BACILLUS SUBTILIS STRAIN JCK-1398 THAT INDUCES RESISTANCE IN VARIOUS PLANTS, AND COMPOSITION AND METHOD FOR CONTROLLING PINE WILT DISEASE USING THE SAME
Patent Information
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- JAN153 BIOTECH INC
- Filing Date
- 2022-08-11
- Publication Date
- 2026-05-19
AI Technical Summary
Current methods for controlling pine wilt disease, caused by Bursaphelenchus xylophilus, are limited by the short duration of chemical treatments and the difficulty in accessing pine forests, making wide-area prevention challenging and costly, with existing chemicals like abamectin and Green Guard having efficacy issues.
A strain of Bacillus subtilis JCK-1398 is developed to induce resistance in pine trees and plants, using a composition containing the strain, its culture, or culture supernatant, combined with synthetic agrochemicals to enhance control efficacy.
The Bacillus subtilis JCK-1398 strain effectively controls pine wilt disease and other plant pathogens by inducing resistance, reducing the need for high chemical concentrations and providing long-lasting protection against nematodes, bacteria, and fungi.
Abstract
Description
BACILLUS SUBTILIS STRAIN JCK-1398 THAT INDUCES RESISTANCE IN VARIOUS PLANTS, AND COMPOSITION AND METHOD FOR CONTROLLING PINE WILT DISEASE USING THE SAME 7. i bb / n / zznz / q / υιλι TECHNICAL FIELD The present invention was made with the support of the Korea Forest Service under project No. FE0702-2016-02, which was carried out within the research project entitled Development and Validation of Environmentally Compatible Control Agents against Pine Wilt Disease Based on Induced Resistance within the research program called Service Research Program of the Chonnam National University Industrial-Academic Cooperation Foundation under the direction of the National Institute of Forest Science, from April 19, 2019 to November 29, 2019. This application claims priority and benefit from Korean Patent Application No. 10-2020-0017232, filed with the Intellectual Property Office of Korea on February 12, 2020, disclosure of which is incorporated herein by reference. The present invention relates to a strain of Bacillus subtilis JCK-1398 that induces resistance in pine trees and various plants, as well as to a composition and a method for controlling plant diseases by using it. PRELIMINARY TECHNIQUE Pine wilt disease, caused by Bursaphelenchus xylophilus, is severely damaging pine trees locally and abroad, and has recently been spreading rapidly in a complicated pattern along with changes in the forest ecosystem environment as a consequence of climate change. Pine wilt disease is known to be caused primarily by Bursaphelenchus xylophilus, a forest pest that defoliates pines through complex interactions with hosts, pathogens, insect vectors, and environmental factors, and is difficult to control; moreover, once infected, almost all pines die without treatment. Several methods exist for controlling pine wilt disease, but trunk injection is virtually the only preventative method. However, abamectin and emamectin benzoate, widely used for trunk injection, have a short duration of effectiveness, lasting only two years, and a limited injection window. Furthermore, Green Guard, from Japan, is expensive and has limitations for general application. Furthermore, trunk injection is problematic for preventing pine wilt disease over a wide area, as is the cost of the chemicals, and it is ineffective due to the difficulty of accessing pine forests in high mountain areas. Additionally, Kuroda and Kenmochi (Pine Wilt Disease Conference, IUFRO, 2016) warned that repeated trunk injections of nematicides to control pine wilt disease result in the death of uninfected pines. Consequently, there is an urgent need to develop environmentally friendly chemicals that can effectively control plant diseases and pests over a wide area through soil irrigation, foliar spraying, or similar methods. DESCRIPTION OF THE INVENTION Technical Problem The inventors undertook the development of a microbial agent that induces resistance in pine trees and various other plants. As a result, the inventors concluded that a new strain of Bacillus subtilis JCK-1398 has a controlling effect against several plant pathogens, including the nematodes that cause pine wilt disease. This effect is due to the resistance-inducing activity of this strain, and thus the present invention was obtained. Accordingly, one aspect of the present invention is to provide a strain of Bacillus subtilis JCK-1398 (registration number KCTC 14084BP) that activates induced resistance in a plant against a disease and a pest. Another aspect of the present invention is to provide a pesticide or antibiotic composition containing as an active ingredient at least one ingredient selected from the group consisting of a strain of Bacillus subtilis JCK-1398, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and a combination thereof. Another additional aspect of the present invention is to provide a composition for controlling plant diseases or pests, which contains as an active ingredient at least one ingredient selected from the group consisting of a strain of Bacillus subtilis JCK-1398, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and a combination thereof. Another additional aspect of the present invention is to provide a method for controlling plant diseases or pests by using at least one component selected from the group consisting of a Bacillus subtilis JCK-1398 strain, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and a combination thereof. Solution to the Problem The inventors set out to develop a microbial agent that induces resistance in pine trees and various other plants. As a result, they concluded that a new strain of Bacillus subtilis JCK-1398 has resistance-inducing activity against several nematodes and bacteria that cause plant diseases, including Bursaphelenchus xylophilus. The present invention is oriented to a pesticide or antibiotic composition and to a composition for the control of plant diseases or pests, and each composition contains as an active ingredient a strain of Bacillus subtilis JCK-1398 (registration number KCTC 14084BP) that activates induced resistance in plants, a culture of the strain or similar components. I bb / n / 77n7 / q / YILI The present invention will henceforth be described in greater detail. One aspect of the present invention is oriented to a strain of Bacillus subtilis JCK-1398 (registration number KCTC 14084BP). The strain includes the gyrA nucleotide sequence of SEQ ID NO: 33. The nucleotide sequence of SEQ ID NO: 33 was identified as a new strain, since the nucleotide sequence has 99% homology and 1% heterogeneity with the reference strain CP021892. The nucleotide sequence of gyrA (gyrase subunit A) of the Bacillus subtilis strain JCK-1398 was identified by searching the GenBank database and the NCBI database using the Blast program. The new strain obtained was named Bacillus subtilis strain JCK-1398 and was deposited in the Korean Type Culture Collection with registration number KCTC 14084BP on December 19, 2019. The Bacillus subtilis JCK-1398 strain can be obtained by isolation and identification from a tomato plant, and the properties of the strain are as follows: The strain is a rod-shaped, cylindrical bacillus that actively moves with flagella and forms circular or oval spores in the cell center. It thrives even in a standard incubator, forming large, grayish-white colonies with radial spread. Due to its spore-forming nature, the strain exhibits exceptional resistance to desiccation and high temperatures. It is a Gram-positive bacterium containing glycogen and producing acids through the breakdown of various carbohydrates. The strain utilizes carbon sources such as D-glucose, L-arabinose, and sucrose for energy. In an example of the present invention, the resistance-inducing activity of the Bacillus subtilis strain JCK-1398 was evaluated by an experiment in which pines and various plants were used (Figures 3 to 9). The Bacillus subtilis strain JCK-1398 exhibits activity to control diseases and pests through resistance induction activity. The Bacillus subtilis strain JCK-1398 exhibits activity to control plant pests or diseases caused by phytopathogenic nematodes, pests, or phytopathogenic bacteria and fungi (molds). The nematodes may be Bursaphelenchus xylophilus, although they are not limited to this species. The pests may be Aculops lycopersici, although they are not limited to this species. The bacteria and fungi may be Xanthomonas euvesicatoria and / or Sclerotinia homoeocarpa, although they are not limited to these species. Plant diseases can include: pine wilt disease, bacterial spot and / or dollar spot, but are not limited to these diseases. Therefore, the Bacillus subtilis strain JCK-1398 of the present invention exhibits plant disease control activity through its ability to inhibit the growth of I bb / n / 77n7 / q / YILI phytopathogenic nematodes, bacteria, fungi or pests by inducing resistance in the hosts. The Bacillus subtilis strain JCK-1398 induces a synergistic effect when combined with an existing induced resistance trigger, and can therefore be used in the ecological control of plant diseases. The induced resistance trigger used as a combination agent with the Bacillus subtilis strain JCK-1398 can be acibenzolar-S-methyl (ASM) and / or methyl salicylate (MeSA), although it is not limited to these compounds. When the Bacillus subtilis strain JCK-1398 is combined with an existing synthetic bactericide (synthetic agrochemical), it induces a synergistic effect. Therefore, the synthetic agrochemical, even when used at a concentration lower than a commonly used concentration, has an equivalent or greater effect on controlling plant diseases than when used at the commonly used concentration. Thus, the strain can be used to reduce the concentration and quantity of a commonly used synthetic bactericide and to control plant diseases in an environmentally friendly way. The synthetic agrochemical used as a combining agent with the Bacillus subtilis strain JCK-1398 may be tebuconazole, iprodione, fludioxonil, benomyl and / or difenoconazole, although it is not limited to these compounds. Another aspect of the present invention is to provide a pesticide or antibiotic composition containing at least one component selected from the group consisting of a Bacillus subtilis JCK-1398 strain (registration number KCTC 14084BP), a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and a combination thereof. Therefore, the present invention may provide a pesticide or antibiotic microbial agent containing at least one component selected from the group consisting of a Bacillus subtilis JCK-1398 strain, a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and a combination thereof, and may also provide a pesticide or antibiotic method by treatment with the microbial agent. The microbial agent can be formulated using a typical method and can be prepared as a dry powder or a liquid fertilizer. Specifically, the microbial agent of the present invention can be prepared in liquid form, and it can be used in powder form by adding a diluent or formulated to form granules. However, the microbial agent is not particularly limited in terms of its formulation. The microbial agent of the present invention can be prepared by incorporating an additive, diluent, nutrient, or similar substance into a strain or culture thereof. At least one of the following compounds may be selected for use as an additive: polycarboxylates, sodium lignosulfonates, calcium lignosulfonates, sodium dialkyl sulfosuccinates, sodium alkyl aryl sulfonates, polyoxyethylene alkyl phenyl ethers, sodium tripolyphosphates, polyoxyethylene alkyl aryl phosphoric esters, polyoxyethylene alkyl aryl ethers, polyoxyethylene alkyl aryl polymers, polyoxyalkylone alkyl phenyl ethers, polyoxyethylene I bb / n / 77n7 / q / YILI nonyl phenyl ethers, sodium naphthalene sulfonate formaldehydes, Triton 100 and Tween 80; as extender and nutrient at least one component selected from the group consisting of: skimmed milk (medium), soy flour, rice, wheat, ochre, diatomite, bentonite, dextrin, glucose and starch may be used; and as disintegrant at least one component selected from the group consisting of bentonite, talc, dialite, kaolin and calcium carbonate may be used. Furthermore, the present invention provides a method for inducing resistance in a plant by treating the soil or the plant with the microbial agent. The treatment method can be carried out using a commonly used method, i.e., spraying (e.g., misting, atomizing, powder spraying, granular spraying, watering for rice paddies, applying to planting compartments, etc.), soil treatment (e.g., mixing, irrigation, etc.), surface application (e.g., coating, dispersing, lining, etc.), immersion, pesticide application, smoke application, or similar processes. The quantity of the microbial agent used can be appropriately determined based on the formulation, the damage caused, the application method, the application site, etc. In the present invention, the effective quantity of microorganisms contained in the agent used for treatment by the method can be from 1 to 1 x 10¹⁰ microorganisms per arable land area (m²). The effective quantity of microorganisms contained in the agent used for spray treatment between the methods can be from 1 to 1 x 10¹⁰ microorganisms per mi, and the effective quantity of microorganisms contained in the composition used for immersion treatment can be from 1 to 1 x 10¹⁰ microorganisms per mi. Another aspect of the present invention is to provide a composition for controlling plant diseases or pests, containing at least one component selected from the group consisting of a Bacillus subtilis JCK-1398 strain (registration number KCTC 14084BP), a culture of the strain, a concentrate of the culture, a dried product of the culture, a culture supernatant of the strain, and a combination thereof. Each of the compositions of the present invention may contain not only the strain, the strain culture, the culture concentrate, the dried culture product and / or the strain supernatant, which corresponds to an active ingredient, but also a culture containing cells of the strain, an extract of the cells, a concentrate, a concentrated product or a dried product thereof, or if necessary, a diluted solution, a diluted product, or similar components, and may include any component obtained by treatment of the culture or the cultured product. The cultivation, extraction, separation, concentration, drying, dilution, and other similar processes of the strain are not particularly limited. Examples of a culture medium for the strain may typically include milk proteins, as in the case of skim milk, whey and casein, sugars and yeast extracts, and various types of general aerobic or anaerobic methods may be appropriately used for cultivation. 7. i bb / n / zznz / q / υιλι After culturing the strain, a culture or supernatant can be concentrated, dried, or diluted if necessary. Furthermore, by separating the supernatant and the cells from the culture through centrifugation or membrane separation, the cells can be recovered in a concentrated state. The cells can be subjected to ultrasonic, enzymatic, or similar treatment to extract the cell components, or a culture, supernatant, cells, extract, or similar components can be dried. These can then be used as active ingredients in the compositions of the present invention. The joint description of the strain and each composition containing it is omitted due to the complexity of this disclosure. Favorable Effects of the Invention The present invention relates to a strain of Bacillus subtilis JCK-1398 (registration number KCTC 14084BP) that exhibits resistance-inducing activity in pines and various other plants, to a pesticide or antibiotic composition and to a composition for controlling plant diseases or pests, each of which contains the strain as an active ingredient, and to a control method using said components. It was experimentally confirmed that the Bacillus subtilis JCK-1398 strain of the present invention exhibited control activity against pests, nematodes, and bacteria that cause various plant diseases, inducing resistance in the hosts.Accordingly, the Bacillus subtilis strain JCK1398 of the present invention can be favorably used to control a related plant disease and can be sprayed over a wide area by means of foliar spraying, and it is therefore expected that the present invention will prevent the spread of pine wilt disease at a low cost. BRIEF DESCRIPTION OF THE FIGURES Figure 1 confirms the expression of genes related to resistance induced by the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention. Figure 2 shows the result of the phylogenetic analysis of the gyrA nucleotide sequence of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention. Figure 3A confirms the pine wilt disease control effect of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention, as it shows the seedling test result of a culture of the JCK-1398 strain on Pinus densiflora seedlings expressed by a disease progression curve. Figure 3B confirms the pine wilt disease control effect of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention, as it shows Pinus densiflora seedlings treated with a culture of the JCK-1398 strain (a), untreated (b), and uninoculated (c). Figure 4A confirms the pine wilt disease control effects of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention, as it shows I bb / n / 77n7 / q / YILI the effects of pine wilt disease control of a culture, a culture filtrate and a cell fraction of strain JCK-1398 at an OD 600=0.8. Figure 4B confirms the pine wilt disease control effects of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention, as it shows Pinus densiflora seedlings treated with a culture of the JCK-1398 strain (a), with a culture filtrate of the JCK-1398 strain (b), with a cell fraction of the JCK-1398 strain (c), untreated (d), and uninoculated (e). Figure 5A confirms the control effect of the Bacillus subtilis strain JCK-1398 on pine wilt disease as a function of treatment time in accordance with an example of the present invention, as it shows the seedling test result of the JCK-1398 strain culture on Pinus densiflora seedlings expressed by a disease progression curve. Figure 5B confirms the control effect of the Bacillus subtilis strain JCK-1398 on pine wilt disease as a function of treatment time in accordance with an example of the present invention, as it indicates a control effect of the JCK-1398 strain 60 days after inoculation with Bursaphelenchus xylophilus. Figure 5C confirms the pine wilt disease control effect of the Bacillus subtilis strain JCK-1398 as a function of treatment time in accordance with an example of the present invention, as it shows Pinus densiflora seedlings treated 2 weeks before - 1 week before (a), 3 weeks before - 1 week before (b), and 4 weeks before - 1 week before (c) inoculation with Bursaphelenchus xylophilus, untreated (d) and uninoculated (e). Figure 6 confirms the pine wilt disease control effect of the Bacillus subtilis strain JCK-1398 as a function of the treatment concentration according to an example of the present invention. Figure 7A confirms the control effect of the Bacillus subtilis strain JCK-1398 on pine wilt disease in accordance with an example of the present invention, as it shows the seedling test result of a culture of the JCK-1398 strain on adult Pinus densiflora trees expressed by a disease progression curve. Figure 7B confirms the pine wilt disease control effects of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention, as it shows the control effects of the Bacillus subtilis strain JCK-1398 through a first and a second field trial. Figure 7C confirms the pine wilt disease control effect of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention, as it shows mature Pinus densiflora trees treated with a 50-fold diluted solution of a spray-dried powder of the JCK-1398 strain (a), with emamectin benzoate (b) and without inoculation (c). I bb 7 Ω / 77Ω7 / 3 / YILI Figure 8 confirms the pine wilt disease control effects of the combined agents of a Bacillus subtilis JCK-1398 (20% CS) formulation and the induced resistance triggers ASM and MeSA, in accordance with an example of the present invention. Figure 9 confirms the pine wilt disease control effects of a Bacillus subtilis JCK-1398 (20% CS) formulation and a Bacillus subtilis JCK-1398 (10% CS) formulation with various concentrations according to an example of the present invention. Figure 10A confirms the control effect of a Bacillus subtilis JCK-1398 (10% CS) formulation on 30-year-old adult trees in accordance with an example of the present invention, as it shows the evaluation result of the practical application using an unmanned helicopter, expressed by a disease progression curve. Figure 10B confirms the pine wilt disease control effect of a Bacillus subtilis JCK-1398 (10% CS) formulation on 30-year-old adult trees in accordance with an example of the present invention, as it shows the severity of the disease 6 months after inoculation with Bursaphelenchus xylophilus. Figure 11 confirms the bacterial spot control effect of a culture of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention. Figure 12 confirms the dollar spot control effect of a culture of the Bacillus subtilis strain JCK-1398 in accordance with an example of the present invention. Figure 13 confirms the control effects of Aculops lycopersici of a formulation of a Bacillus subtilis strain JCK-1398 (20% CS) in accordance with an example of the present invention. Best Way to Implement the Invention The present invention is directed to a strain of Bacillus subtilis JCK-1398 (registration number KCTC 14084BP) that activates induced resistance against diseases and pests in a plant. Implementation Method of the Invention The present invention will henceforth be described in greater detail, with reference to illustrative embodiments. These illustrative embodiments serve only to illustrate the present invention, and it will be evident to those skilled in the art that the scope of the present invention is not limited to the illustrative embodiments. Example 1: Selection of strains that produce induced resistance To obtain strains that produce induced resistance against pine wilt disease, 500 plant-derived microbial strains were isolated from various plants. The strains that produce induced resistance (25 strains) were selected from these 500 plant-derived microbial strains using Arabidopsis thaliana transformed with a vector carrying the PR-1 promoter labeled with GUS. The results are shown in Table 1. 7. i bb / η / ζζηζα / υιλι 7.I bb / Π / 77Π7 / Σ1 / ΥΙΛΙ TABLE 1 Strain Activity Strain Activity Strain Activity Strain Activity JCK-757 JCK-1180 * JCK-1266 JCK-1333 X JCK-761 X JCK-1217 X JCK-1307 JCK-1318X Example 2: In vitro induced resistance assay using pine callus The 25 strains selected in Example 1 were evaluated for the expression of genes related to the induced resistance of the callus of Pinus densiflora. Specifically, a pine resistance-inducing strain was cultured in 500 pl of LM medium in 12-well microplates until an absorbance of 0.8 at 600 nm (OD600) was reached. Then, the surface of 100 mg of Pinus densiflora callus was treated with 500 pl of the culture. The callus surface and the pine resistance-inducing strain culture were incubated for 24 hours in a shaking incubator at 50 rpm and 25 °C under dark conditions. The incubated callus was then separated by centrifugation at 600 x g for 5–10 minutes. RNA was extracted from the separated callus to synthesize cDNA, and the specific increase in the expression of genes related to induced resistance was assessed by RT-PCR or qRT-PCR. The results are shown in Figure 1 and Table 2. The induced resistance-related genes used for qRT-PCR are shown in Table 3 below. TABLE 2 No. Name Expression Level 1 PR-1b Family 1.35 2 PR-2 Family 1.02 3 PR-3 Family Class 1 0.70 4 PR-3 Family Class 4 2.84 5 PR-4 Family 10.20 6 PR-5 Family 2.21 7 PR-9 Family 1.49 8 PR-10 Family 1.56 9 Antimicrobial Peptide 11.91 10 Cytochrome P450 1.06 11 Extensin 0.84 12 Hydroxyproline-Rich Glycoprotein Precursor 0.50 13 Metallothionein-Like Protein 1.59 14 Xyloglycan Endotransglycosylase 0.72 7. i bb / n / zznz / q / υιλι TABLE 3 SEQ ID NO Name Sequence (5 -> 3') Size (bp) 1 Family PR-1b Dir TGCCCCTTCAGGTAAATCGT 125 2 Family PR-1b Inv GCGGGTCGTAGTTGCAGATA A 3 Family PR-2 Dir. CGACAACATTCGCCCCTTCT 130 4 Family PR-2 Inv. CTGCAGCGCGGTTTGAATAT 5 Family PR-3 Class 1 Dir. ACCTACAGCGCTTCATTGC 120 6 Family PR-3 Class 1 Inv TGTGGTTTCATGCGACGTTT 7 Family PR-3 Class 4 Dir. C CATC GAAG CC CAG GTAATT T 90 8 Family PR-3 Class 4 Inv AGCCGGGAAG C AAT ATT AT G GT 9 Family PR-4 Dir. CCCCGTTACTGCAATTGCAT 90 10 Family PR-4 Inv. AAAGCGTGACGGTGCGTATT 11 Family PR-5 Dir. GAACCAGTGCCCATACACAG TCT 96 12 Family PR-5 Inv. CCTGCGGCAACGTTAAAAGT C 13 Family PR-9 Dir. ACACCACCGTGCTGGACATT 118 14 Familia PR-9 Inv. GTGCGGGAGTCGGTGTAGAG 15 Family PR-10 Dir TGTCTCAAGTGGAGGCAAGG A 90 16 Family PR-10 Inv AAGCGACAATTTCAGGCAAA AC 17 Antimicrobial peptide Dir. GC GTTG CTCATAC CC GTTTT 90 18 Antimicrobial peptide Inv GCAGCACTTAGCACTGGATG AA 19 Cytochrome P450 Dir.AACATGTCCTGCAGCACGAA 95 20 Cytochrome P450 Inv GTGCACCGCAAGTAAACCAA 21 Extensin Dir CGAATGTAATTCCGAAGTTGC A 110 22 Extensin Inv. CCATCCCAAACCACCAGTCT 23 Hydroxyproline-rich glycoprotein precursor Dir. GAGAAACTGGCACCGTCTTA GGA 140 24 Hydroxyproline-rich glycoprotein precursor Inv. ACCTCCCCCTCCATCTCACA 25 Metallothionein-like protein Dir. TCAGGCTGCTGCGTTATTTG 120 26 Metallothionein-like protein Inv TGTCAGCGCAGTCACAATTT Gs 27 Xyloglucan endotransglycosylase Dir. TCTGCGCCCCTACTTTTCC 121 28 Xyloglucan endotransglycosylase Inv. AGCTGGGCGATTGATCATGT 29 Elongation factor-1 alpha Dir. GGGAAGCCACCCAAAGTTTT 160 30 Elongation factor-1 alpha Inv TACATGGGAAGACGCCGAAT. As can be confirmed from Figure 1 and Table 2, the present inventive strain of Bacillus subtilis JCK-1398 among the 25 selected strains specifically increased genes for proteins, as in the case of the PR-1b family, the PR-3 class 4 family, the PR-4 family, the PR-5 family, the PR-9 family, the PR-10 family, the antimicrobial peptide and the metallothionein-like protein. Example 3: Molecular biological identification and phylogenetic classification The Bacillus subtilis strain JCK-1398 was plated on tryptic soy agar (TSA, Difeo) and incubated at 30 °C for 1 day. Individual colonies were then streaked onto tryptic soy agar (TSA, Difeo) using a sterile loop, and the culture was shaken at 30 °C and 150 rpm for 1 day. Genomic DNA (gDNA) was then extracted from the strain using the DOKDO-Prep Bacterial Genomic DNA Purification Kit (Elpis Biotech) according to the protocol. The extracted gDNA was mixed with a polymerase chain reaction premix (PCR-premix) from IntRON Biotechnology and a primer set capable of amplifying the gyrase subunit A (gyrA) gene. Subsequently, the gyrA gene from strain JCK-1398 was amplified via PCR. The primer set used for PCR is shown in Table 4 below. TABLE 4 I bb / n / 77n7 / q / YILI SEQ ID NO Name Sequence (5 -> 3!) 31 gyrA Dir. CAG TCA GGA AAT GCG TAC GTC CTT 32 gyrA Inv. CAA GGT AAT GCT CCA GGC ATT GCT PCR was initially performed at 95 °C for 5 min, followed by 30 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, then at 72 °C for 7 min; amplification was terminated at 12 °C. Nucleotide sequencing of the amplified PCR product was performed by Genotech (Daejong, South Korea), and the nucleotide sequence of the gyrA gene from strain JCK-1398 (SEQ ID NO: 33) was obtained. The obtained nucleotide sequence of the gyrA gene was compared with the nucleotide sequences in the GenBank database using the nBlast search at the NCBI center.In addition, nucleotide sequences of the gyrA gene with high similarity were checked in the GenBank database, and all nucleotide sequences and the nucleotide sequence of the gyrA gene of strain JCK-1398 were aligned using the BioEdit Sequence Alignment Editor; phylogenetic analysis was carried out based on the neighbor joining (NJ) algorithm using the Mega Program (version 6.0) with the number of bootstrap resampling trials set to 1000. The results are shown in Figure 2. I bb / n / 77n7 / q / YILI TABLE 5 SEQ ID NO Name Sequence (5 -> 3 ) 33 Sequence of gyrA of strain JCK1398 of Bacillus subtilis GATGTTTGTAGAGCAGTTTGTTTGTACAGATTGTTTAAGATGA CATTCGCATTGGCATCGCGTCTGATTTCATGACAATTCTCAT ACCTGTACGATCCGACTCATTCAGCCTAGCCATCC TATCTTTTTGTCCCTTACGAGATCAGCAATTTTCTCAATTAATT TCGCCTTTTATTTGGTAAGGTAACTCTGTAACGATAATTCT TTCTTTACCCGAAGATGTTTGTTCGATCAGCTTTTGCCCG GATCGTGATAGAGCCTCGGCCTGATTCGTATGCTTTCCGGAT ACCGCTGCCAGCCAGGCCGAGCCGAGCCGATTGCCGATT GTCCTGGAATGACTTCCATAAGCTCTGGAATGGTAATGTCCG GATTCTCACTGACAAGCAAGTACTCCGTCAATGATTTCTCCCA GCTGGTGCGGAGGAATGTTGTTGCCATACCTACCGCAATG CCGGCAGCACCGTTCACGAGCAGATTCGGGAACCTTGAAGG CATAACGACCGGAATGTTGTTGATTGTTGATTGAAGG GTAATCGATTGTGTCTTTTGTGATGTCACGAAGAATCTCCATT GAGATTTTAGACATTCTTGCTTCTGTATAACGCATGGCCGCC GCTGAGTCTGCGTCAACAGAACCGAAGTTTCCGTGACCGTC AACGAGCATATAACGGTAGTTGAAATCCTGAGCCATTCTGAC CATGGATTCATAGACCATGGTTGGTTGGCCGTC CCCGATAACTTCTCCAACGATACGCGCGGATTTTTAAGG CTTGTCACTTGTCATGCCTAAATCATTCATTGCATACAAAATC CGTCTATGAACTG As can be confirmed in Figure 2, strain JCK-1398 was identified as a strain of Badilus subtilis. Example 4: Control effect against pine wilt disease To evaluate the control effect of a crop of the Badllus subtilis JCK-1398 strain against pine wilt disease, a seedling trial was conducted using 3-4 year old Pinus densiflora seedlings (approximately 5.5 m in diameter and approximately 35-45 cm in height from the ground). 4-1. Preparation of the JCK-1398 strain culture The JCK-1398 strain, suspended in a 20% glycerol solution and stored in a freezer at -80 °C, was statically cultured in TSA at 30 °C for approximately 24 hours. TSB was then placed in a test tube, the opening of which was sealed with a cotton plug, and subsequently sterilized. A colony of the cultured JCK-1398 strain was scraped using a platinum loop and inoculated onto TSB. This culture was further cultured with shaking at 150 rpm and 30 °C under aerobic conditions for approximately 24 hours. The JCK-1398 culture was transferred to a 250 mL Erlenmeyer flask containing 50 mL of sterilized TSB until the optical density value was 1.0 at 600 nm in a UV spectrometer, resulting in a suspension. The culture was then agitated at 30°C and 150 rpm under aerobic conditions for about 24 hours. 4-2. Spraying of the JCK-1398 strain culture First, each pine tree was pre-treated with 5 ml of Tween 20 (250 pg / ml) and then dried for 2 hours to allow the JCK1398 strain culture to adsorb well onto the leaves. Subsequently, the JCK-1398 strain culture obtained in Experimental Example 4-1 was diluted in an aqueous solution containing Tween 20 (250 pg / ml) to an optical density of 0.8. The resulting solution was placed in a fine sprayer, and each pine tree was sprayed at leaf level with 5 ml of the solution. 4-3. Culture of Bursaphelenchus xylophilus Botrytis cinerea, a food source for Bursaphelenchus xylophilus, was inoculated onto potato dextrose agar (PDA) and incubated statically for 7 days at 25°C. Bursaphelenchus xylophilus (National Institute of Forest Sciences) was inoculated into the cultured Botrytis cinerea, followed by an incubation statically for 7 days at 25°C. The cultured Bursaphelenchus xylophilus was collected using the Baermann funnel method and then adjusted to 20,000 nematodes / ml by observing the number of nematodes under a light microscope. 4-4. Control effect against pine wilt disease Approximately 1 cm of a woody portion of the pine trees, which had been previously treated with the JCK-1398 strain culture in Experimental Example 4-2 by foliar spraying, was cut into the deep endothelial area using a sterilized knife. Sterilized cotton 0.5 cm wide and 1 cm long was then inserted into the cut site, and inoculation was carried out with isolated Bursaphelenchus xylophilus at a rate of 2000 nematodes in 100 plants (inoculation 1 week after treatment with a chemical, such as the JCK-1398 strain culture). The inoculated site was then sealed with Parafilm to prevent drying (bark stripping inoculation method). The degree of wilting was observed 45 days after inoculation with Bursaphelenchus xylophilus and the results are shown in Figures 3A and 3B, as well as in Table 6. I bb / n / 77n7 / 3 / YILI TABLE 6 Time after inoculation 0 Days 34 Days 39 Days 42 Days 45 Days 50 Days Disease severity (%) JCK-1398 0 4 6 8 16 24 No treatment 0 24 26 54 78 84 As can be confirmed in Figures 3A to 3B and Table 6, the JCK1398 strain culture exhibited a disease severity as reduced as 24% against pine wilt disease in Pinus densiflora seedlings and a control value of 71.4% compared to an untreated group. Example 5: Evaluation of nematicidal activity in vitro 5-1. Obtaining the culture filtrate of the JCK-1398 strain and nematodes to be controlled The JCK-1398 strain was cultured using the same method as in Example 4-1 and then centrifuged at 13,000 rpm for 30 minutes using a centrifuge, whereby a culture filtrate was collected. The culture filtrate was subjected to bacterial irradiation using a sterile 0.2 µm microsyringe filter. As for Meloidogyne incognita, its eggs were obtained from tomato roots, which were artificially infected with Meloidogyne incognita in a greenhouse at Chonnam National University, Gwangju, Korea, and the larvae (second-instar larvae) that hatched from the eggs were separated using the Baermann funnel method and used for experimentation. Bursaphelenchus xylophilus was collected using the same method as in Example 4-3. 5-2. Obtaining the culture filtrate of the JCK-1398 strain and nematodes to be controlled A suspension of each nematode obtained in Example 5-1 was placed in each well of a 96-well microplate, and each well was then treated with the culture filtrate of strain JCK-1398 at a concentration of 0.625 to 20%, resulting in a final well volume of 100 µL. After sample treatment, the 96-well plate was shaken for 30 seconds and stored at room temperature in a plastic case at 100% relative humidity. 72 hours after sample treatment, the nematicide percentages were determined using the following equation under an inverted optical microscope. Each experiment was repeated in triplicate, and the results are shown in Table 7. Equation Nematicide percentage (%) = ((mortality percentage of the treated group - mortality percentage of the control group) / (100 - mortality percentage of the control group)) X 100 7. i bb / n / zznz / q / υιλι TABLE 7 Nematode Control value 20% 10% 5% 2.5% 1.25% 0.625% Meloidogyne incognita 97.45 13.15 - - - - Bursaphelenchus xylophilus - - - - - - As can be seen in Table 7 above, Meloidogyne incognita exhibited a nematicidal activity of 97.45% in the group treated with a 20% culture filtrate and a nematicidal activity of 13.15% in the group treated with a 10% culture filtrate, although it did not exhibit nematicidal activity at concentrations below 5%. Bursaphelenchus xylophilus did not exhibit nematicidal activity in any treated group, indicating that the control effect of Bacillus subtilis JCK-1398 against pine wilt disease was due to induced resistance, but not to direct nematicidal activity. Example 6: Induced resistance trigger showing a control effect against pine wilt disease Based on the results of Example 5, the presence of induced resistance triggers (a culture, a culture filtrate, and a cell fraction) exhibiting the control effect of the Bacillus subtilis strain JCK-1398 against pine wilt disease was evaluated. The JCK-1398 strain was cultured using the same method as in Example 4-1 and adjusted to an optical density value of 0.8. The JCK-1398 strain culture was separated into a culture filtrate and a cell fraction by centrifugation (1300 rpm, 15 min). The precipitated cell fraction was resuspended by adding the same volume of phosphate-buffered saline as used before centrifugation. Each pine tree was pre-treated with 5 ml of Tween 20 (250 pg / ml) and then dried for 2 hours to allow each sample (culture, culture filtrate, and cell fraction) to adsorb well onto the leaves. The culture, culture filtrate, and cell fraction were then dissolved in an aqueous solution containing Tween 20 (250 pg / ml) to an optical density of 0.8. These solutions were then placed in a fine sprayer, and each pine tree was sprayed at the foliar level with 5 ml of each sample.The nematicide emamectin benzoate, as a control group, was dissolved in an aqueous solution containing 10% methanol at 20 mg / ml, followed by trunk injection. The results are shown in Figures 4A and 4B, as well as in Table 8. TABLE 8 7. i bb / n / zznz / q / υιλι Treated group Culture Culture filtrate Cell fraction EB Control value (%) 61.7 64.2 42.0 97.0 As can be confirmed in Figures 4A and 4B and in Table 8, the culture and culture filtrate of the JCK-1398 strain exhibited control effects of 61.7% and 64.2%, respectively, although its cell fraction exhibited a slightly low control effect of 42%. These results indicate that the control effect of the JCK-1398 strain against pine wilt disease was due to extracellular secretions. Example 7: Optimal treatment time for the control effect against pine wilt Based on the results of Example 6, the optimal treatment time was evaluated using an in vivo assay of the Bacillus subtilis strain JCK-1398 against pine wilt disease. The in vivo assay was conducted using 3-4 year old Pinus densiflora seedlings (approximately 5.5 m in diameter and approximately 35-45 cm in height from the ground). The JCK-1398 strain was cultured using the same method as in Example 4-1 and adjusted to an optical density of 0.8. Each pine tree was then sprayed at the foliar level with 5 ml of the culture. The culture treatment was performed in duplicate at different times: 2 weeks and 1 week before, 3 weeks and 1 week before, and 4 weeks and 1 week before inoculation with Bursaphelenchus xylophilus. Inoculation with Bursaphelenchus xylophilus was performed 7 days after the second culture treatment using the same method as in Example 4-4. Finally, the degree of wilting was observed 60 days after inoculation with Bursaphelenchus xylophilus, and the results are shown in Figures 5A and 5C, as well as in Tables 9 and 10. I bb / Ω / 77Ω7 / 3 / YILI TABLE 9 Time after inoculation 0 Days 30 Days 35 Days 46 Days 49 Days 54 Days 57 Days 60 Days Disease severity (%) 2 weeks before -1 week before 0 16 29 30 32 40 40 40 3 weeks before -1 week before 0 14 20 28 28 58 70 78 4 weeks before -1 week before 0 10 14 26 28 48 58 60 No treatment group 0 32 46 58 68 84 88 98 TABLE 10 Group with treatment 2 weeks before 1 week before 3 weeks before -1 week before 4 weeks before -1 week before Control value (%) 592 20 4 38 8 As can be confirmed in Figures 5A to 5C and Tables 9 and 10, the severity of pine wilt disease remained at similar levels regardless of treatment time up to 49 days after inoculation. Subsequently, disease severity changed significantly depending on the treatment time (Figure 5A). Consequently, the treatment 2 weeks before to 1 week before inoculation (59.2%) exhibited an excellent control effect compared to the treatment 3 weeks before to 1 week before inoculation (20.4%) and the treatment 4 weeks before to 1 week before inoculation (38.8%). Example 8: Optimal treatment concentration for the control effect against pine wilt disease Based on the results of Example 7, the optimal treatment concentration was evaluated using an in vivo assay of a spray-dried powder of the Bacillus subtilis strain JCK-1398 against pine wilt disease. The in vivo assay was performed using 3-4 year old Pinus densiflora seedlings. Specifically, a spray-dried powder of strain JCK-1398 was prepared using the method in Table 11 in 50x, 500x, and 5000x dilute solutions using sterilized water. Each pine tree was then sprayed at the foliar level with each dilute solution in duplicate at 7-day intervals using the same method as in Example 4-2. Finally, inoculation with Bursaphelenchus xylophilus was performed 7 days after the second dilute treatment using the same method as in Example 4-4. The degree of wilting was observed 55 days after inoculation with Bursaphelenchus xylophilus, and the results are shown in Figure 6 and Table 12. TABLE 11 Lbb7 Ω / 77Ω7 / 3 / YILI Spray Drying JCK-1398 Inlet and Outlet Temperatures 190-198°C / 90-98°C Atomization Speed 10,000 rpm Carrier Culture 70 L Spray Dried Powder 11 kg CC 2.4 x 10⁹ CFU / g CFU (x50) 4.8 x 10⁷ CFU / g TABLE 12 Treatment group: 50x diluted solution, 500x diluted solution, 5000x diluted solution. Control value (%): 85.5, 60.5, 69.8 As can be confirmed in Figure 6 and Table 12, the 50 times dilute solution (85.5%) of the spray-dried powder of the JCK-1398 strain exhibited an excellent control effect compared to the 500 times dilute solution (60.47%) and the 5000 times dilute solution (69.77%). Example 9: Control effect against pine wilt disease Based on the previous results, a field trial was further conducted using 15-year-old adult Pinus densiflora trees (root diameter: 8–11 cm, height: 6–8 m) to evaluate the control effect of the Bacillus subtilis strain JCK-1398 against pine wilt disease in mature trees. The field trial was conducted in duplicate in 2018 (first field trial) and 2019 (second field trial). In the first field trial, a spray-dried powder of a JCK-1398 strain culture (prepared using the same method as in Example 8) was used, and in the second field trial, a spray-dried powder of a JCK-1398 strain culture was formulated in a JCK-1398 emulsion (20% CS) prior to use. The formulation of JCK-1398 (20% CS) was formulated with a composition of a spray-dried powder of JCK-1398 (20.0%), CR-NF 135B (4.5%), xanthan gum (0.03%), an antifoam (0.1%) and water (75.37%).Spray-dried powder from the JCK-1398 strain culture and the JCK-1398 formulation (20% CS) were diluted 50-fold and 2000-fold, respectively, in an aqueous solution containing 250 pg / ml of Tween 20. These solutions were then placed in a sprayer, and each pine tree was sprayed foliarly with approximately 1 L of each diluted solution. The foliar spray treatment was performed twice, one month apart. One week after each second treatment, each pine tree was inoculated by trunk injection with 20,000 Bursaphelenchus xylophilus nematodes in the first field trial and 10,000 nematodes in the second. For a control group, A-Pharm (emamectin benzoate 2.15%, emulsion, Syngenta) was applied at 1 ml per diameter by trunk injection, and A-Pharm was applied once 1 week prior to inoculation with Bursaphelenchus xylophilus.The untreated group was treated with only 250 pg / ml of Tween 20 without chemical agents in the same manner. The results are shown in Figures 7A to 7C and in Tables 13 and 14. 7. i bb / n / zznz / q / υιλι TABLE 13 Time after inoculation 1 Month 2 Months 3 Months 4 Months 5 Months 6 Months Disease severity (%) JCK-1398 0 0.5 12 25 20 25 EB 0 1 2.5 7.5 7.5 10 Untreated group 0 16 48.5 72.5 72.5 72.5 TABLE 14 Group with treatment 2018 Field Trial 2018 Field Trial Spray-dried powder JCK1398 EB JCK-1398 formulation 20% CS EB Control value (%) 65.5 86.2 68.8 75 As can be confirmed in Figures 7A to 7C and Tables 13 and 14, the 50-fold dilute solution of spray-dried powder of strain JCK-1398 (JCK-1398) and of the JCK-1398 formulation (20% CS) exhibited control effects of 65.5% and 68.8%, respectively, compared to the untreated group. The reproducibility of the control effect of strain JCK-1398 against pine wilt disease was confirmed through two field trials. Example 10: Synergistic effect of pine wilt control using combined agents Based on the results of the examples, an additional field trial was conducted using 15-year-old adult Pinus densiflora trees (root diameter: 8-11 cm, height: 6-8 m) to evaluate the control effect of the combined agents of the Bacillus subtilis strain JCK-1398 with the induced resistance triggers acibenzolar-S-methyl (ASM) and methyl salicylate (MeSA) against pine wilt disease in adult trees. A formulation of JCK-1398 (20% CS), an ASM (5% CS) formulation, and a MeSA (20% EC-LV) agent were prepared to a 2000-fold dilution, 0.1 mM, and 0.5 mM, respectively. A combination agent of JCK-1398 (20% CS) + ASM (5% CS) and a combination agent of JCK-1398 (20% CS) + MeSA (20% EC-LV) were prepared so that their final concentrations included half the concentration of each individual agent in the treated groups. Each sample was placed in a sprayer, and each pine tree was treated with 1 L of each sample in duplicate at a 1-month interval. One week after the second treatment, inoculation with 10,000 Bursaphelenchus xylophilus nematodes was performed by trunk injection. For a control group, A-Pharm (emamectin benzoate 2.15%, emulsion, Syngenta) was applied at 1 ml per diameter by trunk injection, and A-Pharm was applied once 1 week after inoculation with Bursaphelenchus xylophilus.The untreated group was treated with only 250 pg / ml of Tween 20 without chemical agents in the same manner. The results are shown in Figure 8 and Table 15. I bb / n / 77n7 / 3 / YILI TABLE 15 Group with treatment ASM 5% CS MeSA 20% EC-LV JCK1398 20% CS ASM 5% CS + JCK-1398 20% CS MeSA 20% ECLV + JCK-1398 20% CS EB 2.15% CE Control value (%) 27.3 33.9 23.1 46.2 53.8 61.5 As can be confirmed in Figure 8 and Table 15, the JCK-1398 (20% CS), ASM (5% CS), and MeSA (20% EC-LV) formulations exhibited control effects of 23.1%, 27.3%, and 33.9%, respectively, compared to a no-treatment group. However, the combination agent JCK-1398 (20% CS) + ASM (5% CS) and the combination agent JCK-1398 (20% CS) + MeSA (20% EC-LV) exhibited synergistic control effects of 46.2% and 53.8%, respectively, compared to the no-treatment group. Therefore, it was confirmed that the Bacillus subtilis strain JCK-1398 can control pine wilt disease more effectively through a synergistic effect when applied together with the induced resistance triggers ASM and MeSA. Example 11: Preparation of aerial spray formulations and their control effects against pine wilt disease To evaluate the control effects of the Bacillus subtilis strain JCK-1398 against pine wilt disease via aerial spraying on mature trees, a novel formulation was prepared. The JCK-1398 (10% CS) formulation consisted of a spray-dried powder of JCK-1398 (10.0%), CR-NF 135B (3.0%), xanthan gum (0.01%), an antifoaming agent (0.1%), propylene glycol (5.0%), sodium benzoate (0.2%), and water (81.69%). The JCK-1398 (10% CS) and JCK-1398 (20% CS) formulations (existing formulation, Example 9) were prepared in 10-fold, 100-fold, and 500-fold dilute solutions. Each 3-year-old pine tree was sprayed foliarly with 100 µL (1 / 50 of the existing treatment amount) of each of the two-fold dilute solutions at intervals of 7 days, 2 weeks, and 1 week prior to inoculation. Finally, inoculation with Bursaphelenchus xylophilus was carried out 7 days after the second treatment with the dilute solution using the same method as in Example 4-4, and the degree of wilting was determined 40 days after inoculation with Bursaphelenchus xylophilus. The results are shown in Figure 9 and Table 16. I bb / n / 77n7 / q / YILI TABLE 16 Group with treatment JCK-1398 20% CS JCK-1398 10% CS EB 10x diluted solution 100x diluted solution 500x diluted solution 10x diluted solution 100x diluted solution 500x diluted solution Control value (%) 51.7 58.6 79.3 87.9 79.3 86.2 100.0 As can be confirmed in Figure 9 and Table 16, compared to the JCK-1398 (20% CS) formulation, the JCK-1398 (10% CS) formulation exhibited stable control effects at all concentrations: 10x dilute (87.9%), 100x dilute (79.3%), and 500x dilute (86.2%). Therefore, the JCK-1398 (10% CS) formulation was selected as the final formulation for subsequent aerial spraying. Example 12: Evaluation of the practical application of the JCK-1398 (10% CS) formulation for aerial spraying for the control of Bursaphelenchus xylophilus Based on the results, a field trial was conducted using 30-year-old Pinus densiflora to evaluate the control effect of JCK-1398 (10% CS) for aerial spraying against pine wilt disease in mature trees. After a 50-fold dilute solution of the JCK-1398 formulation (10% CS) was prepared, 3.6 L (80 L / 1 ha) of the dilute solution was sprayed aerially in the Jinju Experimental Forest (450 m²) using an unmanned aerial vehicle or unmanned helicopter. The aerial spraying treatment was carried out three times: 2 months before, 1 month before, and 1 month after inoculation with Bursaphelenchus xylophilus. One week after the second treatment, each pine tree was inoculated with 20,000 Bursaphelenchus xylophilus grubs using the same method as in Example 9. The results are shown in Figures 10A and 10B, as well as in Table 17. TABLE 17 Treatment Group Disease Severity (%) 0 Months later 1 Month later 2 Months later 3 Months later 4 Months later 6 Months later JCK-1398 10% CS 0.0 0.0 0.0 3.3 3.3 20.0 Untreated Group 0.0 0.0 0.0 20.0 23.3 73.3 I bb / Ω / 77Ω7 / 3 / YILI As can be confirmed in Figures 10A and 10B, as well as in Table 17, the JCK-1398 10% CS (20.0%) formulation exhibited a significantly reduced severity compared to the untreated group (73.3%) 6 months after inoculation with Bursaphelenchus xylophilus. That is, the JCK-1398 (10% CS) formulation was confirmed to have a 72.7% control effect and, therefore, can also control pine wilt disease very effectively in the field, as in the seedling trial. Example 13: Control effects against various plant diseases Based on the resistance-inducing effect of the JCK-1398 strain of Bacillus subtilis, the control effects against various plant diseases were evaluated using a spray-dried powder of a culture of the JCK-1398 strain for expanded application experiments. 13-1. Control effect against bacterial spot (pathogen: Xanthomonas euvesicatoria) To 500x and 5000x dilute solutions of a spray-dried powder of strain JCK-1398 prepared by the same method as in Example 8, the surfactant Tween 20 (250 pg / ml) was added, and chili plants at the 8- to 9-leaf stage (Hungnong seeds, Bultap chili) were then treated with the resulting solutions at 20 ml per well by soil irrigation and foliar spraying. Each sample was applied 4 days before inoculation with Xanthomonas euvesicatoria. As for a control group, the synthetic agrochemical pesticides sungbocycline wettable powder (oxytetracycline, SUNGBO Chemicals) and ilpum wettable powder (oxolinic acid 20% WP, Dongbang Agro) were applied in a predetermined amount (1000 times diluted solution) and as for an untreated group, only Tween 20 (250 pg / ml) was applied in the same way without chemical agents. Next, Xanthomonas euvesicatoria was subjected to static culture in TSA at 30 °C for approximately 48 hours, and the cells were subsequently collected using 2 mL of sterile water. The inoculum was prepared by diluting the collected Xanthomonas euvesicatoria samples to an optical density of 0.1 at 600 nm using a UV spectrometer. Each seedling was sprayed at the foliar level with 5 mL of the inoculum. The inoculated seedlings were placed in a growth chamber maintained at 25 ± 2 °C and 95% humidity for 3 days. Disease severity was then assessed with continuous irrigation and foliar spraying. The results are shown in Figure 11 and Table 18. Each treatment was repeated in triplicate, and each experiment was repeated in duplicate. Disease severity was determined using an index of 0 to 6 (Abbasi), and thus the severity of the bacterial spot formed on the chili leaves was assessed. The criteria for the disease severity index were as follows: = No disease = 1-2 small spots on 1-2 leaves = Several spots on several leaves = Many spots clustered on the leaf = Many spots clustered on many leaves = Severe disease and defoliation = Plant death I bb / n / 77n7 / q / YILI TABLE 18 Group with treatment JCK-1398 X500 JCK-1398 X5000 Oxolinic acid Oxytetracycline Foliar spray Soil irrigation Foliar spray Soil irrigation Foliar spray Soil irrigation Control value (%) 20.8 37.5 31.3 52.1 27.1 20.8 As can be seen in Figure 11 and Table 18, the 5000x diluted solution of the spray-dried powder of the Bacillus subtilis strain JCK-1398 exhibited a 52.1% control effect for soil irrigation and a 31.3% control effect for foliar spray. Furthermore, the 500x diluted solution exhibited a 37.5% control effect for soil irrigation and a 20.8% control effect for foliar spray. Therefore, treating chili plants with cultures of the JCK-1398 strain is expected to be effective in controlling bacterial spot by inducing resistance. 13-2. Control effect against dollar spot (pathogen: Sclerotinia homoeocarpa) Regarding the dilute solutions of a JCK-1398 culture, the JCK-1398 strain was cultured using the same method as in Example 4-1. A solution obtained by diluting the culture to an optical density of 0.08 at 600 nm using a UV spectrometer was then used as a 100-fold dilute solution, and a solution obtained by diluting the culture to an optical density of 0.008 was used as a 1000-fold dilute solution. The JCK-1398 (20% CS) formulation was prepared using dilute solutions of a JCK-1398 culture obtained by 100-fold and 1000-fold dilution with sterile water. For the untreated group, a solution obtained by adding Tween20 at 250 pg / ml was used, and for the control group, Tebuconazole (25% EC) (Horikuo emulsion) was used in a predetermined amount (solution diluted 2000 times) and half of it (solution diluted 4000 times). Each sample was treated by applying a soil irrigation solution 4 days prior to inoculation with Sclerotinia homoeocarpa inoculum. The solutions were diluted 100 times and 1000 times from the JCK culture. JCK-1398 cultures were applied as single agents or in combination with a 4000x dilute solution of tebuconazole (25% EC). 100x and 1000x dilute solutions of JCK-1398 culture (20% CS) were applied as single agents or in combination with a 4000x dilute solution of tebuconazole (25% EC). Next, Sclerotinia homoeocarpa flora was extracted as an agar plug measuring 2 x 2 mm, inoculated onto PDA medium, and then incubated at 25°C for 5 days. Flora from the strain grown on hull-bran medium (9 g bran, 1.5 g rice hulls, and 10 mL distilled water) was double-sterilized to a size of 1 x 1 cm, with 5 units subsequently transplanted. The inlet was then blocked with a single Bio-Sili plug, and the culture was incubated at 25°C for 7 days. The cultured cells and medium were then placed in a grinder, and 110 mL of streptomycin sulfate (200 pg / mL) was added, followed by further grinding. Finally, the planting holes in creeping grass, cultivated for approximately one month after sowing, were perforated to form a hole approximately 1 cm in diameter in their centers. Inoculation was then carried out with the crushed inoculum at 3.3 ml per hole. The inoculated grass was maintained at 95% humidity and 25 °C until a difference was observed between an untreated and a treated group. Disease severity was calculated by examining the affected area compared to the total area of the hole. Experiments were performed on three holes twice per treated group. The results are shown in Figure 12 and Table 19. I bb / n / 77n7 / 3 / YILI TABLE 19 Treatment Group Control Value (%) JCK-1398 Culture X100 Single Agent 16.16 Combination Agent 97.26 JCK-1398 Culture X1000 Single Agent 0.00 Combination Agent 26.03 JCK-1398 20% CS X100 Single Agent 2.19 Combination Agent 84.93 JCK-1398 20% CS X1000 Single Agent 34.25 Combination Agent 73.97 Tebuconazole 25% CE X2000 Single Agent 78.08 Tebuconazole 25% CE X4000 Single Agent 41.10 As can be confirmed in Figure 12 and Table 19, treatment with JCK-1398 cultures (100 times diluted solution and 1000 times diluted solution) and JCK-1398 (20% CS) (100 times diluted solution) as individual agents, exhibited a disease severity similar to that of an untreated group. However, treatment with the combination agent of JCK-1398 culture (100x diluted solution) and the 4000x diluted solution of Tebuconazole 25% EC showed a control effect as high as 97.26%, and treatment with the combination agents of JCK-1398 20% CS (100x diluted solution and 1000x diluted solution) and the 4000x diluted solution of Tebuconazole 25% EC showed control effects of 84.93% and 73.97%, respectively, indicating a dose-dependent control effect.Therefore, it is expected that the JCK-1398 strain crops of the present invention will significantly reduce the amount of agrochemical treatment used in the control of dollar spot. 13-3. Control effect against Aculops lycopersici (pest) The JCK-1398 (20% CS) formulation was prepared using diluted solutions of a JCK-1398 culture obtained by 250x, 500x, and 1000x dilution with sterile water. For the untreated group, a solution obtained by adding Tween-20 at 250 pg / ml was used, and for the control group, a predetermined amount of Sunchungtan liquid (fostiazate 30% LS, FarmHannong) was used (4000x diluted solution). The treatment with each sample was carried out on Lycopersicon esculentum Mili at the 4- to 5-leaf stage at a rate of 20 ml per tree via soil irrigation. JCK-1398 (20% CS) was applied twice at a 3-day interval, and Sunchungtan was applied once. Aculops lycopersici was then naturally generated by maintaining appropriate temperature and humidity (25–28 °C, 30%). Aculops lycopersici emerged 2 weeks after the second chemical treatment. After 2 weeks of Aculops lycopersici generation, the shoot length was measured to assess the control effect against Aculops lycopersici. The results are shown in Figure 13 and Table 20. I bb 7 Ω / 77Ω7 / 3 / YILI TABLE 20 Group treated with JCK-1398 20% CS Fosthiazate 30% SL Group not treated with X250 X500 X1000 X4000 Length (cm) 26.13 21.75 15.88 32.00 16.83 As can be seen in Figure 13 and Table 20, the groups treated with 250x, 500x, and 1000x diluted solutions of JCK-1398 (20% CS) exhibited shoot lengths of 26.13 cm, 21.75 cm, and 15.88 cm, respectively, indicating that higher concentrations resulted in larger shoot lengths. The 4000x diluted solution of fosthiazate 30% LS, used as the control group, exhibited the greatest shoot length at 32 cm, while the untreated group exhibited the shortest at 16.83 cm. Therefore, treating tomato trees with JCK-1398 strain cultures is expected to be effective in controlling Aculops lycopersici by inducing resistance. Industrial applicability The present invention relates to a strain of Bacillus subtilis JCK-1398 that induces resistance in pines and various plants, as well as to a composition and a method for controlling plant diseases by using it. Registration number Name of the depository institution: Korean Collection of Type Cultures Registration number: KCTC14084BP Deposit date: 20191219
Claims
CLAIMS 1. A strain of Bacillus subtilis JCK-1398 (registration number KCTC 14084BP) that activates induced resistance against diseases and pests in a plant.
2. The strain according to claim 1, wherein the strain includes the gyrA nucleotide sequence of SEQ ID NO:
33.
3. The strain according to claim 1, wherein the strain exhibits a control effect against at least one plant pest or disease selected from the group consisting of pine wilt disease, bacterial spot, dollar spot, and Aculops lycopersici.
4. A pesticide or antibiotic composition containing at least one component selected from the group consisting of a strain according to any one of claims 1 to 3, a culture of the strain, a concentrate of the culture, a dried product of the culture, and a culture supernatant of the strain.
5. The composition according to claim 4, wherein the composition exhibits pesticidal activity against at least one of the organisms selected from the group consisting of Bursaphelenchus xylophilus and Aculops lycopersici.
6. The composition according to claim 4, wherein the composition exhibits antibacterial activity against at least one organism selected from the group consisting of Xanthomonas euvesicatoria and Sclerotinia homoeocarpa.
7. A composition for controlling a plant pest or disease; the composition contains at least one component selected from the group consisting of the strain according to any of claims 1 to 3, a culture of the strain, a concentrate of the culture, a dried product of the culture, and a supernatant of the strain culture.
8. The composition according to claim 7, wherein the plant pest or disease is selected from the group consisting of pine wilt disease, bacterial spot, dollar spot and Aculops lycopersici.
9. The composition according to claim 7, wherein the composition is used as a combining agent with a synthetic agrochemical.
10. The composition according to claim 8, wherein the synthetic agrochemical is tebuconazole.