 3; Table 1)].

[0057] Table 1 : HTT and MSH3 reference sequences.

[0058] CGCCGCCTCCTCAGCTTCCTCAGCCGCCGCCGCAGGCACAGCCGCTGCTGCCTCAGCC

[0059] GCAGCCGCCCCCGCCGCCGCCCCCGCCGCCACCCGGCCCGGCTGTGGCTGAGGAGCC

[0060] GCTGCACCGACCGTGAGTTTGGGCCCGCTGCAGCTCCCTGTCCCGGCGGGTCCCAGGC

[0061] TACGGCGGGGATGGCGGTAACCCTGCAGCCTGCGGGCCGGCGACACGAACCCCCGGC

[0062] CCCGCAGAGACAGAGTGACCCAGCAACCCAGAGCCCATGAGGGACACCCGCCCCCTCC

[0063] TGGGGCGAGGCCTTCCCCCACTTCAGCCCCGCTCCCTCACTTGGGTCTTCCCTTGTCCT

[0064] CTCGCGAGGGGAGGCAGAGCCTTGTTGGGGCCTGTCCTGAATTCACCGAGGGGAGTCA

[0065] CGGCCTCAGCCCTCTCGCCCTTCGCAGGATGCGAAGAGTTGGGGCGAGAACTTGTTTCT

[0066] TTTTATTTGCGAGAAACCAGGGCGGGGGTTCTTTTAACTGCGTTGTGAAGAGAACTTGGA

[0067] GGAGCCGAGATTTGCTCAGTGCCACTTCCCTCTTCTAGTCTGAGAGGGAAGAGGGCTGG

[0068] GGGCGCGGGACACTTCGAGAGGAGGCGGGGTTTGGAGCTGGAGAGATGTGGGGGCAG

[0069] TGGATGACATAATGCTTTTAGGACGCCTCGGCGGGAGTGGCGGGGCAGGGGGGGGGC

[0070] GGGGAGTGAGGGCGCGTCCAATGGGAGATTTCTTTTCCTAGTGGCACTTAAAACAGCCT

[0071] GAGATTTGAGGCTCTTCCTACATTGTCAGGACATTTCATTTAGTTCATGATCACGGTGGTA

[0072] GTAACACGATTTTAAGCACCACCTAAGAGATCTGCTCATCTAAGCCTAAGTTGGTCTGCA

[0073] GGCGTTTGAATGAGTTGTGGTTGCCAAGTAAAGTGGTGAACTTACGTGGTGATTAATGAA

[0074] ATTATCTTAAATATTAGGAAGAGTTGATTGAAGTTTTTTGCCTATGTGTGTTGGGAATAAAA

[0075] CCAACACGTTGCTGATGGGGAGGTTAATTGCCGAGGGATGAATGAGGTGTACATTTTAC

[0076] CAGTATTCCAGTCAGGCTTGCCAGAATACGGGGGGTCCGCAGACTCCGTGGGCATCTCA

[0077] GATGTGCCAGTGAAAGGGTTTCTGTTTGCTTCATTGCTGACAGCTTGTTACTTTTTGGAA

[0078] GCTAGGGGTTTCTGTTGCTTGTTCTTGGGGAGAATTTTTGAAACAGGAAAAGAGAGACCA

[0079] TTAAAACATCTAGCGGAACCCCAGGACTTTCCCTGGAAGTCTGTGTGTCGAGTGTACAGT

[0080] AGGAGTTAGGAAGTACTCTGGTGCAGTTCAGGCCTTTCTCTTACCTCTCAGTATTCTATTT

[0081] CCGATCTGGATGTGTCCCAGATGGCATTTGGTAAGAATATCTCTGTTAAGACTGATTAATT

[0082] TTTAGTAATATTTCTTGTTCTTTGTTTCTGTTATGATCCTTGTCTCGTCTTCAAAGTTTAATT

[0083] AGAAAATGATTCGGAGAGCAGTGTTAGCTTATTTGTTGGAATAAAATTTAGGAATAAATTA

[0084] TTCTAAAGGATGGAAAAACTTTTTGGATATTTGGAGAAATTTTAAAACAATTTGGCTTATCT

[0085] CTTCAGTAAGTAATTTCTCATCCAGAAATTTACTGTAGTGCTTTTCTAGGAGGTAGGTGTC ATAAAAGTTCACACATTGCATGTATCTTGTGTAAACACTAAACAGGGCTCCTGATGGGAA

[0086] The skilled person can easily determine the silencing potency by using standard luciferase reporter assays and appropriate controls such as described in the Examples and as known in the art (Zhuang et al. 2006 Methods Mol Biol.342:181-7). Suitable sequences encoding guide sequences according to the invention that are targeting a region within the human MSH3 gene may be selected from Table 2. Indeed, as described in Materials and Methods, the guide sequences having SEQ ID NOs. 98-187 were incorporated into the sequence encoding the first strand of the second RNA (miR-451) of scaffold A ( / .e., miR-144 helper scaffold combined with one miR-451 downstream scaffold) and tested in luciferase reporter assays. The first guide sequence is to be combined with a second strand. The skilled person is capable of designing and selecting a suitable second strand of RNA in order to provide a first and second strand for the RNA that can induce RNA interference when expressed in a cell. In one embodiment the guide sequence that is substantially complementary to a region within MSH3 gene reduces MSH3 expression by at least 50 %, at least 55 %, at least 60 %, at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 85 %, at least 90 %, at least 95 %, or at least 100 %. In one embodiment the guide sequence that is substantially complementary to a region within MSH3 gene reduces MSH3 expression by at least 65 %, at least 66 %, at least 67 %, at least 68 %, at least 69, at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, or at least 80 %. In a preferred embodiment the guide sequence that is substantially complementary to a region within MSH3 gene is selected from the group consisting of SEQ ID NOs. 100, 101 , 102, 128, 129, 130, 139, and 183. In a preferred embodiment the guide sequence that is substantially complementary to a region within MSH3 gene is selected form the group consisting of SEQ ID NOs. 101 ,128, and 130.

[0087] Table 2: Suitable guide sequences targeting MSH3 gene.

[0088] In one embodiment of the invention, the nucleic acid molecule further comprising a second guide sequence, preferably of at least 19 nucleotides, wherein the first RNA and second RNA each comprises a guide sequence. In one embodiment, preferably the second guide sequence is substantially complementary to a region within a human gene selected from HTT, ATXN1, ATXN2, ATXN3, DM1, FXTAS, DRPLA, or C9ORF72, preferably the human HTT gene. Thus, the second guide sequence is targeting a gene with a nucleotide repeat expansion that causes a repeat expansion disorder in which somatic instability is implicated. Examples of repeat expansion disorders are Huntington's disease (HD), Spinocerebellar Ataxias (SCA1 , 2, 3, 6, 7, 8, 12 and 17), Myotonic Dystrophy Type 1 (DM1), Fragile X-associated tremor / ataxia syndrome (FXTAS), Friedreich's Ataxia (FRDA), Dentatorubral pallidoluysian atrophy (DRPLA), spinal and bulbar muscular atrophy (SBMA), C9ORF amyotrophic lateral sclerosis / frontotemporal dementia (C9ORF ALS / FTD), brachydactyly and cleidocranial dysplasia (BCCD), blepharophimosis, ptosis and epicanthus inversus (BPES), Huntington disease-like 2 (HDL2), congenital central hypoventilation syndrome (CCHS), Fragile X-associated premature ovarian infertility (FXPOI), fragile X syndrome (FXS), brachydactyly and cleidocranial dysplasia (BCCD), Baratela-Scott syndrome (BSS), cerebellar ataxia, neuropathy and vestibular areflexia syndrome (CANVAS), myotonic dystrophy type 2 (DM2), early infantile epileptic encephalopathy type 1 (EIEE1), progressive myoclonus epilepsy type 1 (Unverricht-Lundborg disease) (EPM1), familial adult myoclonic epilepsy (FAME), Fuchs endothelial corneal dystrophy type 3 (FECD3), fragile XE syndrome (FRAXE), global developmental delay, progressive ataxia, and elevated glutamine (GDPAG), hand-foot-genital syndrome (HFGS), holoprosencephaly type 5 (HPE5), mental retardation with isolated growth hormone deficiency (MRGH), oculopharyngeal muscular dystrophy (OPMD), neuronal intranuclear inclusion disease (NIID), oculopharyngodistal myopathy type 1 (OPDM1), oculopharyngeal muscular dystrophy type 2 (OPDM2), oculopharyngeal myopathy with leukoencephalopathy type 1 (OPML1), synpolydactyly type 1 (SPD1), X-linked dystonia parkinsonism (XDP).

[0089] In a preferred embodiment, the second guide sequence is substantially complementary to a region within intron 1 of the human HTT gene or to a region within exon 1 of the human HTT gene. The present invention provides a combined therapeutic approach that can lower the MSH3 expression and modulate the expression of a gene that presents a (tri) nucleotide repeat expansion. An example of such a gene is the Huntingtin (HTT) gene that presents a CAG repeat expansion in exon 1 , which is the cause of Huntington's disease (HD). The molecular pathogenesis of HD is complex, with toxicity arising among others, from the mutant huntingtin protein and proteolytic cleavage products thereof, as well as from mis-splicing of the mRNA, which leads to the production of HTT1a transcript and subsequently a toxic protein species called HTTexonl . These pathogenic processes are driven by repeat length and, therefore, exacerbated by somatic instability.

[0090] Because of such complexity, the ideal therapeutic approach should target multiple pathways. The present invention describes a therapeutic approach able to potently silence MSH3 expression by targeting a region within the MSH3 gene and to lower mutant HTT levels by targeting a region within intron 1 of the human HTT gene and / or targeting a region within exon 1 of the human HTT gene.

[0091] In one embodiment, the second guide sequence of the second RNA has a length of 19, 20, 21 , or 22 nucleotides and is substantially complementary to a region within intron 1 of the human HTT gene. Thus, said RNA is able to reduce mHTT transcripts, preferably HTT1a mis-spliced transcript. In some further embodiments, said induction of RNA interference to reduce expression of RNA transcripts comprising the target RNA sequence means that it reduces HTT gene expression.

[0092] As shown in the Examples section, RNA comprising a guide strand of 22 nucleotides complementary to the target RNA sequence in the intron 1 ofthe human HTT gene were tested. These strands had no mismatches and were fully complementary with the target RNA sequence. Having a few mismatches between the strand complementary to the target RNA and the target RNA sequence may however be allowed according to the invention, as long as the double stranded RNA according to the invention is capable of reducing expression of transcripts comprising the target RNA sequence, such as a luciferase reporter or a transcript comprising the target RNA sequence.

[0093] As described in the Material and Methods, the guide sequences targeting the intron 1 of human HTT gene were designed to target the HTT reference sequence NG_009378.1 nt 5001 - 7498 (SEQ ID NO. 1 ; Table 1). The skilled person can easily determine the silencing potency by using standard luciferase reporter assays and appropriate controls such as described in the examples and as known in the art (Zhuang et al. 2006 Methods Mol Biol.342:181 -7). Suitable sequences encoding guide sequences according to the invention that are targeting the intron 1 of human HTT gene may be selected from Table 3. As described in the Materials and Methods, the guide sequences having SEQ ID NOs. 17-97 were incorporated into the sequence encoding the first strand of the second RNA (miR-451) of scaffold A ( / .e., miR-144 helper scaffold combined with one miR-451 downstream scaffold) and tested in luciferase reporter assays. This second guide sequence is to be combined with a second strand. The skilled person is capable of designing and selecting a suitable second strand in order to provide a first and second strand for the RNA that can induce RNA interference when expressed in a cell.

[0094] In one embodiment the first guide sequence reduces mHTT expression by at least 50 %, at least 55 %, at least 60 %, at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 85 %, at least 90 %, at least 95 %, or at least 100 %. In one embodiment the first guide sequence reduces mHTT expression by at least 70 %, at least 71 %, at least 72 %, at least 73 %, at least 74 %, at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, at least 80 %, at least 81 % at least 82 %, at least 83 %, at least 84 %, or at least 85 %.

[0095] In a preferred embodiment the first guide sequence reduces mHTT expression by at least 75 %, at least 76 %, at least 77 %, at least 78 %, at least 79 %, or at least 80 %. In a preferred embodiment the guide sequence that is substantially complementary to a region within intron 1 of the human HTT gene is selected from the group consisting of SEQ ID NOs. 21 , 22, 23, 35, 50, 58, 72, and 73. In a preferred embodiment the first guide sequence is selected form the group consisting of SEQ ID Nos: 22, 35, and 58.

[0096] Table 3: Suitable guide sequences targeting the intron 1 of human HTT gene. | | |

[0097] In one embodiment, said second guide sequence has a length of 19, 20, 21 , or 22 nucleotides and is substantially complementary to a region within exon 1 of the human HTT gene. Said RNA according to the invention reduces the expression of HTT transcripts (full length mHTT and wtHTT) and HTT1a transcript. Thus, transcripts that may be targeted may include spliced, mis-spliced and unspliced RNA transcripts. The second guide sequence is to be combined with a second strand of the RNA. The skilled person is capable of designing and selecting a suitable second strand in order to provide a first and second strand for the RNA that can induce RNA interference when expressed in a cell. As shown in the Examples section, RNA comprising a guide strand of 22 or 21 nucleotides complementary to the target RNA in exon 1 of the human HTT gene were tested. These strands had no mismatches and were fully complementary with the target RNA sequence. Having a few mismatches between the strand complementary to the target RNA and the target RNA sequence may however is also encompassed by the invention, because such sequences are also capable of reducing expression of transcripts comprising the target RNA sequence. The skilled person may employ reporter assays, such as luciferase reporter assays, to determine these sequences.

[0098] As described in the Material and Methods the guide sequences targeting the exon 1 of human HTT gene were designed to target the HTT reference sequence NG_009378.1 nt 5001 - 7498 (SEQ ID NO. 1 ; Table 1). Suitable sequences encoding guide sequences according to the invention that are targeting the exon 1 of human HTT gene may be selected from Table 4. As described, the guide sequences having SEQ ID NOs. 4-16 were incorporated into the sequence encoding the first strand of the second RNA (miR-451) of scaffold A ( / .e., miR-144 helper scaffold combined with one miR-451 downstream scaffold) and tested in luciferase reporter assays. This second guide sequence is to be combined with a second strand. The skilled person is capable of designing and selecting a suitable second strand of RNA in order to provide a first and second strand for the RNA that can induce RNA interference when expressed in a cell.

[0099] In a one embodiment the guide sequence that is substantially complementary to a region within exon 1 of the human HTT gene reduces mHTT expression by at least 50 %, at least 55 %, at least 60 %, at least 65 %, at least 70 %, at least 75 %, at least 80 %, at least 85 %, at least 90 %, at least 95 %, or at least 100 %. In one embodiment the first guide sequence reduces mHTT expression by at least 55 %, at least 56 %, at least 57 %, at least 58 %, at least 59 %, at least 60 %, at least 61 %, at least 62 %, at least 63 %, at least 64 %, at least 65 %, at least 66 % at least 67 %, at least 68 %, at least 69 %, or at least 70 %. In a preferred embodiment the first guide sequence reduces mHTT expression by at least 60%, at least 61 %, at least 62 %, at least 63 %, at least 64 %, or at least 65 %. In a preferred embodiment the guide sequence that is substantially complementary to a region within exon 1 of the human HTT gene is selected from the group consisting of: SEQ ID NOs. 8-10 and SEQ ID NO. 16.

[0100] Table 4: Suitable guide sequences targeting the exon 1 of human HTT gene.

[0101] The guide sequence length of the guide sequence is preferably at most 21 , 22, 23, 24, 25, 26, or 27 nucleotides. As described above, guide sequences of 22 nucleotides long were tested. These strands had no mismatches and were fully complementary with the target RNA sequence.

[0102] With regard to the second strand on the RNA, the second strand is substantially complementary with the first strand on the RNA. The second strand combined with the first strand forms a double stranded RNA. As said, this is to form a suitable substrate for the RNA interference machinery such that a guide sequence derived from the first strand is comprised in the RISC complex in order to sequence specifically inhibit expression of its target, i.e., RNA encoded by a gene. The sequence of the second strand has sequence identity with the target RNA sequence. However, the substantial complementarity of the second strand with the first strand may be selected to have less substantial complementarity as compared with the substantial complementarity between the first strand and the target RNA sequence. Hence, the second strand may comprise 0, 1 , 2, 3, 4, or more mismatches, 0, 1 , 2, 3, or more G-U wobble base pairs, and may comprise insertions of 0, 1 , 2, 3, 4, nucleotides and / or deletions of 0, 1 , 2, 3, 4, nucleotides. It is understood that, where the guide sequence is comprised within the second strand of the first RNA, the description above applies to the first strand of the first RNA.

[0103] Preferably the first strand and the second strand are substantially complementary, said complementarity comprising 0, 1 , 2 or 3 G-U base pairs and / or wherein said complementarity comprises at least 17 base pairs. These mismatches, G-U wobble base pairs, insertions and deletions, are with regard to the first strand, i.e., the double stranded region that is formed between the first and second strands. As long as the first and second strands can substantially base pair, and are capable of inducing sequence specific inhibition of an RNA encoded by gene of interest, such substantial complementarity is allowed according to the invention. It is also understood that substantially complementarity between the first and the second strands may depend on the double stranded RNA design of choice. It may depend for example on the miRNA scaffold that is chosen for in which the double stranded RNA is to be incorporated.

[0104] As becomes clear from the above, the substantial complementarity between the first strand and second strand of the RNA may comprise mismatches, deletions and / or insertions relative to a first and second RNA sequence being fully complementary (i.e., fully base paired). In some embodiments, the first and second strands of the RNA have at least 11 consecutive base pairs. Hence, at least 11 consecutive nucleotides of the first strand and at least 11 consecutive nucleotides of the second strand are fully complementary. In some embodiments the first and second strands of the RNA have at least 15 nucleotides that base pair. Said base pairing between at least 15 nucleotides of the first strand and at least 15 nucleotides of the second strand may consist of G-U, G-C and A-U base pairs, or may consist of G-C and A-U base pairs.

[0105] In some embodiments, the first and second RNA sequences have at least 15 nucleotides that base pair and have at least 11 consecutive base pairs. In other embodiments, the first RNA sequence and the second RNA sequence are substantially complementary, wherein said complementarity comprises at least 17 base pairs. Said 17 base pairs may preferably be 17 consecutive base pairs, said base pairing consisting of G- U, G-C and A-U base pairs or consisting of G-C and A-U base pairs. miR-144 and miR-451

[0106] In an embodiment, the nucleic acid of the invention encodes for a first and a second RNA that each comprises a pre-miRNA or pri-miRNA hairpin. Preferably, the first RNA encoded by the nucleic acid of the invention comprises a pre-miRNA or a pri-miRNA hairpin derived from miR-144 and the second RNA comprises a pre-miRNA or a pri-miRNA hairpin derived from miR-451. In other words, and as described above, the first and second strands of the first RNA as defined herein are incorporated in a pre-miRNA or a pri-miRNA hairpin derived from miR-144 and the first and second strands of the second RNA as defined herein are incorporated in a pre-miRNA or a pri-miRNA hairpin derived from miR-451 . Thus, the first RNA can be described as a hairpin or a double stranded RNA that is substantially complementary to itself. In some embodiments, the hairpin in the first RNA comprises at least 70 nucleotides. Thus, the second RNA can be described as a hairpin or a double stranded RNA that is substantially complementary to itself. In some embodiments, the hairpin in the first RNA comprises at least 70 nucleotides.

[0107] In some embodiments, the nucleotide sequence encoding the first RNA comprises SEQ ID NO. 193 or a variant thereof, and the nucleotide sequence encoding the second RNA comprises SEQ ID NO. 192 or a variant thereof. In a specific embodiment of the invention where the first RNA comprises a pre-miRNA or a pri-miRNA hairpin derived from miR-144, the first RNA is mutated to reduce processing and / or expression of the first RNA, here also called miR-144 helper hairpin. In one embodiment, the nucleotide sequence encoding the wild type miR-144 hairpin comprising SEQ ID NO. 457, or a variant thereof, has a mutation. Thus, in one embodiment the nucleotide sequence encoding the first RNA comprises SEQ ID NO. 191 or a variant thereof, and reduces or eliminates processing and / or expression of the first RNA. In some embodiments, the mutation is a single point mutation. In other words, the first RNA comprises a single point mutation to reduce processing and / or expression of the first RNA. Any mismatch, bulge or G-U - wobble introduced within positions 4-8 of the Drosha cleavage site may impair the enzymatic activity of Drosha. Double and triple mismatches, bulges or wobbles within said positions further decrease the activity of Drosha. Therefore, any of the following single nucleotide polymorphisms (SNPs) and combinations thereof within the 4-8 nucleotide stretch of miR-144 may alter (pre-)-miR-144 expression.

[0108] In some embodiments, the nucleic acid encoding for the first RNA comprises at least one mutation selected from the group consisting of: T>G at position 4; A>T or G at position 5; T>A at position 6; C>G or T at position 7; and A>T or G at position 8.

[0109] In preferred embodiments, the first RNA comprises: a single point mutation A>T at position 5. The skilled person can easily determine whether this is the case by using standard assays and appropriate controls such as described in the examples and as known in the art. In preferred embodiments, the nucleic acid encoding for the first RNA comprises: a single point mutation A>T at position 5. The skilled person can easily determine whether this is the case by using standard assays and appropriate controls such as described in the examples and as known in the art.

[0110] The miR-451 scaffold is found to be particularly useful within the present invention as it can induce RNA interference that can result in mainly guide strand induced RNA interference. The miR-451 scaffold does not result in a passenger strand because the processing is different from the canonical miRNA processing pathway (Cheloufi et al. 2010 Nature 465(7298):584-9 and Yang et al., 2010 Proc Natl Acad Sci USA 107(34):15163-8). The miR-451 scaffold represents an excellent backbone to develop a gene therapy product as unwanted potential off-targeting by passenger strands can be largely, if not completely, avoided. As the passenger strand (corresponding to the second sequence) may result in targeting other transcripts, using such scaffolds may prevent such unwanted targeting. Hence, it is preferred that selected scaffolds produce less than 15%; less than 10%; less than 5%; less than 4%; or less than 3% of passenger strands. A miR-451 hairpin preferably comprises from 5' to 3', firstly 5'-CUUGGGAAUGGCAAGG-3' (SEQ ID NO.

[0111] 455), followed by a sequence of 22 nucleotides, comprising or consisting of the first RNA sequence, followed a sequence of 17 nucleotides, which can be regarded as the second RNA sequence, which is complementary over its entire length with nucleotides 2-18 of said sequence of 22 nucleotides, subsequently followed by sequence 5'-VWCUUGCUAUACCCAGA-3' (SEQ ID NO. 456, wherein V is an A or a G or a C and W is an A or a U). Preferably the first 5 -G / C / A nucleotide of the latter sequence is not to base pair with the first nucleotide of the first strand of the first or second RNA.

[0112] Such a hairpin may comprise flanking sequences as found in the original pri-miR-451 hairpin. Alternatively, the 5'-CUUGGGAAUGGCAAGG-3' (SEQ ID NO. 455) and 5'-VWCUUGCUAUCCCAGA-3' (SEQ ID NO.

[0113] 456) may be replaced by flanking sequences of other pri-miRNA structures. As is clear, the sequence of the hairpin may differ not only with regard to the (putative) guide strand sequence, and sequence complementary thereto, as present in the wild type hairpin, but may also comprise additional mutations in the 5', loop and 3' sequence as well, as additional mutations may be required to provide for an RNA structure that is predicted to mimic the secondary structure of the wild type hairpin. Such a hairpin may be comprised in a larger RNA transcript, e.g., a pol II expressed transcript, comprising e.g., a 5'UTR and a 3'UTR and a poly(A) tail. Flanking structures may also be absent.

[0114] The mutated miR-144 helper hairpin combined with one miR-451 downstream hairpin, is defined herein as scaffold A (Figure 1 A). Such scaffold was used to screen all the designed guide sequences that are shown in Table 2-3-4. Suitable sequences encoding for Scaffold A can be selected from SEQ ID NOs. 202-388. Each sequence comprises in a 5’-3’ direction: 5' flanking region (SEQ ID NO. 196), miR-144 helper scaffold (SEQ ID NO. 191), first spacer (SEQ ID NO. 194), one miR-451 scaffold having the characteristics described above with a guide sequence of Table 2-3-4, a 3' flanking region (SEQ ID NO. 197), a BamHI restriction site and the polyadenylation sequence (SEQ ID NO. 198).

[0115] In other embodiments of the invention, the first RNA encoded by a nucleic acid according to the invention also comprises a guide sequence, wherein the nucleotide sequence encoding the first RNA comprises SEQ ID NO. 193 or a variant thereof and the nucleotide sequence encoding the second RNA comprises SEQ ID NO. 192 or a variant thereof. Thus, the nucleic acid of the invention encodes for a first and a second RNA, wherein the first RNA comprises a pre-miRNA or a pri-miRNA hairpin derived from miR-144 and the second RNA comprises a pre-miRNA or a pri-miRNA hairpin derived from miR-451 . As stated above, the first RNA comprises a guide sequence. In those embodiments of the invention where the first RNA comprises a miR- 144 hairpin, the guide sequence may be incorporated into the first or the second strand of the first RNA.

[0116] In those embodiments where the first RNA as defined herein comprises a miR-144, the pri-miRNA preferably comprises from 5' to 3', firstly 5'- UGGGGCCCUGGCUN-3' (SEQ ID NO. 452, wherein N is an A or a C or a G or a U), followed by a sequence of 22 nucleotides, comprising or consisting of a first RNA sequence (first strand), followed by a sequence of 15 nucleotides which can be regarded as the apical loop 5'-UUUGCGAUGAGASMM-3' [SEQ ID NO. 453, wherein S is preferably a C or a G, but can also be a A or a U (in this case S should be W, which is A or U), and is to base pair with the last nucleotide of the first strand of the first RNA; and wherein M is an A or a C and is not to base pair with nucleotide 21 of the first strand of the first RNA], followed by a sequence of 20 nucleotides, which can be regarded as the second RNA sequence (second strand), and which is complementary over its entire length with nucleotides 1 and 3-10 and 12-20 of said sequence of 22 nucleotides, except nucleotide 18 that forms a mismatch with nucleotide 2 of the first strand, subsequently followed by sequence 5'- AGUCCGGGCACCCCC-3' (SEQ ID NO. 454). Preferably the first 5'-U nucleotide of the latter sequence is not to base pair with the first nucleotide of the first strand of the first RNA.

[0117] The miR-144 scaffold may comprise flanking sequences as found in the original pri-miR-144 scaffold. Alternatively, those flanking sequences might be replaced by flanking sequences of other pri-miRNA structures. Specifically, in those embodiments the guide sequence may be comprised within the 5p- or 3p- arm of the hairpin. Drosha processing of miR- 144, subsequently followed by Dicer processing, generates a miRNA duplex which ultimately enters the process of miRNA strand selection. Strand selection is operated within the RISC and determines which strand will become the active strand (also referred to as the guide strand) and which strand will be degraded (passenger strand) (Noland and Doudna, 2013 RNA, 19:639-648).

[0118] Guide strand selection is highly determined by thermodynamic characteristics of the miRNA duplex, and thus it may be influenced by modifying the nucleotide sequence encoding the miRNA. Generally speaking, the strand with the lower thermodynamic stability at its 5' end will become the guide strand. Another key feature of human miRNA guide strands is a 5' end U-bias associated with an enrichment for A and G nucleotides, whilst the passenger strands exhibit a 5' end C-bias and an enrichment for C and U nucleotides (Hai Yang Hu et al. 2009, BMC Genomics 2009, 10:413).

[0119] Conveniently, since the guide strand selection is sequence dependent, the miR-144 constructs of the invention comprising guide strands may be designed as 5p- or 3p- guide-containing regions. Importantly, the probability with which the desired guide strand of the invention will be selected in RISC can be modulated by single nucleotide variations such as selecting U as the first nucleotide of the first strand (5p- design) or the first nucleotide of the second strand (3p- designs) and selecting C or G as nucleotide 20 of the first strand (5p- designs) or nucleotide 19 of the second strand (3p- designs).

[0120] As with miR-451 hairpins, described above, the sequence of the miR-144 hairpin may differ not only with regard to the (putative) guide strand sequence, and sequence complementary thereto, as present in the wildtype hairpin, but may also comprise additional mutations in the 5’, loop and 3’ sequence as well, as additional mutations may be required to provide for an RNA structure that is predicted to mimic the secondary structure of the wild type hairpin. Again, such a hairpin may be comprised in a larger RNA transcript, e.g., a pol II expressed transcript, comprising e.g., a 5' UTR and a 3'UTR and a poly(A) tail. Flanking structures may also be absent.

[0121] The miR-144 hairpin combined with one miR-451 downstream hairpin (Figure 1 B), within this application it is also called scaffold B ( Figure 1 B). Suitable sequences encoding for Scaffold B can be found in Table 5. Each sequence comprises in a 5'-3' direction: 5' flanking region (SEQ ID NO. 196), miR-144 scaffold having the characteristics described above with a guide sequence of Table 2 and Table 3, first spacer (SEQ ID NO. 194), one miR-451 scaffold having the characteristics described above with a guide sequence of Table 2-3-4, a 3' flanking region (SEQ ID NO. 197), a BamHI restriction site and the polyadenylation sequence (SEQ ID NO. 198).

[0122] Table 5: Suitable sequences encoding for Scaffold B.

[0123] Thus, in one embodiment the nucleic acid molecule comprises a nucleotide sequence encoding a first RNA and a nucleotide sequence encoding a second RNA, wherein at least one RNA comprises a first guide sequence of at least 19 nucleotides substantially complementary to a region within the human MSH3 gene and the other RNA comprises a second guide sequence.

[0124] In one embodiment, the first RNA comprises the first guide sequence substantially complementary to a region within the human MSH3 gene and the second RNA comprises the second guide sequence which is substantially complementary to a region within intron 1 of the human HTT gene.

[0125] In one embodiment the first RNA comprises the first guide sequence substantially complementary to a region within the human MSH3 gene and the second RNA comprises the second guide sequence which is substantially complementary to a region within exon 1 of the human HTT gene. In one embodiment the first RNA comprises the second guide sequence which is substantially complementary to a region within exon 1 of the human HTT gene and the second RNA comprises the first guide sequence substantially complementary to a region within the human MSH3 gene.

[0126] In one embodiment the first RNA comprises a second guide sequence substantially complementary to a region within intron 1 of the human HTT gene and the second RNA the first guide sequence substantially complementary to a region within the human MSH3 gene.

[0127] Different combinations were tested in vitro and in vivo. Examples of nucleotide sequences encoding for such combination can be found in Table 5, where the guide sequences are embedded in miR-144 hairpin combined with one miR-451 downstream hairpin (Figure 1 B), herein also called scaffold B.

[0128] In a specific embodiment, the first RNA comprises the first guide sequence that is substantially complementary to a region within the human MSH3 gene and the second RNA comprises a second guide sequence that is substantially complementary to a region within intron 1 of the human HTT gene or to a region within exon 1 of the human HTT gene.

[0129] In another embodiment, the nucleic acid further comprises a nucleotide sequence encoding a third RNA, wherein each RNA molecule comprises a guide sequence independently selected from a guide sequence that is substantially complementary to a region within intron 1 of the human HTT gene; or a guide sequence that is substantially complementary to a region within exon 1 of the human HTT gene; or a guide sequence that is substantially complementary to a region within the human MSH3 gene. In said embodiments, the nucleotide sequence encoding the first RNA comprises SEQ ID NO. 193 or a variant thereof, and the nucleotide sequences encoding the second and third RNA comprise SEQ ID NO. 192 or a variant thereof. Thus, in some embodiments, a nucleic acid as disclosed herein encodes for a first, a second and a third RNA, wherein the first RNA comprises a pre-miRNA or a pri-miRNA scaffold derived from miR-144 and the second and third RNA comprise a pre-miRNA or a pri-miRNA scaffold derived from miR-451 .

[0130] As stated above, thus, in some embodiments, a nucleic acid as disclosed herein encodes for a first, a second and a third RNA, wherein the first RNA comprises a pre-miRNA or a pri-miRNA scaffold derived from miR-144 and the second and third RNA comprise a pre-miRNA or a pri-miRNA scaffold derived from miR-451.

[0131] The miR-144 hairpin combined with two miR-451 downstream hairpins, within this application is also called scaffold C (Figure 1C). In some embodiments, suitable sequences encoding for Scaffold C can be found in Table 6. Preferably, each sequence comprises in a 5'-3' direction: 5' flanking region (SEQ ID NO. 196), miR-144 scaffold having the characteristics described above with a guide sequence of Table 2 and Table 3, first spacer (SEQ ID NO. 194), one miR-451 scaffold having the characteristics described above with a guide sequence of Table 2-3-4, second spacer (SEQ ID NO. 195), second miR-451 scaffold having the characteristics described above with a guide sequence of Table 2-3-4, a 3' flanking region (SEQ ID NO. 197), a BamHI restriction site and the polyadenylation sequence (SEQ ID NO. 198).

[0132] Table 6: Suitable sequences encoding for Scaffold C.

[0133] Thus, in one embodiment the first RNA comprises a guide sequence substantially complementary to a region within exon 1 of the human HTT gene, the second RNA comprises a first guide sequence substantially complementary to a region within the human MSH3 gene and the third RNA comprises the guide sequence substantially complementary to a region within intron 1 of the human HTT gene.

[0134] In one embodiment the first RNA comprises a guide sequence substantially complementary to a region within exon 1 of the human HTT gene, the second RNA comprises a guide sequence substantially complementary to a region within intron 1 of the human HTT gene and the third RNA comprises a first guide sequence substantially complementary to a region within the human MSH3 gene.

[0135] In one embodiment the first RNA comprises a guide sequence substantially complementary to a region within exon 1 of the human HTT gene and the second and the third RNA comprise a first guide sequence substantially complementary to a region within the human MSH3 gene.

[0136] In one embodiment the first RNA comprises a guide sequence substantially complementary to a region within intron 1 of the human HTT gene, the second RNA comprises a first guide sequence substantially complementary to a region within the human MSH3 gene and the third comprises a guide sequence substantially complementary to a region within exon 1 of the human HTT gene.

[0137] In one embodiment the first RNA comprises a guide sequence substantially complementary to a region within intron 1 of the human HTT gene, the second RNA comprises a guide sequence substantially complementary to a region within exon 1 of the human HTT gene and the third RNA comprises a first guide sequence substantially complementary to a region within the human MSH3 gene.

[0138] In one embodiment the first RNA comprises a guide sequence substantially complementary to a region within intron 1 of the human HTT gene and the second and the third RNA comprise a first guide sequence substantially complementary to a region within the human MSH3 gene.

[0139] In one embodiment the first RNA comprises a first guide sequence substantially complementary to a region within the human MSH3 gene, the second RNA comprises a guide sequence substantially complementary to a region within exon 1 of the human HTT gene and the third RNA comprises a guide sequence substantially complementary to a region within intron 1 of the human HTT gene.

[0140] In one embodiment the first RNA comprises a first guide sequence substantially complementary to a region within the human MSH3 gene, the second RNA comprises a guide sequence substantially complementary to a region within intron 1 of the human HTT gene and the third RNA comprises a guide sequence substantially complementary to a region within exon 1 of the human HTT gene.

[0141] In one embodiment the first RNA comprises a first guide sequence substantially complementary to a region within the human MSH3 gene, and the second and the third RNA comprise a guide sequence substantially complementary to a region within intron 1 of the human HTT gene.

[0142] In one embodiment the first RNA comprises a first guide sequence substantially complementary to a region within the human MSH3 gene, and the second and the third RNA comprise a guide sequence substantially complementary to a region within exon 1 of the human HTT gene. In one embodiment, the first, second and third RNA each comprises a guide sequence substantially complementary to a region within the human MSH3 gene. Different combinations were tested in vitro and in vivo.

[0143] Expression cassette

[0144] In a second aspect of the invention, there is provided an expression cassette comprising the nucleic acid molecule of the invention. In some specific embodiments, the nucleic acid comprised within the expression cassette is operably linked to a promoter and optionally to a poly-A signal. In some embodiments, the expression cassette comprises, in 5' to 3' order, the following elements: at least one promoter, at least a first and second nucleic acid sequence encoding an RNA and at least a poly A signal, thus forming an expression cassette for expression of the nucleic acid as defined in the invention in mammalian target cell to be treated by gene therapy with the gene product of interest.

[0145] The term "expression cassette" as used herein describes the functional unit capable of affecting expression of a transgene, or sequence encoding a product to be expressed. The coding sequence is operably linked to the appropriate expression control sequence, which at least comprises a suitable transcription regulatory sequence and optionally, 3' transcription termination signals. Additional factors necessary or helpful in affecting expression may also be present, such as expression enhancer elements. The expression control sequences might further contain a leader sequences and fusion partner sequences. The term can also include the design of the nucleic acid sequence such that undesirable, potential initiation codons in and out of frame, are removed from the sequence. It can also include the design of the nucleic acid sequence such that undesirable potential splice sites are removed. Thus, an expression control sequence can include promoters, enhancers, internal ribosome entry sites (IRES), transcription terminators, a start codon in front of a protein-encoding gene, splicing signal for introns, and stop codons.

[0146] As used herein, the term "promoter" or "transcription regulatory sequence" refers to a nucleic acid fragment that functions to control the transcription of one or more coding sequences. Typically, it is a mammalian cell-compatible transcription regulatory sequence and is located upstream with respect to the direction of transcription of the transcription initiation site of the coding sequence, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. The promoter and the coding sequence are operably linked. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated, e.g., by the application of a chemical inducer or biological entity (cycle-specific). A "tissue-specific" or a "cell-type-specific" promoter shows activity in a specific cell or tissue. Many of such promoters are known in the art (see Sambrook and Russel, 2001 , supra). Promoters that are inducible, tissue-specific, cell-type-specific, or cell cycle-specific may be used. Constitutive promoters that are broadly active in many cell types, such as the CMV promoter may be used. Preferably, the promoter of the invention drives expression in a brain cell, preferably wherein the promoter comprises SEQ ID NO. 201. Thus, such promoter is preferred for expression of transgene in the peripheral and / or central nervous system. As HD primarily affects the brain, it may, in particular, be useful to use a neuro specific promoter. Examples of suitable neuro-specific promoters area neuron-specific enolase (NSE) promoter, platelet-derived growth factor (PDGF) promoter, platelet-derived growth factor B-chain (PDGF- (3) promoter, synapsin or synapsin-1 (Syn or Syn-1) promoter, methyl-CpG binding protein 2 (MeCP2) promoter, Ca+Zcalmodulin-dependent protein kinase II (CaMKII) promoter, metabotropic glutamate receptor 2 (mGluR2) promoter, neurofilament light (NFL) or heavy (NFH) promoter, p-globin minigene np2 promoter, preproenkephalin (PPE) promoter, enkephalin (Enk) promoter and excitatory amino acid transporter 2 (EAAT2) promoter. For astrocyte-specific expression a promoter may be selected from glial fibrillary acidic protein (GFAP) and EAAT2 promoters. For oligodendrocyte-specific expression the myelin basic protein (MBP) promoter may be selected.

[0147] The polyA signal is preferably the simian virus polyadenylations (SV40 polyA, SEQ ID NO. 198). Other examples are the Bovine Growth Hormone polyadenylation signal (BGH polyA), or the Human Growth Hormone polyadenylation signal (HGH polyA).

[0148] As used herein, the term "operably linked" refers to a linkage of polynucleotide (or polypeptide) elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a transcription regulatory sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two encoding regions, contiguous and in reading frame.

[0149] An expression cassette as used herein is flanked by at least one inverted terminal repeats (ITR). In one embodiment, the expression cassette is flanked by two AAV ITR nucleotide sequences, whereby the expression cassette is located in between the two AAV ITR nucleotide sequences. In another embodiment, the expression cassette is flanked by one ITR engineered with two D regions, wherein the expression cassette is located on either side of the engineered ITR.

[0150] Vectors

[0151] A third aspect of the present invention relates to recombinant adeno-associated virus (rAAV) vectors comprising the nucleic acid or expression cassette of the invention. An "AAV vector" is defined as a recombinantly produced AAV or AAV particle that comprises an expression cassette (or a polynucleotide) to be delivered into a host cell, either in vivo, ex vivo or in vitro. Herein, an AAV vector construct thus refers to the contents of the AAV particle, i.e., the polynucleotide comprising or part thereof, usually at least one ITR, or the expression cassette of the invention, i.e., the nucleotide sequence comprising the promotor and / or regulatory sequences necessary for the expression of the sequence encoding the two or more RNAs, and the poly A sequence.

[0152] The term "recombinant" in the context of an AAV particle as used herein refers to an rAAV particle having a mutated capsid as compared to the corresponding wild type AAV particles. Alterations include, for example, modifications introducing additions of nucleic acids, nucleic acid deletions, nucleic acid substitutions, or changes of the AAV capsid proteins, such as additions, deletions, or substitutions of amino acids in the capsid proteins, or a shuffling of capsid proteins derived from different AAV serotypes.

[0153] Preferably, the expression cassette is flanked by ITRs, one on each side. Such (r)AAV vectors can be replicated and packaged into infectious viral particles when present in a suitable host cell that is expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When the expression cassette is flanked by at least one ITR, then the expression cassette is incorporated into a larger nucleic acid construct (e.g., in a chromosome or in another vector such as a plasmid or baculovirus used for cloning or transfection), this is typically referred to as a "pro-vector" which can be "rescued" by replication and encapsidation in the presence of AAV packaging functions and necessary helper functions.

[0154] Preferably the capsids of the rAAV vector are of serotype 5, 9 or rh10. rAAV of serotype 5, 9 or rh10 (also referred to as rAAV5, rAAV9, rAAVrhW) may be particularly useful for transducing human neurons. Therefore, in some embodiment, there is such an rAAV comprising an expression cassette as disclosed herein. Thus, rAAV5, rAAV9 and rAAVrhW can efficiently transduce different human cell types of the central nervous system (CNS) including forebrain neurons (FBN), dopaminergic neurons, motor neurons and astrocytes and is therefore a suitable vector candidate to deliver therapeutic genes to the CNS to treat neurogenerative diseases, including but not limited to the treatment of HD via targeting e.g., HTT gene alone or HTT and MSH3 genes, as described herein. The production of AAV vectors comprising any expression cassette of interest is well described in W02007 / 046703, W02007 / 148971 , W02009 / 014445, W02009 / 104964, WO2011 / 122950, WO2013 / 0361 18, which are incorporated herein in its entirety.

[0155] An isolated nucleic acid as described herein may exist on its own, as part of an expression cassette and / or as part of a vector. Generally, a vector can be a plasmid, cosmid, phagemid, bacterial artificial chromosome (BAC), or a viral vector such as a gene therapy vector, most preferably an rAAV vector. Expression cassettes according to the invention can be transferred to a cell, using e.g., transfection methods. Viral vectors according to the invention can be transferred to a cell, using e.g., infection methods. Any suitable means may suffice to transfer an expression cassette according to the invention. Preferably, viral vectors are used that stably transfer the expression cassette to the cells such that stable expression of the double stranded RNA(s) that induce sequence specific inhibition of the HTT gene alone or HTT and MSH3 genes as described above can be achieved.

[0156] Suitable vectors may be lentiviral vectors, retrotransposon based vector systems, or rAAV vectors. It is understood that as e.g., lentiviral vectors carry an RNA genome, the RNA genome will encode for the said expression cassette such that after transduction of a cell, the said DNA sequence and said expression cassette is formed.

[0157] AAV sequences that may be used in the present invention for the production of AAV vectors, e.g., produced in insect or mammalian cell lines, can be derived from the genome of any AAV serotype.

[0158] Generally, the AAV serotypes have genomic sequences of significant homology at the amino acid and the nucleic acid levels, provide an identical set of genetic functions, produce virions which are essentially physically and functionally equivalent, and replicate and assemble by practically identical mechanisms. For the genomic sequence of the various AAV serotypes and an overview of the genomic similarities see e.g., GenBank Accession number U89790; GenBank Accession number J01901 ; GenBank Accession numberAF043303; GenBank Accession number AF085716; Chlorini et al. (1997, J. Vir. 71 : 6823-33); Srivastavar et al. (1983, J. Vir. 45:555-64); Chlorini etal. (1999, J. Vir. 73:1309-1319); Rutledge etal. (1998, J. Vir.r72:309-319); and Wu et al. (2000, J. Vir. 74: 8635-47).

[0159] Preferably the AAV ITR sequences for use in the context of the present invention are derived from AAV1 , AAV2, and / or AAV5. Likewise, the Rep52, Rep40, Rep78 and / or Rep68 coding sequences are preferably derived from AAV1 , AAV2 and AAV5. The sequences coding for the VP1 , VP2, and VP3 capsid proteins for use in the context of the present invention may however be taken from any of the known 42 serotypes, more preferably from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAVrhW or newly developed AAV-like particles obtained by e.g., capsid shuffling techniques and AAV capsid libraries. AAV capsids may consist of VP1 , VP2 and VP3, but may also consist of VP1 and VP3.

[0160] In some embodiment, the AAV vector according to the inventions comprises AAV5 or AAV9 or AAVrhW capsid protein. In some embodiment, the AAV vector according to the inventions comprises AAV5 capsid protein. In some embodiment, the AAV vector according to the inventions comprises AAV9 capsid protein.

[0161] In another embodiment, a host cell is provided comprising said nucleic acid or said expression cassette according to the invention. For example, said expression cassette or nucleic acid may be comprised in a plasmid contained in bacteria. Said expression cassette or nucleic acid may also be comprised in a production cell that produces e.g., a viral vector. Said expression cassette may also be provided in a baculovirus vector. Various modifications of the nucleotide sequences as defined above, including e.g., the wildtype AAV sequences, for proper expression in the host cell is achieved by application of well-known genetic engineering techniques such as described e.g., in Sambrook and Russell (2001) "Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York. Various further modifications of coding regions are known to the skilled artisan which could increase the yield of the encoded proteins. These modifications are within the scope of the present invention. In one embodiment, any mammalian cell may be infected by an AAV vector of the invention, for example, but not limited to, a muscle cell, a liver cell, a nerve cell, a glial cell and an epithelial cell. In a preferred embodiment, the cell to be infected is a human cell. It is to be understood that the capsid amino acid sequences and the nucleotide sequences encoding them can be engineered, for example, the sequence may be a hybrid form or may be codon optimized, such as for example by codon usage of AcmNPv or Spodoptera frugiperda. The capsid proteins may be engineered, for example, via DNA shuffling, error prone PCR, bioinformatics rational design or site saturated mutagenesis. Resulting capsids are based on the existing serotypes but contain various amino acid or nucleotide changes that improve the features of such capsids. The resulting capsids can be a combination of various parts of existing serotypes, "shuffled capsids" or contain completely novel changes, i.e., additions, deletions or substitutions of one or more amino acids or nucleotides, organized in groups or spread over the whole length of gene or protein. See for example Schaffer and Maheshri; Proceedings of the 26th Annual International Conference of the IEEE EMBS San Francisco, CA, USA; September 1-5, 2004, pages 3520-3523; Asuri et al., 2012, Molecular Therapy 20(2):329-3389; Lisowski et al., 2014, Nature 506(7488):382-386, herein incorporated by reference. In some embodiments, the ITRs and capsid proteins (or parts thereof) in the rAAV vector of the invention may be from different AAV serotypes. By way of example, and not limitation, the ITRs may be derived from AAV2, whilst the capsid proteins may be derived from a different serotype, for example AAV5 or AAV9.

[0162] Pharmaceutical composition

[0163] In another aspect, the invention pertains to a pharmaceutical composition comprising an AAV vector according to the invention, i.e., an rAAV vector comprising a nucleic acid according to the invention, or an expression cassette according to the invention. In one embodiment, the invention provides a composition comprising an rAAV vector according to the invention and suitable excipients, such as buffers and stabilizers, antioxidants etc. In one particular embodiment, these compositions are used to transduce cells in vitro or ex vivo, in which case the excipients will need to be compatible with cell culture. In other preferred embodiments, the compositions are used for the treatment of (human) subjects. For that purpose, the invention provides a pharmaceutical composition comprising an rAAV vector according to the invention and at least one pharmaceutically acceptable carrier. In the case of AAV gene delivery vehicles, a pharmaceutical composition typically comprises physiological buffers, such as e.g., PBS, comprising further stabilizing agents such as e.g., sucrose. Such compositions are compatible with and suitable and intended for use in subsequent intravenous, intrathecal, intraparenchymal, intravitreal, subretinal administration or for use in organ-targeted vascular delivery such as intraporal or intracoronary delivery or isolated limb perfusion. Therefore, in some embodiments, the invention provides a nucleic acid according to the invention, or an expression cassette according to the invention, or an rAAV vector according to the invention, or a pharmaceutical composition according to the invention for a use as disclosed herein, wherein the nucleic acid, the expression cassette, the rAAV vector or the pharmaceutical composition is administered to the central nervous system, preferably by intracerebral injection, intraparenchymal injection, intrathecal injection, intra cisterna magna injection, intracerebroventricular injection or a combination thereof, more preferably by convection enhanced delivery.

[0164] Uses

[0165] Another aspect of the invention relates to the use of an rAAV vector according to the invention, or a composition comprising the rAAV vector. In one embodiment, there is provided an expression cassette according to the invention, an rAAV vector according to the invention, or a pharmaceutical composition according to the invention for use as a medicament. In a further embodiment, there is provided a nucleic acid according to the invention, an expression cassette according to the invention, an rAAV vector according to the invention, or a pharmaceutical composition according to the invention for use in the treatment or in the treatment and / or prevention of repeat expansion disorders, preferably HD, in a subject. In a further embodiment, there is provided a nucleic acid according to the invention, an expression cassette according to the invention, an rAAV vector according to the invention, or a pharmaceutical composition according to the invention for use in the treatment or and / or prevention of repeat expansion disorders, preferably HD, in a subject. In a further embodiment, there is provided a nucleic acid according to the invention, an expression cassette according to the invention, an rAAV vector according to the invention, or a pharmaceutical composition according to the invention for use in the treatment of repeat expansion disorders, preferably for the treatment of HD.

[0166] Host cells and methods for producing an rAAV vector and kits thereof

[0167] In a further aspect, the invention relates to a method for producing an rAAV vector according to the invention, or a kit composition according to the invention.

[0168] The methods for producing a nucleic acid or an expression cassette according to the invention comprises any methods for producing nucleic acids, including but not limited to de novo synthesis all of which would be apparent to the skilled person.

[0169] The method for producing an rAAV vector preferably comprising the steps of: a) culturing a host cell as herein defined below under conditions such that the rAAV vector is produced; and, b) optionally, one or more of recovery, purification and formulation of the rAAV vector.

[0170] The host cell preferably is a host cell that is suitable for the production of rAAV vectors. Accordingly, the host cell is a host cell that is amenable to in vitro culture, preferably at large scale. Host cells that are suitable for the production of rAAV vectors are well-known in the art and will typically be an insect cell line or a mammalian cell line. Mammalian cell lines for producing rAAV vectors are selected from among any mammalian species, including, without limitation, cells such as A549, WEHI, 3T3, 10T1 / 2, BHK, MDCK, COS 1 , COS7, BSC 1 , BSC 40, BMT 10, VERO, WI38, HeLa, a HEK293 cell (which express functional adenoviral E1), Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals including human, monkey, mouse, rat, rabbit, and hamster. The selection of the mammalian species providing the cells is not a limitation of this invention; nor is the type of mammalian cell, i.e., fibroblast, hepatocyte, tumour cell. Mammalian cell lines for producing rAAV vectors in particular include a broad range of HEK293 cell lines, of which the HEK293T cell line is preferred.

[0171] Insect cell lines for producing rAAV vectors can be any cell line that is suitable for the production of heterologous proteins. Preferably the insect cell allows for replication of baculoviral vectors and can be maintained in culture, more preferably in suspended culture. In a preferred embodiment, the insect cell allows for replication of recombinant parvoviral vectors, including rAAV vectors. For example, the cell line used can be from Spodoptera frugiperda, Drosophila, or mosquito, e.g., Aedes albopictus derived cell lines. Preferred insect cells or cell lines are cells from the insect species which are susceptible to baculovirus infection, including e.g., S2 (CRL-1963, ATCC), Se301 , SelZD2109, SeUCRI , Sf9, Sf900+, Sf21 , BTI-TN- 5B1-4, MG-1 , Tn368, HzAml , Ha2302, Hz2E5, High Five (Invitrogen, CA, USA) and expresSF+® (US 6,103,526; Protein Sciences Corp., CT, USA).

[0172] Thus, in one embodiment, the expression cassette or construct is an insect cell-compatible vector or a mammalian cell-compatible vector. A "mammalian cell-compatible vector" is understood to be a nucleic acid molecule capable of productive infection of a mammalian cell or cell line. Mammalian cell-compatible vectors are well-known in the art.

[0173] An "insect cell-compatible vector" is understood to be a nucleic acid molecule capable of productive infection of an insect or an insect cell. Exemplary insect cell-compatible vectors include plasmids, linear nucleic acid molecules, and recombinant viruses, such as baculoviruses. Any vector can be employed as long as it is insect cell compatible. The mammalian or insect cell-compatible vector may integrate into the cell's genome but the presence of the vector in the cell need not be permanent and transient episomal vectors are also included.

[0174] The vectors can be introduced by any known methods, for example by chemical treatment of the cells, electroporation, transfection, transduction, or infection.

[0175] The rAAV in the supernatant can be recovered and / or purified using suitable techniques which are known to those of skill in the art. For example, monolith columns (e.g., in ion exchange, affinity or IMAC mode), chromatography (e.g., capture chromatography, fixed method chromatography, and expanded bed chromatography), centrifugation, filtration and precipitation, can be used for purification and concentration. These methods may be used alone or in combination. In one embodiment, capture chromatography methods, including column-based or membrane-based systems, are utilized in combination with filtration and precipitation. Suitable precipitation methods, e.g., utilizing polyethylene glycol (PEG) 8000 and NH3SO4, can be readily selected by one of skill in the art. Thereafter, the precipitate can be treated with benzonase and purified using suitable techniques. In addition, recovery may preferably comprise the step of affinity-purification of the virions comprising the rAAV vector using an anti-AAV antibody, preferably an immobilised antibody. The anti-AAV antibody preferably is a monoclonal antibody. A particularly suitable antibody is a single chain camelid antibody or a fragment thereof as, e.g., obtainable from camels or llamas (see e.g., Muyldermans, 2001 , Biotechnol. 74: 277-302). The antibody for affinity-purification of rAAV preferably is an antibody that specifically binds an epitope on an AAV capsid protein, whereby preferably the epitope is an epitope that is present on capsid protein of more than one AAV serotype. E.g., the antibody may be raised or selected on the basis of specific binding to AAV2 capsid but at the same time also it may also specifically bind to AAV1 , AAV3 and AAV5 capsids.

[0176] In general, suitable methods for producing a rAAV vector according to the invention in mammalian or insect host cells, and means, therefore (such as expression constructs for expression of AAV rep proteins), are described, for mammalian cells in: Clark et al. (1995, Hum. Gene Ther. 6, 1329-134), Gao et al. (1998, Hum. Gene Ther. 9, 2353-2362), Inoue and Russell (1998, J. Virol. 72, 7024-7031), Grimm et al. (1998, Hum. Gene Ther. 9, 2745-2760), Xiao etal. (1998, J. Virol. 72, 2224-2232) and Judd etal. (Mol Ther Nucleic Acids. 2012; 1 : e54), and for insect cells in: Urabe et al. (2002, Hum. Gene Ther. 13:1935-1943), WG2007 / 046703, WG2007 / 148971 , WG2009 / 014445, WG2009 / 104964, WO2011 / 122950,

[0177] WO2013 / 036118, WO2015 / 137802, WO2019 / 016349 and in co-pending applications EP21177449.2, PCT / EP2021 / 058794 and PCT / EP2021 / 058798, all of which are incorporated herein in their entirety.

[0178] In a further aspect, there is provided a kit comprising a nucleic acid according to the invention, an expression cassette according to the invention, an rAAV vector according to the invention, or a pharmaceutical composition according to the invention, wherein the kit further comprises an immunosuppressive agent.

[0179] In certain embodiments of the invention, the immunosuppressive compound may reduce and / or prevent an immune response induced by administration of the nucleic acid, the rAAV vector, or the pharmaceutical composition of the invention.

[0180] In another aspect, the invention relates to a cell comprising the nucleic acid of the invention or the rAAV of the invention, or a host cell.

[0181] In some embodiments, the cell of the invention is a prokaryote cell. In some specific embodiments, the cell of the invention is a bacterial cell. In some embodiments, the cell of the invention is a eukaryote cell. In some embodiments, the cell of the invention is a mammalian cell. In some embodiments, the cell of the invention is an insect cell.

[0182] The nucleic acid of the invention or the rAAV vector of the invention may be delivered into the cell of the invention by any suitable methods, included but not limited to, transfection, transformation infection, transduction, nucleofection, electroporation, microinjection. For example, the expression cassette or nucleic acid of the invention may be comprised in a plasmid contained in bacteria. The expression cassette or nucleic acid of the invention may also be comprised in a production cell that produces e.g., a viral vector. Said expression cassette may also be provided in a baculovirus vector. Further details on host cells comprising an rAAV vector according to the invention have been provided elsewhere in this application.

[0183] Any mammalian cell may be infected by the AAV vector of the invention, including but not limited to a muscle cell, a liver cell, a nerve cell, a glial cell or an epithelial cell. In some preferred embodiments of the invention, the cell to be infected is a human cell.

[0184] In another aspect, the present invention relates to a method of treating or preventing a disorder, wherein the method comprises administering the nucleic acid of the invention or the rAAV of the invention to a subject, thereby treating or preventing the disorder. In another aspect, the invention relates to the nucleic acid of the invention or the rAAV of the invention for use in the manufacture of a medicament for the treatment of a disorder as detailed herein.

[0185] The present invention has been described above with reference to a number of exemplary embodiments as shown in the drawings. Modifications and alternative implementations of some parts or elements are possible, and are included in the scope of protection as defined in the appended claims.

[0186] Description of the figures

[0187] Figure 1. Schematic representation of the miR-144-miR-451 scaffolds of the invention (Scaffolds A, B and C). Guide sequences are indicated in gray. Note that from the miR-144 hairpin, the guide sequence can be encoded either in the 5p arm (dark gray) or in the 3p arm (light gray) of the hairpin.

[0188] Figure 2. Schematic overview of luciferase reporter constructs. Regions of the HTT and MSH3 genes containing the miRNA binding sites were cloned into the 3’ UTR of the synthetic Renilla Luciferase gene. Nucleotide numbers correspond to the RefSeq sequences NG_009378 (HTT) and NM_002439 (MSH3). e=exon.

[0189] Figure 3. Dual luciferase reporter screening for MSH3-targeting miRNAs expressed from scaffold A in HEK293T cells. A) Single dose transfection (1x109copies / well) of all the initial 90 MSH3-targeting miRNAs. The 20 candidates that were selected for further testing are indicated by the striped bars. B) Multiple dose transfection (4x107, 2x108or 1x109copies / well) of the selected 20 MSH3-targeting miRNAs. The five candidates that were selected for further testing are indicated by the striped bars. miSCR=non-targeting control miRNA.

[0190] Figure 4. Endogenous lowering of MSH3 by MSH3-targeting miRNAs expressed from scaffold A after transfection in HEK293T cells. A) Single dose (10 ng / well) transfection of the selected 20 MSH3-targeting miRNAs. The five candidates that were selected for further testing are indicated by the striped bars. miSCR=non-targeting control miRNA. B) Multiple dose transfection (2, 10, 50, 250 ng / well) of the selected five candidates. The three candidates that were selected for further testing are indicated by the striped bars.

[0191] Figure 5. Processing of MSH3-targeting miRNAs expressed from scaffold A after transfection in HEK293T cells. A) 5’ end processing B) isomiR length distribution.

[0192] Figure 6. Dual luciferase reporter screening for HTT1a-targ eting miRNAs expressed from scaffold A in HEK293T cells. A) Single dose transfection (1x109copies / well) of all the initial 93 HTT1a-targeting miRNAs. The 19 most potent candidates that were selected for further testing are indicated by the striped bars. B) Multiple dose transfection (4x107, 2x10® or 1x109copies / well) of the selected 19 HTT1 a-targeting miRNAs. The three candidates that were selected for scaffold B and C designs are indicated by the striped bars. miSCR=non-targeting control miRNA.

[0193] Figure 7. In vivo study of expression and target engagement by MSH3-targeting miRNAs expressed from scaffold A in HdhQ111 / +knock-in mice. A) Schematic overview of study design. B) vDNA levels. C) Specific miRNA expression levels expressed as raw Ct values. D) Relative expression of MSH3 mRNA. E) MSH3 protein levels. F) Somatic instability as measured by the instability index. In all graphs, negative control conditions are indicated by the open bars, MSH3-targeting miRNAs are indicated by the diagonally striped bars and the HTT-targeting miRNA is indicated by the horizontally striped bar. miSCR=non-targeting control miRNA.

[0194] Figure 8. Dual luciferase reporter screening for HTT- and MSH3-targeting miRNAs expressed from scaffold B and C constructs after transfection in HEK293T cells at multiple doses. HTT- and MSH3-targeting miRNAs expressed from scaffold A constructs were included as positive controls. The candidates that were selected for further testing are indicated by the striped bars. miSCR=non-targeting control miRNA.

[0195] Figure 9. Endogenous lowering of MSH3 by MSH3-targeting miRNAs expressed from scaffold B and C constructs after transfection in HEK293 Jump In T-Rex HTT1a 45CAG cells at multiple doses (4, 20 or 100 fmol / well). The candidates that were selected for further testing are indicated by the striped bars. miSCR=non-targeting control miRNA.

[0196] Figure 10. Processing of HTT- and MSH3-targeting miRNAs expressed from scaffold B and C constructs after transfection in HEK293T cells. A) Expression, guide to passenger ratio and 5’ end processing of miR- 144 expressed miRNAs. B) isomiR length distribution of miR-144 expressed miRNAs. C) isomiR length distribution of miR-451 expressed miRNAs.

[0197] Figure 11. In vivo study of expression and target engagement by HTT- and MSH3-targeting miRNAs expressed from scaffold B and C vectors in C57BL / 6 mice. A) Schematic overview of study design. B) vDNA levels. C) Specific miRNA expression levels. D) Relative expression of MSH3 mRNA.

[0198] Figure 12. In vivo study of expression and target engagement by HTT- and MSH3-targeting miRNAs expressed from scaffold A and B vectors in R6 / 1 mice. A) Schematic overview of study design. B) vDNA levels. C) Specific miRNA expression levels. D) Relative expression of Msh3 and HTTexI mRNA. E) Somatic instability as measured by the instability index. In all graphs, negative control conditions are indicated by the open bars, MSH3-targeting miRNAs are indicated by the vertically striped bars and the HTT-targeting miRNA is indicated by the horizontally striped bar. Vectors targeting both MSH3 and HTT are indicated by checkered bars, with different shades indicating different doses. miSCR=non-targeting control miRNA. F and G) Reversal of genotype-dependent differential expression (DGE) and differential splicing events (DSE) by HTT- and HTT1 a-targ eting miRNAs. F) DGE reversal calculated as the ratio between the log fold change in NT control WT vs NT control R6 / 1 and R6 / 1 mice treated with HTT-, Msh3- targeting miRNAs or both, compared to NT control R6 / 1 mice. G) DSE reversal calculated as the ratio between the inclusion level difference in NT control WT vs NT control R6 / 1 and R6 / 1 mice treated with HTT-, Msh3-targeting miRNAs or both, compared to NT control R6 / 1 mice. For this analysis, only genotypedependent differentially expressed genes (DEGs; FDR < 0.05 and absolute Iog2-fold change > 1 .2) and genotype-dependent DSEs (FDR < 0.05, absolute Inclusion Level Difference in NT control WT vs NT control R6 / 1 > 5% and mean junction count > 75) were selected. Values were categorized as super-reversal (ratio <= -1.3), full reversal (-1.3 < ratio <= -0.7), partial reversal (-0.7 < ratio <= -0.3), negligible reversal (-0.3 < ratio <= 0.3), exacerbation (ratio > 0.3), using the Posterior Probabilities approach. Super-reversal indicates that the log fold change or inclusion level difference between treated and NT control R6 / 1 mice is larger than between WT and R6 / 1 mice; this category is still considered to be a reversal of genotype-dependent differential expression or splicing. Exacerbation indicates that the change in log fold change or inclusion level is the opposite in treated mice compared to NT control WT mice, relative to NT control R6 / 1 mice ( / .e., negative in one and positive in the other, or vice versa). Splicing events that were not detected in the treated groups are categorized as NA.

[0199] Figure 13. In vivo study of expression and target engagement by HTT-, HTT1 a- and MSH3-targeting miRNAs expressed from scaffold A, B and C vectors in BAC-CAG mice. A) Schematic overview of study design. B) Protein levels of soluble FL-HTT protein. C) Protein levels of soluble and aggregated HTTexonl protein. Negative control conditions are indicated by the open bars. The HTTexI -targeting miRNA is indicated by the horizontally striped bar. The HTTintl -targeting miRNA is indicated by the diagonally striped bars. The MSH3-targeting miRNA is indicated by vertically striped bars. Scaffold B construct expressing both miMSH3 and miHTT is indicated by a checkered bar. The scaffold C construct expressing all three miRNAs is indicated by the brick-patterned bar.

[0200] Examples

[0201] Materials and Methods miRNA guide strand design

[0202] The MSH3-targeting miRNA guide strands were designed to target MSH3 reference seguence NM_002439.5 exons 2-10 (nt 314 - 1644) or exons 13-24 until the first major polyA site (nt 1840 - 3551) (SEQ ID NO. 2 and SEQ ID NO. 3; Table 1). To assess conservation of the MSH3 reference seguence with non-human primate and mouse, the MSH3 reference seguence was aligned to the corresponding seguences of Macaca fascicularis (XM_005557283) and Mus musculus (NM_010829), respectively. Furthermore, the MSH3 reference seguence was screened for the presence of common SNPs based on dbSNP release 146 and confirmed using dbSNP 153 (1000 genomes phase 3 MAF >= 1%). Ninety (90) different guide strands having 22 nucleotides, here named miMSH3-1 to miMSH3-90 (SEQ ID NOs: 98- 187; Table 2), were generated to be tested in vitro.

[0203] The HTT1 a-targ eting miRNA guide strands were designed to target HTT reference seguence NG_009378.1 nt 5001 - 7498 (SEQ ID NO. 1 ; Table 1), i.e., to target seguences in HTT exon 1 or HTT intron 1 upstream of the first cryptic polyadenylation site. To ensure that target seguences were conserved with non-human primate, the HTT reference seguence was aligned to the corresponding seguence for Macaca fascicularis (NC_022276, chr5:3171562-3174006). Furthermore, the HTT reference seguence was screened for the presence of common SNPs based on dbSNP release 146 and confirmed using dbSNP 153 (1000 genomes phase 3 minor allele frequency >= 1%). This design led to the generation of different guide strands having a length of 22 nucleotides, of which 93 were tested in vitro. The miRNAs targeting HTT exon 1 are here named miHTTex1-1 to miHTTex1-12 (SEQ ID Nos: 4-16; Table 4). The miRNAs targeting / - / TTintron 1 are here named miHTTint1-1 to miHTT-int1-81 (SEQ ID Nos: 17-97; Table 3). As a positive control, the HTT- targeting miRNA described in WO 2016 / 102664 Al, here named miHTTex1-13 and having as guide sequence SEQ ID NO: 16, was also taken along.

[0204] Non-targeting control miRNA guide strands were designed to generate the negative controls miSCR-1 to miSCR-3 ( SEQ ID Nos: 188-190; Table 7).

[0205] Table 7: Non-targeting control miRNA guide strands.

[0206] DNA constructs

[0207] The sequences encoding miRNA and the non-targeting control miRNA guide strands were incorporated into different scaffolds.

[0208] The scaffold A comprises the mutated miR-144 helper hairpin combined with one mir-451 downstream hairpin (Figure 1A). In scaffold A, the HTT1a-, MSH3- or the non-targeting guide strands were incorporated into the miR-451 hairpin.

[0209] The scaffold B comprises the miR-144 hairpin combined with one miR-451 downstream hairpin (Figure 1 B). In scaffold B, one miRNA guide strand was incorporated into the miR-144 hairpin and another miRNA guide strand into the miR-451 hairpin.

[0210] The scaffold C comprises the miR-144 hairpin combined with two miR-451 downstream hairpins (Figure 1C). In scaffold C, one miRNA guide strand was incorporated into each of the three hairpins.

[0211] In cases where a guide strand was incorporated into the 3p arm of the miR-144 scaffold, only the first 20 nt of said guide strand were incorporated.

[0212] Each association of hairpins comprises a spacer sequence that separates a first hairpin and a second hairpin. In scaffolds A, B and C, the miR-144 and miR-451 hairpins are separated by an endogenous 92 bp spacer sequence (SEQ ID NO. 194), while in scaffold C, the two miR-451 hairpins are separated by a synthetic 30 bp spacer sequence (SEQ ID NO. 195). All scaffolds are flanked by a 28 nucleotides 5’ flanking region (SEQ ID NO. 196) and a 205 nucleotides 3’ flanking region (SEQ ID NO. 197), followed by a BamHI restriction site and a 133 bp polyadenylation signal (SEQ ID NO. 198). Insert sequences with 5’ and 3’ flanking restriction sites were synthesized and subsequently subcloned by GeneWiz (Azenta Life Sciences) into a pUC screening vector (SEQ ID NO. 199) for transfection experiments, or into an ITR vector (SEQ ID NO. 200) for AAV production. The sequences encoding for scaffolds A (SEQ ID NOs. 202-388), B (SEQ ID NOs. 389-402) and C (SEQ ID NOs. 403-415) of the invention were expressed from a constitutive synthetic promoter (SEQ ID NO. 201) (Figure 1).

[0213] Dual-Luciferase® reporter assay

[0214] To assess reporter gene lowering by Dual-Luciferase® reporter assay (Promega), HEK293T cells were plated into 96-well tissue culture-treated plates at a density of 2x104cells / well for forward transfection, or 8x104cells / well for reverse transfection. Screening plasmids (1x109copies / well for single dose experiments; 4x107, 2x108or 1x109copies / well for dose response experiments, adjusted to an equal dose (ng / well) using pBlueScript SK(+) as balancer plasmid) were co-transfected using Lipofectamine 2000 (Invitrogen), along with Dual-Luciferase reporter vectors (2x108copies / well) containing the relevant miRNA binding sites in the 3’ UTR of the Renilla luciferase (RL) gene and a HSV-TK driven Firefly Luciferase (FL) (Figure 2; SEQ ID NOs. 416-420). The RL and FL activity was measured by Dual-Luciferase reporter assay 48 h post-transfection. All transfections were performed as technical triplicates. The assay readouts were acquired in a GloMax Luminescence reader (Promega). Dual luciferase reporter lowering was measured as a decrease in the RL / FL activity ratio, relative to the negative control(s). All experiments were performed at least two times.

[0215] MSH3 transcript lowering in HEK293T and HEK293T-derived cells

[0216] For scaffold A constructs, HEK293T cells were plated into 96-well tissue culture-treated plates at a density of 1x104cells / well. After 24 h, cells were transfected with 10 ng / well of each of the plasmids (single dose experiments, quadruplicate wells) or 2, 10, 50 or 250 ng of each of the plasmids per well (dose response experiments, triplicate wells) using Lipofectamine 2000 (Invitrogen) and collected 48 h post-transfection for RNA isolation.

[0217] For scaffold B and C constructs, HEK293 Jump In T-Rex HTT1 a 45CAG cells (custom cell line generated by ThermoFisher) were plated into 96-well tissue culture-treated plates at a density of 1x104cells / well. After 24 h, cells were transfected with 4, 20 or 100 fmol (corresponding to approximately 10, 50 or 250 ng) of each of the plasmids per well (triplicate wells) using Lipofectamine 2000 (Invitrogen) and collected 48 h post-transfection for RNA isolation.

[0218] Total RNA was isolated using the MagMAX™ mirVana™ Total RNA Isolation Kit (Applied Biosystems). The eluted RNA was used for cDNA synthesis with the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific) and subsequently used for RT-qPCR using SYBR Green assays to measure MSH3 and the reference genes GAPDH and ACTB (Table 9) on the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems). The experiments were performed at least three times. AAV production

[0219] Recombinant AAVs (rAAV5 and rAAV9) were produced by various methods. The rAAVs were produced by PEI transfection of HEK293T cells with two plasmids encoding for Rep-Cap and one plasmid encoding the transgene in an ITR-Cassette by Sirion Biotech. Following two-step purification with primary capture with POROS™ CaptureSelect™ AAV-X resin (Thermo Fisher Scientific) and iodixanol gradient. The rAAVs were also produced in an insect cell based system. For instance, rAAVs harboring the expression cassettes were further produced by infecting SF+ insect cells (Protein Sciences Corporation, Meriden, Connecticut, USA) with two Baculoviruses, encoding Rep, Cap and the transgene. SF+ produced AAVs were purified using standard protein purification procedures on a fast protein liquid chromatography system (AKTA Explorer, GE 30 Healthcare) using AVB sepharose (GE Healthcare). For all production methods, the titer of the purified AAV was determined using qPCR.

[0220] Small RNA sequencing using next-generation sequencing (NGS) and data analysis

[0221] Total RNA was isolated from transfected HEK293T cells as described above (dose: 50 ng; samples from two independent experiments). Small RNA sequencing was performed by GenomeScan BV (Leiden, Netherlands) using the NEBNext® Multiplex Small RNA Library Prep Kit for Illumina (Index Primers 1-48, #7560S) and BluePippin size selection of the final library, followed by Illumina NovaSeq6000 PE150 sequencing. The data were analyzed in-house using CLC Genomics Workbench v21 (QIAGEN). The trimmed small RNA reads were aligned against the human database of microRNAs (miRbase v22) and against a custom database containing the synthetic hairpin sequences. Precision of 5’ end processing was expressed as the percentage of reads with the exact 5’ end ( / .e., starting from the first nucleotide of the designed guide sequence) relative to the total number of reads that mapped to the synthetic miRNA. Length distribution of the different isomiRs was expressed as the percentage of reads with a particular length relative to the total number of reads that mapped to the synthetic miRNA.

[0222] To assess miRNA processing from scaffolds B and C, HEK293T cells were plated into 96-well tissue culture-treated plates at a density of 2x104cells / well. Screening plasmids (1x109copies / well) were transfected using Lipofectamine 2000 (Invitrogen). RNA was isolated and used for small RNA sequencing using the NEBNext® Multiplex Small RNA Library Prep Kit for Illumina (Index Primers 1-48, #7560S) and BluePippin size selection of the final library, followed by Illumina NovaSeq6000 PE150 sequencing. Analysis of miR-451 expressed miRNAs was done as described for scaffold A constructs. For miR-144 expressed miRNAs, a custom database containing the synthetic miRNA sequences was used, where the hairpin was divided into the 5p and 3p arms to be able to distinguish between guide and passenger strands. miRNA expression was quantified as a % of the number of counts per sequence relative to the total number of mapped miRNA reads. Guide to passenger ratio (G / P ratio) was quantified by dividing the number of reads mapping to the guide strand by the number of reads mapping to the passenger strand. In vivo study of target engagement by scaffold A vectors rAAV5 vectors encoding selected scaffold A constructs (miMSH3-4, 31 , 33 and miHTTex1-13) were administered to 7-week old HdhQ111 / +knockin mice (N=8 per group) through bilateral intrastriatal injection at a dose of 1.3x1011genome copies / animal. At 24 weeks post injection, animals were euthanized and tissues were collected.

[0223] The striatum was used for DNA and RNA isolation using the AHPrep DNA / RNA mini kit (QIAGEN), according to manufacturer’s instructions. Vector DNA (vDNA) levels were measured using Tagman gPCR (see Table 8) and miRNA expression was measured by RT-gPCR using SYBR Green assays, using the method described by Cirera and Busk (2014). Samples with > 2 log lower than average vDNA levels, undetermined or low expression of the candidate miRNA, or expression of a miRNA with the wrong identity (all indicative of misinjection), were excluded from the analysis. MSH3 mRNA levels were measured by RT-gPCR using a SYBR Green Assay (see Table 9) on the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems). Relative expression was normalized to the reference genes Ppia and Actb (see Table 9) and to the nontargeting control (miSCR-2) group. Somatic instability was assessed by fragment analysis at Laragen and data were expressed as the instability index, using the method described by Lee et al. (2010).

[0224] MSH3 protein levels in a selection of striatal samples were assessed using Western blot. Briefly, tissues were lysed using RIPA buffer containing phosphatase inhibitors (PhosSTOP, Roche) and dissociated mechanically using Lysing Matrix D tubes (MP Biomedicals) in combination with the TissueLyser II (QIAGEN). After removal of tissue debris, protein content was determined using BCA assay and samples were diluted to egual concentrations in Laemmli Sample Buffer containing 2-mercaptoethanol. Samples were run on gel and transferred using wet blotting procedure, after which blots were incubated with primary mouse-anti-MSH3 antibody clone 1 F6 (MABE324, Sigma Aldrich) and rabbit-anti-ACTB (ab8227, Abeam) and subseguently the secondary IRDye 800 CW Goat-anti-Mouse and IRye 680RD Goat-anti-Rabbit antibodies (LI-COR). Blots were imaged using the Odyssey CLx scanner (LI-COR) and intensity of the MSH3 bands (127 kDa) was quantified relative to the ACTB loading control.

[0225] In vivo study of expression and target engagement by scaffold A, B and C vectors rAAV9 vectors encoding selected scaffold A, B and C constructs (miHTTex1-13, miHTTint1-miHTTex1-3, miMSH3-miHTTex1-2, miMSH3-miHTTint1-miHTTex1-9) were administered to 9-week old C57BL / 6 mice (N=5 per group) through bilateral intrastriatal injection at a dose of 6.0x1010genome copies / animal. At 4 weeks post injection, animals were euthanized and tissues were collected.

[0226] DNA and RNA were isolated from the striatal tissue samples using the AHPrep DNA / RNA mini kit (QIAGEN), according to manufacturer’s instructions. vDNA levels were measured using Taqman qPCR (see Table 8) and miRNA expression was measured by RT-qPCR using SYBR Green assays, using the method described by Cirera and Busk (2014). MSH3 mRNA levels were measured by RT-qPCR using a SYBR Green Assay (see Table 9) on the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems). Relative expression was normalized to the reference genes Ppia, Actb, Gapdh and Ywhaz and to the non-targeting control group (miSCR1 +2).

[0227] Table 8: Primers and probes used in Taqman assays.

[0228] Table 9: Primers used in SYBR Green assays.

[0229] In vivo assessment of target engagement and phenotypic correction by scaffold A and B vectors rAAV9 vectors encoding selected scaffold A and B constructs (miMSH3-4, miHTTex1-13 or miMSH3- miHTTex1-2) were administered to 6-week old R6 / 1 transgenic mice (1X1=11-12 per group) through bilateral intrastriatal injection at a dose of 9.0x1010genome copies / animal. miMSH3-miHTTex1-2 are also administered at 1.8x1 O10and 3.6x109genome copies / animal. At 12 weeks post injection, animals were euthanized and tissues were collected.

[0230] DNA and RNA were isolated from the striatal tissue samples using the AllPrep DNA / RNA mini kit (QIAGEN), according to manufacturer’s instructions. vDNA levels were measured using Taqman qPCR (see Table 8) and miRNA expression was measured by RT-qPCR using SYBR Green assays, using the method described by Cirera and Busk (2014). MSH3 and HTTexI mRNA levels were measured by RT-qPCR using probe-based assays (MSH3: TaqMan assay ID Mm00487756_m1 ; HTTexI : see Table 8) on the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems). Relative expression was normalized to the reference genes Gapdh, Gusb and Hprtl (TaqMan assay IDs Gapdh: Mm99999915_g1; Hprtl: Mm00446968_m1; Gusb: Mm00446953_mT) and to the non-targeting control group (miSCR1+2). Somatic instability was assessed by fragment analysis at Laragen and data were expressed as the instability index, using the method described by Lee et al. (2010).

[0231] RNA sequencing

[0232] Total RNA isolated from striatum of R6 / 1 mice (N=6 per group) was sent to GenomeScan (Leiden, The Netherlands) for mRNA-sequencing analysis. Library preparation was performed according to the protocol "NEBNext Ultra II Directional RNA Library Prep Kit for Illumina" (NEB #E7760S / L). Briefly, mRNA was isolated from total RNA using the oligo-dT magnetic beads. After fragmentation of the mRNA, a cDNA synthesis was performed. This was used for ligation with the sequencing adapters and PCR amplification of the resulting product. Clustering and DNA sequencing were performed on the NovaSeq6000 according to manufacturer's protocols using the NovaSeq control software NCS v1 .8. A concentration of 0.8 nM of DNA was used. Image analysis, base calling, and quality check was performed with the Illumina data analysis pipeline RTA3.4.4 and BcIConvert v4.2.4. A minimum of 28M clusters was generated per sample.

[0233] RNA sequencing analysis

[0234] RNA sequencing data acquired from the in vivo studies described above were analyzed using a custom analysis pipeline. Briefly, reads were aligned to the mouse reference genome (Refseq reference genome version GCF_000001635.27) using STAR (Dobin et al. 2013). Gene expression was quantified using featureCounts (Lian et al. 2014). Outliers based on gene expression profiles were identified by multidimensional scaling (limma MDS function) analysis and unsupervised clustering (heatmap.2 function) and were excluded from the analysis. Differential gene expression analysis was performed using the voom, ImFit and eBayes functions of the limma package (Law et al. 2014; Ritchie et al. 2015; Phipson et al. 2016), applying a threshold of false discovery rate (FDR)-adjusted p-value < 0.05 and absolute fold change > 1 .2. Differential splicing was quantified using the rMATS (Shen et al. 2012; Park et al. 2013; Shen et al. 2014) package and downstream analysis, including data filtering and visualization, was performed in R version 4.1 .0. Briefly, we used the output from rMATS based on the junction counts (JC) only and applied a cutoff of False Discovery Rate-adjusted p-value (FDR) < 0.05 and mean inclusion level difference > 5% to all data sets. Where applicable, we applied a threshold of 75 JCs.

[0235] Finally, reversal of genotype-dependent alternative splicing was quantified using the Bayesian Posterior Probabilities method (Marchionini et al. 2022), with some modifications to fit to the alternative splicing setting. Specifically, instead of using the log-fold change, we used the Inclusion Level Difference with a threshold of 5%, as well as a threshold of 0.05 for the FDR-adjusted p value. The standard error was calculated from the p values in the rMATS output data by 1) determining the t statistic based on the degrees of freedom (N1 + N2 - 2) and 2) calculating the standard error of the mean difference as the mean Inclusion Level Difference divided by the t statistic.

[0236] In vivo assessment of target engagement and phenotypic correction by scaffold A, B and C vectors

[0237] To study target engagement and phenotypic correction by scaffold A, B and C vectors, rAAV9 vectors encoding selected scaffold A, B and C constructs were administered to 7- to 8-week old BAC-CAG transgenic mice (N=12 per group) through bilateral intrastriatal injection at a dose of 9.0x1010genome copies / animal. At 30 weeks post injection and at 47 weeks post injection, animals were euthanized and tissues were collected. Protein analysis was done using HTRF, as described in Landles etal. (2021). Briefly, tissues were lysed in PBS containing 1% Triton-X-100 (10% w / v), then diluted for each assay to a predefined optimal concentration. HTRF HTT bioassays using donor and acceptor antibody pairs were used to detect various HTT protein species, including full-length mutant HTT (mHTT) and HTTexonl , the protein translated from the HTT1 a transcript. Means were compared separately for each timepoint and each assay, using an unpaired two-tailed T-test (2 months baseline, untreated WT vs BAC-CAG mice) or a one-way ANOVA (30 weeks and 47 weeks post injection) with a Dunnet’s post hoc test, comparing to miSCR1 +2 injected BAC-CAG mice.

[0238] HTT and Msh3 mRNA expression are quantified using RT-qPCR. Somatic instability is assessed by fragment analysis at Laragen and data are expressed as the instability index, using the method described by Lee et al. (2010). RESULTS

[0239] Example 1

[0240] Scaffold A: in vitro

[0241] In vitro silencing efficiency and processing of MSH3-targeting scaffold A constructs. To evaluate the knockdown efficiency of the MSH3-targeting constructs in vitro, HEK293T cells were co-transfected with dual luciferase reporters encoding the Renilla luciferase (RL) gene with MSH3 target seguences (pLuc5, pLuc6 or pLuc7; Figure 2) and said MSH3-targeting constructs. The Firefly luciferase (FL) gene was expressed from the same reporter vector and served as an internal control to correct for transfection efficiency. In the first screening, HEK293T cells were co-transfected with 1x109copies of each of the MSH3- targeting constructs or non-targeting control construct miSCRI and 2x108copies of the pLuc5, pLuc6 or pLuc7 reporter construct.

[0242] From the 90 constructs designed to target MSH3 exon 2 - 10 or exon 13 - 24 seguences, seven constructs with a fully conserved binding site in mouse (miMSH3-2, 31 , 32, 3, 33, 4, 5) induced more than 70% inhibition of the luciferase reporter plasmid, and a further thirteen constructs specific for human (miMSH3- 7, 10, 16, 36, 37, 81 , 82, 39, 85, 42, 86, 87, 23) induced more than 77% inhibition of the luciferase reporter plasmid; these 20 constructs were selected for titration experiments (Figure 3A, striped bars).

[0243] Selected constructs were subseguently used for titration experiments. The constructs were co-transfected in HEK293T cells in different concentrations: 4x107, 2x108or 1x109copies of the selected constructs with 2x108of their corresponding luciferase reporter plasmid. A balancer plasmid (pBlueScript SK(+)) was used to ensure that all wells received the same total amount of DNA. All the tested constructs showed dosedependent lowering of the luciferase reporter (Figure 3B).

[0244] Next, selected constructs were used to assess efficacy of lowering of endogenous MSH3. MSH3-targeting constructs were transfected at a single concentration in HEK293T cells and relative MSH3 mRNA expression was determined by RT-gPCR (Figure 4A). The most potent constructs that showed more than 30% endogenous lowering were miMSH3-2, 3, 4, 5, 10, 16, 23, 33, 85.

[0245] In addition to the silencing efficiency, we assessed compatibility of the construct seguences for which the binding sites were fully conserved in mouse with the miR-144 hairpin. We found that only miMSH3-4 was fully compatible with both the 5p and the 3p arm of the miR-144 hairpin. miMSH3-3 was fully compatible with the 5p arm, while miMSH3-5 was fully compatible and miMSH3-32 was partly compatible with the 3p arm of the miR-144 hairpin. Based on these results, scaffold B and C constructs were designed with miMSH3-4 in either arm, miMSH3-3 in the 5p arm, or miMSH3-5 in the 3p arm.

[0246] In our selection of candidates for AAV production, which were to be used in mouse models with the endogenous murine Msh3, we only selected candidates with full conservation of the target site in mouse. Although the most potent candidates included miMSH3-2, 3, 4 and 5, these four candidates all bind within the same 26-nt region of the target gene. Therefore, from these four candidates, we selected miMSH3-4, as this candidate showed the broadest compatibility with the miR-144 hairpin. Likewise, miMSH3-32 and miMSH3-33 both bound within the same 23-nt region. From these two, we selected the candidate miMSH3- 33, which had shown the highest efficacy of those two. Finally, we selected miMSH3-31 , as a third candidate binding in a different region of the MSH3 gene.

[0247] These selected candidates, in addition to two candidates with target sites that are not conserved in mice (miMSH3-42 and miMSH3-86), were subsequently transfected at various doses in HEK293T cells. All five constructs showed dose-dependent lowering of endogenous MSH3 in vitro, with the highest dose giving more than 50% lowering for candidates miMSH3-33, miMSH3-4 and miMSH3-42 (Figure 4B).

[0248] Using small RNA-sequencing, we assessed the fidelity of the 5’ end processing, which is important as the seed sequence depends on the 5’ end of the miRNA. For all three candidates, we found that more than 90% of reads aligning to the miRNA had the correct 5’ end (Figure 5A). Additionally, we assessed the range of isomiR lengths that were observed, which is mainly driven by 3’ end processing. For miMSH3-31 , the most abundant length was 30 nt; for miMSH3-33, the most abundant lengths were 24, 26 and 28; for miMSH3-4, the most abundant lengths were 22 and 25 nt (Figure 5B).

[0249] In vitro silencing efficiency of HTT1 a-tarqetinq scaffold A constructs. To evaluate the knockdown efficiency of the HTT1a-targeting constructs in vitro, HEK293T cells were co-transfected with dual luciferase reporters encoding the Renilla luciferase (RL) gene with HTT target sequences (pLuc1 or pLuc2; Figure 2) and said HTT 1 a-targeting constructs. The Firefly luciferase (FL) gene was expressed from the same reporter vector and served as an internal control to correct for transfection efficiency. In the first screening, HEK293T cells were co-transfected with 1x109copies of each of the miRNA constructs or non-targeting control construct miSCRI and 2x108copies of the pLuc reporter construct.

[0250] From the 93 constructs designed to target HTT1 a, 19 constructs (miHTTint1-5, 6, 7, 19, 26, 30, 32, 33, 34, 35, 42, 47, 49, 50, 51 , 56, 57, 58, 75) induced more than 77.5% inhibition of the luciferase reporter plasmid and were selected fortitration experiments (Figure 6A, striped bars). As a positive control, the HTT-targeting candidate miHTTex1-13 was also selected.

[0251] The selected constructs were subsequently used for titration experiments. The constructs were cotransfected in HEK293T cells in different concentrations: 4x107, 2x108or 1x109copies of the selected constructs with 2x108of their corresponding luciferase reporter plasmid. A balancer plasmid (pBlueScript SK(+)) was used to ensure that all wells received the same total amount of DNA. All the tested constructs showed dose-dependent lowering of the luciferase reporter (Figure 6B). The most potent constructs were miHTTint1-5, 6, 7, 19, 34, 42, 56, 57.

[0252] In addition to the silencing efficiency, we assessed compatibility of the construct sequences with the miR- 144 hairpin. We found that candidates miHTTint1-6 and miHTTint1-42 were fully compatible with both the 5p and the 3p arm of the miR-144 hairpin. The most potent candidate, miHTTint1-19, did not meet the prioritization criterion of starting with a U, however, since nt 19 is a C, it would still be expected to be expressed well from the miR-144 3p arm. Based on these results, the three candidates that were selected for design of scaffold B and C constructs were miHTTint1-6, miHTTint1-19 and miHTTint1-42. Example 2

[0253] Scaffold A: in vivo

[0254] In vivo study of scaffold A vectors for the lowering of murine Msh3 and inhibition of somatic instability. To evaluate the capacity of the three designed candidates to lower murine Msh3 and subsequently inhibit somatic instability in vivo, AAV5-miMSH3-31 , AAV5-miMSH3-33 or AAV5-miMSH3-4 were injected bilaterally into the striatum of 7-week old HdhQ111 / +knock-in mice. To assess the effect of HTT lowering on somatic instability, AAV5-miHTTex1-13 was taken along. As negative controls, mice were injected with the non-targeting control AAV5-miSCR-2 (HdhQ111 / +and WT littermates), or formulation buffer (HdhQ111 / +only). Mice were sacrificed 24 weeks post injection.

[0255] At the single dose used, vDNA was detected in striata from AAV5 injected animals, while in the control animals, vDNA levels were below the lower limit of quantification (LLOQ) (Figure 7A). Transduction led to expression of miRNA candidates in a vector-specific manner (Figure 7B): each miRNA was only detected in animals injected with that particular vector, as signified by the lower Ct values in those groups. Excluded from the analysis were seventeen animals that showed i) vDNA levels > 2 logs below average and / or ii) miRNA expression low outlier or undetermined. Due the small group size of the AAV5-miSCR-2 injected group after exclusion of misinjected animals, the formulation buffer group was used as comparator group for downstream statistical comparisons.

[0256] At the single dose used, all three MSH3-targeting miRNA vectors were effective at reducing MSH3 mRNA expression in the striatum, as evaluated by RT-qPCR, compared to the controls (Figure 7C). Using Western Blot analysis on a subset of samples, we confirmed that also on the protein level, there was significant MSH3 lowering (Figure 7D). Finally, by repeat length sizing, we showed that somatic instability was significantly reduced in HdhQ111 / +mice injected with any of the three MSH3-targeting miRNA vectors, while miHTTex1-13 did not affect somatic instability.

[0257] This study shows that miMSH3 candidates can reduce expression of murine Msh3 mRNA and protein, and subsequently diminish somatic instability in a mouse model of Huntington’s disease.

[0258] Example 3

[0259] Scaffolds B and C: in vitro

[0260] In vitro silencing efficiency of scaffold B and C constructs. To facilitate knockdown of MSH3 in combination with another gene, in this case HTT, we designed various constructs from which multiple miRNAs are expressed simultaneously (scaffolds B and C; Figure 1).

[0261] To evaluate the knockdown efficiency of the scaffold B and C constructs in vitro, HEK293T cells were cotransfected with dual luciferase reporters encoding the Renilla luciferase (RL) gene with HTT target sequences (pLuc1 or pLuc2) or MSH3 target sequences (pLuc5; Figure 2) and said scaffold B and C constructs. The Firefly luciferase (FL) gene was expressed from the same reporter vector and served as an internal control to correct for transfection efficiency. The constructs were co-transfected in HEK293T cells in different concentrations: 4x107, 2x108or 1x109copies of the selected constructs with 2x108of their corresponding luciferase reporter plasmid. A balancer plasmid (pBlueScript SK(+)) was used to ensure that all wells received the same total amount of DNA. All constructs showed dose-dependent lowering of their respective luciferase reporters) (Figure 8).

[0262] To assess endogenous lowering of MSH3 in vitro, HEK293 Jump In T-Rex HTT 1 a 45CAG were transfected with different concentrations of cells MS / 73-targeting scaffold B and C constructs and relative MSH3 mRNA expression was determined by RT-qPCR (Figure 9). All constructs showed approximate dose-dependent lowering of endogenous MSH3 up to around 40%.

[0263] Processing of constructs upon transfection in HEK293T cells. Using small RNA-sequencing, we assessed i) expression of the miR-144 expressed guide, ii) ratio of guide to passenger strand, iii) the fidelity of the 5’ end processing, and iv) miRNA processing.

[0264] We found that the hairpin sequence is an important driver of expression, G / P ratio and 5’ end processing, whereas the other miRNA(s) in the scaffold do not appear to influence these parameters. The scaffolds where miHTTint1-6, miHTTint1-42, miMSH3-3 or miMSH3-4 was expressed from the 5p arm of the miR- 144 hairpin showed G / P ratios larger than 1 ( / .e., the guide strands were more abundant than the passenger strands), whereas the scaffolds where miHTTint1-6, miHTTint1-42, miMSH3-4 or miMSH3-5 were expressed from the 3p arm showed G / P ratios smaller than 1 ( / .e., the passenger strands were more abundant than the guide strands). In addition, we found that while the miRNAs expressed from the 5p arm generally showed precise 5’ end processing (>95% of reads with the correct 5’ end), those expressed from the 3p arm typically had more imprecise 5’ end processing (ranging from 12% to 95%; Figure 10A). This 5’ processing result is in line with the reported cleavage precision of Drosha and Dicer (Starega-Roslan et al. 2015).

[0265] Assessing the range of isomiR lengths that were observed, we found that miR-144 expressed miRNAs were generally between 20 and 24 nt, where 3p expressed miRNAs tended to be slightly shorter compared to 5p expressed miRNAs (Figure 10B). As observed previously, miR-451 expressed miRNAs showed more variable isomiR lengths, which tended to be longer than those observed for miR-144, which is reflective of the different processing mechanisms (canonical vs. non-canonical). In all cases, the dominant isoform was different between the guide sequences, but not influenced noticeably by the composition of the scaffold (Figure 10C).

[0266] Based on the luciferase activity assays and the miRNA processing data, we selected two scaffold B constructs and one scaffold C construct for further testing: miHTTint1-miHTTex1-3, miMSH3-miHTTex1-2 and miMSH3-miHTTint1-miHTTex1-9, respectively (indicated with striped bars in Figures 8 and 9).

[0267] Example 4

[0268] Scaffolds B and C: in vivo

[0269] In vivo study of scaffold B and C candidates. To evaluate the capacity of the three designed candidates to be properly expressed in vivo, rAAV9 vectors encoding miHTTint1-miHTTex1-3, miMSH3-miHTTex1-2 and miMSH3-miHTTint1-miHTTex1-9 were injected bilaterally into the striatum of 9-week old C57BL / 6 mice (Figure 11A). As a positive control, miHTTex1-13 was taken along. As negative controls, mice were injected with non-targeting control rAAV9-miSCR-1 +2, or formulation buffer. Mice were sacrificed 4 weeks post injection.

[0270] At the single dose used, vDNA was detected in striata from rAAV9 injected animals, while in the control animals, vDNA levels were undetectable (Figure 11 B). Transduction led to expression of miRNAs in a vector-specific manner: each miRNA was only detected in animals injected with the particular vectors in which it was encoded (Figure 11 C). While target engagement of HTT could not be assessed in these WT mice, which only bear the murine Htt gene, we confirmed that miMSH3-4 expression from either rAAV9- miMSH3-miHTTex1-2 or rAAV9-miMSH3-miHTTint1-miHTTex1-9 led to significant lowering of Msh3 mRNA (Figure 11 D).

[0271] Example 5

[0272] In vitro assessment of target engagement by scaffold A, B and C vectors

[0273] To confirm our in vivo findings in a human cell model, patient-derived iPSCs with 180 CAG repeats (CS97i HD-180; derived from GM09197) differentiated into forebrain-like neurons are transduced with AAV vectors encoding selected scaffold A, B and C constructs. Cells are harvested before transduction and at multiple time points post transduction for DNA and RNA isolation. FL-HTT, HTT1a and MSH3 expression are determined by RT-gPCR. Mutant and wild type FL-HTT expression are guantified using allele-specific RT- gPCR (Miller et aL). Somatic instability is assessed using fragment analysis.

[0274] Example 6

[0275] In vivo assessment of target engagement and phenotypic correction by scaffold A and B vectors

[0276] To study target engagement and phenotypic correction by scaffold A and B vectors, rAAV9 vectors encoding miMSH3-4, miHTTex1-13 or miMSH3-miHTTex1-2 are administered to 6-week old R6 / 1 transgenic mice (1X1=11-12 per group) through bilateral intrastriatal injection at a dose of 9.0x1010genome copies / animal. rAAV9-miMSH3-miHTTex1-2 is also administered at 1.8x1010and 3.6x109genome copies / animal. Motor performance is assessed on at least one timepoint post injection. At 12 weeks post injection, animals were euthanized and tissues were collected. vDNA was detected in striata from AAV9 injected animals in a dose-dependent manner; in the groups injected with the control vector miSCR1 +2, vDNA levels were at around the same level as in the low dose group of miMSH3-miHTTex1-2 (Figure 12B). Transduction led to expression of miRNAs in a vector-specific manner: each miRNA was detected several logs over background in animals injected with the particular vectors in which it was encoded (Figure 12C). On the mRNA level, we confirmed target engagement by miHTTex1-13, miMSH3-4 and miMSH3-miHTTex1-2, all leading to significant lowering of Msh3 and / or HTTexI mRNA (Figure 12D), as expected based on the encoded miRNA(s) and in a dose-dependent manner. Finally, we assessed somatic instability and found that those groups where Msh3 was lowered showed a significantly lower instability index, approaching zero in the high dose groups (Figure 12E).

[0277] In order to specifically assess downstream effects of the miRNA candidates, we employed a transcriptomics approach. Thus, we found that comparing WT and R6 / 1 mice injected with the control vector allows us to select genotype-specific effects on gene expression and alternative splicing, which correlate well with differential gene expression and differential splicing results from publicly available RNA-sequencing data for this mouse model (data not shown). In total, we identified 729 differentially expressed genes (FDR < 0.05 and absolute fold change > 1.2) and 1689 differential splicing events (FDR < 0.05 and absolute inclusion level difference > 5%) between NT control injected WT and R6 / 1 mice.

[0278] Treatment with miHTTex1-13 led to partial rescue of 71% of the genotype-specific gene expression (Figure 12F) and 55% of the genotype-specific splicing effects (Figure 12G).

[0279] Treatment with miMSH3-4 led to a less pronounced rescue of genotype-specific transcriptional dysregulation (rescue of around 37% of the genotype-specific gene expression events; Figure 12F), while the effect on the missplicing phenotype was in the same range as miHTTex1-13 (43%; Figure 12G).

[0280] Treatment with miMSH3-miHTTex1-2 had a very similar effect to miHTTex1-13, partially rescuing both transcriptional dysregulation (62-63%; Figure 12F) and missplicing (49-53%; Figure 12G) with only small differences between the different doses.

[0281] Taken together, these results indicate that the miRNAs when incorporated in scaffold B are equally potent as the miRNAs in scaffold A, reaching similar levels of target engagement as well as downstream effects on somatic instability and genotype-dependent differential gene expression and differential splicing.

[0282] Example 7

[0283] In vivo assessment of target engagement and phenotypic correction by scaffold A, B and C vectors

[0284] To study target engagement and phenotypic correction by scaffold A, B and C vectors, rAAV9 vectors encoding selected scaffold A, B and C constructs were administered to 6-week old BAC-CAG transgenic mice (N=12 per group) through bilateral intrastriatal injection at a dose of 9.0x1010genome copies / animal (Figure 13A). Motor performance is assessed at different time points post injection.

[0285] At 30 weeks post injection and at 47 weeks post injection, animals were euthanized and tissues were collected.

[0286] Levels of various HTT protein species were determined using HTRF. As expected, levels of full length soluble mHTT were well above background in untreated, formulation buffer- and miSCR1+2-injected BAC- CAG mice (Figure 13B). All vectors encoding miHTTex1-13 showed a reduction of soluble mHTT at both timepoints and using both assays, albeit non-significant for the 30 weeks post injection timepoint with the MAB2166:4C9 assay. Scaffold A vectors miHTTint1-42 and miMSH3-4 did not lead to a reduction of soluble mutant HTT. Soluble HTTexonl and aggregated HTTexonl , were also well above background in untreated, formulation buffer- and miSCR1+2-injected BAC-CAG mice (Figure 13C). We confirmed that HTTexonl aggregation increased over time in the control BAC-CAG groups, as expected. All vectors encoding either miHTTex1-13 and / or miHTTint1-42 showed a strong reduction of both soluble and aggregated HTTexonl at both timepoints. These data support that miHTTint1-42 is preferential for HTTexonl , while miHTTexl- 13 lowers both full-length HTT and HTTexonl . I ntriguingly , the scaffold A vector encoding miMSH3 also led to a reduction of soluble and aggregated HTTexonl at the 47 weeks timepoint, supporting the notion that HTT1a production is linked to somatic expansion, and that targeting of MSH3 may indirectly act on HTTexonl levels, and may be sufficient for disease modification if intervening in early disease stages.

[0287] HTT and Msh3 mRNA expression are quantified using RT-qPCR. Somatic instability is assessed using fragment analysis.

[0288] Example 8

[0289] In vivo assessment of target engagement and phenotypic correction by scaffold A, B and / or C vectors To further study target engagement and phenotypic correction by scaffold A, B and / or C vectors rAAV vectors encoding selected scaffold constructs are administered to WT and / or HD mice through bilateral intrastriatal injection at doses ranging from 5.2x109to 1.3x1011genome copies / animal. If applicable, motor performance is assessed at different timepoints post injection. At 4 to 48 weeks post injection, animals are euthanized and tissues are collected. As applicable, HTT and Msh3 mRNA expression are quantified using RT-qPCR. Somatic instability is assessed using fragment analysis. HTT protein levels are quantified using HTRF.

[0290] Example 9

[0291] In vivo assessment of target engagement in other repeat expansion disorders

[0292] To assess whether MSH3-targeting miRNAs can also rescue somatic instability in other repeat expansion disorders, selected scaffold A, B and / or C vectors are administered to mouse models of other disorders. Examples include SCA2 Atxn2Q10° knock-in mice and DM1 DM300 or DMSXL transgenic mice.

Claims

Claims1 . A nucleic acid molecule comprising a nucleotide sequence encoding a first RNA and a nucleotide sequence encoding a second RNA, wherein:

1. the first and second RNA molecule each comprises a hairpin; and ii. at least one of the first and second RNA comprises a first guide sequence of at least 19 nucleotides substantially complementary to a region within the human MSH3 gene.

2. A nucleic acid molecule according to claim 1 , wherein in a 5’ to 3’ direction, the nucleotide sequence encoding the first RNA is followed by the nucleotide sequence encoding the second RNA.

3. A nucleic acid molecule according to claim 1 or 2, wherein the first guide sequence is comprised in the second RNA.

4. A nucleic acid molecule according to any one of claims 1 to 3, wherein the nucleotide sequence encoding the first RNA comprises SEQ ID NO. 191 or a variant thereof, and reduces or eliminates processing and / or expression of the first RNA.

5. A nucleic acid molecule according to any one of claims 1 to 4, wherein the nucleotide sequence encoding the second RNA comprises SEQ ID NO. 192 or a variant thereof.

6. A nucleic acid molecule according to claims 1 or 2, further comprising a second guide sequence, preferably of at least 19 nucleotides, wherein the first RNA and second RNA each comprises a guide sequence.

7. A nucleic acid molecule according to claim 6, wherein the second guide sequence is substantially complementary to a region within a human gene selected from HTT, ATXN1, ATXN2, ATXN3, DM1, FXTAS, DRPLA, or C9ORF72, preferably the human HTT gene.

8. A nucleic acid molecule according to claims 6 or 7, wherein the second guide sequence is substantially complementary to a region within intron 1 of the human HTT gene or to a region within exon 1 of the human HTT gene.

9. A nucleic acid molecule according to claims 6 to 8, wherein he nucleotide sequence encoding the first RNA comprises SEQ ID NO. 193 or a variant thereof.

10. A nucleic acid molecule according to claims 6 to 9, wherein the nucleotide sequence encoding the second RNA comprises SEQ ID NO. 192 or a variant thereof.

11. A nucleic acid molecule according to claim 6 to 9, wherein: i. the first RNA comprises the first guide sequence; ii. the second RNA comprises a guide sequence that is substantially complementary to a region within intron 1 of the human HTT gene or to a region within exon 1 of the human HTT gene.

12. A nucleic acid molecule according to claims 6 to 10, further comprising a nucleotide sequence encoding a third RNA, wherein said nucleotide sequence, in a 5' to 3' direction, follows the nucleotide sequence encoding the second RNA.

13. A nucleic acid molecule according to claim 12, wherein the nucleotide sequence encoding the third RNA comprises SEQ ID NO. 192 or a variant thereof.

14. A nucleic acid molecule according to claim 12 or 13, wherein each RNA molecule comprises a guide sequence independently selected from: i. a guide sequence that is substantially complementary to a region within the human MSH3 gene; or ii. a guide sequence that is substantially complementary to a region within intron 1 of the human HTT gene; orHi. a guide sequence that is substantially complementary to a region within exon 1 of the human HTT gene.

15. A nucleic acid molecule according to any of the preceding claims, wherein the first guide sequence reduces MSH3 expression by at least 50 %.

16. A nucleic acid molecule according to claims 6 to 15, wherein the guide sequence that is substantially complementary a region within exon 1 of the human HTT gene reduces mHTT expression by at least 50 %.

17. A nucleic acid molecule according to claims 6 to 16, wherein the guide sequence that is substantially complementary a region within intron 1 of the human HTT gene reduces mHTT expression by at least 50 %.

18. An expression cassette comprising a nucleic acid molecule according to any one of claims 1 to 17.

19. The expression cassette according to claim 18, wherein the nucleic acid is operably linked to a promoter and optionally to a poly-A signal.

20. The expression cassette according to claim 18 or 19, wherein the promoter drives expression in a brain cell, preferably wherein the promoter comprises SEQ ID NO. 201 .21 . An adeno-associated virus (AAV) vector comprising the expression cassette according to claims 18 to 20.

22. A pharmaceutical composition comprising the nucleic acid molecule according to any one of claims 1 to 17, the expression cassette of any one of claims 18 to 20, or the AAV vector according to claim 21 , and at least one pharmaceutically acceptable excipient.

23. The nucleic acid molecule according to any one of claims 1 to 17, the expression cassette according to any one of claims 18 to 20, the AAV vector according to claim 21 , or the pharmaceutical composition according to claim 22 for use as a medicament.

24. The nucleic acid molecule according to any one of claims 1 to 17, the expression cassette according to any one of claims 18 to 20, the AAV vector according to claim 21 , or the pharmaceutical composition according to claim 22 for use in the treatment of a nucleotide repeat disorder, preferably Huntington's disease.

25. A kit comprising a nucleic acid molecule according to any one of claims 1 to 17, the expression cassette according to any one of claims 18 to 20, the AAV vector according to claim 21 , or the pharmaceutical composition according to claim 22, further comprising an immunosuppressive compound.

26. A host cell comprising the expression cassette according to any one of claims 18 to 20.