VARIANT OF THE GENUS YARROWIA AND PROCEDURE FOR PREPARING FAT BY USING THE SAME

Abstract

A variant strain of the genus Yarrowia is provided. More specifically, a variant strain of the genus Yarrowia is provided in which the activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated, and a procedure for increasing a fat in the strain, including culturing the strain, or a procedure for preparing a fat.

Description

VARIANT OF THE GENUS YARROWIA AND PROCEDURE FOR PREPARING FAT BY USING THE SAME TECHNICAL FIELD OF THE INVENTION This disclosure relates to the improvement of yeasts for enhancing fat content and a method for preparing the same, and in particular to a variant strain of the genus Yarrowia in which the activity of phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated and fat content is therefore enhanced, and to a method for increasing fat content in the strain by culturing the variant strain of the genus Yarrowia in a medium containing choline. BACKGROUND OF THE INVENTION Oleaginous yeasts that produce fatty acid derivatives, such as free fatty acids, fatty alcohols, fatty acid ethyl esters, alkanes, etc., have received attention in various fields, including energy, cosmetics, food, and animal feed, and numerous related studies have been conducted. Among these, triacylglycerol (TAG), a precursor of fatty acid derivatives and a form of fat available for long-term storage, has been studied for the synthesis of large quantities. As a procedure for improving TAG content in oilseed yeasts, strategies to enhance TAG biosynthetic pathways (e.g., dga1-2, slc1, acl12, acc1, sct1, Iro1), inhibit TAG degradation (e.g., tgl1-4, faa1, pxa1-2), and inhibit beta-oxidation (e.g., pox1-6, mfe1, pex1-32, pot1) are primarily used by many researchers (U.S. patent application publication N.s2013-0344548 A1). In recent years, various strategies have been attempted to improve fat content in yeast, but no significant increase has been achieved. Therefore, there is a demand for an alternative to improve fat production while preventing impairment of yeast growth. qz LRnn / zznz / E / γΐΛΐ BRIEF DESCRIPTION OF THE INVENTION Technical problem The present inventors found that fat production can be increased by a variant strain in which the activity of phosphatidylethanolamine N-methyltransferase or phospholipid methyltransferase is inactivated, thereby completing the present disclosure. Technical solution One object of the present disclosure is to provide a variant strain of the genus Yarrowia, in which the activity of phosphatidylethanolamine / V-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated. Another object of this disclosure is to provide a cosmetic composition, a food composition, a feed composition, or a medical composition, each including at least one of the variant strain of the genus Yarrowia, a culture of the strain, an extract of the strain, a dried product of the strain, a used portion of the strain, and a fat recovered from at least one of the strain, the culture, the extract, the dried product, and the lysate. Yet another object of the present disclosure is to provide a procedure for increasing a fat in a strain, which includes: cultivating the variant strain of the genus Yarrowia. Yet another object of the present disclosure is to provide a procedure for preparing a fat, the procedure which includes: cultivating the variant strain of the genus Yarrowia. Yet another object of the present disclosure is to provide a use of the variant strain of the genus Yarrowia, the culture of the strain, the extract of the strain, the dried product of the strain, the lysate of the strain, the cosmetic composition, the food composition, the feed composition, the medical composition, or the cultivation of the variant strain of the genus Yarrowia in fat production. Advantageous effects The varant strain of the genus Yarrowia in this disclosure can increase intracellular fat production by inactivating phosphatidylethanolamine N-methyltransferase (PEMT) or phospholipid methyltransferase activity. A procedure for increasing a fat in the strain and a procedure for preparing a fat of the present disclosure can effectively increase fat production while preventing impairment of strain growth at the same time. A cosmetic composition, a food composition, a feed composition, and a medical composition of the present disclosure may provide enhanced functionality by increasing a fat content. BEST WAY TO DO IT This disclosure is described in detail below. Furthermore, each description and embodiment disclosed in this disclosure may also apply to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this disclosure are included within the scope of this disclosure. Additionally, the scope of this disclosure is not limited by the specific description provided below. In addition, those skilled in the art will recognize or be able to determine, using nothing but routine experimentation, many equivalents of the specific embodiments described in this disclosure. Furthermore, these equivalents should be considered as included in this disclosure. To achieve the above objectives, one aspect of this disclosure provides a variant strain of the genus Yarrowia, in which the activity of phosphatidylethanolamine N-methyltransferase or phospholipid methyltransferase is inactivated. As used in the present invention, phosphatidylethanolamine A / V-methyltransferase (PEMT) is a transferase enzyme that converts phosphatidylethanolamine (PE) to phosphatidylcholine (PC). The phosphatidylcholine produced via PEMT can be used in choline synthesis, membrane structure, and very low-density lipoprotein (VLDL) secretion to play a wide range of physiological roles. In the present disclosure, phosphatidylethanolamine A / V-methyltransferase may be used interchangeably with PEMT. In the present disclosure, phosphatidylethanolamine A / V-methyltransferase may be encoded by the cho2 gene. As used in the present invention, phospholipid methyltransferase is an enzyme that catalyzes a methylation reaction of phosphatidylethanolamine (PE) and may play a role in the synthesis of phosphatidylcholine (PC). In the present disclosure, phospholipid methyltransferase may be encoded by the opi3 gene. The inactivation of phosphatidylethanolamine / V-methyltransferase or phospholipid methyltransferase activity in this disclosure means the inactivation of the activity of one of the two enzymes or the inactivation of a combination of these. With respect to the objects of this disclosure, the variant strain of the genus Yarrowia, in which the activity of one of the two enzymes is inactivated or the activities of both are inactivated, may have increased fat content in the strain, in comparison with the wild type, although it is not limited to the above. The sequences of phosphatidylethanolamine / V-methyltransferase or phospholipid methyltransferase can be obtained from a public database, and examples of public databases may include NCBI's GenBank, etc. For example, it may be phosphatidylethanolamine / V-methyltransferase and / or phospholipid methyltransferase derived from the genus Yarrowia (Yarrowia sp.), and specifically, phosphatidylethanolamine / V-methyltransferase may include an amino acid sequence from SEQ ID NO: 2 and phospholipid methyltransferase may include an amino acid sequence from SEQ ID NO: 12, although it is not limited to the above.The polypeptide that includes the amino acid sequence of SEQ ID NO: 2 may be used interchangeably with a polypeptide having the amino acid sequence of SEQ ID NO: 2 or a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, and the polypeptide that includes the amino acid sequence of SEQ ID NO: 12 may be used interchangeably with a polypeptide having the amino acid sequence of SEQ ID NO: 12 or a polypeptide consisting of the amino acid sequence of SEQ ID NO: 12. Additionally, any polypeptide sequence may be included, provided it has the same activity as the above amino acid sequence. Additionally, the polypeptide may include, but is not limited to, the amino acid sequence of SEQ ID NO: 2 of phosphatidylethanolamine / V-methyltransferase and / or the amino acid sequence of SEQ ID NO: 12 of phospholipid methyltransferase, or an amino acid sequence that has 30% or more homology or identity with them. Specifically, the polypeptide may include an amino acid sequence that has at least 30%, 60%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 2 of phosphatidylethanolamine / V-methyltransferase and / or SEQ ID NO: 12 of phospholipid methyltransferase.Additionally, it is obvious that any polypeptide having an amino acid sequence with a deletion, modification, substitution, or addition in part of the sequence may also be included within the scope of this disclosure, provided that the amino acid sequence has a homology or identity described above and shows corresponding effectiveness to that of the polypeptide. In other words, although described herein as a protein or polypeptide consisting of an amino acid sequence of a specific SEQ ID NO, it is obvious that any polypeptide having an amino acid sequence with a deletion, modification, substitution, or addition in part of the sequence may also be used herein, provided that the polypeptide can have identical or corresponding activity to that of a polypeptide consisting of the amino acid sequence of the corresponding SEQ ID NO. For example, it is obvious that any polypeptide can belong to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, provided that it has identical or corresponding activity to that of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2. In this disclosure, the genes encoding phosphatidylethanolamine N-methyltransferase and phospholipid methyltransferase may be the cho2 and opi3 genes, respectively. The polynucleotide sequences encoding the amino acids in this disclosure may be, but are not limited to, polynucleotide sequence(s) from SEQ ID NO: 1 and / or SEQ ID NO: 11 encoding phosphatidylethanolamine / V-methyltransferase and / or phospholipid methyltransferase. Additionally, the polynucleotide sequences may include any sequence without limitation, provided it has the same activity as the polynucleotide sequence. The cho2 gene may be a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2 and, more specifically, may be a sequence that includes the nucleotide sequence of SEQ ID NO: 1, but is not limited to this.The sequence including the nucleotide sequence of SEQ ID NO: 1 and the polynucleotide including the nucleotide sequence of SEQ ID NO: 1 can be used interchangeably with a polynucleotide having the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 and a gene consisting of the polynucleotide sequence of SEQ ID NO: 1. The opi3 gene may be a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 12 and, more specifically, may be a sequence including a nucleotide sequence of SEQ ID NO: 11, although it is not limited to the above. The sequence including the nucleotide sequence of SEQ ID NO: 11 and the polynucleotide including the nucleotide sequence of SEQ ID NO: 11 may be used interchangeably with a polynucleotide having the nucleotide sequence of SEQ ID NO: 11, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11, and a gene consisting of the polynucleotide sequence of SEQ ID NO: 11. As used in the present invention, the term polynucleotide, which refers to a long-chain polymer of nucleotides formed by the joining of nucleotide monomers through covalent bonds, has a meaning that collectively includes DNA or RNA molecules. Nucleotides, which are the basic structural units of polynucleotides, include not only natural nucleotides but also modified analogues of Q7 LRnn / ZZnZ / E / YIAI the same, in which the sugar or base residues are modified (see, Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)). The polynucleotide may include a polynucleotide encoding the phosphatidylethanolamine A / V-methyltransferase and / or phospholipid methyltransferase polypeptide of this disclosure or a polynucleotide sequence having at least 30%, 60%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with the phosphatidylethanolamine A / V-methyltransferase and / or phospholipid methyltransferase polypeptide of this disclosure. Additionally, it is obvious that any polynucleotide sequence with a deletion, modification, substitution, or addition to part of the sequence may also be included within the scope of this disclosure, provided that the polynucleotide sequence has this homology or identity and encodes the polypeptide. Additionally, it is apparent that, due to codon degeneracy, a polynucleotide that can be translated into a polypeptide that includes the amino acid sequences of SEQ ID NO: 2 and / or 12, or a polypeptide that includes an amino acid sequence that has 30% or more identity with SEQ ID NO: 2 and / or 12, or a polypeptide that has homology or identity with them, can also be included. Alternatively, a probe that can be prepared from a known gene sequence—for example, any polynucleotide sequence that hybridizes with a complementary sequence containing all or part of the polynucleotide sequence under rigorous conditions to encode a polypeptide that includes an amino acid sequence that has 30% or more identity with the amino acid sequence of SEQ ID NO: 2—can be included without limitation.Rigorous conditions refer to the conditions that allow specific hybridization between polynucleotides. Such conditions are specifically disclosed in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Coid Spring Harbor Laboratory Press, Coid Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., New York).For example, stringency conditions may include conditions in which genes have high homology or identity, genes that have 30% or more, 70% or more, 80% or more, specifically 85% or more, specifically 90% or more, more specifically 95% or more, much more specifically 97% or more, in particular specifically 99% or more of homology or identity, hybridize with each other, whereas genes that have lower homology or identity than the above homology or identity do not hybridize with each other; or they may include ordinary washout conditions of the qz LRnn / zznz / E / γΐΛΐ hybridization. Southern, i.e., washing once, specifically twice or three times, at a salt concentration and temperature corresponding to 60 °C, 1XSSC, 0.1% SDS, specifically 60 °C, 0.1XSSC, 0.1% SDS and more specifically 68 °C, 0.1XSSC, 0.1% SSD. Hybridization requires that two polynucleotides have complementary sequences, although base mismatches are possible depending on the rigor of the hybridization. The term complementary is used to describe a relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, this disclosure may also include an isolated polynucleotide fragment complementary to the full sequence, as well as a polynucleotide sequence substantially similar to it. Specifically, a polynucleotide exhibiting homology or identity can be detected using hybridization conditions that include a hybridization step at a Tm value of 55 °C under the conditions described above. Additionally, the Tm value can be 60 °C, 63 °C, or 65 °C, but it is not limited to these values ​​and can be appropriately controlled by experts in the technique depending on the intended purpose. The appropriate rigor for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, and these variables are well known in the technique (e.g., J. Sambrook et al., cited above). As used in the present invention, the term homology or identity refers to the degree of similarity between two given amino acid sequences or two given nucleotide sequences and can be expressed as a percentage. The terms homology and identity can often be used interchangeably. The homology or identity of conserved polynucleotide or polypeptide sequences can be determined using conventional alignment algorithms, which can be used in conjunction with a default gap penalty set by the software. Substantially, homologous or identical sequences are typically expected to hybridize with all, or at least approximately 50%, 60%, 70%, 80%, or 90% or more of the full sequence length under moderate or high-stricity conditions. Polynucleotides containing degenerate codons instead of codons in the hybridization polynucleotides are also considered. It can be determined whether any two polynucleotide or polypeptide sequences qz LRnn / zznz / E / γΐΛΐ have homology, similarity, or identity using a known computer algorithm, such as the FASTA program, using predetermined parameters as in Pearson et al., (1988) Proc. Nati. Acad. Sel. USA 85:2444. Alternatively, it can be determined by the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), which is performed using the Needleman program from the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or later) (GCG software package (Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF et al., J MOLEC BIOL 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994; and CARILLO et al. (1988) SIAM J Applied Math 48:1073).For example, homology, similarity, and identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information. The homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using, for example, the GAP computer program, as described by Needleman et al. (1970), J Mol Biol. 48:443, and reported in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In summary, the GAP program defines homology as the value obtained by dividing the number of similarly aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include (1) a one-to-one comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix (or EDNAFULL substitution matrix (NCBI NUC4.4 EMBOSS version)) of Gribskov et al. (1986). Acids Res. 14:6745, as disclosed in Schwartz and Dayhoff, eds.Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for trailing gaps. Accordingly, as used in the present invention, the term homology or identity refers to the relationship between sequences. The inactivation of polypeptide or protein activity described herein refers to a case where the polypeptide or protein is not expressed in any way, or a case where the polypeptide or protein is expressed but shows no activity or shows reduced activity, compared to a natural wild-type strain, a parental strain, or a strain in which the relevant polypeptide or protein is not present. Q7 LRnn / ZZnZ / E / YIAI modified. Inactivation or attenuation can be used interchangeably with the terms attenuation, negative regulation, decrease, reduction, etc. In this sense, inactivation is a concept that includes a case where the activity of a polypeptide itself is reduced or eliminated, compared to the activity of the polypeptide originally processed by a microorganism, due to a modification in the gene encoding the polypeptide, a modification in an expression regulatory sequence, deletion of part or all of the gene, etc.; a case where the level of total polypeptide activity within a cell is reduced, compared to the wild-type strain or the strain before the modification, due to inhibition of the expression of the gene encoding the polypeptide or inhibition of translation, etc.; a case where the gene is not expressed in any way; or a case where the gene is expressed but shows no activity; and a combination of these. In this disclosure, inactivation is not limited to that and can be achieved by applying various well-known procedures in the technique (Nakashima N. et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014; 15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.). Examples of these procedures include a procedure for deleting part or all of a gene encoding the polypeptide on a chromosome; a procedure for replacing the gene encoding the polypeptide on the chromosome with a gene modified to reduce enzyme activity; and a procedure for introducing a modification into a regulatory sequence of the gene encoding the polypeptide on the chromosome.a procedure for replacing the expression regulatory sequence of the gene encoding the polypeptide with a sequence having weak or no activity (e.g., a procedure for replacing a gene promoter with a promoter weaker than an endogenous promoter); a procedure for deleting part or all of a gene encoding the polypeptide on the chromosome; a procedure for introducing an antisense oligonucleotide (e.g., antisense RNA), which inhibits the translation of an mRNA into the protein or polypeptide through complementary binding to a transcript of the gene encoding the polypeptide on the chromosome; a procedure for making ribosome binding impossible by forming a secondary structure by artificially adding a sequence complementary to the SD sequence at the forward end of the SD sequence of the gene encoding the polypeptide;and a reverse transcription engineering (RTE) procedure, which adds a reverse transcription promoter to the 3' terminus of the open reading frame (ORF) of the polynucleotide sequence of the gene encoding the polypeptide; or a combination thereof, although not particularly limited to the foregoing. Q7 LRnn / ZZnZ / E / YIAI Specifically, the procedure for deleting part or all of the gene encoding the protein or polypeptide can be carried out by replacing the polynucleotide encoding the endogenous target protein within the chromosome with a polynucleotide or marker gene having a partially deleted nucleic acid sequence, using a vector for chromosomal insertion in microorganisms. For example, a procedure for deleting a gene by homologous recombination can be used, although the procedure is not limited to this. Additionally, the term "part," as used in the present invention, can refer specifically to 1 to 300 nucleotides, more specifically to 1 to 100 nucleotides, and more specifically to 1 to 50 nucleotides, although it may vary depending on the types of polynucleotides, and this can be appropriately determined by those skilled in the art. However, the part is not particularly limited to the foregoing. The procedure for suppressing part or all of a gene can be carried out by inducing a mutation using light, such as ultraviolet rays or chemicals, and selecting a strain, in which the target gene is deleted, from the resulting mutants. The gene suppression procedure also includes a process that uses DNA recombination technology. DNA recombination technology can be achieved, for example, by injecting a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene into the microorganism to induce homologous recombination. Furthermore, the injected nucleotide sequence or vector may include a dominant selection marker, although this is not the only possibility. Furthermore, a regulatory expression sequence can be modified by inducing a change in the sequence through deletion, insertion, conservative or non-conservative substitution, or a combination thereof, thereby further weakening the activity of the regulatory expression sequence, or by replacing the sequence with a nucleic acid sequence that has weaker activity. The regulatory expression sequence may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome-binding domain, and a sequence regulating transcription and translation termination. Likewise, the procedure of modifying the gene sequence on the chromosome can be carried out by inducing a modification in the sequence through deletion, insertion, conservative or non-conservative substitution, or a combination thereof, thereby further weakening the activity of the polypeptide; or by replacing the sequence with a Q7 LRnn / ZZnZ / E / YIAI The variant strain of the genus Yarrowia in this disclosure may be a strain of the genus Yarrowia in which the phosphatidylethanolamine / V-methyltransferase activity is inactivated, the phospholipid methyltransferase activity is inactivated, or the activities of phosphatidylethanolamine AZ-methyltransferase and phospholipid methyltransferase are inactivated. Additionally, it may be a strain of the genus Yarrowia, in which the cho2 gene encoding phosphatidylethanolamine A / -methyltransferase, the opi3 gene encoding phospholipid methyltransferase, or a combination thereof is deleted, although it is not limited to the above. Specifically, with respect to the subjects of this disclosure, the variant strain of the genus Yarrowia is not limited, provided that it is a variant strain in which the phosphatidylethanolamine / V-methyltransferase or phospholipid methyltransferase activity is inactivated and, therefore, the fat content in the strain is increased, compared to the wild type. As used in the present invention, the microorganism having the increased fat content, compared to the wild type, can be used interchangeably with a fat-producing microorganism, a microorganism having the ability to produce a fat, a microorganism for fat production, a microorganism having a triacylglycerol (TAG) production capacity, a microorganism having the ability to produce triacylglycerol (TAG), or a microorganism for the production of triacylglycerol (TAG). The variant strain of the genus Yarrowia may be a choline auxotrophic strain possessing choline auxotrophy. Choline is colorless and highly alkaline and is a component of phospholipids, acetylcholine, B vitamins, etc. It is synthesized from the choline synthesis pathway via serine and ethanolamine in living organisms and is also chemically synthesized from trimethylamine and ethylene oxide. With regard to the subject matter of this disclosure, when the strain, which is a choline auxotrophic strain, is grown in a medium containing choline, it is possible to recover the growth of the strain and at the same time, increase the fat content in the strain. As used in the present invention, the term fat, which is a type of lipid, is an ester in which three fatty acids are bonded to glycerol and is a representative organic substance. Living organisms contain fat, which can be used as a source of energy. Specifically, fat can be triacylglycerol (TAG), although it is not limited to this. Triacylglycerol (TAG), a type of fat, is a triglyceride with a structure in which three fatty acid molecules are linked to a glycerol molecule via ester bonds. To increase TAG content, strategies can be employed to enhance the TAG biosynthetic pathway, inhibit TAG degradation, or inhibit beta-oxidation. The term "fat" can be used interchangeably with TAG or triacylglycerol. Furthermore, TAG can be a precursor to fatty acid derivatives and a form of fat that can be stored for extended periods. Another object of this disclosure provides a cosmetic composition, a food composition, a feed composition, or a medical composition, each including at least one of the variant strain of the genus Yarrowia of this disclosure; a culture of the strain; an extract of the strain; a dried product of the strain; a lysate of the strain; and a fat recovered from at least one of the strain, the culture, the extract, the dried product, and the lysate. The genus Yarrowia and the variant strain of the genus Yarrowia of the present disclosure are the same as those described above. With respect to the subject matter of this disclosure, the composition may include the varant strain of the genus Yarrowia itself, in which the phosphatidylethanolamine V-methyltransferase or phospholipid methyltransferase activity is inactivated and, therefore, the fat content in the strain is increased compared to the wild type, and may include the culture, dried product, extract, or lysate of the strain. In addition, the composition may include fat recovered from any of the strain described in this disclosure, including the culture, dried product, extract, or lysate. However, the composition may include any form without limitation, provided it is capable of increasing the desired TAG content within the scope of this disclosure. The cosmetic composition of this disclosure may be formulated in a preparation selected from the group consisting of, but not limited to, a solution, an ointment for external use, a cream, a foam, a nourishing lotion, a soothing lotion, a compress, a soothing water, an emulsion, a makeup base, an essence, a soap, a liquid cleanser, a bath product, a tanning cream, a sunscreen oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a cleansing oil containing surfactant, a powder base, an emulsion base, a cerulean base, a dermal patch, and a spray. The cosmetic composition may additionally include one or more cosmetically acceptable vehicles that are blended into skin cosmetics in general and as a common component, for example, oil, water, a surfactant, a humectant, a lower alcohol, a thickener, a chelating agent, a pigment, a preservative, a fragrance, etc., may be appropriately blended, although the procedure is not limited to these. The cosmetically acceptable vehicle to be included in the cosmetic composition of this disclosure varies depending on the formulation of the cosmetic composition. The cosmetic composition of this disclosure may include at least one of the variant strain of the genus Yarrowia, the strain culture; the strain extract; the strain dry product; the strain lysate; and a fat recovered from at least one of the strain, the culture, the extract, the dry product and the lysate and, therefore, may include the increased fat content. The food composition of the present disclosure includes all forms, such as a functional food, a nutritional supplement, a health food, a food additive, etc., and the above types of food composition can be prepared in various forms according to a common procedure known in the art. The food composition of this disclosure may include forms such as pills, powders, granules, infusions, tablets, capsules or liquids, and examples of foods to which the composition of this disclosure is added include various foods such as beverages, gummies, teas, vitamin complexes, health supplement foods, etc. The food composition of this disclosure may include other additional ingredients, such as various medicinal plant extracts, food supplement additives, or natural carbohydrates as found in common foods. Furthermore, food supplement additives may include food additives commonly used in the industry, for example, a fragrance agent, a flavoring agent, a coloring agent, a filler, a stabilizer, etc. Examples of natural carbohydrates include common sugars such as monosaccharides (e.g., glucose, fructose, etc.), disaccharides (e.g., maltose, sucrose, etc.), polysaccharides (e.g., dextrin, cyclodextrin, etc.), and sugar alcohols (e.g., xylitol, sorbitol, erythritol, etc.). In addition, both natural fragrance agents (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic fragrance agents (e.g., saccharin, aspartame, etc.) can be advantageously used as fragrance agents. In addition, the food composition of this disclosure may include various nutrients, vitamins, minerals (electrolytes), a flavoring agent, such as a synthetic flavoring agent, a natural flavoring agent, etc., a coloring agent, a prolonging agent (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, an organic acid, a protective colloidal thickener, a pH adjuster, a stabilizer, a preservative, glycerin, alcohol, a carbonating agent used for a carbonated beverage, etc. Furthermore, the functional food composition of this disclosure may include pulp that can be used to prepare natural fruit juice, fruit juice drinks, and vegetable drinks. Such components may be used independently or in combination. The food composition described herein can be prepared by adding raw materials and ingredients commonly used in the technique during preparation. Additionally, formulations of the food composition can be prepared without limitation, provided they are accepted as a food. The food composition described herein can be prepared in various types of formulations. Unlike general drugs, the food composition described herein has advantages in that it does not have side effects caused by long-term administration, because it uses a food as a raw material, and it has excellent transferability; therefore, the food composition described herein can be consumed as a supplement. The food composition of this disclosure may include at least one of the variant strain of the genus Yarrowia, the strain culture; the strain extract; the strain dry product; the strain lysate; and a fat recovered from at least one of the strain, the culture, the extract, the dry product and the lysate and, therefore, may include the increased fat content. The feed composition referred to herein means any natural or artificial diet, meal, etc., or components of such meals intended or suitable for being eaten, taken, or digested by animals. The feed composition may be prepared in various types of feed known in the art and, specifically, may contain concentrated feeds, bulking feeds, and / or specialty feeds. The type of feed is not particularly restricted, and any feed commonly used in the technique may be used. Non-limiting examples of feed may include plant-based feeds such as grains, nuts, food by-products, seaweed, fibers, pharmaceutical by-products, fats and oils, starches, flours, grain by-products, etc.; and animal-based feeds such as proteins, inorganic matter, fats and oils, minerals, single-cell proteins, zooplankton, food, etc. These may be used alone or in a mixture of two or more of them. The feed composition of the present disclosure may include at least one of the variant strain of the genus Yarrowia-, the strain culture; the strain extract; the strain dry product; the strain lysate; and a fat recovered from at least one of the strain, the qz LRnn / zznz / E / γΐΛΐ culture, the extract, the dry product and the Used and, therefore, may include the increased fat content. The medical composition described herein refers to those prepared for the purpose of preventing or treating a disease and which may be used after being formulated in various forms according to a common procedure. For example, the medical composition may be formulated in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, etc., and may be formulated as external preparations, suppositories, and sterile injectable solutions. In addition, the medical composition may be prepared by including additionally pharmaceutically acceptable vehicles, such as buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, bases, excipients, lubricants, etc., known in the art, according to each formulation. Furthermore, the medical composition of the present disclosure is administered in a pharmaceutically effective amount. As used in the present invention, the term "pharmaceutically effective amount" means an amount that is sufficient to treat diseases in a reasonable benefit / risk ratio applicable to any medical treatment and without causing any adverse effects. The effective dosage level can be determined by those skilled in the art, depending on factors including a patient's health condition, severity, drug activity, drug sensitivity, administration procedure, timing of administration, route of administration, excretion rate, duration of treatment, drugs used in combination or concurrently, and other factors well known in the medical field. The medicinal composition of this disclosure may include at least one of the variant strain of the genus Yarrowia; the strain culture; the strain extract; the strain dry product; the strain lysate; and a fat recovered from at least one of the strain, culture, extract, dry product, and lysate and, therefore, may include the increased fat content. With respect to the subjects of this disclosure, the increased fat content in the strain may be, but is not limited to, the increased TAG content. Yet another object of the present disclosure provides a procedure for increasing a fat in a strain, which includes: cultivating the variant strain of the genus Yarrowia of the present disclosure. The genus Yarrowia, the variant strain of the genus Yarrowia, and the fat are the same as those previously described. qz LRnn / zznz / E / γΐΛΐ As used in the present invention, the term "culture" refers to the growth of the variant strain of the genus Yarrowia under suitably controlled environmental conditions. The cultivation process of the present disclosure can be achieved using a suitable culture medium and conditions known in the art. Such a cultivation process can be implemented by simply adjusting the conditions by those skilled in the art according to the selected strain. The strain can be cultured, though not exclusively, using a batch, continuous, or semi-continuous method, as known in the art. Regarding culture conditions, the pH can be adjusted to a suitable pH (e.g., pH 5 to 9, specifically pH 6 to 8, and more specifically pH 6.8) using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid), though not limited to these. Additionally, aerobic conditions can be maintained by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature can be maintained at 20°C to 45°C, and specifically 25°C to 40°C, for approximately 10 to 160 hours, though not limited to these. As used in the present invention, the term "medium" refers to a culture medium that includes a substance obtained by mixing nutrients required to cultivate the variant strain of the genus Yarrowia as a main component and / or a product obtained after cultivation. The medium and other culture conditions used in cultivating the microorganism of the present disclosure are not particularly limited, provided that the medium is a medium commonly used in the cultivation of the microorganism. However, the microorganism of the present disclosure may be cultivated in a common medium containing suitable carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins, etc., under aerobic conditions, provided that temperature, pH, etc., are adjusted. As a carbon source for the culture medium used in this disclosure, sugars and carbohydrates (e.g., glucose, sucrose, lactose, fructose, galactose, mannose, maltose, arabinose, xylose, molasses, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower seed oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), organic acids (e.g., acetic acid), etc., may be used alone or in combination. Specifically, the carbon source may be one or more selected from the group consisting of glucose, fructose, maltose, galactose, mannose, sucrose, arabinose, xylose, and glycerol, but is not limited to the foregoing.Additionally, the culture medium used in this disclosure may include, as a carbon source, glucose at a concentration of 10 g / L to 50 g / L, 10 g / L to 40 g / L, 20 g / L to 50 g / L, 20 g / L to 40 g / L or 25 g / L to 35 g / L, although it is not limited to the above. A nitrogen source for the culture medium used in this disclosure may be classified as either an organic or an inorganic nitrogen source, and either the organic or inorganic nitrogen source may be used alone or in a mixture. Specifically, the carbon source may be an organic nitrogen source selected from the group consisting of yeast extract, beef extract, peptone, and tryptone, or an inorganic nitrogen source selected from the group consisting of ammonium acetate, ammonium nitrate, ammonium chloride, ammonium sulfate, sodium nitrate, urea, and monosodium glutamate (MSG). Additionally, in the culture medium used in this disclosure, examples of nitrogen sources may include, but are not limited to, yeast extract, ammonium sulfate, sodium nitrate, and MSG. Yeast extract can be included in the culture medium at a concentration of 0.1 g / L to 10 g / L, 0.5 g / L to 10 g / L, 0.5 g / L to 7 g / L, 0.5 g / L to 5 g / L, 0.5 g / L to 3 g / L, 0.5 g / L to 2 g / L, or 0.5 g / L to 1.5 g / L; ammonium sulfate can be included in the culture medium at a concentration of 1 g / L to 5 g / L, 1 g / L to 4 g / L, 2 g / L to 5 g / L, or 2 g / L to 4 g / L; sodium nitrate can be included in the culture medium at a concentration of 0.1 g / L to 10 g / L, 0.5 g / L to 9 g / L, 1 g / L to 9 g / L, or 2 g / L to 1.5 g / L. g / L to 9 g / L, 3 g / L to 9 g / L, 5 g / L to 9 g / L or 7 g / L to 9 g / L and MSG can be included in the culture medium at a concentration of 0.1 g / L to 2 g / L, 0.1 g / L to 1.5 g / L, 0.5 g / L to 2 g / L or 0.5 g / L to 1.5 g / L, although these are not limited to the above. The Yarrowia variant strain described herein may be cultivated in a medium containing choline. Specifically, the choline concentration in the choline-containing medium described herein may be, but is not limited to, 0.05 mM to 5 mM, 0.1 mM to 5 mM, 0.1 mM to 3 mM, 0.1 mM to 2 mM, or 0.1 mM to 1 mM. With regard to the subject matter of this disclosure, when the strain, which is a choline auxotrophic strain, is grown in a medium containing choline, it is possible to recover the growth of the strain and at the same time, increase the fat content in the strain. With respect to the purposes of this disclosure, the medium may have an optimal C / N ratio in order to increase the fat content in the strain. qz LRnn / zznz / E / γΐΛΐ As used in the present invention, the expression C / N ratio (carbon-to-nitrogen ratio; C:N ratio) refers to the ratio of the mass of carbon to the mass of nitrogen in a medium. As the ratio increases, the nitrogen source in the medium may decrease, and consequently, the cell concentration may decrease due to growth inhibition. As the C / N ratio in the medium described herein increases, the DO value may decrease and the intracellular fat content may increase. Therefore, the preferred C / N ratio in the medium is important for maximum fat productivity. The C / N ratio that shows maximum fat productivity in the strain of the present disclosure can be calculated by DO * fat content value and the C / N ratio in the medium can be 10 to 120, specifically 30 to 90, more specifically 40 to 80 and more specifically 50 to 70, although not limited to the above. The preferred C / N ratio in the medium can effectively increase fat productivity, while avoiding inhibition of the growth of the strain in this disclosure. Yet another aspect of this disclosure provides a procedure for preparing a fat, which includes: cultivating the variant strain of the genus Yarrowia of this disclosure, in which the phosphatidylethanolamine / V-methyltransferase (PEMT) or phospholipid methyltransferase activity is inactivated. The genus Yarrowia, the variant strain of the genus Yarrowia, the culture and the fat of the present disclosure are the same as those described above. The strain can be cultured by growing the strain in a medium containing choline. The concentration of choline in the choline-containing medium of this disclosure may be 0.05 mM to 5 mM, 0.1 mM to 5 mM, 0.1 mM to 3 mM, 0.1 mM to 2 mM or 0.1 mM to 1 mM. The C / N ratio in the medium can be 10 to 120, specifically 30 to 90, more specifically 40 to 80 and more specifically 50 to 70, although it is not limited to the above. With regard to the objects of this disclosure, when the strain, which is a choline auxotrophic strain, is grown in a medium containing choline, it is possible to recover the growth of the strain and at the same time, increase the fat content in the strain and thus make it easy to prepare the fat. The procedure for preparing a fat of this disclosure may additionally include preparing the microorganism of this disclosure, preparing a medium for culturing the strain, or a combination thereof (in any order), for example, prior to culturing. Q7 LRnn / ZZnZ / E / YIAI The procedure for preparing a fat of the present disclosure may further include recovering the fat from the strain, the culture thereof, the extract thereof, the dried product thereof, and the lysate thereof, after cultivating the variant strain of the genus Yarrowia. In other words, the fat may be collected from the strain itself or from the culture thereof produced in the cultivation of the present disclosure. For example, centrifugation, filtration, anion-exchange chromatography, crystallization, HPLC, etc., may be used, and the target fat may be recovered from the cultivated strain or culture thereof, the dried product thereof, or the lysate thereof, using a suitable procedure known in the art. Additionally, fat recovery may include further isolation and / or purification, which can be carried out using a suitable procedure known in the art. Therefore, the recovered fat may be in a purified form or in a microbial fermentation liquid containing the fat. Yet another aspect of this disclosure provides for a use of the variant strain of the genus Yarrowia, in which the activity of phosphatidylethanolamine A / -methyltransferase or phospholipid methyltransferase is inactivated; the culture of the strain; the extract of the strain; the dried product of the strain; the used product of the strain; the cosmetic composition, the food composition, the feed composition, or the medical composition, each including at least one of the strain, the culture, the extract, a dried product, and the lysate and fat recovered from at least one of the strain, the culture, the extract, the dried product, and the lysate, in the production of fat. The phosphatidylethanolamine / V-methyltransferase, phospholipid methyltransferase, genus Yarrowia, variant strain of genus Yarrowia, culture, fat, cosmetic composition, food composition, feed composition and medical composition of this disclosure are the same as those described above. qz LRnn / zznz / E / γΐΛΐ Method for carrying out the invention Hereafter, this disclosure will be described in more detail with reference to illustrative embodiments. However, these embodiments are only to illustrate this disclosure more specifically, and it will be apparent to those skilled in the art that the scope of this disclosure is not limited to these embodiments. Example 1. Preparation of a deficient strain based on wild-type yeast To prepare an auxotrophic strain for ethanolamine or choline, a strain was prepared in which a gene encoding CHO2 or OPI3 was deleted, based on a wild-type yeast, Yarrowia lipolytica POlf (ATCC MYA-2613). 1-1. Preparation of a cho2-deficient strain (CC08-0162) To prepare a cassette capable of suppressing the cho2 gene on the Yarrowia lipolytica chromosome, a polynucleotide sequence from SEQ ID NO: 1 and an amino acid sequence from SEQ ID NO: 2 of cho2 (YALI0E06061 g) were obtained based on a nucleotide sequence registered in KEGG (Kyoto Encyclopedia of Genes and Genomes). The polymerization process (PRP) was performed using Yarrowia lipolytica P01f genomic DNA as a template and the primers from SEQ IDs 3 and 4, 7 and 8, and 9 and 10, respectively. The PRP was also performed using an auxotrophic marker of URA3 as a template and the primers from SEQ IDs 5 and 6. The PRP was performed for 35 cycles under conditions consisting of denaturation at 95 °C for 1 minute; annealing at 55 °C for 1 minute; and polymerization at 72 °C for 1 minute and 30 seconds. As a result, 5'UTRs of 1055 bp, 5'UTRs of 638 bp, 3'UTRs of 1050 bp, and URA3 of 1569 bp were obtained. The PCR-amplified DNA fragments were prepared on a cho2-deficient cassette using overlapping extension PCR, and the cassette was arranged in the order 5'UTR-URA3-5'UTR_RP-3'UTR. The cho2-deficient cassette was transformed into Yarrowia lipolytica P01f by heat shock and selected on a uracil-free solid medium. The primary strain thus selected was then subjected to a second cross to prepare a cho2-deficient strain. The deficient strain prepared in this way was designated CC08-0162 and was deposited under the Budapest Treaty with the Korean Center for Microbiological Culture (KCCM), an International Depository Authority, on February 20, 2020, under Accession No. KCCM12672P. Q7 LRnn / ZZnZ / E / YIAI Table 1 SEQ ID NO: Name of cebador Secuencia (5-3') 3 CHO2_5'_For GTACCCGGGGATCCTCTAGAGTCATCCGCAAACACAACAC 4 CHO2_5'_Rev GCAATGACGAGTCAGACAGGGGTGTTTGTGGAAGCTGGTG 5 CHO2_URA_For CACCAGCTTCCACAAACACCCCTGTCTGACTCGTCATTGC 6 CHO2_URA_Rev CGCATTCTGCGTACA lili GCTGGTGGTATTGTGACTGGG 7 CHO2_5'RP_For CCCAGTCACAATACCACCAGCAAAAATCGCAGAATGCG 8 CHO2_5'RP_Rev CAGATATGCTCTCTGCAAACGGTGTTTGTGGAAGCTGGTG 9 CHO2_3'_For CACCAGCTTCCACAAACACCGTTTGCAGAGAGCATATCTG 10 CHO2_3'_Rev GCAGGTCGACTCTAGAGAGAGGTCTGTTCACAACATCGGC Q7 LRnn / ZZnZ / E / YIAI 1-2. Preparation of a deficient strain in op¡3 (CC08-0123) To prepare a case capable of suppressing the opi3 gen in the Yarrowia lipolytica chromosome, a polynucleotide sequence of SEQ ID NO: 11 and a sequence of amino acids of SEQ ID NO: 12 of op¡3 (YALI0E12441 g) were obtained based on a sequence of nucleic acids registered in it KEGG (Kyoto Encyclopedia of Genes and Genomes). The polymerase chain reaction (PCR) was performed using Yarrowia lipolytica P01f genomic DNA as a template and the primers from SEQ IDs 13 and 14, 17 and 18, and 19 and 20, respectively. The PCR was also performed using the URA3 auxotrophic marker as a template and the primers from SEQ IDs 15 and 16. PCR was performed for 35 cycles under conditions consisting of denaturation at 95 °C for 1 minute; annealing at 55 °C for 1 minute; and polymerization at 72 °C for 1 minute and 30 seconds. As a result, 5'UTRs of 980 bp, 5'UTRs of 730 bp, 3'UTRs of 1001 bp, and URA3 of 1569 bp were obtained. The PCR-amplified DNA fragments were prepared on an opi3-deficient cassette using overlapping extension PCR, and the cassette layout was arranged in the order 5'UTR-URA3-5'UTR_RP-3'UTR. The opi3-deficient cassette was transformed into Yarrowia lipolytica PO1f by heat shock and selected on a uracil-free solid medium. The primary strain thus selected was then subjected to a second cross to prepare an opi3-deficient strain. The deficient strain prepared in this way was designated CC08-0123 and deposited under the Budapest Treaty with the Korean Center for Culture of Microorganisms (KCCM), an International Depositary Authority, on February 20, 2020, with Accession No. KCCM12673P. qz ί«ηη / ζζηζ / Ε / γΐΛΐ Table 2 SEQ ID NO: Primer Name Sequence (5'—3') 13 OPI3_5'_For GTACCCGGGGATCCTCTAGACACCAATTCGACATGGAC 14 OPI3_5'_Rev GCAAIGACGAGI CAGACAGGGAG lili CCAGAGAGCCAAC 15 OPI3_ORA_URA GTTGGCTCTCTGGAAAACTCCCTGTCTGACTCGTCATTCGC 16 OPI3_URA_Rev CAGTCCTTAATCAACGGTGGCTGGTGGTATTGTGACTGGG 17 OPI3_5'RP_For CCCAGTCACAATACCAG_CCACCGTTGATTAAGGACTG 18 OPI3_IIIRe3' IRPIICG IRPIICG GCGAG lili CCAGAGAGCCAAC 19 OPI3_3'_For GTTGGCTCTCTGGAAAACTCGCAACAGAAAACGGCCTACG 20 OPI3_3'_Rev GCAGGTCGACTCTAGAGTGCCGTCTCGATTGTCACAGG 1-3. Preparation of a strain codeficient in cho2y op / 3(CC08-0183) To examine the effect of cho2 and op3 codeficiency in Yarrowia lipolytica P01f, the cho2 and op3 codeficient strain was prepared in the same manner as in Examples 1-1 and 1-2 and the strains, in which the respective genes were deleted in combination, were designated CC08-0183 and deposited pursuant to the Budapest Treaty with the Korean Center for Microorganism Culture (KCCM), an International Depository Authority, on February 20, 2020, with Accession No. KCCM12671P. Example 2. Evaluation of the growth and fat accumulation of deficient strains based on wild-type strains The growth and fat accumulation of the deficient strains CC080162, CC08-0123 and CC08-0183 prepared in Example 1 were evaluated. 2-1. Evaluation according to the medium The two strain types and the control group (P01f) were seeded into a 250 ml corner baffle flask containing 50 ml of either YPD or YLMM1 (Yarrowia lipolytica minimal medium 1) at an initial OD of 0.01 and cultured with shaking at 250 rpm and 30 °C for 72 h. In YLMM1, 0.3 mM choline chloride (Cl) was added, if required. The compositions of YPD and fat medium 1 (YLMM1) were as follows. <ypd> g / L of glucose, 10 g / L of yeast extract (manufactured by BD, Bacto yeast extract, choline at 0.38% in Bacto yeast extract), 0.5 g / L of uracil, 20 g / L of Bacto peptone<YLMM1 (pH 7.2)> g / L of glucose, 1.7 g / L of amino acid-free yeast nitrogenous bases and ammonium sulfate, 0.5 g / L of uracil and 2.5 g / L of ammonium sulfate were dissolved in 0.1 M sodium phosphate buffer (pH 7.2). After the culture was completed, the culture medium was centrifuged to discard the supernatant, and the cells remaining in the bottom layer were dried in a dry oven at 60 °C for 24 hours, followed by crude fat extraction. Crude fat extraction was performed according to the conventional feed analysis procedure (Feed standard analysis method. 2001. National Livestock Research Institute, Rural Development Administration), and the analyzed OD and intracellular crude fat content are shown below in Table 3. The results in Table 3 are from experiments performed in triplicate, and the increase in crude fat content was assessed using the mean of these values. qz LRnn / zznz / E / γΐΛΐ Table 3 Medium Strain DOeoo Crude Fat Content [%] Batch 1 Batch 2 Batch 3 Media Batch 1 Batch 2 Batch 3 Media YPD P01f 60.8 63.2 62.9 62.3 9.7 9.4 9.4 9.5 CC08-O1 61.7 11.2 10.7 11.4 11.1 CC08-O123 62.5 62.4 61.4 62.1 11.0 10.7 10.7 10.8 CC08-O183 61.7 61.5 61.9 1.1.1.1.1. 11.1 YIMM1 P01f 47.2 46.1 47.7 47.0 10.9 11.5 12.4 11.6 P01f (with CL) 46.6 47.9 47.2 47.2 11.9 11.1 11.5 18.5 CC-01818 12.8. 11.9 13.6 12.1 15.0 14.6 15.1 14.9 CC08-O162 (with CL) 44.4 45.0 48.3 45.9 16.4 16.1 16.4 16.3 CC08-O123 16.6 16.6 14.2 14.4 14.9 14.5 CC08-O123 (with CL) 45.7 46.5 46.4 46.2 16.1 15.6 16.3 16.0 CC08-O183 15.0 CC08-O183 (with CL) 45.8 46.1 45.9 45.9 16.3 16.5 16.2 16.3 Q7 LRnn / ZZnZ / E / YIAI As shown in Table 3, crude fat content was confirmed to increase in strains, regardless of the medium, in which the cho2 or opi3 gene was deleted individually or simultaneously from the parental strain PO1f. Crude fat content was also observed to increase when the same strain was cultured in YLMM1 compared to YPD. The increase was approximately 17% in the cho2-deficient strain and approximately 14% in the opi3-deficient strain, compared to PO1f, in YPD medium. In contrast, the increase was approximately 28% in the cho2-deficient strain and approximately 25% in the opi3-deficient strain, compared to PO1f, in YLMM1 medium, indicating that the increase in fat content was greater in YLMM1 than in YPD. Furthermore, in the strain in which the cho2 and opi3 genes were simultaneously deleted, an increase in fat content similar to that of the cho2-deficient strain was observed. However, unlike YPD, YLMM1 did not contain choline, and therefore the pathway to synthesize phosphatidylcholine from phosphatidylethanolamine was blocked, and the cho2-deficient strain, the opi3-deficient strain, and the cho2- and opi3-deficient strain provided with choline auxotrophy showed inhibition of growth in YLMM1. Therefore, 0.3 mM choline was added to the medium for growth recovery and it was confirmed that when choline was added to the medium, the growth of the choline auxotrophic strain recovered as much as in the control group and the crude fat content in the strain also increased by approximately 10%, compared to no addition of choline. The growth and fat accumulation of the cho2 and op¡3 deficient strains prepared based on the yeast Yarrowia lipolytica P01f showed a similar trend to that of budding yeasts of Saccharomyces cerevisiae, but the strains are different from Saccharomyces cerevisiae in that when choline was added, their growth recovered and the fat content also increased, which is a characteristic of the oleaginous yeast, Yarrowia lipolytica. 2-2. Evaluation of growth and fat accumulation according to the C / N ratio When cultured in YLMM1 with a C / N ratio of 30, compared to YPD with a C / N ratio of less than 1 in Example 2-1, the fat content in the strain was confirmed to increase. Therefore, the three strain types prepared in Example 1 and the P01f control were cultured in CN test media with different C / N ratios, and growth and fat accumulation were evaluated according to the C / N ratio. Each strain was inoculated into a 250 mL corner baffle flask containing 50 mL of CN test medium, to which different concentrations of ammonium sulfate were added, at an initial OD of 0.01, and cultured with shaking at 250 rpm and 30 °C for 72 hours. The composition of the CN test medium according to the C / N ratio is as follows. <Medio de prueba de CN (pH 7.2)> g / L of glucose; 1.7 g / L of yeast nitrogenous base without amino acids and ammonium sulfate; 0.5 g / L of uracil; 0.3 mM choline chloride; 2.5 g / L (C / N ratio of 30), 1.25 g / L (C / N ratio of 60), 0.83 g / L (C / N ratio of 90) or 0.63 g / L (C / N ratio of 120) of ammonium sulfate were dissolved in 0.1 M sodium phosphate buffer (pH 7.2). After the culture was completed, the culture medium was centrifuged to discard the supernatant, and the cells remaining in the bottom layer were dried in a dry oven at 60 °C for 24 hours, followed by fat extraction. Crude fat extraction was performed according to the conventional feed analysis procedure (Feed standard analysis method. 2001. National Livestock Research Institute, Rural Development Administration), and the analyzed OD and intracellular crude fat content are shown below in Table 4. The results in Table 4 are from experiments qz LRnn / zznz / E / γALA performed in triplicate, and the increase in fat content was assessed by the mean of these results. qz ί«ηη / ζζηζ / Ε / γΐΛΐ Table 4 C / N Ratio Strain DOeoo Crude Fat Content [%] Batch 1 Batch 2 Batch 3 Medium Batch 1 Batch 2 Batch 3 Medium 30 P01f 47.2 46.1 47.7 47.0 10.9 11.5 12.4 11.6 CC 40.44-445. 48.3 45.9 16.4 16.1 16.4 16.3 CC08-O123 45.7 46.5 46.4 46.2 16.1 15.6 16.3 16.0 CC08-O183 46.2 45.9 16.6.6.6. 16.2 16.2 60 P01f 44.9 45.5 45.5 45.3 12.8 12.9 13.3 13.0 CC08-O162 44.5 44.0 43.8 44.1 18.9 18.4 1.9.18 CC08-818-O162. 44.9 44.6 45.2 44.9 18.0 18.8 19.3 18.7 CC08-O183 43.9 44.2 44.1 44.1 19.2 18.5 18.9 18.9 90 P01f 3.3.3.3.3. 15.5 15.1 15.0 15.2 CC08-O162 32.0 31.7 31.1 31.6 22.2 21.8 22.3 22.1 CC08-O123 32.6 32.2 32.1 32.3 2.2.2.2.2.2. CC08-O183 31.8 32.1 31.5 31.8 21.9 22.5 22.2 22.2 120 P01f 23.7 23.9 24.4 24.0 16.7 16.4 16.7 16.6 CC080-623233. 23.7 23.4 24.1 24.6 24.2 24.3 CC08-O123 23.8 23.1 23.0 23.3 24.0 24.1 23.6 23.9 CC08-O183 23.4 23.6 23.23.23. 24.1 24.1 As shown in Table 4, it was confirmed that the fat content increased independently of the C / N ratio of the medium in the strains in which the cho2 or opi3 gene was deleted individually or simultaneously from the parental strain PO1 f, as in Example 2-1. It was also observed that the increase was approximately 43%, independent of the C / N ratio. However, as the C / N ratio in the medium increased, the nitrogen source decreased and the OD (oxidation density) tended to decrease, although the intracellular fat content tended to increase. In order to obtain the C / N ratio that shows maximum productivity, the value of OD * fat content was calculated. In all strains, when the C / N ratio was 15 out of 60, the maximum value of OD * fat content was observed. Therefore, a C / N ratio of 60 was determined to be the optimal C / N ratio. Example 3. Preparation and evaluation of a fat-accumulating SCO023-based deficient strain 3-1. Preparation of a fat-accumulating SCO023 strain To examine the effect of deletion of the gene encoding CHO2 or OPI3 in a fat-accumulating strain, a high fat-producing yeast strain was prepared. To prepare the high-fat-producing yeast strain, the TAG degradation pathway was first blocked. The TAG degradation pathway is as follows: TAG is converted to a fatty acid (FA) by TGL3 and 4, and the FA is then transported into the peroxisome by acyl-CoA-binding proteins. The transported FA is acylated by two peroxisomal acyl-CoA synthases (pxa1, 2), and the adilated FA is desaturated by acyl-CoA oxidases (pox1-6) at the vinyl position. In the desaturated FA-CoA ester, the double-bond portion is hydrated by the multifunctional enzyme 2 (MFE2-C domain, mfe1), forming a 3-hydroxyacyl-CoA intermediate. Here, the A / B domain of the MFE2 enzyme acts to oxidize the 3-hydroxyacyl-CoA intermediate to a 3-ketoacyl-CoA intermediate, and the 3-ketoacyl-CoA intermediate is cleaved at the alpha carbon by peroxisomal 3-oxyacyl-thiolase (pot1) to produce acetyl-CoA and fatty acyl-CoA.The degradation of AG occurs as the cycle is repeated from the pox reaction to the pot1 reaction (AIMS Bioengineering 2016. 3(4):493-514). Among the genes, pox2 (YALI0F10857), mfe1 (YALI0E15378), and pot1 (YALI0E18568) were deleted in Yarrowia lipolytica P01f to prevent the expression of each enzyme. Additionally, to reduce the number of peroxisomes, the site of beta-oxidation, pex10 (YALI0C01023), a gene involved in peroxisome formation, was deleted to prevent enzyme expression (AIMS Bioengineering 2016. 3(4):493-514). Finally, mhy1 (YALI0B21582), a gene related to morphology, was also deleted. In the case of the deleted mhy1 gene, the carbon flow in amino acid synthesis decreased and the carbon flow in fat biosynthesis increased, thus increasing the intracellular crude fat content (Biochim. Biophys. Acta. 2018. 1863(1):81-90). To prepare a cassette capable of suppressing each gene, a polynucleotide sequence from SEQ ID NO: 21 and an amino acid sequence from SEQ ID NO: 22 of pox2 were obtained, a polynucleotide sequence from SEQ ID NO: 23 and an amino acid sequence from SEQ ID NO: 24 of mfe1, a polynucleotide sequence from SEQ ID NO: 25 and an amino acid sequence from SEQ ID NO: 26 of pex10, a polynucleotide sequence from SEQ ID NO: 27 and an amino acid sequence from SEQ ID NO: 28 of pot1, and a polynucleotide sequence from SEQ ID NO: 29 and an amino acid sequence from SEQ ID NO: 30 of mhy1, based on the nucleotide sequences recorded in KEGG. The design of each gene-deficient cassette was performed in the order 5'UTR-URA35'UTR_RP-3'UTR and 5'UTR, 5'UTR_RP and 3'UTR were subjected to POR using Yarrowia lipolytica P01f genomic DNA as a template and the following primers, respectively; The primers from SEQ ID NO: 31 and 32, SEQ ID NO: 35 and 36, SEQ ID NO: 37 and 38 were used for the preparation of a pox2-deficient cassette; the primers from SEQ ID NO: 39 and 40, SEQ ID NO: 43 and 44, SEQ ID NO: 45 and 46 were used for the preparation of an mfe1-deficient cassette; the primers from SEQ ID NO: 47 and 48, SEQ ID NO: 51 and 52, SEQ ID NO: 53 and 54 were used for the preparation of a pex10-deficient cassette; the primers from SEQ ID NO: 55 and 56, SEQ ID NO: 59 and 60, SEQ ID NO: 61 and 62 were used for the preparation of a pot1-deficient cassette; and for the preparation of a deficient cassette in mhy1, the primers of SEQ ID NO: 63 and 64, SEQ ID NO: 67 and 68, SEQ ID NO: 69 and 70.URA3 was subjected to POR using an auxotrophic URA3 marker as a template and the primers from SEQ ID NO: 33 and 34 for the preparation of a pox2-deficient cassette, the primers from SEQ ID NO: 41 and 42 for the preparation of an mfe1-deficient cassette, the primers from SEQ ID NO: 49 and 50 for the preparation of a pex10-deficient cassette, the primers from SEQ ID NO: 57 and 58 for the preparation of the pot1-deficient cassette, and the primers from SEQ ID NO: 65 and 66 for the preparation of the mhy1-deficient cassette. The POR was performed for 35 cycles under conditions consisting of denaturation at 95 °C for 1 minute; hybridization at 55 °C for 1 minute; and polymerization at 72 °C for 1 minute and 30 seconds. As a result, the following were obtained: pox2_5'UTR of 1035 sc, pox2_5'UTR_RP of 720 sc, pox2_3'UTR of 1010 sc, pox2_URA3 of 1569 sc, mfe1_5'UTR of 1003 sc, mfe1_5'UTR_RP of 709 sc, mfe1_3'UTR of 1036 sc, mfe1_URA3 of 1569 sc, pex10_5'UTR of 1032 sc, pex10_5'UTR_RP of 735 sc, pex10_3'UTR of 1033 sc, pex10_URA3 of 1569 sc, pot1_5'UTR of 1036 sc, pot1_5'UTR_RP of 735 sc, pot1_3'UTR of 1010 bp, pot1_URA3 of 1569 bp, mhy1_5'UTR of 921 bp, mhy1_5'UTR_RP of 526 bp, mhy1_3'UTR of 1029 bp and mhy1_URA3 of 1569 bp. PCR-amplified DNA fragments were prepared on a pox2, mfe1, pex10, pot1 or mhy1-deficient cassette by overlapping extension PCR. qz LRnn / zznz / E / γΐΛΐ First, the pox2-deficient cassette was transformed into Yarrowia lipolytica PO1f by heat shock and selected on a uracil-free solid medium. The primary strain thus selected was then subjected to a second cross to prepare a pox2-deficient strain. Similarly, mfe1-, pex10-, pot1-, and mhy1-deficient strains were prepared using cassettes deficient in mfe1, pex10, pot1, or mhy1. The deficient strains thus prepared were designated SCO023. qz LRnn / zznz / E / γΐΛΐ Table 5 SEQ ID NO: Primer Name Sequence (5'—3') 31 POX2_5'_For GTACCCGGGGATCCTCTAGAGATTCCGCCAAGTGAGACTG 32 POX2_5'_Rev GCAATGACGAGTCAGACAGGCGTTGCTTGTGTGAI III IG 33 POX2_URA_For CAAAAATCACACAAGCAACGCCTGTCTGACTCGTCATTGC 34 POX2_URA_Rev CGCTTGTCCAGTATGAATAGCTGGTGGTATTGTGACTGGG 35 POX2_5'RP_For CCCAGTCACAATACCACAGCTATTCATACTGGACAAGCG 36 POX2_RP_Rev'5' CAATAAATACCCGCTTGTCCGTTGCTTGTGTGA IIII IG 37 POX2_3'_For CAAAAATCACACAAGCAACGGACAAGCGGGTATTTATTG 38 POX2_3'_Rev GCAGGTCGACTCTAGACCAAACAAAGCTGATGACAC 39 MFE1_5'_For GTACCCGGGGATCCTCTAGACAAGCCAAAGAGATGTTGAC 40 MFE1_5'_Rev GCAATGACGAGTCAGACAGGTTATAACGTATCTTCTAC 41 MFE1_URA_For GTAGAAGATACGTTATTAACCCTGTCTGACTCGTCATTGC 42 MFE1_URA Rev CAAATCAGCCGTTGGCCTGCCTGGTGGTATTGTGACTGGG 43 MFE1_5'RP_For CCCAGTCAATAACCACCAGGCAGGCCAACGGCTGATTTG 44 MFE1_5'RP_Rev CACTTGGTCAGATAATAGCGTTAATAACGTATCTTCTAC 45 MFE1'_Or GTAGAAGATACGTTATTAACGCTATTATCTGACCAAGTG 46 MFE1_3'_Rev GCAGGTCGACTCTAGATGCTTGAAGGCATATGTGACTG 47 PEX10_5'_For GTACCCGGGGATCCTCTAGAG IIIICG I CTTAGCGTCATG 48 PEX10_5'_Rev GCAATGACGAGTCAGACAGGGCCGAGGCAGATTTGGGTTG 49 PEXIOURAFor CAACCCAAATCTGCCTCGGCCCTGTCTGACTCGTCATTGC 50 PEXIOURARev GAGTCCAGTAATTCTTTCCGCTGGTGGTATTGTGACTGGG 51 PEX10_5'RP_For CCCAGTCACAATACCACCAGCGGAAAGAATTACTGGACTC 52 PEX10_5'RP_Rev CCTTCCATCCAGACCTCGTCGCCGAGGCAGATTTGGGTTG 53 PEX10_3'_For CAACCCAAATCTGCCTCGGCGACGAGGTCTGGATGGAAGG SEQ ID NO: Primer Name Sequence (5'—3') 54 PEX10_3'_Rev GCAGGTCGACTCTAGAGCTGACCTACCAGATCAGACGC 55 POT1_5'_For GTACCCGGGGATCCTCTAGACACAATACCCCACAGGTGC 56 POT1_3'_Rev GCAATGACGAGTCAGACAGGGTGTGTCTTGGTTGGATGAG 57 POT1_URA_For CTCATCCAACCAAGACACACCCTGTCTGACTCGTCATTGC 58 POTIURARev CAGGCGCTCCCCCATTGGCGCTGGTGGTATTGTGACTGGGG 59 POT1_RP_5' CCCAGTCACAATACCACCAGCGCCAATGGGGGAGCGCCTG 60 POT1_5'RP_Rev GTTCGATCGCGATTCATTTCGTGTGTCTTGGTTGGATGAG 61 POT1_3'_For CTCATCCAACCAAGACACACGAAATGAATGGCGATCGAAC 62 POTRev1 GCAGGTCGACTCTAGAGAGGAGTGCTAAAATTAGCCCTGC 63 MHY1_5'_For GTACCCGGGGATCCTCTAGATGTCAGCGAAAGCTCAAAG 64 MHY1_5'_Rev GCAATGACGAGTCAGACAGGCAATTCGAGGTCCAI II IGG 65 MHY1_URA_For CCAAAATGGACCTCGAATTGCCTGTCTGACTCGTCATTGC 66 MHY1_URA_Rev GTGGTGCI IIIG IACTTGTCCTGGTGGTATTGTGACTGGG 67 MHY1_5'RP_For CCCAGTCACAATACCACAGGACAAGTACAAAAGCACCACY 68 MHY1_URA_Rev_HRP GAAGGCGCTCTACCTCTAGTCCAATTCGAGGTCCATTTG 69 MHY1_3'_For CAAAATGGACCTCGAATTGGACTAGAGGTAGAGCGCCTTC 70 MHY1_3'_RevGCAGGTCGACTCTAGACTGTGTTTGATTAGCTCTTCTCAG 3-2. Preparation of a cho2-deficient strain based on SCO023 (SCO079) A cho2-deficient strain was prepared based on the high-fat-producing yeast strain SCO023 prepared in Example 3-1. The cho2-deficient cassette prepared in Example 1-1 was transformed into SCO023 by heat shock and selected on a uracil-free solid medium. The primary strain thus selected was then subjected to a second cross to prepare a cho2-deficient strain. The deficient strain prepared in this way was designated SCO079. 3-3. Preparation of an op13-deficient strain based on SCO023 (SCO163) An opi3-deficient strain was prepared based on the high-fat-producing yeast strain SCO023 prepared in Example 3-1. The opi3-deficient cassette prepared in Example 1-2 was transformed into SCO023 by heat shock and selected on a uracil-free solid medium. The primary strain thus selected was then subjected to a second cross to prepare an opi3-deficient strain. The deficient strain prepared in this way was designated SCO163. 3-4. Flask test A flask test was prepared from the SCO079 and SCO163 strains prepared in Examples 3-2 and 3-3. The two strain types and the control group were seeded in a 250 ml corner baffle flask containing 50 ml of YLMM2, to which different concentrations of choline were added, at an initial OD of 0.01 and cultured with shaking at 250 rpm and 30 °C for 72 hours. The composition of YLMM2 is as follows. <YLMM2 (pH 7.2)> g / L of glucose, 1.7 g / L of yeast nitrogenous bases without amino acids and ammonium sulfate, 0.5 g / L of uracil and 1.25 g / L of ammonium sulfate were dissolved in 0.1 M sodium phosphate buffer (pH 7.2). After the culture was completed, the culture medium was centrifuged to discard the supernatant, and the cells remaining in the bottom layer were dried in a dry oven at 60 °C for 24 hours, followed by fat extraction. Crude fat extraction was performed according to the conventional feed analysis procedure (Feed standard analysis method. 2001. National Livestock Research Institute, Rural Development Administration), and the analyzed OD and intracellular fat content are shown below in Table 6. The results in Table 6 are from experiments performed in triplicate, and the increase in fat content was assessed using the mean of these values. qz LRnn / zznz / E / γιΛι Tabla 6 qz LRnn / zznz / E / yΙΛΐ Strain Choline Concentration [mM] DOeoo Crude Fat Content [%] Batch 1 Batch 2 Batch 3 Average Batch 1 Batch 2 Batch 3 Average SCO023 0.00 45.5 45.9 46.0 45.8 22.8 23.0 22.6 22.8 0.05 45.8 46.4 45.8 46.0 22.7 22.3 22.8 22.6 0.10 46.1 45.5 46.1 45.9 22.8 22.7 23.2 22.9 0.30 46.3 46.0 46.3 46.2 22.6 22.4 22.8 22.6 0.50 46.8 47.2 46.7 46.9 22.9 22.5 23.0 22.8 1.00 47.1 47.0 46.0 46.7 22.4 22.3 22.8 22.5 SCO079 0.00 9.8 9.6 11.2 10.2 25.3 25.2 25.7 25.4 0.05 31.7 31.4 31.7 31.6 26.5 26.1 26.0 26.2 0.10 44.0 43.9 43.5 43.8 27.9 26.7 26.7 27.1 0.30 46.6 44.4 44.9 45.3 27.5 27.7 27.6 27.6 0.50 45.2 47.1 44.8 45.7 26.8 26.3 26.1 26.4 1.00 45.4 46.3 46.6 46.1 25.7 26.0 26.3 26.0 SCO163 0.00 11.4 10.5 12.0 11.3 25.9 25.1 24.9 25.3 0.05 33.5 31.6 31.8 32.3 26.0 26.0 25.7 25.9 0.10 43.7 44.4 44.5 44.2 26.1 26.4 26.1 26.2 0.30 44.6 45.8 44.3 44.9 26.9 26.0 27.2 26.7 0.50 45.5 44.7 45.1 45.1 26.3 25.6 26.4 26.1 1.00 46.0 45.8 44.7 45.5 26.0 26.1 25.6 25.9 As shown in Table 6, the strain in which the cho2 or op13 gene was deleted from the parental strain SCO023 showed fat content equal to or similar to the parental strain SCO023 in medium containing choline at a concentration of 0 mM or 0.055 mM, but the oxidation density (OD) was greatly reduced. When choline was added at a concentration of 0.1 mM or more to the medium, the OD recovered to the level of the control group, and the effect of increasing fat content in the strain was also observed. When choline was added at 0.1 mM to 1 mM to the medium, SCO079 showed an increase of 16% to 22% in crude fat content, and SCO163 showed an increase of 14% to 18% in crude fat content, compared to SCO023. However, in the SCO023 strain, where the PEMT pathway remained, there was no change in crude fat content, regardless of the choline concentration in the medium. As a result, it was confirmed that when an adequate amount of choline was added to the strain in which the cho2 or opi3 gene was deleted in the PEMT pathway, the strain's growth recovered and its fat content increased. However, it was confirmed that the increase in fat content was relatively low when choline was added after the cho2 and opi3 genes were deleted based on the fat-storing strain SCO023, compared to the case where the cho2 and opi3 genes were deleted based on the wild-type strain. Example 4. Preparation and evaluation of a fat-accumulating SCO028-based deficient strain 4-1. Preparation of a fat-accumulating SCO028 strain To examine the effect of deletion of the gene encoding CHO2 or OPI3 in a strain that has a higher fat content than the strain prepared in Example 3-1, another high fat-producing yeast strain was prepared. It is known that when the acyl-CoA:diacylglycerol acyltransferase isozyme I (DGA1), a terminal enzyme in the fat biosynthetic pathway, is overexpressed, based on mfe1- and pexW-deficient strains, fat content increases (Nat. Commun. 2014. 5:3131). Therefore, a dga1 promoter (YALI0E32769) was replaced with a TEFINt promoter, based on the SCO023 strain prepared in Example 3-1, in which the fat degradation pathway was blocked and carbon flux in fat biosynthesis increased (METAB ENG 2015. 29:56-65). A procedure for preparing a cassette for promoter replacement is as follows. To prepare the cassette capable of replacing the dga1 gene promoter, a polynucleotide sequence from SEQ ID NO: 71 and an amino acid sequence from SEQ ID NO: 72 of dga1 were obtained based on the nucleotide sequence recorded in KEGG. The cassette design for creating the dga1 promoter was carried out in the order 5'UTR-TEFINt1URA3-TEFINt2-gen(dga1) and 5'UTR, and the TEFINt1 and TEFINt2 genes were PCR-encoded using Yarrowia lipolytica PO1f genomic DNA as a template and the primers from SEQ ID NO: 73 and 74, SEQ ID NO: 75 and 76, SEQ ID NO: 79 and 80, and SEQ ID NO: 81 and 82, respectively. Additionally, PCR was performed using the URA3 auxotrophic marker as a template and the primers from SEQ ID NO: 77 and 78. PCR was performed for 35 cycles under conditions consisting of denaturation at 95 °C for 1 minute; qz LRnn / zznz / E / γALA hybridization at 55 °C for 1 minute; and polymerization at 72 °C for 1 minute and 30 seconds.As a result, dga1_5'UTR of 1539 bp, dga1_TEFINt1 of 573 bp, dga1_TEFINt2 of 571 bp, dga1_gen of 1539 bp, and dga1_URA3 of 1574 bp were obtained. The PCR-amplified DNA fragments were subjected to overlapping extension PCR to prepare the cassette for replacing the dga1 promoter. The cassette for replacing the dga1 promoter was transformed into SCO023 by heat shock and selected on a uracil-free solid medium. The primary strain thus selected was then subjected to a second crossover to prepare a strain in which the dga1 promoter was replaced with the TEFINt promoter. The deficient strain prepared in this way was designated SCO028. qz ί«ηη / ζζηζ / Ε / γΐΛΐ Table 7 SEQ ID NO: Primer Name Sequence (5-3') 73 DGA1_5'_For GTACCCGGGGATCCTCTAGAGACGAGAAACAAATCATGTG 74 DGA1_5'_Rev CGCCGCCAACCCGGTCTCTAGCI II IGI II IGTGTGACTTG 75 DGA1_TEF1_For CAAGTCACACAAAACAAAAGCTAGAGACCGGGTTGGCGGCG 76 DGA1_TEF1_Rev GACGAGTCAGACAGGAGCACTGCGGTTAGTACTGCAAAAAG 77 DGA1_URA_For CI III IGCAGTACTAACCGCAGTGCCTCCTGTCTGACTCGTC 78 DGAlURARev CGCCGCCAACCCGGTCTCTTGGTGGTATTGTGACTGGG 79 DGA1_TEF2_For CCCAGTCACAATACCACCAAGAGACCGGGTTGGCGGCG 80 DGA1_TEF2_Rev GTAGTATTGTGAGTCGATAGTCTGCGGTTAGTACTGCAAAAAG 81 DGA1_dga1_For CI III IGCAGTACTAACCGCAGACTATCGACTCACAATACTAC 82 DGA1_dga1_Rev GCCTGCAGGTCGACTCTAGATTACTCAATCATTCGGAACTC 4-2 Preparation of a cho2-deficient strain based on SCO028 (SCO048) A cho2-deficient strain was prepared based on the high-fat-producing yeast strain SCO028 prepared in Example 4-1. The cho2-deficient cassette prepared in Example 1-1 was transformed into SCO028 by heat shock and selected on a uracil-free solid medium. The primary strain thus selected was then subjected to a second cross to prepare a cho2-deficient strain. The deficient strain prepared in this way was designated SCO048. 4-3. Preparation of an op13-deficient strain based on SCO028 (SCO067) An opi3-deficient strain was prepared based on the high-fat-producing yeast strain SCO028 prepared in Example 4-1. The opi3-deficient cassette prepared in Example 1-2 was transformed into SCO028 by heat shock and selected on a uracil-free solid medium. The primary strain thus selected was then subjected to a second cross to prepare an opi3-deficient strain. The deficient strain prepared in this way was designated SCO067. 4-4. Flask test A flask test was prepared from the SCO048 and SCO067 strains prepared in Examples 4-2 and 4-3. The two strain types and SCO028 were seeded into a 250 ml corner baffle flask containing 50 ml of YLMM2 either choline-free or choline-containing 0.3 mM at an initial OD of 0.01 and each was cultured with shaking at 250 rpm and 30 °C for 72 h. The composition of YLMM2 is the same as in Examples 3-4. After the culture was completed, the culture medium was centrifuged to discard the supernatant, and the cells remaining in the bottom layer were dried in a dry oven at 60 °C overnight, followed by fat extraction. Crude fat extraction was performed according to the conventional feed analysis procedure (Feed standard analysis method. 2001. National Livestock Research Institute, Rural Development Administration), and the analyzed OD and intracellular fat content are shown below in Table 8. The results in Table 8 are from experiments performed in triplicate, and the increase in fat content was assessed using the mean of these values. Table 8 DOeoo Strain Crude Fat Content [%] Batch 1 Batch 2 Batch 3 Average Batch 1 Batch 2 Batch 3 Average SCO028 44.8 44.1 43.7 44.2 45.9 45.9 45.6 45.8 SCO028 (with CL) 43.9 44.0 44.6 44.2 45.3 45.8 46.0 45.7 SCO048 11.2 11.4 11.3 11.3 47.2 47.1 47.6 47.3 SCO048 (with CL) 43.3 43.4 45.0 43.9 52.3 54.4 49.9 52.2 SCO067 11.7 11.9 11.2 11.6 47.1 47.8 46.7 47.2 SCO067 (with CL) 44.5 44.1 44.6 44.4 50.3 50.8 50.7 50.6 As shown in Table 8, the strain in which the cho2 or op¡3se gene was deleted from the parental strain SCO028 showed equal or similar fat content in the medium that did not contain choline, but the OD was greatly reduced. When 0.3 mM choline was added to the medium, the OD recovered to the level of the control group, and the effect of increasing the fat content in the strain was also observed, as in Example 3-4. When 0.3 mM choline was added to the medium, SCO048 showed a 14% increase in fat content and SCO067 showed a 10% increase in fat content, compared to SCO028. Therefore, it was also confirmed that when an adequate amount of choline was added to the strain in which the cho2 or opi3 gene was deleted, the strain's growth was restored and, at the same time, the fat content in the strain increased. Furthermore, as described in Example 3-4, as the fat content in the strain increased, the increase in fat content decreased when the cho2 and opi3 genes were deleted. Based on the foregoing description, those skilled in the art will understand that the present disclosure may be implemented in a specific, different form without altering its technical spirit or essential characteristics. Therefore, the foregoing embodiment should be understood as not limiting but illustrative in all respects. The scope of the disclosure is defined by the appended claims rather than by the preceding description, and therefore all changes and modifications falling within the scope and limitations of the claims, or their equivalents, are intended to be covered by the claims.< / ypd>

Claims

1. A variant strain of the genus Yarrowia, characterized by the fact that the activity of phosphatidylethanolamine / V-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated.

2. The variant strain of the genus Yarrowia according to claim 1, characterized in that the phosphatidylethanolamine / V-methyltransferase is encoded by the cho2 gene and the cho2 gene consists of a polynucleotide sequence of SEQ ID NO:

1.

3. The variant strain of the genus Yarrowia according to claim 2, characterized in that the cho2 gene is deleted.

4. The variant strain of the genus Yarrowia according to claim 1, characterized in that the phospholipid methyltransferase is encoded by the opi3 gene and the opi3 gene consists of a polynucleotide sequence of SEQ ID NO:

11.

5. The variant strain of the genus Yarrowia according to claim 4, characterized in that the opi3 gene is deleted.

6. The variant strain of the genus Yarrowia according to claim 1, characterized in that the strain of the genus Yarrowia includes Yarrowia lipolytica.

7. The variant strain of the genus Yarrowia according to claim 1, characterized in that the variant strain of the genus Yarrowia is a choline auxotrophic strain.

8. The variant strain of the genus Yarrowia according to claim 1, characterized in that the variant strain of the genus Yarrowia has an increased fat content, compared to a wild type.

9. The variant strain of the genus Yarrowia according to claim 8, characterized in that the fat includes triacylglycerol (TAG). qz LAnn / zznz / E / γΐΛΐ 10. A cosmetic composition characterized in that it comprises one or more of the variant strain of the genus Yarrowia as claimed in any of claims 1 to 9, a culture of the strain, an extract of the strain, a dried product of the strain, a lysate of the strain, and a fat recovered from one or more of the strain, the culture, the extract, the dried product, and the used.

11. A food composition characterized in that it comprises one or more of the variant strain of the genus Yarrowia as claimed in any of claims 1 to 9, a culture of the strain, an extract of the strain, a dried product of the strain, a lysate of the strain, and a fat recovered from one or more of the strain, the culture, the extract, the dried product, and the used.

12. A feed composition characterized in that it comprises one or more of the variant strain of the genus Yarrowia as claimed in any of claims 1 to 9, a culture of the strain, an extract of the strain, a dried product of the strain, a lysate of the strain, and a fat recovered from one or more of the strain, the culture, the extract, the dried product, and the used.

13. A medical composition characterized in that it comprises one or more of the variant strain of the genus Yarrowia as claimed in any of claims 1 to 9, a culture of the strain, an extract of the strain, a dried product of the strain, a lysate of the strain, and a fat recovered from one or more of the strain, the culture, the extract, the dried product, and the used.

14. A method for increasing a fat in a strain, characterized in that it comprises: cultivating a variant strain of the genus Yarrowia, in which the activity of phosphatidylethanolamine / V-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated.

15. The process for increasing a fat in a strain according to claim 14, characterized in that the strain culture is the culture of the strain in a medium containing choline. qz LRnn / zznz / E / γΐΛΐ 16. The process for increasing a fat in a strain according to claim 15, characterized in that it comprises a concentration of choline in the medium of 0.05 mM to 5 mM.

17. The procedure for increasing a fat in a strain according to claim 15, characterized in that the C / N ratio in the medium is from 40 to 80.

18. The process for increasing a fat in a strain according to claim 14, characterized in that the fat includes triacylglycerol (TAG).

19. A process for preparing a fat, characterized in that it comprises: cultivating a variant strain of the genus Yarrowia, in which the activity of phosphatidylethanolamine / V-methyltransferase (PEMT) or phospholipid methyltransferase is inactivated.

20. The process for preparing a fat according to claim 19, characterized in that it further comprises: recovering the fat from the strain, a culture thereof, an extract thereof, a dry product thereof or a used portion thereof, after culturing the strain.

21. The process for preparing a fat according to claim 19, characterized in that the strain culture is the culture of the strain in a medium containing choline.

22. The process for preparing a fat according to claim 21, characterized in that the C / N ratio in the medium is from 40 to 80.

23. Use of a variant strain of the genus Yarrowia, in which the phosphatidylethanolamine V-methyltransferase (PEMT) or phospholipid methyltransferase activity is inactivated; a culture of the strain; an extract of the strain; a dried product of the strain; a lysate of the strain; a cosmetic composition, a food composition, a feed composition or a medical composition, each including one or more of the strain, culture, extract, dried product and used and a fat recovered from one or more of the strain, culture, extract, dried product and lysate in the production of fat.