p-HYDROXYPHENYLPYRUVATE DIOXYGENASE MUTANT, NUCLEIC ACID THAT ENCODES IT AND ITS USE

Abstract

The present invention relates to a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof, and an isolated polynucleotide comprising a nucleic acid sequence encoding the protein or fragment thereof, wherein the p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof retains or improves the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogenate and is significantly less sensitive to HPPD-inhibiting herbicides than a wild-type HPPD. The present invention also relates to a nucleic acid construct, an expression vector, and a host cell comprising the polynucleotide, as well as a method for producing a plant having the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogenate and significantly reduced sensitivity to HPPD-inhibiting herbicides.

Description

p-HYDROXYPHENYLPYRUVATE DIOXYGENASE MUTANT, NUCLEIC ACID THAT ENCODES IT AND ITS USE Technical field of the invention The present invention belongs to the field of agricultural genetic engineering and, in particular, relates to a new mutant p-hydroxyphenylpyruvate dioxygenase (HPPD), which confers on plants resistance or tolerance to HPPD-inhibiting herbicides, a nucleic acid that encodes them and their use. Background of the invention p-Hydroxyphenylpyruvate dioxygenases (HPPDs) are enzymes that catalyze the reaction in which hydroxyphenylpyruvate (HPP) is converted into homogenate. This reaction takes place in the presence of iron and enzyme-bound oxygen. Herbicides that work by inhibiting HPPD are well known and include several types, such as isoxazoles, diketonitriles, triketones, and pyrazoline salts. HPPD inhibition blocks the biosynthesis of plastoquinone (PQ) from tyrosine. PQ is an essential cofactor in the biosynthesis of carotenoid pigments, which are necessary for photoprotection of the photosynthetic center. Herbicides that inhibit HPPD are bleaching agents that can move through the phloem, causing new meristems and light-exposed leaves to appear white. In the absence of carotenoids, chlorophyll is photodestructible and becomes a photochemical cleavage agent by photosensitization of singlet oxygen. Technical routes and methods for providing plants tolerant to HPPD-inhibiting herbicides are also known, including overexpression of the HPPD enzyme to produce quantities of the HPPD enzyme in the plant that are fully relevant to a given herbicide, so that the plant has sufficient functional enzyme available despite the presence of its inhibitor, or mutation of the target HPPD enzyme into a functional HPPD that is less sensitive to the herbicide. HPPD-inhibiting herbicides are a large class covering many different types. While a particular HPPD enzyme may provide a useful level of tolerance to some HPPD-inhibiting herbicides, it may be quite inadequate to provide commercially viable levels of tolerance to a different, more desirable HPPD-inhibiting herbicide (see, for example, US Application Publication No. 2004 / 0058427 and PCT Application Publication No.WO 98 / 20144 and WO 02 / 46387; see also Application Publication US No. 2005 / 0246800, which refers to the identification and marking of soybean varieties that are relatively resistant to HPPD). Furthermore, different HPPD-inhibiting herbicides may differ in terms of the weed varieties they control, the crops to which they are applied, their manufacturing costs, and their environmental benefits. Therefore, there is still a need in the art for a new HPPD mutant that confers resistance / tolerance to HPPD-inhibiting herbicides for different crops and crop varieties. Transgenic technology has been widely used to create herbicide-tolerant crops and crop varieties. However, the use of genetically modified crops has been limited due to high registration costs, and this situation may change due to advances in gene-editing techniques, among which CRISPR / Cas9 is a prime example. CRISPR / Cas9 is a new site-directed gene editing technique that has emerged since 2012 (Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, JA, and Charpentier, E. 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337: 816-821.; Cong, L., Ran, FA, Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, PD, Wu, X., Jiang, W., Marraffini, LA, and Zhang, F. 2013. Multiplexgenome engineering using CRISPR / Cas Systems Science. Zhang, D., Bush, J., Church, G.M., and Sheen, J. 2013.Multiplexing and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat. Biotechnol. 31: 688.; Mali, P., Yang, L., Esvelt, KM, Aach, J., Guell, M., Dicarlo, JE, Norville, JE, and Church, GM 2013. RNA-guided human genome engineering via Cas9. Science. 339: 823). Recognition of a target edited by the CRISPR / Cas9 system is based on base pairing between nucleic acid molecules. The system can edit any 20 bp target sequence immediately adjacent to PAM (NGG). Furthermore, the CRISPR / Cas9 system is easy to operate and only requires replacing the 20–30 bp target nucleotide sequence in a new vector for each target, which is suitable for high-throughput operations. The system can simultaneously edit multiple sites of the same gene, as well as multiple different genes.Currently, this technique has shown great potential for use in biomedicine, functional genomics, trait improvement and creation of new traits in animals and plants, and has a revolutionary role in facilitating the improvement of animals and plants (Huí Zhang, Jinshan Zhang, Zhaobo Lang, José Ramón Botellad, and Jian-Kang Zhu. 2017. Genome Editing—Principles and Applications for Functional Genomics Research and Crop Improvement, Critical Reviews in Plant Sciences, 36:4, 291-309, DOI:10.1080 / 07352689.2017. 1402989). As a third-generation gene-editing tool, CRISPR / Cas9 performs site-directed editing in three main ways. First, site-directed gene knockout to produce mutants. Specifically, Cas9 recognizes and cleaves target sites under the direction of guide RNA (gRNA) to generate double-strand DNA breaks. DNA breaks are typically repaired by non-homologous end junctions (NHEJs), and frameshift mutations readily occur during the repair process, resulting in gene destruction. The efficiency of site-directed gene knockout is high. Second, homologous substitution of a target to replace the target sequence or achieve site-directed insertion. In the case of double-strand DNA breaks, if a homologous repair template is present, homologous replacement or site-directed insertion can occur.The efficiency of homologous substitution is lower and becomes much lower as the length of a sequence to be replaced increases. Third, the third approach is base editing (Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. 2016 May 19; 533(7603):420-4. doi: 10.1038 / nature17946; Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR. Programmable base editing of Α·Τ to G«C in genomic DNA without DNA cleavage. 2017 Nov 25. Erratum in:. CQ / yzn / Lznz / q / Yl· Nature. 2018 May 2). Base editing is a gene-editing method that uses the CRISPR / Cas9 system to direct deaminase to a specific site in the genome to modify a specific base. This method has been successfully applied to rice. For example, Yan F., Kuang Y., Ren B., Wang J., Zhang D., Lin H., Yang B., Zhou X., and Zhou H. (2018). High-efficient AT to GC base editing by Cas9n-guided tRNA adenosine deaminase in rice. Mol. Plañí, doi: 10.1016 / j.molp.2018.02.008. On the other hand, CRISPR / Cpf1 can also be used for gene editing (Zetsche, B., Gootenberg, JS, Abudayyeh, OO, Slaymaker, IM, Makarova, KS, Essletzbichler, P., Volz, SE, Joung, J., Oost, J., Regev, A., Koonin, EV, and Zhang, F. 2015. Cpf1 is a single RNA-guided endonuclease ota Class 2 CRISPR Cas System 163: 759-771; Endo, A., Masafumi, M., Kaya, H., and Toki, S. 2016a. CRISPR / Cpf1 contains two main components, the Cpf1 enzyme and the crRNA that determines the specificity of the system.Although the CRISPR / Cpf1 system is similar to the CRISPR / Cas9 system, there are some important differences between them (Huí Zhang, Jinshan Zhang, Zhaobo Lang, José Ramón Botella & Jian-Kang Zhu (2017) Genome Editing - Principles and Applications for Functional Genomics Research and Crop Improvement, Critical Reviews in Plant Sciences, 36:4, 291-309, DOI:10.1080 / 07352689.2017.1402989). First, the CRISPR / Cpf1 system does not require a trans-action crRNA (tracrRNA), which is necessary for the CRISPR / Cas9 system. Second, the CRISPR / Cpf1 system is relatively short, consisting of only 42-44 nucleotides, comprising a 19-nucleotide repeat and a 23-25 ​​nucleotide spacer.Third, unlike Cas9, which cleaves a double-stranded DNA sequence at the same position (3–4 bp upstream of PAM) to produce a blunt end, Cpf1 cleaves a target sequence 23 bp downstream of the PAM sequence and a non-target single strand 18 bp downstream of the PAM sequence to produce a sticky end with a 5 bp overhang. The resulting sticky end can increase the efficiency of HDR-mediated insertion of donor DNA at Cpf1 cleavage sites. Fourth, the CRISPR / Cpf1 system requires only one promoter to handle multiple arrays of small crRNAs when editing multiple targets or genes, making it ideal for multi-target editing.Fifth, the CRISPR / Cas9 system requires a G-rich PAM sequence (5'-NGG-3j) at the 3' end of a target sequence, whereas CRISPR / Cpf1 requires a T-rich PAM sequence (5'-TTTN-3' or 5-TTN-3) at the 5' end of a target sequence and is suitable for editing multiple DNA or A / T genes. Currently, three CRISPR / Cpf1 engineering systems have been developed, including FnCpfl from Francisella novicida, AsCpfl from Acidaminococcus sp., and LbCpfl from Lachnospiraceae bacteria. All three Cpf1 systems have been used for plant genome editing in several species, including rice, Arabidopsis, tobacco, and soybean (Endo, A., Masafumi, M., Kaya, H., and Toki, S. 2016a. Efficient targeted mutagenesis of rice and tobacco genomes using Cpfl from Francisella novicida. Sci Rep 6: 38169; Kim, H., Kim, ST, Ryu, J., Kang, BC, Kim, JS, and Kim, SG 2017. CRISPR / Cpf1-mediated DNA-free plant genome editing. Nat. Commun. 8: 14406.; Tang, X., Lowder, L.G., Zhang, T., Malzahn, A. A., Zheng, X., Voytas, D. F., Zhong, Z., Chen, Y., Ren, Q., and Li, Q. 2017. A CRISPR-Cpf1 System for efficient genome editing and. CQ7 / 7Π / Ι 707 / 3 / Yl· transcriptional repression in plañís. Nat. Plants. 3: 17018.; Wang, M., Mao, Y., Lu, Y., Tao, X., and Zhu, J. K. 2017a. Multiplexgene editing in rice using the CRISPR-Cpf1 system. Mol. Plant. 10: 1011-1013). Currently, one of the research goals in the field of gene editing is how to improve the herbicide tolerance of important crops through gene-edited homologous substitution, site-directed modification, or single-base editing. Several successful examples have been reported; however, most focus on tolerance to acetolactate synthase (ALS) inhibitor herbicides (Yongwei Sun, Xin Zhang, Chuanyin Wu, Ubing He, Youzhi Ma, Han Hou, Xiuping Guo, Wenming Du, Yunde Zhao, and Lanqin Xia. 2016. Engineering Herbicide-Resistant Rice Plants through CRISPR / Cas9-Mediated Homologous Recombination of Acetolactate Synthase. Molecular Plant 9, 628–631 doi.org / 10.1016 / j.molp.2016.01.001; Yiyu Chen, Zhiping Wang, Hanwen Ni, Yong Xu, Qijun Chen, Linjian Jiang. 2017. CRISPR / Cas9-mediated base-editing system efficiently generates gain-of-function mutations in Arabidopsis. Sci China Life Sci 60. doi: 10.1007 / s11427-017-9021-5) and glyphosate herbicides (document WO 2017028768A1). Consequently, there is a need for scientists to continue researching and developing new approaches to improve crop tolerance to different types of herbicides. Brief description of the invention In view of the foregoing, the present invention provides a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) that confers resistance or tolerance to HPPD-inhibiting herbicides to plants. This mutant HPPD retains or improves the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) in homogenate and is significantly less sensitive to HPPD-inhibiting herbicides than a wild-type HPPD. The present invention also relates to a bioactive fragment of the mutant p-hydroxyphenylpyruvate dioxygenase, a polynucleotide encoding the protein or a fragment thereof, and its use. Accordingly, in one aspect, the present invention provides a mutant phydroxyphenylpyruvate dioxygenase (HPPD) protein, having one or more of the mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 1911, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 3901, 392L, 403G, 4101, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L in one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild type rice p-hydroxyphenylpyruvate dioxygenase protein as indicated in SEQ ID NO: 2.Preferably, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence as set forth in SEQ ID NO: 2. More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence as set forth in SEQ ID NO: 2, except that it has one or more amino acid mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 1911, 220K. CQ / yzn / Lznz / q / Yl· 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 3902L, 403G, 4101, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L in one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of the wild type rice p-hydroxyphenylpyruvate dioxygenase protein as set out in SEQ ID NO: 2. In another aspect, the present invention provides a bioactive fragment of the mutating p-hydroxyphenylpyruvate dioxygenase (HPPD) protein, the fragment of which lacks a residue of one or more (e.g., 1-50, 1-25, 1-10 or 1-5, e.g., 1,2, 3, 4 or 5) amino acid residues at the N and / or C end of the protein, but still retains the desired biological activity of the full-length protein, i.e., the fragment retains or improves the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) in homogenate and is significantly less sensitive to HPPD-inhibiting herbicides than a wild-type HPPD or a corresponding bioactive fragment thereof. The present invention further relates to a fusion protein comprising the mutating phydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to the present invention and an additional component fused to it, for example, a peptide or polypeptide component. Preferably, the component imparts desired properties to the fusion protein, for example, by facilitating its isolation and purification, increasing its stability, extending its half-life, providing additional biological activity, and directing the fused HPPD protein to a target region, such as a plastid, for example, chloroplasts. Options for the corresponding component are well known to a person skilled in the art. In another aspect, the present invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding the mutating p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof or the fusion protein. The present invention further provides a nucleic acid construct comprising the polynucleotide and a regulatory element operatively attached thereto. In an additional aspect, the present invention provides an expression vector comprising the polynucleotide and an expression regulator operatively linked thereto. In another aspect, the invention provides a host cell comprising the polynucleotide, nucleic acid construct, or expression vector. The present invention also provides a method for producing a plant that has improved resistance or tolerance to HPPD-inhibiting herbicides. The present invention also relates to a plant produced by the above method. The present invention also provides a method for improving the resistance or tolerance of a plant to HPPD-inhibiting herbicides, comprising expressing the mutating p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof or the fusion protein according to the present invention in the plant. The present invention further provides a method for improving the resistance or tolerance of a plant to HPPD-inhibiting herbicides, comprising crossing a plant expressing the mutating p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof or the fusion protein according to the present invention with another plant. The present invention further provides a method for improving the resistance or tolerance of a plant to HPPD-inhibiting herbicides, comprising gene editing of an endogenous HPPD protein gene of the plant cell, plant tissue, part of the plant or plant. The present invention also relates to the use of the mutating p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof or the fusion protein according to the present invention to improve the resistance or tolerance of a plant to HPPD-inhibiting herbicides. The present invention also relates to a method for controlling weeds in a plant cultivation site, comprising applying to a site comprising the plant or seed according to the present invention an effective herbicidal quantity of one or more HPPD-inhibiting herbicides, without significantly affecting the plant. Description of figures Figure 1 shows the color reaction of a culture medium of recombinant E. coli transformed with a wild-type or mutant rice HPPD gene grown in a 96-well plate, wherein recombinant E. coli expresses the wild-type (WT) rice HPPD or one of the single-site mutant rice HPPDs, and recombinant E. coli is grown in a culture medium containing a herbicide, tembotrione (left) or a metabolite of benzufucaotong (right, having a structural formula of CQ / yzn / Lznz / q / Yl· at different concentrations, showing different degrees of color change. In the wells with the herbicide at the same concentration, the darker the color, the greater the resistance / tolerance to this herbicide. Figure 2 shows the color reaction of a culture medium containing recombinant E. coli transformed with a wild-type or mutant rice HPPD gene grown in a 96-well plate. The recombinant E. coli expresses either the wild-type (WT) rice HPPD or each of the single-site mutant rice HPPDs. The recombinant E. coli is cultured in a medium containing either the herbicide huanbifucaotong (left) or topramezone (right) at different concentrations, resulting in varying degrees of color change. In wells containing the herbicide at the same concentration, the darker the color, the greater the resistance / tolerance to that herbicide. Figure 3 shows the color reaction of a culture medium containing recombinant E. coli transformed with a wild-type or mutant rice HPPD gene grown in a 96-well plate. The recombinant E. coli expresses either the wild-type (WT) rice HPPD or each of the single-site mutant rice HPPDs. The culture medium contains the herbicide mesotrione at different concentrations, resulting in varying degrees of color reaction. In wells containing the herbicide at the same concentration, the darker the color, the greater the resistance / tolerance to this herbicide. Figure 4 shows the color reaction of a culture medium of recombinant E. coli transformed with a wild-type or mutant rice HPPD gene grown in a 96-well plate, where recombinant E. coli expresses wild-type (WT) rice HPPD or a single-site mutant HPPD comprising a mutation of H141R, G342D, or D370N, or a combination thereof, and recombinant E. coli is grown in a culture medium containing a herbicide, tembotrione (top) or a metabolite of benzufucaotong (bottom), at different concentrations, showing different degrees of color change. In the wells with the herbicide at the same concentration, the darker the color, the greater the resistance / tolerance to this herbicide. Figure 5 shows the color reaction of a culture medium of recombinant E. coli transformed with a wild-type or mutant rice HPPD gene grown in a 96-well plate, wherein recombinant E. coli expresses wild-type (WT) rice HPPD or a single-site mutant HPPD comprising a mutation of H141R, G342D, or D370N or a combination thereof (where 141 + 342 represents H141R / G342D; 141 + 370 represents H141R / D370N; 342 + 370 represents G342D / D370D; and 141 + 342 + 370 represents H141R / G342D / D370N), and recombinant E. coli is grown in a culture medium containing a herbicide, huanbifucaotong (above), or a metabolic product of Topramezone (below), at different concentrations, showing varying degrees of color change. In the wells with the herbicide at the same concentration, the darker the color, the greater the resistance / tolerance to this herbicide. Figure 6 shows the color reaction of a culture medium of recombinant E. coli transformed with a wild-type or mutant rice HPPD gene grown in a 96-well plate, wherein recombinant E. coli expresses wild-type (WT) rice HPPD or a single-site mutant HPPD comprising a mutation of H141R, G342D or D370N or a combination thereof in the culture medium, and recombinant E. coli is grown in a culture medium containing a herbicide, mesotrione, at different concentrations, showing different degrees of color change in the wells with the herbicide at the same concentration; the darker the color, the greater the resistance / tolerance to this herbicide. Figure 7 shows all amino acid mutations observed in the HPPD protein of wild-type rice. Figure 8 shows the color reaction of a culture medium of recombinant E. coli transformed with a mutant rice HPPD gene grown in a 96-well plate, wherein recombinant E. coli expresses a mutant HPPD comprising various combinations of mutations at nearby positions 336-338-342-346 and the combination of 141R + 342D + 370N (where 336D, 338D, 338S, 338Y, 342D, 346C, 346H and 346S represent P336D, N338D, N338S, N338Y, G342D, R346C, R346H and R346S), respectively; 141R + 342D + 370N represents H141R / G342D / D370N) in the culture medium, and recombinant E. coli is grown in a culture medium containing a herbicide, a product CQ / / 7n / L7nZ / q / YI¡ shuangzuocaotong metabolite (with a code number of 101, which has a structural formula ), at different concentrations, showing different degrees of color change. In the wells with the herbicide at the same concentration, the darker the color, the greater the resistance / tolerance to this herbicide. Figure 9 shows the color reaction of a culture medium of recombinant E. coli transformed with a mutant rice HPPD gene grown in a 96-well plate, wherein recombinant E. coli expresses a mutant HPPD comprising various combinations of mutations at 3 or 4 positions (where 141R, 336D, 338D, 338S, 338Y, 342D, 346C, 346S, 346H, 370N, 418P and 419F represent H141R, P336D, N338D, N338S, N338S, N338Y, R346C, R346S, R346H, R336) G419F, respectively) in the culture medium, and recombinant E. coli is grown in a culture medium containing a herbicide, a metabolic product of shuangzuocaotong, at different concentrations, showing different degrees of color change. In the wells with the herbicide at the same concentration, the darker the color, the greater the resistance / tolerance to this herbicide. Figure 10 shows the inhibition curves of wild-type OsHPPD and various mutants by the metabolic product of shuangzuocaotong, where the abscissa indicates the concentration of compound 101, the ordinate indicates the residual enzyme activity at different concentrations of compound 101 (the reaction rate is 100% at an inhibitor concentration of 0), and the numbers in the figure represent the various mutation sites. The figure shows that wild-type OsHPPD is extremely sensitive to compound 101, with activity completely inhibited at a concentration of approximately 60 M of compound 101, and each mutant exhibits significantly increased resistance.Based on the results, the IC50 value can be calculated, which expresses the inhibition of each mutant's activity by compound 101, similarly confirming that each mutant shows significantly improved resistance compared to wild-type OsHPPD (where 141R, 338D, 342D, 346C, 346H, 370N, 386T, 418P, 419F, and 420S stand for H141R, N338D, G342D, R346C, R346H, D370N, P386T, K418P, G419F, and N420S, respectively). Figure 11 shows the sensitivity of transgenic rice (Zhonghua 11) to the HPPD-inhibiting herbicide tembotrione. Rice expressing the OsHPPD3M mutant (H141R / G342D / D370N) can remain green in a culture medium containing 3 μM of tembotrione, but the seedling expressing mCherry as a negative control (CK) also bleaches severely in a 1.0 M tembotrione culture medium (phytotoxicity). Figure 12 shows the tolerance of transgenic rice (Zhonghua 11) to the HPPD-inhibiting herbicide, shuangzuocaotong. Generation T0 plants expressing the OsHPPD3M rice mutant are tolerant to 8–16 grams of shuangzuocaotong as the active ingredient per mu, but non-transgenic controls (CK) die shortly after severe bleaching (A, B); Generation T1 plants expressing the OsHPPD3M rice mutant are tolerant to 32–64 grams of shuangzuocaotong as the active ingredient per mu, but non-transgenic controls die shortly after severe bleaching (C, D). Figure 13 shows a base editing vector of the rice HPPD gene. Figure 14 shows a base-edited rice seedling and a target H141R sequence analysis (CAC > CGC) of the same. A: The edited seedlings at the base: In the culture medium containing 0.4 M tembotrione, seedlings that are not edited correctly are bleached (phytotoxicity) and those that are successfully edited remain green. B: The base-edited target sequence: The amino acid at position 141 of wild-type rice HPPD is histidine (His), and the corresponding codon is CAC (the panel above), whereas, after editing, the corresponding amino acid is arginine (Arg), and the corresponding codon is CGC (the example is a hybrid, and there is a double peak). Figure 15 shows the structure of the rice hppd gene (Oshppd> NC029257.1), which shows two exons, one intron, three mutation sites (141, 342, 370) and engineered targeting excision sites (gRNA1-2, gRNA2-1). Figure 16 shows the structure of the template DNA, where the length of the core replacement region for the three mutated amino acids 141-342-370 is 1056 bp, the left and right homology arms are each 350 bp long, 6 bp is left at each of the left and right ends after vector division, and the total template length is 1768 bp; to facilitate rapid genotyping of the PCR product after PCR amplification, the Ncol cleavage site is removed; and to prevent re-cleavage after substitution, the PAM (NGG) at the original cleavage site in the template is also removed. Figure 17 shows the three homologously substituted mutation sites (H141R-G342DD370N) of the rice HPPD gene. A: Rice HPPD gene-edited seedlings: In culture medium containing 0.4 pM tembotrione, the unsuccessfully edited seedlings (wild-type WT) bleach (phytotoxicity) and the successfully edited ones (two seedlings: AW2 and AW3) remain green; B: After homologous substitution, the codons corresponding to amino acid positions 342 and 370 change, i.e., GGC becomes GAC and GAC becomes AAC (a hybrid; leading to partial G342D and D370N); H141R (CAC > CGC) is also successfully edited (the sequence is not listed in the figure). Detailed description of the invention Some terms used in the specification are defined below. In the present invention, the term “HPPD-inhibiting herbicide” refers to a substance that has herbicidal activity per se or a substance used in combination with other herbicides and / or additives that may alter its effect, and the substance can act by inhibiting HPPD. Substances capable of producing herbicidal activity by inhibiting HPPD are well known in the art. CQ / yzn / Lznz / q / Yl· including many types: 1) triketones, for example, sulcotrione (CAS No.: 99105-77-8), mesotrione (CAS No.: 104206-82-8), bicyclopyrone (CAS No.: 352010-68-5), tembotrione (CAS No.: 33510484-2), tefuryltrione (CAS No.: 473278-76-1), benzobicyclone (CAS No.: 156963-66-5); 2) diketonitriles, for example, 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-4-trifluoromethylphenyl)propane-1,3-dione (CAS No.: 143701-75-1), 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-3,4-dichlorophenyl)propane-1,3-dione (CAS No.: 212829-55-5), 2-cyano-1-[4-(methylsulfonyl)-2-trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione (CAS No.: 143659-52-3); 3) isoxazoles, for example, isoxaflutol (CAS No.: 141112-29-0); isoxachlortol (CAS No.: 141112-06-3), clomazone (CAS No.: 81777-89-1); 4) pyrazoles, for example, topramezone (CAS No.: 210631-68-8); pyrazulfotol (CAS No.: 365400-11-9), pyrazoxyphene (CAS No.: 71561-11-0); pyrazolate (CAS No.: 58011-68-0), benzofenap (CAS No.CAS: 82692-44-2), shuangzuocaotong (CAS No.: 1622908-18-2), tolpiraclate (CAS No.: 1101132-67-5), benzuofucaotong (CAS No.: 1992017-55-6), and CAS (CAS No. 55-6). 1855929-45-1), sanzuohuangcaotong (CAS No.: 1911613-97-2); 5) benzophenones; 6) others: lancothrione (CAS No.: 1486617-21-3), fenquinotryone (CAS No.: 1342891-70-6). Preferably, such herbicides are tembotrione, benzuofucaotong, huanbifucaotong, topramezone, mesotrione, shuangzuocaotong or any combination thereof and the like. Plants with “enhanced tolerance to HPPD-inhibiting herbicides” or “enhanced resistance to HPPD-inhibiting herbicides” refer to plants that exhibit greater tolerance or resistance to such HPPD-inhibiting herbicides compared to plants with wild-type HPPD genes. HPPD enzymes with “enhanced tolerance to HPPD-inhibiting herbicides” or “enhanced resistance to HPPD-inhibiting herbicides” refer to HPPD enzymes that exhibit enzymatic activity that is at least 10%, preferably at least 15%, and more preferably at least 20%, higher than wild-type HPPD enzymes at herbicide concentrations known to inhibit the activity of the corresponding wild-type HPPD enzyme protein.In the present invention, the expressions “tolerance to HPPD-inhibiting herbicide” and “resistance to HPPD-inhibiting herbicide” are used interchangeably and both refer to tolerance to HPPD-inhibiting herbicides and resistance to HPPD-inhibiting herbicides. The expression “wild type” refers to an existing nucleic acid or protein molecule that can be found in nature. The terms “protein,” “polypeptide,” and “peptide” may be used interchangeably in the present invention and refer to a polymer of amino acid residues, including polymers of chemical analogues in which one or more amino acid residues are naturally occurring amino acid residues. The proteins and polypeptides of the present invention may be produced recombinantly or synthesized chemically. The terms “mutant protein” or “mutant protein” refer to a protein having substitutions, insertions, deletions, and / or additions of one or more amino acid residues compared to the amino acid sequence of a corresponding wild-type protein. The terms “polynucleotide” and “nucleic acid” are used interchangeably, including DNA, RNA, or their hybrids, which are either double-stranded or single-stranded. In the present invention, “host organism” is understood to mean any single or multicellular organism into which a nucleic acid encoding a mutating HPPD protein can be introduced, including, for example, bacteria such as Escherichia coli, fungi such as yeasts (e.g., Saccharomyces cerevisiae), molds (e.g., Aspergillus), plant cells, plants, and the like. In the present invention, “plant” is to be understood as any differentiated multicellular organism capable of performing photosynthesis, in particular monocot or dicot plants, for example, (1) forage crops: Oryza spp.; Triticum spp., such as Triticum aestivum, T. Turgidumssp. durum; Hordeum spp., such as Hordeum vulgare, Hordeum arizonicum; Cereal scale; Oats spp., such as Avena sativa, Avena fatua, Avena byzantine, Avena fatua var. sativa, Hybrid oats; Echinochloa spp., such as Pennisetum glaucum, Sorghum, Sorghum bicolor, Sorghum vulgare, Triticale, Zea mays or maize, millet, rice, Foxtail millet, Proso millet, Sorghum bicolor, Panicum, Fagopyrum spp., Panicum miliaceum, Setaria italica, Zizania palustris, Eragrostís tef, Panicum miliaceum, Eleusine coracana; (2) legumes: Glycine spp. such as Glycine max, Soybean hispid, Soybean max, Vicia spp., Vigna spp., Pisum spp., beans, Lupinus spp., Vicia, Tamarindus indica, Lensculinaris, Lathyrus spp., Lablab, beans, mungo beans, red beans, garbanzo; (3) oleaginous crops: Arachis hypogaea, Arachis spp., Sesamum spp., Helianthus spp. such as Helianthus annuus, Elaeis such as Elaeis guineensis, Elaeis oleífera, soja, Brassicanapus, Brassica olerácea, Sesamum orientale, Brassica júncea, oilseed rape, Camellia oleífera, oil palm, olive, castor oil plant, Brassica napus L., canola; (4) fibrous crops: Agave sisalana, Gossypium spp. such as Gossypium, Gossypium barbadense, Gossypium hirsutum, Hibiscus cannabinus, Agave sisalana, Musa textilis Nee, Linum usitatissimum, Corchorus capsularis L, Boehmeria nivea (L), Cannabis sativa, Cannabis sativa; (5) fruit crops: Ziziphus spp., Cucumis spp., Passiflora edulis, Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Púnica granatum, Malus spp., Citrullus lanatus, Citrus spp., Ficus carica, Fortune lia spp., Fragaria spp., Crataegus spp., Diospyros spp., Eugenia unifora, Eriobotrya japonica, Dimocarpus longan, Carica papaya, Cocos spp., Averrhoa carambola, Actinidia spp., Prunus amygdalus, Musa spp. (musa acuminate), Persea spp. (Persea Americana), Psidium guajava, Mammea Americana, Mangifera indica, Canary Island album (Olea europaea), Caricapapaya, Cocos nucifera, Malpighia emarginata, Manilkara zapota, Ananas comosus, Annona spp., Citrus reticulata (Citrus spp.), Artocarpus spp., Litchi chinensis, Ribes spp., Rubus spp., pear, peach, apricot, plum, red mulberry, lemon, kumquat, duran, orange, strawberry, blueberry, hami melon, melon, date palm, walnut, cherry; (6) rhizome crops: Manihot spp., Ipomoea batatas, Colocasia esculenta, tuber mustard, Allium cepa (onion), Eleocharis tuberose, Cyperus rotundas, Rhizoma dioscoreae; (7) vegetables: Spinacia spp., Phaseolus spp., Lactuca sativa, Momordica spp., Petroselinum crispum, Capsicum spp., Solanum spp. (such as Solanum tuberosum, Solanum integrifolium, Solanum lycopersicum), Lycopersicon spp. (such as Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Kale, Luffa acutangula, lentils, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, carrot, cauliflower, celery, collard greens, Benincasa hispida, Asparagus officinalis, Apium graveolens, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia, Cucurbita spp., Coriandrum sativum,. B.carínata, Rapbanus sativus, Brassica spp. (tales como Brassica napus, Brassica rapa ssp., cañóla, colza oleaginosa, nabos, coles, coles de Bruselas, solanáceas (berenjenas), Capsicum annuum (pimientos), pepinos, luffas, coles chinas, coles, repollos, calabazas, loto, raíz de loto, lechuga; (8) cultivos de flor: Tropaeolum minus, Tropaeolum majus, Carina indica, Opuntia spp., Tagetes spp., Cymbidium (orquídea), Crínum asiaticum L., Olivia, Hippeastrum rutilum, Rosa rugosa, Rosa Chinensis, Jasmínum sambac, Tulipa gesneríana L., Cerasus sp., Pharbitís níl (L.) Choisy, Caléndula officinalis L, Nelumbo sp., Bellis perennis L., Dianthus caryophyllus, Petunia hybrída, Tulipa gesneríana L, Lilium brownie, Prunus mume, Narcissus tazetta L, Jasmínum nudiflorum Lindl., Primula malacoides, Daphne odora, Carne ¡lia japónica, Michelia alba, Magnolia liliiflora, Viburnum macrocephalum, Olivia miniata, Malus spectabilis, Paeonia suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii, Rhododendron hybridum, Michelia figo (Lour.) Spreng., Cercis chinensis, Kerría japónica, Weigela florida, Fructus forsythiae, Jasmínum mesnyi, Parochetus communis, Cyclamen persicum Mili., Phalaenophsís hybrid, Dendrobium nobile, Hyacinthus orientalis, Iris tectorum Maxim, Zantedeschia aethiopica, Caléndula officinalis, Hippeastrum rutilum, Begonia semperflorenshybr, Fuchsia hybrid, Begonia maculata Raddi, Geranium; (9) medicinal crops: Carthamus tinctorius, Mentha spp., Rheum rhabarbarum, Crocus sativus, Lycium chinense, Polygonatum odoratum, Polygonatum Kingianum, Anemarrhena asphodeloides Bunge, Radix ophiopogonis, Fritillaria cirrhosa, Cúrcuma aromatica, Amomum villosum Lour., Poíygonum multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, Astragalus membranaceus, Panax ginseng, Panax notoginseng, Acanthopanax gracilistylus, Angélica sinensis, Ligusticum wallichii, Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha haplocalyx, Leonurus sibirícus L., Agastache rugosus, Scutellaria baicalensis, Prunella vulgarís L., Pyrethrum carneum, Ginkgo biloba L., Cínchona ledgeriana, Hevea brasilíensís (wíld), Medicago sativa Linn, Piper Nigrum L.; (10) cultivars of raw materials: Hevea brasilíensís, Ricinus communis, Vernicia fordii, Morus alba L., Hops Humulus lupulus, Betula, Alnus cremastogyne Burk., Rhus vemicíflua stokes; (11) pasture cultivars: Agropyron spp., Trífolium spp., Míscanthus sinensis, Pennisetum sp., Phalarís arundinacea, Panicum virgatum, praíríegrasses, Indiangrass, Big bluestem grass, Phleum pratense, turf, cyperaceae (Kobresia pygmaea, Carex pediformis, Carex humílís), Medicago sativa Linn, Phleum pratense L., Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Crotalaria júncea, Sesbania cannabina, Azolla imbibercata, Eichhornia crassipes, Amorpha fruticosa, Lupinus micranthus, Trífolium, Astragalus adsurgens pall, Pistia stratiotes linn, Alternanthera philoxeroides, Lolium; (12) sugar crops: Saccharum spp., Beta vulgarís; (13) drink crops: Camellia sinensis, Camellia Sinensis, tea, coffee (Coffea spp.), Theobroma cacao, Humulus lupulus Linn.; (14) grass plants: Ammophila arenaria, Poa spp. (Poa pratensis (bluegrass)), Agrostis spp. (Agrostis matsumurae, Agrostis palustrís), Lolium spp. (Lolium), Festuca spp. (Festuca ovina L.), Zoysía spp. (Zoysiajaponica), Cynodon spp. (Cynodon dactylon / bermudagrass), Stenotaphrum secunda tum (Stenotaphrum secundatum), Paspalum spp., Eremochloa ophiuroides, Axonopus spp., Bouteloua dactyloides, Bouteloua var. spp.(Bouteloua gracilis), Digitaria sanguinalis, Cyperusrotundus, Kyllingabrevifolia, Cyperusamuricus, Erigeron canadensis, Hydrocotylesibthorpioides, Kummerowiastriata, Euphorbia humifusa, Viola arvensis, Carex rígescens, Carex heterostachya, turf; (15) tree crops: Pinus spp., Salix spp., Acer spp., Hibiscus spp., Eucalyptus. CQ / yzn / Lznz / q / Yi spp., Ginkgo biloba, Bambusa sp., Populus spp., Prosopis spp., Quercus spp., Phoenix spp., Fagus spp., Ceiba pentandra, Cinnamomum spp., Corchorus spp., Phragmites australis, Physalis spp., Desmodium spp., Populus, Iderá helix, Populus tomentosa Carr, Viburnum odoratissinum, Ginkgo biloba L., Quercus, Ailanthus altissima, Schima superba, ílex purpurea, Platanus acerífolia, ligustrum lucídum, Buxus megistophylla Lev!., Dahurian larch, Acacia mearnsii, Pinus massoniana, Pinus khasys, Pinusyunnanensis, Pinus fínlaysoniana, Pinus tabuliformis, Pinus koraiensis, Juglans nigra, Citrus limón, Platanus acerífolia, Syzygium jambos, Davidia involucrate, Bombax malabarica L., Ceiba pentandra (L), Bauhinia blakeana, Albizia saman, Albizzia julíbríssin, Erythrína corallodendron, Erythrína indica, Magnolia gradíflora, Cycas revolute, Lagerstroemia indica, conifers, macrophanerophytes, Bush; (16) cultivation of nuts: Bertholletia excelsea, Castanea spp., Corylus spp., Carya spp., Juglans spp., Pistacia vera, Anacardium occidentale, Macadamia (Macadamia integrifolia), Carya illinoensis Koch, Macadamia, Pistachio, Badam, other nut-producing plants; (17) others: Arabidopsis thaliana, Brachiaria eruciformis, Cenchrus echinatus, Setaria faberí, Eleusine indica, Cadaba farinosa, aígae, Carex elata, ornamental plants, Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, Melilotus spp., Morus nigra, Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, Sambucas spp., Sinapis sp., Syzygium spp., Tripsacum dactyloides, Triticosecale rímpaui, Viola odorata, and similar. In the present invention, the expression “plant tissue” or “plant part” includes plant cells, protoplasts, plant tissue cultures, plant calluses, plant blocks and plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, nuclei, spikes, roots, root tips, anthers, etc. In the present invention, “plant cell” shall be understood to mean any cell derived from or found in a plant that is capable of forming, for example, an undifferentiated tissue such as callus, a differentiated tissue such as an embryo, a plant part, a plant, or a seed. For terms relating to amino acid substitutions used in the descriptive report, the first letter represents a naturally occurring amino acid at a specific position in a particular sequence, the following number represents the position corresponding to SEQ ID NO: 2, and the second letter represents a different amino acid that substitutes for the naturally occurring amino acid. For example, A103S indicates that alanine at position 103 is substituted with serine relative to the amino acid sequence of SEQ ID NO: 2. For an amino acid substitution where the first letter is absent, it means that, relative to the amino acid in the wild-type protein's acid sequence, the naturally occurring amino acid at the position corresponding to SEQ ID NO: 2 is substituted by the amino acid represented by the second letter after the number. For double or multiple mutations, each mutation is separated by 7".For example, H141R / G342D / D370N means that, relative to the amino acid sequence of SEQ ID NO: 2, histidine at position 141 is substituted with arginine, glycine at position 342 is substituted with aspartic acid, and aspartic acid at position 370 is substituted with asparagine, and all three mutations are present in the specific mutant HPPD protein. cqj / zn / Lznz / q / Yii In one aspect, the present invention describes a mutant HPPD protein or a bioactive fragment thereof, which retains the activity to catalyze the conversion of p-hydroxyphenylpyruvate (HPP) into homogenate while having improved resistance or tolerance to HPPD-inhibiting herbicides, compared to a wild-type p-hydroxyphenylpyruvate dioxygenase protein.In particular, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein according to the present invention has one or more of the mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 1911, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 3901, 392L, 403G, 4101, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L in one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 370, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild type rice p-hydroxyphenylpyruvate dioxygenase protein as indicated in SEQ ID NO: 2.Preferably, the amino acid sequence of the mutant phydroxyphenylpyruvate dioxygenase protein further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the amino acid sequence as set out in SEQ ID NO: 2.Preferably, the mutant p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence indicated in SEQ ID NO: 2, except that it has one or more amino acid mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 1911, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 393L, 403G, 4103, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L in one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild type rice p-hydroxyphenylpyruvate dioxygenase protein as set out in SEQ ID NO: 2. In one embodiment, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein according to the present invention further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as indicated in SEQ ID NO: 2, and has one or more amino acid mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 1911, 220K, 226H, 276W, 277N, 336D, 337A, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 3901, 392L, 403G, 4101, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L in one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420,430 and 431 of the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as set forth in SEQ ID NO: 2. Preferably, the mutant p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence as set forth in SEQ ID NO: 2, except that it has one or more of the mutations selected from the group consisting of R93S, A103S, H141R, H141K, H141T, A165V, V191I, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, I377C, P386T, L390I, CQ / yzn / Lznz / q / Yl· M392L, E403G, K410I, K418R, G419F, G419L, G419V, N420S, N420T, E430G and Y431L in one or more positions corresponding to 93, 103, 141, 165, 191, 220, 226, 276, 277, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein as set out in SEQ ID NO: 2. A particular amino acid position (numbering) within the protein of the present invention is determined by aligning the amino acid sequence of a protein of interest with SEQ ID NO: 2 using a standard sequence alignment tool, for example, the SmithWaterman algorithm or the Clustal W2 algorithm. Two sequences are aligned, and the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983), “Rapid similarity searches of nucleic acid and protein data banks”, Proc. Nati. Acad. Sci. USA, 80: 726-730. The default parameters used in the ClustalW2 algorithm (1.82) are preferably: protein gap opening penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; final protein / DNA gap = -1. and protein / DNA GAPDIST = 4. Preferably, the AlignX program (a part of the NTI vector set) is used to match the default parameters for multiple alignment (gap opening penalty: 10 og, gap extension penalty: 0.05), and the position of a particular amino acid within a protein of the present invention is determined by aligning the amino acid sequence of the protein with SEQ ID NO: 2. The identity of amino acid sequences can be determined by conventional methods, for example, by referring to the teachings of Smith and Waterman, (1981, Adv. Appl. Math. 2: 482, Pearson and Lipman, 1988, Proc. Nati. Acad. Sci. USA 85: 2444), computer algorithms of Thompson et al. (1994, Nucleic Acids Res 22: 467380, etc., as determined by computerized (GAP, BESTFIT, FASTA, and TFASTA, Genetics Computer Group in the Wisconsin Genetics software package), or it can be determined using the BLAST algorithm (Altschul et al., 1990, Mol. Biol. 215: 403-10) available from the National Center for Biotechnology Information www.ncbi.nlm.nih.gov / ) with predetermined parameters. In a further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase protein according to the present invention has an amino acid sequence as set forth in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82 or SEQ ID NO: 84. In a further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein according to the present invention has the following amino acid mutations in its amino acid sequence: H141R / G342D, H141R / D370N, G342D / D370N, H141R / N338D, H141R / G342D, N338D / G342D, K418P / G419F, G419F / N420S, G342D / R346C, G342D / R346H, H141R / N420S, G338D / K418P, P277N / N338D, L276W / P277N, H141R / G342D / D370N, Η141R / N338D / N420S, Η141R / N338S / N420S, P336D / N338D / G342D, P336D / N338S / G342D, P336D / N338Y / G342D, N338D / G342D / R346C, N338D / G342D / R346H, N338D / G342D / R346S, N338S / G342D / R346C, N338S / G342D / R346H, N338S / G342D / R346S, N338Y / G342D / R346C, N338Y / G342D / R346H, N338Y / G342D / R346S, P336D / G342D / R346C, P336D / G342D / R346H, P336D / G342D / R346S, P336D / N338D / R346C, P336D / N338D / R346H, P336D / N338D / R346S, P336D / N338S / R346C, P336D / N338S / R346H, P336D / N338S / R346S, P336D / N338Y / R346C, P336D / N338Y / R346H, P336D / N338Y / R346S, H141R / N338D / G342D, H141R / G342D / K418P, H141R / G342D / G419F, Η141R / G342D / P386T, K418P / G419F / N420T, K418T / G419F / N420T, Η141R / G342D / R346C, Η141R / G342D / R346H, H141R / G342D / N420S, Η141R / G342D / P277N, H141R / G342D / P336D, Η141R / G342D / L276W, H141R / G342D / R346S, Η141R / G342D / L390I, H141R / G342D / I377C, H141R / G342D / M392L,H141R / P337A / G342D, Η141R / N338S / G342D, Η141R / N338Y / G342D, P277N / N338D / G342D, P277N / G342D / R346C, P277N / N338D / N420S, N338D / G342D / K418P, H141R / N338D / G342D / K418P, H141R / N338D / G342D / G419F, H141R / N338D / G342D / P386T, Η141R / N338D / G342D / R346C, Η141R / N338D / G342D / R346H, Η141R / G342D / K418P / G419F, Η141R / G342D / L276W / P277N, P336D / N338D / G342D / R346C, P336D / N338D / G342D / R346H, P336D / N338D / G342D / R346S, P336D / N338S / G342D / R346C, P336D / N338S / G342D / R346H, P336D / N338S / G342D / R346S, P336D / N338Y / G342D / R346C, P336D / N338Y / G342D / R346H, P336D / N338Y / G342D / R346S, P277N / P336D / N338D / G342D, P277N / N338D / G342D / R346C, P277N / N338D / K418P / G419F, H141R / N338D / G342D / K418P / G419F, Η141R / N338D / G342D / G419F / N420S, H141R / G336D / G342D / K418P / G419F / N420S, H141R / N338D / G342D / K418P / G419F / N420S, H141R / N338D / G342D / K418P / G419F / N420T, H141R / N338D / G342D / R346C / K418P / G419F / N420S, H141R / N338D / G342D / R346H / K418P / G419F / N420S, H141R / P277N / N338D / G342D / K418P / G419F / N420S, o Η141R / P277N / P336D / N338D / G342D / K418P / G419F / N420S. In another further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase protein according to the present invention has an amino acid sequence as set forth in SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID cq? / zn / Lznz / q / Yi NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO : 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO : 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO: 258 o SEQ ID NO: 260. In the present invention, the wild-type p-hydroxyphenylpyruvate dioxygenase protein can be derived from any plant, particularly the monocotyledonous or dicotyledonous plants mentioned above. The sequences of some wild-type p-hydroxyphenylpyruvate dioxygenase proteins from other sources and their coding sequences are described in prior technical publications, which are incorporated herein by reference. Preferably, the wild-type p-hydroxyphenylpyruvate dioxygenase protein of the present invention is derived from Oryza, particularly Oryza sativa. More preferably, the wild-type p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence as set forth in SEQ ID NO: 2, or at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence as set forth in SEQ ID NO: 2. It will also be evident to a person skilled in the art that the structure of a protein can be altered without adversely affecting its activity and function. For example, one or more conservative amino acid substitutions can be introduced into the amino acid sequence of the protein without adversely affecting the activity and / or three-dimensional configuration of the protein molecule. A person skilled in the art is familiar with examples and methods for carrying out conservative amino acid substitutions.Specifically, an amino acid residue at a certain site may be substituted with another amino acid residue belonging to the same group as the amino acid being substituted; that is, a nonpolar amino acid residue is substituted with another nonpolar amino acid residue, a polar uncharged amino acid residue is substituted with another polar uncharged amino acid residue, a basic amino acid residue is substituted with another basic amino acid residue, and an acidic amino acid residue is substituted with an acidic amino acid residue. Provided that a substitution does not affect the biological activity of the protein, such a conservative substitution, whereby one amino acid is replaced by another amino acid belonging to the same group, is within the scope of the present invention. Accordingly, the mutant HPPD protein of the present invention may also contain one or more different mutations, such as conservative substitutions in the amino acid sequence, in addition to the mutations mentioned above. Furthermore, the invention also encompasses mutant HPPD proteins that further contain one or more non-conservative substitutions, provided that the non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention. As is well known in the art, one or more amino acid residues can be removed from the N and / or C terminus of a protein, and the protein still retains its function and activity. Accordingly, in another aspect, the present invention also relates to fragments lacking one or more amino acid residues at the N and / or C terminus of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein while maintaining the desired function and activity. Within the scope of the invention, these fragments are referred to as bioactive fragments. In the present invention, a “bioactive fragment” refers to a portion of a mutant HPPD protein of the present invention that retains the biological activity of the mutant HPPD protein of the present invention while exhibiting improved resistance or tolerance to HPPD inhibitors compared to an HPPD fragment lacking the mutations.For example, a bioactive fragment of a mutant HPPD protein may be a bioactive fragment that lacks a residue of one or more (e.g., 1-50, 1-25, 1-10 or 1-5, e.g., 1, 2, 3, 4 or 5) amino acid residues at the N and / or C end of the protein, but still retains the desired biological activity of the full-length protein. The present invention also provides a fusion protein comprising a mutant HPPD protein or a bioactive fragment thereof according to the present invention and an additional component that fuses with it. In a preferred embodiment, the additional component is a plastid-targeting peptide, such as a chloroplast-targeting peptide, which enables the mutated HPPD protein to target the chloroplast. In another embodiment, the additional component is a marker peptide, such as 6χHis. In yet another embodiment, the additional component is a peptide that contributes to increasing the solubility of the mutant HPPD protein, such as a NusA peptide. In another aspect, the present invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding a p-hydroxyphenylpyruvate dioxygenase (HPPD) protein described above or a complementary sequence thereof. The term “isolated” polynucleotide means that the polynucleotide does not substantially comprise components normally associated with it in a natural environment. In one embodiment, the amino acid sequence of the mutant phydroxyphenylpyruvate dioxygenase (HPPD) protein has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence as stated in SEQ ID NO: 2, and furthermore has one or more amino acid mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 1911, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346H, 346S, 346Y,370N, 377C, 386T, 3901, 393L, 403G, 4103, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L in one or more positions corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of the rice p-hydroxyphenylpyruvate dioxygenase protein of type Wild as set out in SEQ ID NO: 2, the mutation is one or more mutations selected from the group consisting of R93S, A103S, H141R, H141K, H141T, A165V, V1911, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, I377C, P386T, L390I, M392L, E403G, K410I, K418P, G419F, G419L, G419V, N420S, N420T, E430G and Y431L. More preferably, the protein, CQ / yzn / Lznz / q / Yl· p-hydroxyphenylpyruvate dioxygenase (HPPD) mutant or bioactive fragment thereof is derived from a rice HPPD protein and has one or more amino acid substitutions selected from the above. It will be evident to a person skilled in the art that a variety of different nucleic acid sequences can encode the amino acid sequences described herein due to the degeneracy of genetic codes. A person skilled in the art can generate additional nucleic acid sequences that encode the same protein, and thus the present invention encompasses nucleic acid sequences that encode the same amino acid sequence due to the degeneracy of genetic codes. For example, to achieve high expression of a heterologous gene in a host organism, such as a plant, the gene can be optimized using codons preferred by the host for improved expression. Accordingly, in some embodiments, the polynucleotide of the present invention has a nucleic acid sequence selected from: (1) una secuencia de ácido nucleico que codifica una secuencia de aminoácidos como se establece en: SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO: 258 or SEQ ID NO: 260, or a complementary sequence thereof; (2) a nucleic acid sequence as set forth in: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: cq? / zn / Lznz / q / Yi 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO:131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO:143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO:155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO:167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO:179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO:191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO:203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO:215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO:227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQ ID NO:239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQ ID NO:251, SEQ ID NO: 253, SEQ ID NO: 255, SEQ ID NO: 257 o SEQ ID NO: 259, o su secuencia complementaria. (3) a nucleic acid sequence that hybridizes with the sequence shown in (1) or (2) under rigorous conditions; and (4) a nucleic acid sequence that encodes an amino acid sequence equal to a sequence shown in (1) or (2) due to genetic code degeneracy, or a complementary sequence thereof. More preferably, the polynucleotide of the present invention has a nucleic acid sequence selected from the nucleic acid sequence as set forth in: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111,SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID, NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID cq? / zn / Lznz / q / Yi NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQID NO: 239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQID NO: 251, SEQ ID NO: 253, SEQ ID NO: 255, SEQ ID NO: 257 or SEQ ID NO: 259, or complementary sequence thereof. Preferably, rigorous conditions may refer to 6M urea, 0.4% SDS, and 0.5% SSC, or equivalent hybridization conditions. They may also refer to more stringent conditions, such as 6M urea, 0.4% SDS, and 0.1% SSC, or equivalent hybridization conditions. Under various conditions, the temperature may be above approximately 40°C; for example, when more stringent conditions are required, the temperature may be approximately 50°C, or even approximately 65°C. More preferably, the wild-type and mutant codons corresponding to the amino acid mutation sites are in the table below: cq? / zn / Lznz / q / Yi Sitios de mutación de aminoácidos Codones de tipo salvaje Codones mutantes A103S GCC TCG ;TC A;TCC ;TCT; AGC; AGT H141R CAC CCG;CGA;CGC;CGT;AGG;AGA H141K CAC AAG;AAA H141T CAC ACC;ACT;ACA;ACG A165V GCG GTG;GTA;GTC;GTT V1911 GTC ATA;ATC;ATT R220K CGG AAG;AAA G342D GGC GAC;GAT D370N GAC AAC;AAT K410I AAG ATA;ATC;ATT R93S CGC AGC;AGT;TCA;TCC;TCG;TCT G226H GGC CAC;CAT L276W CTG TGG P277N CCG AAC;AAT P336D CCG GAT;GAC P337A CCC GCA;GCC;GCG;CGT N338D AAC GAC;GAT N338S AAC AGC;TCG;TCA;TCC;TCT;AGT N338Y AAC TAC;TAT G342D GGC GAC;GAT R346C CGC TGC;TGT R346H CGC CAC;CAT R346S CGC AGC;TCG;TCA;TCC;TCT;AGT R346D CGC GAC;GAT R346Y CGC TAC;TAT I377C ATC TGC;TGT P386T CCA ACA;ACC;ACG;ACT L390I TTG ATA; ATC; ATT M392L ATG CTA;CTC;CTG;CTT;TTA;TTG E403G GAG GGA;GGC;GGG;GGT P418P AAG CCA;CCC;CCG;CCT G419F GGC TTC;TTT G419L GGC CTA;CTC;CTG;CTT;TTA;TTG G419V GGC GTA;GTC;GTG;GTT N420S AAC AGC;TCG;TCA;TCC;TCT;AGT N420T AAC ACA;ACC;ACG;ACT E430G GAG GGA;GGC;GGG;GGT Y431L TAT CTA;CTC;CTG;CTT;TTA;TTG cq; / zn / i znz / zi / Yl· The present invention also provides a nucleic acid construct comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or a bioactive fragment thereof or a fusion protein thereof according to the present invention, and one or more regulatory elements operatively linked thereto. The term “regulatory element” as used in the present invention refers to a nucleic acid sequence capable of modulating the transcription and / or translation of a nucleic acid operatively linked thereto. The regulatory element may be a suitable promoter sequence that is recognized by a host cell for the expression of a nucleic acid sequence encoding a protein of the present invention. The promoter sequence comprises a transcriptional regulatory sequence that mediates the expression of the protein. The promoter may be any nucleotide sequence exhibiting transcriptional activity in a selected host cell, including mutated, truncated, and hybrid promoters, and may be derived from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to the host cell gene. As a promoter expressed in a plant cell or plant, a naturally occurring p-hydroxyphenylpyruvate dioxygenase promoter or a heterologous promoter with plant activity may be used. The promoter may lead to constitutive or inducible expression.Examples of promoters include, for instance, the histone promoter, the rice actin promoter, a plant viral promoter such as the cauliflower mosaic virus promoter, and the like. The regulatory element may also be a suitable transcription terminator sequence that is recognized by the host cell to terminate transcription. The termination sequence is operatively linked to the 3' end of a nucleic acid sequence encoding a protein of the invention. Any terminator that functions in a selected host cell may be used in the present invention. The regulatory element can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is important for translation in a host cell. The leader sequence is operatively linked to the 5' end of a nucleic acid sequence encoding a protein of the invention. Any leader sequence that functions in a selected host cell can be used in the present invention. The regulatory element may also be a polyadenylation sequence, that is, a sequence operatively linked to the 3' end of the nucleic acid sequence and recognized by a host cell as a signal for the addition of polyadenylic acid residues to the transcribed mRNA during transcription. Any polyadenylation sequence that functions in a selected host cell may be used in the present invention. The regulatory element can also be a signal peptide coding region that encodes an amino acid sequence attached to the amino terminus of a protein and directs the encoded protein to the secretory pathway in cells. The 5' end of the nucleic acid coding sequence may inherently comprise a signal peptide coding region that is natively linked to the coding region encoding the secreted polypeptide within the translation reading frame. Alternatively, the 5' end of the coding sequence may comprise a signal peptide coding region that is foreign to the coding sequence. A foreign signal peptide coding region may be required when a coding sequence does not natively comprise a signal peptide coding region.Alternatively, the foreign signal peptide coding region may simply replace the native signal peptide coding region to facilitate polypeptide secretion. In either case, any signal peptide coding region that directs an expressed polypeptide to a secretory pathway in a selected host cell, i.e., secretion of the polypeptide into a culture medium, may be used in the present invention. Regulatory sequences that allow polypeptide expression to be regulated according to the growth of a host cell can also be appropriately added. Regulatory systems include, for example, those that allow gene expression to be switched on or off in response to chemical or physical stimuli (including the presence of regulatory compounds), such as the lac, tec, and tip operon systems, the ADH2 system, the GAL1 system, and similar systems. Examples of other regulatory sequences are those that allow gene amplification. In a eukaryotic system, these include the dihydrofolate reductase gene, which is amplified in the presence of methotrexate, and the metallothionein cq; / zn / i znz / zi / Yl· gene, which is amplified due to heavy metals. In these cases, the nucleotide sequence encoding the polypeptide will be operatively linked to the regulatory sequence. In the present invention, the regulatory element can also be a transcription activator, i.e., an enhancer, for example, the tobacco mosaic virus translation activator described in WO 87 / 07644, or an intron, etc., such as the maize adh1 intron, the bronze maize gene 1 intron, or the rice actin intron 1. These elements can enhance the expression of a mutant HPPD protein, a bioactive fragment thereof, or a fusion protein according to the present invention in a transgenic plant. The present invention also provides an expression vector comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or a bioactive fragment thereof or a fusion protein according to the present invention, and an expression regulatory element operatively linked thereto. The expression vector also contains at least one origin of replication for self-replication. The choice of a vector will generally depend on the vector's compatibility with a host cell into which the vector is to be introduced. The vector may be a self-replicating vector, i.e., a vector that exists as an extrachromosomal entity, and its replication is independent of chromosomal replication, such as plasmids, extrachromosomal elements, minichromosomes, or artificial chromosomes. The vector may contain any element that ensures self-replication.Alternatively, the vector can be a vector that integrates into the host cell's genome upon introduction and replicates along with the chromosome into which it integrates. Furthermore, a single vector or plasmid, or two or more vectors or plasmids, can be used, in addition to comprising a whole DNA sequence to be introduced into the host cell's genome, or a transposon. Alternatively, the vector can also be a vector for gene editing of the host cell's endogenous HPPD gene. The vector may be a plasmid, a virus, a cosmid, or a phage, and the like, which are well known to those skilled in the art and are extensively described in the art. Preferably, the expression vector in the present invention is a plasmid. The expression vector may comprise a promoter, a translation initiation ribosome binding site, a polyadenylation site, a transcription terminator, an enhancer, and the like. Such a selectable marker includes a gene encoding dihydrofolate reductase, a gene conferring tolerance to neomycin, a gene conferring tolerance to tetracycline or ampicillin, and the like. The vector of the present invention may comprise elements that enable integration of the vector into the genome of a host cell or autonomous, independent replication of the genome within the cell. For integration into the genome of a host cell, the vector may be based on a polynucleotide sequence encoding the polypeptide or any other vector element that integrates appropriately into the genome by homologous or non-homologous recombination. Alternatively, the vector may comprise an additional nucleotide sequence to direct integration of the vector into the genome of a host cell at a precise chromosome location by homologous recombination. To increase the probability of integration at the precise position, an integration element The vector CQ / yzn / Lznz / q / Yl· should preferably comprise a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and more preferably 800 to 10,000 base pairs, that is highly identical to a corresponding target sequence to increase the probability of homologous recombination. The integration element can be any sequence homologous to a target sequence within the genome of a host cell. Furthermore, the integration element can be a non-coding or coding nucleotide sequence. Alternatively, the vector can integrate into the genome of a host cell via non-homologous recombination. For autonomous replication, the vector can further comprise an origin of replication that enables the vector to replicate autonomously within the host cell. The origin of replication can be any plasmid replicon that mediates autonomous replication and function in a cell.The expression “origin of replication” or “plasmid replicon” is defined here as a nucleotide sequence that allows a plasmid or vector to replicate in vivo. The polynucleotide with more than one copy of the present invention is inserted into a host cell to increase the yield of a gene product. An increase in the number of polynucleotide copies can be achieved by integrating a sequence with at least one additional copy into the genome of a host cell or by combining an amplified selectable marker gene with the polynucleotide. In the latter case, the cell comprising the amplified selectable marker gene and the polynucleotide with the additional copy can be bred by artificially culturing the cell in the presence of a suitable selectable formulation. A nucleic acid sequence of the present invention can be inserted into a vector by a variety of methods, for example, by digesting the insert and the vector with an appropriate restriction endonuclease and then performing ligation. A variety of cloning techniques are known in the art and are within the scope of knowledge of a person skilled in the art. Suitable vectors for use in the present invention include commercially available plasmids, for example, but not limited to, pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA), pQE70, pQE60, pQE-9 (Qiagen), pD10, ps1X174, pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacy), and similar. The invention also provides a host cell comprising a nucleic acid sequence, a nucleic acid construct, or an expression vector according to the present invention. A vector of the present application is introduced into a host cell, such that the vector is present as part of a chromosomal component or as an extrachromosomal vector for self-replication as described above, or the vector can genetically edit the endogenous HPPD gene in the host cell. The host cell may be any host cell familiar to a person skilled in the art, including prokaryotic and eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells, or plant cells, examples of which are E. coli, Streptomyces, Bacillus subtilis, Salmonella typhimurium, Pseudomonas, Streptomyces, Staphylococcus, Spodoptera Sf9, CHO, COS, etc. A person skilled in the technique can select an appropriate host cell. In the present invention, the term “host cell” also encompasses any progeny of parental cells that is not completely identical to the parent cell due to mutations that occur during replication. A nucleic acid sequence, nucleic acid construct, or expression vector of the present invention can be introduced into a host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti plasmid-mediated gene delivery and calcium phosphate transfection, DEAE-dextran-mediated transfection, lipofection or electroporation and the like (see Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, 1986). In one specific embodiment, the mutant HPPD protein of the present invention can be targeted to a plastid in a plant, such as a chloroplast. This can be achieved by ligating a nucleic acid sequence encoding the mutant HPPD protein of the present invention into the reading frame of a nucleic acid sequence encoding a plastid-targeting peptide, such as a chloroplast-targeting peptide, or by directly transforming a polynucleotide, nucleic acid construct, or expression vector of the present invention into the chloroplast genome of a plant cell. A person skilled in the art knows vectors and methods that can be used to transform chloroplast genomes of plant cells.For example, a nucleic acid sequence encoding a mutant HPPD protein of the present invention can be integrated by bombarding the leaves of a target plant with DNA-coated ions and by homologous or non-homologous recombination. When appropriate, the transformed host cells can be cultured in conventional nutrient media. After transforming a suitable host cell and culturing the host cell at an appropriate cell density, the selected promoter can be induced by a suitable method, such as temperature change or chemical induction, and the cells can be cultured for a further period of time to obtain a mutant HPPD protein or a bioactive fragment thereof or a fusion protein according to the present invention. Accordingly, the present invention also relates to a method for producing a mutant HPPD protein or a bioactive fragment thereof or a fusion protein according to the present invention, comprising: (a) cultivating said host cell under conditions conducive to the production of said mutant HPPD protein or bioactive fragment thereof or fusion protein; and (b) recovering the mutant HPPD protein or its bioactive fragment or fusion protein. In the production method of the present invention, cells are cultured in a suitable nutrient medium to produce the polypeptide using methods well known in the art. For example, cells are cultured in a flask and fermented on a small or large scale (including continuous, batch, or solid-state fermentation) in a suitable culture medium in a laboratory or industrial setting under conditions that permit the expression and / or isolation of the polypeptide. The culture is carried out in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts using procedures known in the art. Suitable media can be purchased from a supplier or formulated according to described compositions (e.g., those in the American Type Culture Collection catalog). If the polypeptide is secreted into the nutrient medium, it can be recovered directly from the culture medium.If the polypeptide is not secreted into the medium, it can be recovered from the cells used. The polypeptide can be detected using methods known in the art as polypeptide-specific. These detection methods may include the use of specific antibodies, the formation of enzyme products, or the loss of enzyme substrates. The polypeptide produced can be recovered by methods known in the art. For example, cells can be collected by centrifugation and disrupted by physical or chemical means, and the resulting crude extract retained for further purification. Transformed host cells expressing a mutation HPPD protein or a bioactive fragment thereof or a fusion protein according to the present invention can be lysed by any convenient means, including freeze-thaw cycles, sonication, mechanical disruption, or using a cell lysing agent. These methods are well known to a person skilled in the art.A mutant HPPD protein or a bioactive fragment thereof according to the present invention can be recovered and purified from a transformed host cell culture, and one method used includes precipitation with ammonium sulfate or ethanol, acid extraction, anion or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and phytohemagglutinin chromatography, and the like. The invention also relates to a method for preparing a host organism, in particular a plant cell, plant tissue, plant part, or plant, that is tolerant or resistant to an HPPD-inhibiting herbicide, comprising transforming the host organism with a nucleic acid sequence encoding a mutant HPPD protein or a bioactive fragment thereof according to the present invention, or a nucleic acid structure or expression vector comprising the nucleic acid sequence. Methods for transforming a host cell, such as a plant cell, are known in the art, including, for example, protoplast transformation, fusion, injection, electroporation, PEG-mediated transformation, ion bombardment, viral transformation, Agrobacterium-mediated transformation, electroporation, drilling or bombardment, and the like.A number of such transformation methods are described in the prior art, for example, the technique for transforming soybeans described in document EP1186666 and suitable techniques for transforming monocotyledonous plants, especially rice, described in document WO 92 / 09696. It is also advantageous to cultivate plant explants with Agrobacterium tumefaciens or Agrobacterium rhizogenes to transfer DNA into a plant cell. A complete plant can be regenerated from a portion of infected plant material (such as leaf fragments, stem segments, roots, and cells grown in suspension or protoplasts) in a suitable culture medium, which may contain antibiotics or pesticides for selection. The transformed cells are grown into plants in a conventional manner, can form germ cells, and transfer transformed traits to progeny plants.These plants can be grown normally and crossed with plants that have the same transformed genetic factors or other genetic factors. The resulting hybrid individuals have corresponding phenotypic properties. The present invention also provides a method for improving the resistance or tolerance of a plant cell, plant tissue, plant part, or plant to an HPPD-inhibiting herbicide, comprising transforming the plant part or plant with a nucleic acid molecule comprising a nucleic acid sequence encoding a mutating HPPD protein or a bioactive fragment thereof or a fusion protein according to the present invention and expressing the nucleic acid molecule. The nucleic acid molecule may be expressed as an extrachromosomal entity, or it may be expressed by integrating it into the genome of a plant cell; in particular, it may be expressed by integrating it into the position of an endogenous gene of a plant cell by homologous recombination. These embodiments are all within the scope of the present invention.The invention also provides a method for preparing a host organism, in particular a plant cell, plant tissue, plant part, or plant, that is tolerant or resistant to an HPPD-inhibiting herbicide, comprising integrating a nucleic acid encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or a bioactive fragment thereof according to the present invention into the genome of the host organism and expressing the nucleic acid. Suitable vectors and selected markers are well known to a person skilled in the art; for example, a method of integration into the tobacco genome is described in WO 06 / 108830, and the descriptions contained therein are incorporated herein by reference. The gene or genes of interest are preferably expressed via constitutive or inducible promoters in the plant cell.Once expressed, mRNA is translated into proteins, thus incorporating amino acids of interest into proteins. Genes encoding a protein expressed in plant cells may be under the control of a constitutive promoter, a tissue-specific promoter, or an inducible promoter. For example, promoters of bacterial origin, such as the octopine synthase promoter, the nopaline synthase promoter, and the mannopine synthase promoter; promoters of viral origin, such as the cauliflower mosaic virus (35S and 19S), 35T (which is a designed 35S promoter; see US Patent No. 6,166,302, especially example 7E). Plant promoter regulatory elements can also be used, including, but not limited to, the small subunit (ssu) of ribulose-1,6-bisphosphate (RUBP) carboxylase, the β-conglycinin promoter, the β-phaseolin promoter, the ADH promoter, heat shock promoters, and tissue-specific promoters.Constitutive promoter regulatory elements can also be used to direct continuous gene expression in all cell types and at all times (e.g., actin, ubiquitin, CaMV 35S, and the like). Tissue-specific promoter regulatory elements are responsible for gene expression in specific cell or tissue types, such as leaves or seeds (e.g., zein, oleosin, napin, ACP, globulin, and the like), and these can also be used in the present invention. Promoter regulatory elements can also be active (or inactive) during a particular stage of plant development. Examples of these include, but are not limited to, specific promoter regulatory elements, pollen-stage-specific elements, embryo-stage-specific elements, and others. CQ7 / 7Π / I 7Γ>7 / 3 / YIi maize silk, cotton fiber specific, root specific, seed endosperm specific, or vegetative phase specific, and the like. In certain circumstances, it may be desirable to use an inducible promoter regulator, which is responsible for gene expression in response to a specific signal, such as: physical stimulus (heat shock genes), light (RUBP carboxylase), hormone (Em), metabolites, chemicals (tetracycline-sensitive), and stress. Other desirable transcription and translation elements that function in plants may also be used. The present invention also provides a method for improving the resistance or tolerance of a plant cell, plant tissue, plant part, or plant to an HPPD-inhibiting herbicide, comprising transforming the plant part or plant with a nucleic acid molecule comprising a nucleic acid sequence encoding a mutant HPPD protein or a bioactive fragment thereof or a fusion protein according to the present invention and expressing the nucleic acid molecule. The nucleic acid molecule may be expressed as an extrachromosomal entity, or it may be expressed by integrating it into the genome of a plant cell; in particular, it may be expressed by integrating it into the position of an endogenous gene of a plant cell by homologous recombination. These embodiments are all within the scope of the present invention. The present invention also provides a method for improving the resistance or tolerance of a plant or a part thereof to the HPPD-inhibiting herbicide, comprising crossing a plant expressing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof or a fusion protein according to the present invention with another plant, and selecting a plant having improved resistance and tolerance to HPPD-inhibiting herbicides. The present invention also provides a method for improving the resistance or tolerance of a plant cell, plant tissue, plant part, or plant to the HPPD-inhibiting herbicide, comprising gene editing of an endogenous HPPD protein gene of the plant cell, plant tissue, plant part, or plant to achieve the expression of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof or a fusion protein according to the present invention. The present invention also relates to a method for preparing a plant that is tolerant or resistant to the herbicide by traditional breeding techniques, comprising self-crossing or crossing a plant in which a nucleic acid sequence encoding a mutant phydroxyphenylpyruvate dioxygenase protein or one of its bioactive fragments according to the present invention is integrated into the genome, and progeny comprising a heterozygous or homozygous nucleic acid sequence is analyzed. The invention also relates to a plant cell, a plant tissue, a plant part, a plant obtained by the above method, or its offspring. Preferably, a plant cell, plant tissue, or plant part transformed with a polynucleotide according to the present invention can be regenerated into a complete plant. The present invention includes cell cultures, including tissue cell cultures, liquid cultures, and solid plate cultures. Seeds produced by the plants of the present invention and / or used to regenerate the plants of the present invention are also included within the scope of the present invention. Other plant tissues and parts are also included in the present invention. The present invention also encompasses a method for producing a plant or cell comprising a nucleic acid molecule of the present invention. A preferred method for producing such a plant comprises planting a seed of the present invention.A plant transformed in this way can be endowed with resistance to a variety of herbicides that have different modes of action. For example, in the transformation of plant cells using Agrobacterium, explants can be combined and incubated with the transformed Agrobacterium for a sufficient time to allow transformation. After transformation, the Agrobacterium is eliminated by selective treatment with the appropriate antibiotic, and the plant cells are cultured on a suitable selective medium. Once calluses have formed, shoot formation can be promoted using appropriate plant hormones according to well-established methods in plant tissue culture and plant regeneration. However, an intermediate callus stage is not always necessary. After shoot formation, these plant cells can be transferred to a medium that promotes root formation, thus completing plant regeneration.The plants can then be cultivated for sowing, and this seed can be used to establish future generations. Regardless of the transformation technique, the gene encoding a bacterial protein is preferably incorporated into a gene transfer vector adapted to express that gene in a plant cell by including in the vector a plant promoter regulatory element, as well as untranslated 3' transcription termination regions, such as Nos and similar elements. The present invention also provides a method for controlling weeds at a plant cultivation site, comprising applying to the site comprising plants or seeds according to the present invention an effective herbicidal amount of one or more HPPD-inhibiting herbicides. In the present invention, the term “cultivation site” includes a site where plants of the present invention are cultivated, such as soil, and also includes, for example, plant seeds, plant seedlings, and cultivated plants. The term “herbicide effective amount” means the amount of a herbicide that is sufficient to affect the growth or development of the target weeds, for example, to prevent or inhibit the growth or development of the target weeds, or to eliminate the weeds. Advantageously, such an effective herbicide amount does not significantly affect the growth and / or development of a plant seed, plant seedling, or plant of the present invention. A person skilled in the art can determine such an effective herbicide amount by conventional experiments. The present invention also provides a method for producing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein that retains or enhances the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) in homogenate and is significantly less sensitive to HPPD-inhibiting herbicides than wild-type HPPD, comprising the steps of: mutating a nucleic acid encoding a wild-type HPPD, consistently fusing and ligating the mutated nucleic acid in an expression vector to a nucleic acid reading frame sequence encoding a solubility-enhancing component to form a sequence encoding a fusion protein, transforming the resulting recombinant expression vector into a host cell, and expressing the CQ / yzn / Lznz / q / Yl· fusion protein under suitable conditions containing the HPPD-inhibiting herbicide and an HPPD enzyme substrate, and selecting a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein that retains or improves the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogenate and has significantly reduced sensitivity to the HPPD-inhibiting herbicide. Preferably, the solubility-enhancing component is selected from NusA, which forms a fusion protein with the mutant HPPD protein of the present invention. More preferably, the expression vector is selected from the pET-44a vector. The host cell is selected from a bacterial cell, a fungal cell, or a plant cell. Unless specifically stated or implied, the terms “a,” “an,” “the,” and “she” used herein mean “at least one.” All patents, patent applications, and publications mentioned or cited herein are incorporated herein by reference in their entirety, and their level of citation is the same as that of the individual citation. Detailed embodiments of the invention The present invention will be further described in conjunction with the examples below. All methods and operations described in the examples are provided by way of illustration and should not be construed as a limitation. For methods of DNA manipulation, see Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel FM, Greene Publishing Associates and Wiley Interscience, 1989, Molecular Cloning, T. Maniatis et al., 1982, or Sambrook J. and Russell D., 2001, Molecular Cloning: a laboratory manual, version 3. Examples Example 1 Cloning of the rice HPPD gene (OsHPPD) The rice (Oryza sativa, Japonica Group) 4-hydroxyphenylpyruvate dioxygenase (HPPD) gene is located on the second chromosome at 0s02g0168100. A DNA coding region (OsHPPD) (General Biosystems, Chuzhou, Anhui Province, China) was directly synthesized according to the corresponding cDNA sequence (NCBI Registration No. XP_015626163.1) and used as a PCR template. The primers NusOsF: acgattgatgacgacgacaag ATGCCTCCCACTCCCACCCC and NusOsR: tccacgagctcccggactc TTA CTAGGATCCTTGAACTGTAG were designed and synthesized according to the sequences of the pET-44a vector (Novagen) and XP_016161626166. PCR amplification was performed using these primers, the synthesized template, and DNA polymerase Q5 (NEB, New England Biolabs, Boston, USA). Amplification was carried out under the following conditions: 98 °C for 2 minutes; then 98 °C for 20 seconds, 65 °C for 30 seconds, and 72 °C for 60 seconds, 35 cycles; and 72 °C for 2 minutes.The amplified fragment was shown to be 1.3 Kb by agarose gel electrophoresis and the DNA concentration of it was determined by ultraviolet absorption after recovery. The pET-44a plasmid (Novagen) was digested with Boxl (Thermo Fisher Scientific, Shanghai, China) at 37 °C for 1 hour, and then heated to 65 °C to inactivate Boxl. The OsHPPD DNA fragment was mixed with the Boxl-linearized pET-44a vector in equal amounts, to which an equal volume of 2 x Gibson Assembly Master Mix (Hanbio Biotechnology Co., Ltd., Shanghai, China) was added, mixed, and incubated at 50 °C for 1 hour. Five percent of the ligation product was used to transform competent E. coli DH5a, and the bacterial solution was applied to the surface of an LB solid medium plate containing 100 ppm ampicillin and cultured overnight at 37 °C. The next day, after the correct clones were confirmed by individual bacterial colony PCR, three correct clones were grown overnight at 37°C, and sufficient plasmid DNA was extracted and sent to Qingke Biotechnology Co., Ltd.(Beijing, China) for sequencing by the Sanger sequencing method. The sequencing results confirmed that the correct full-length rice HPPD coding region DNA was obtained. Example 2 Saturated random mutation of each amino acid in HPPD rice protein (OsHPPD) The full-length rice OsHPPD enzyme has 446 amino acids, and its amino acid sequence is established in SEQ ID NO: 2, where amino acids 1–50 are considered to constitute a signal peptide responsible for directing the enzyme to the chloroplast (Siehl et al. Plant Physiol. 2014 Nov.; 166(3): 1162–1176). Therefore, from amino acid 51 to amino acid 466, a saturated random mutation was performed for each amino acid. This was achieved by performing a bridging PCR using a primer containing a coding sequence for an amino acid to be mutated in NNK and another suitable conventional primer. In NNK, N represented A / T / G / C and K represented G / T, and the codon NNK could code for any of the 20 amino acids or terminators. Consequently, this was a saturated mutation.See: Kille S, Acevedo-Rocha CG, Parra LP, Zhang ZG, Opperman DJ, Reetz MT, Acevedo JP (2013) Reducing codon redundancy and screening effort of combinatorics! protein libraries created by saturation mutagenesis. ACS Synth Biol 2(2):83-92; Directed Evolution Library Creation: methods and protocols 2nd ed. Edited by Elizabeth MJ Gillam, Janine N. Copp and David F. Ackerley New York, NY United States: Springer, 2014. do¡:10.1007 / 978-1-4939-1053-3. A large number of mutants would be produced. The mutant was cloned into a linearized pET-44a vector and transformed into E. coli, which was grown using a 96-well plate in a 2 x YT culture solution containing an HPPD-inhibiting herbicide (such as tembotrione 1-2 pM) and a tyrosine substrate (1 g / L) on a shaker at 28 °C and 150 rpm for 24 hours for expression, and then the mutants were quickly removed according to their brown color.Using the method, 10 single-amino acid mutants were selected: A103S, H141R, H141K, H141T, A165V, V191I, R220K, G342D, D370N, and K410I. The color reaction of these resistant mutants in the presence of tembotrione and the metabolite of benzufucaotong, compared to that of the wild type, was as shown in Figure 1. Among them, the color changes of H141R and G342D were the most significant and obviously deeper than those of the wild type. The method of the present patent improved the solubility of HPPD expressed in bacteria by fusing NusA with the rice HPPD protein, so that the protein could be expressed and the enzymatic reaction could be performed simultaneously at 28 °C, saving a great deal of time and selection time. Similarly, the color reaction of these mutants was determined in the presence of the other three HPPD-inhibiting herbicides, huanbifucaotong, topramezone, and mesotrione, see Figures 2 and 3. CQ7 / 7Π / Ι 7Γ>7 / 3 / ΥΙι The resistance / tolerance of each of the mulants to the five herbicides was estimated approximately based on the color changes of the same and the results are shown in Table 1. The more the sign, the deeper the color and the greater the resistance / tolerance compared to the wild type. Table 1 Single-site HPPD mutants of rice and their relative resistance to 5 CQ / yzn / Lznz / q / Yl· different herbicides HPPD inhibitors Site Wild-type amino acid residue Mutant amino acid residue Tembotrione Metabolic product of benzuofucaotong Huanbifucaotong Topramezone Mesotrione Wild-type — — + + + + + 103 A s 2+ 2+ + 2+ 3+ 141 HR; K; T 141R: 6+ 141R: 6+ 141R: 6+ 141R: 2+ 141R: 5+ 165 AV 3+ 3+ 5+ 2+ 5+ 191 VI 2+ 2+ 3+ 2+ 4+ 220 RK 2+ 2+ 3+ 2+ 4+ 342 GD 6+ 6+ 3+ 2+ 2+ 370 DN 2+ 2+ 3+ 2+ 2+ 410 KI 2+ 2+ 2+ 2+ 1 + The complete process was illustrated by the production and selection of the H141R mutant as an example. 1. PCR amplification was performed using NusOsF and OsHPPD-H141RR:CACCGCGAGGCCGTGGTCC as primers, the synthesized full-length OsHPPD template, and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA) to obtain a DNA fragment. Amplification was carried out under the following conditions: 98 °C / 2 minutes; 98 °C / 20 seconds → 65 °C / 30 seconds → 72 °C / 60 seconds (35 cycles); and 72 °C / 2 seconds. After detection by agarose gel electrophoresis, bands of the correct size were recovered, and concentrations were determined by ultraviolet absorption. Similarly, the NusOsR and OsHPPD-H141 RF carried out PCR amplification: CACGGCCTCGCGGGGNGKGCCGTGGCGC TGCGCG as primers, the synthesized full-length OsHPPD template and Q5 DNA polymerase (NEB, New York, Europe, USA) to obtain the final DNA fragment. 2. The first and last fragments have 19 overlapping bases in the middle (OsHPPDH141R-F and OsHPPD-H141 RR). Accordingly, the two fragments were mixed in equimolar amounts, and an equal volume of 2 x Glodstar MasterMix (ComWin Biotechnology Co., Ltd.) was added. Beijing), and 10 pmol of NusOsF and NusOsR were added as primers to perform a PCR reaction bridge. Amplification was carried out under the following conditions: 96 °C for 2 minutes; 96 °C for 20 seconds, 65 °C for 30 seconds, and 72 °C for 60 seconds (30 cycles); and 72 °C for 5 minutes. After detection by agarose gel electrophoresis, bands of the correct size (1.3 kb) were recovered, and concentrations were determined by ultraviolet absorption. 3. The OsHPPDMut DNA fragment was mixed with the previously linearized pET-44a vector in equal amounts, to which an equal volume of 2 × Gibson Assembly Master Mix (Hanbio Biotechnology Co., Ltd.) was added, and incubated at 50 °C for one hour. Five pL of the ligation product was used to transform competent E. coli DH5a, and the bacterial solution was applied to the surface of an LB solid medium plate containing 100 ppm ampicillin and cultured overnight at 37 °C. All clones (colonies) on the plate were discarded, the plasmids were extracted, and the DNA was quantified by UV absorption. One hundred ng of plasmids were transformed into competent BL21 (DE3), a plate was coated, and the culture was carried out overnight at 37 °C. The plate with the transformed E. coli was temporarily stored at 4 °C to detect mutants. 4. Detection of mutants resistant to HPPD-inhibiting herbicides by color reaction. HPPD-inhibiting herbicides inhibited HPPD enzyme activity. When tyrosine was converted to 4-hydroxyphenylpyruvate (HPP) by tyrosine transaminase, the inactivated HPPD was unable to oxidize 4-hydroxyphenylpyruvate to homogentisic acid (HGA). HGA was dark brown. Therefore, if an HPPD mutant was resistant or tolerant to a herbicide, after expression in E. coli, the mutant could also oxidize 4-hydroxyphenylpyruvate to homogentisic acid, resulting in a dark brown color. E. coli was cultured in a 2 × YT culture medium containing an HPPD-inhibiting herbicide and a tyrosine substrate using a 96-well plate for HPPD expression, and these mutants were rapidly selected based on their color changes. (1) Preparation of 2 χ YT culture medium (1 g / L of L-Tyr, 0.1 mM IPTG, 0.01 mM MnCI2 and 100 mg / L of ampicillin were added). (2) 0.1 mL of the above medium was added to each well of a 96-well plate, and wild-type OsHPPD mutant (OsHPPD Mut) expression clones from the E. coli plate obtained by the above transformation were cultured in liquid form in the 96-well plate. HPPD inhibitors with a final concentration of 1–20 μM were added according to the selected agents; for example, the final concentration of tembotrione was 1.7 μM, while mesotrione was 10 pM. After adding all components, a strong, gas-permeable sealing film was applied as a cover (Suolaibao Biological Agent Company, Beijing, China). (3) The 96-well plate was incubated on a shaker at 28 °C and 150 rpm for 24 hours. Light absorption at 400 nm of the culture was visualized or detected, and clones that significantly produced the black pigments were selected by loop inoculation and subsequently cultured. Plasmid DNA was extracted, sequenced, and used for further studies, such as expression, purification, and enzyme activity assay of the OsHPPD protein. CQ / yzn / Lznz / q / Yl· The single-site mutants A103S, A165V, V1911, R220K, D370N, K410I and the three-site mutants H141R / G342D / D370N were obtained with the primers shown in Table 2 using the same method, respectively. CQ / yzn / Lznz / q / Yi Table 2 Primers used in the preparation of HPPD mutants Primer name Primer sequence (5'-3') NusOsF acg att gat gac gac gac aag ATGCCTCCCACTCCCACCCC NusOsR tccacgagctccggactcTTA CTAGGATCCTTGAACTGTAG OsHPPD-H141 RF CACGGCCTCGCGGTGNNKGCCGTGGGCGCG OsHPPD-H141 RR CACCGCGAGGCCGTGGTCC OsHPPD-A103S-F GCGTTCCTTCACCNNKCCTACGGCGGCGCGACCACG OsHPPD-A103S-R GGTGAAGAGGAACGCGACGGAGGC OsHPPD-A165V-F TCGCGGCCGGTGCGCGCCCGNNKTTTCCAGCCCG OsHPPD-A165V-R CGGGCGCGCACCGGCCGCGAC OsHPPD-V191l-F GTCGTGCTCCGCTTCNNKAGCCACCCGG OsHPPD-V191 lR GAAGCGGAGCACGACGTCGCC OsHPPD-R220K-F CGCCGTGGACTACGGCCTCCGCNNKTTCGACCACG OsHPPD-R220K-R GCGGAGGCCGTAGTCCACGGCGC OsHPPD-D370N-F CTCGTGGACAGGGATNNKCAGGGGGTGTTGCTCCAGATCT OsHPPD-D370N-R ATCCCTGTCCACGAGCACCCC OSHPPD-K410I-F TGGGCAGGAGTACCAGNKGGCGGCTGCGGCG OsHPPD-K410l-R CTGGTACTCCTGCCCACTCTCATCC OsHPPD-H141 R / G342D / D370N-F GGCCTCAACTCGGTGGTGCTCG OsHPPD-H141 R / G342D / D370N- R GCGAGCACCACCGAGTTGAGGC In addition, some two-site mutants involving a combination of single-site mutations, such as H141R / G342D, H141R / D370N, and G342D / D370N, were also prepared using a bridging PCR-like method. Example 3 Combinations of mutations at multiple sites of rice HPPD proteins (OsHPPD) The present invention also tested the color reaction of H141R, G342D, D370N, and mutant HPPD proteins comprising a combination thereof to five different HPPD-inhibiting herbicides, e.g., tembotrione, a metabolite of benzufucaotong, huanbifucaotong, topramezone, and mesotrione, at different times and on different 96-well plates. The test results are shown in Figures 4, 5, and 6. Table 3 shows the resistance / tolerance of these mutants to the corresponding herbicides, estimated based on their color tones. It can be seen in Table 3 that the two-site and three-site mutants also exhibited high herbicide tolerance, demonstrating that combinations of amino acid mutations could be present in the rice HPPD protein (OsHPPD) in combinations that also confer high resistance and / or tolerance to HPPD-inhibiting herbicides. Table 3 HPPD resistance of single-site and multi-site mutant rice to 5 herbicides Complex sites Tembotrione Benzuofucaotong metabolite Huanbifucaotong Topramezone Mesotrione Wild type (WT) + + + + + H141R 2+ 5+ 20+ 15+ 20+ G342D 3+ 5+ 10+ 7+ 20+ D370N 1.5+ 2+ 5+ 5+ 5+ H141R / G342D 10+ 10+ 30+ 25+ 30+ H141R / D370N 3+ 4+ 20+ 20+ 10+ G342D / D370N 2+ 4+ 5+ 5+ 6+ H141R / G342D / D370N 10+ 10+ 30+ 30+ 30+ Example 4 Additional saturation mutation based on the three-site mutant H141R-G342D-D370N 1 .In the color reaction of the three-site mutant OsHPPD H141R-G342D-D370N expressed in In E. coli, when shuangzuocaotong (code 101) was used for inhibition, a concentration of 120 M was required to produce no significant color reaction. Therefore, 120 μM of compound 101 was chosen for initial screening. Using the previously mentioned technical route, a primer pair was designed for each amino acid at amino acid positions 51–446 (excluding sites 141R, 342D, and 370N), respectively, with one of these primers represented by NNK at the amino acid site to be subjected to saturation mutation. A series of mutants were produced by PCR amplification, then expressed in E. coli BL21 (DE3), and repeatedly screened with 120 μM of compound 101. After screening all single-site mutations, 18 new mutation sites were obtained.The new sites were: R93S, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, R346C, R346D, R346H, R346S, R346Y, I377C, P386T, L390I, M392L, E403G, K418P, G419F, G419L, G419V, N420S, N420T, E430G, Y431L. The amino acid and nucleotide (base) changes for these new mutation sites, as well as the primers used to produce these new mutation sites, are listed in Table 4, and the primer sequences are listed in Table 5. To summarize, as shown in Figure 7, 26 mutation sites were obtained by screening, where, an original amino acid at some of the sites could be changed to several different amino acids, e.g., H141R,K,T; N338D,S,Y; R346C,D,H,S,Y; G419F,L,Vand N420S,T. Table 4 All selected mutation sites, amino acid and base changes, and primers used CQ / yzn / Lznz / q / Yi Site WT Mutation Primer Amino acid Base Amino acid Base 93 R CGC S TCC 93F 93R 226 G GGC H CAC 226F 226R 276 L CTG W TGG 276F 276R 277 P CCG N AAT 27 27 R CCG D 36 PCG 336F 336R 337 P CCC A GCC 337F 337R 338 N AAC D,S,Y GAC,AGC,TAC 338F 338R 346 R CGC C,H,S,D,Y TGC,CAC,AGC,GAC,TAT 346F 346R 377 I ATC C TGC 377F 377R 386 P CCA T ACA 386F 386R 390 L TTG I ATT 390F 390R 392 M ATG L CTG 392F 392R 403 E GAG G GGG 403 KAGF 403 KAGF C184 PCG 418F 418R 419 G GGC F,L,V TTC,TTG,GTG 419F 419R 420 N AAC ST AGC.ACC 420F 420R 430 E GAG G GGG 430F 430R 431 Y TAT L CTG 431R 431R Table 5 All newly selected mutation sites and primer sequences used Amino acid position Primer and the sequence (5'^3 j CQ7 / 7Π / Ι 7Π7 / 3 / ϒ 5 93 93- F:CGCACGCCTCCCTCCTCCTCNNKTCCGCCTCCGTCGCGTTCCTC 93-R:GAGGAGGAGGGAGGCGTGCG 226 226-F:GCCGGTTCGACCACGTCGTCNNKAACGTGCCGG 226-R:GACGACGTGGTCGAACCGGC 10 276 276-F:ACAACGCGGAGACCGTGCTGNNKCCGCTCAACG 276-R:CAGCACGGTCTCCGCGTTGT 15 277 277- F:ACGCGGAGACCGTGCTGCTGNNKCTCAACGAGCCGGTGCACGG 277-R:CAGCAGCACGGTCTCCGCGTTG 336 336- F:TCGAGTTCTTGGCGCCGCCGNNKCCCAACTACTACGACGGCGTG 336-R:CGGCGGCGCCAAGAACTCGAAG 20 337 337- F:AGTTCTTGGCGCCGCCGCCGNNKAACTACTACGACGGCGTGCG 337-R:CGGCGGCGGCGCCAAGAACTC 25 338 338- F:TCTTGGCGCCGCCGCCGCCCNNKTACTACGACGGCGTGCGGCG 338-R:GGGCGGCGGCGGCGCCAAGAAC 346 346- F:ACTACGACGGCGTGCGGCGGNNKGCCGGGGACGTGCTCTCGGAG 346-R:CCGCCGCACGCCGTCGTAGTAG 30 377 377-F:ACCAGGGGGTGTTGCTCCAGNNKTTCACCAAGC 377-R:CTGGAGCAACACCCCCTGGT 35 386 386- F:CCAAGCCAGTAGGAGACAGGNNKACCTTTTTCTTGGAGATGATAC 386-R:CCTGTCTCCTACTGGCTTGG CQ7 / 7Π / Ι 7Π7 / 3 / Υ 390 390-F:GAGACAGGCCAACC IIII ICNNKGAGATGATAC 390-R:GAAAAAGGTTGGCCTGTCTC 392 392-F:AGGCCAACC III CTTGGAGNNKATACAAAGGA 392-R:CTCCAAGAAAGGTTG3GCTG 492-R:GAAAAAGGTTGGCCTGTCTC 403-F:TTGGGTGCATGGAGAAGGATNNKAGTGGGCAGGAGTACCAGAAG 403-R:ATCCTTCTCCATGCACCCAATC 418 418- F:GCGGCTGCGGCGGGTTTGGGNNKGGCAACTTCTCGGAGCTGTTC 418-R:CCCAAACCAGGCCCG-1949 F:GGCTGCGGCGGGTTTGGGAAGNNKAACTTCTCGGAGCTGTTCAGCCAG 419-R:CTTCCCAAACCCGCCGCAGCC 420 420- F:GCGGCGGGTTTGGGAAGGGCNNCTCTCGGAGCTGTTCAAGTC 420-R:GCCTTCCCAAA4 430-F:AGCTGTCCAAGTCCATTGAGNNCTATGAGAAATCCCTTGAAGC 430-R:CTCAATGGACTTGAACAGCTC 431 431- F :TGTCCAAGTCCATTGAGG AG NN KGAGAAATCCCTTG AAGCCAAG 431 -R: AGCTCATTGAGTCATGAGG Example 5 Mutation Site Combinations The mutation sites were combined based on the following three principles: the sites were close together to facilitate homologous replacement in gene editing, resulting in high editing efficiency; the base change was the same as A → G / T → C or CT / G → A to facilitate base editing; and the resistant sites were as small as possible to facilitate editing and avoid potential negative effects. According to these principles, the combinations, corresponding primers, and prokaryotic expression vectors were designed and then analyzed using colorimetric reactions. CQ / yzn / Lznz / q / Yi to find a highly resistant combination suitable for gene editing. (1) A total of 33 combinations were designed according to the close distance principle, of which 24 combinations had 3 mutation sites and 9 combinations had 4 mutation sites. Table 6 shows these combinations and the primer sequences used. CQ7 / 7Π / I 7Π7 / 3 / Y Table 6 Combinations of mutation sites (3 or 4 mutation sites) designed under the short distance principle Combinations of 3 / 4 positions of different types and sizes (5'^3 j P336D / N338D / G342D 1-336D-F1 : TCGAGTTCTTGGCCGCCGGATCCCGAC TACTACGACGACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG P336D / N338S / G342D 1-338S-F1 : TCTTGGCGCCGCCGGATCCCAGCTACTAC GACGACGTGCGGCG 1-338S-R1 : GGGATCCGGCGGCGCCAAG GCGGCG 1-338S-R1: GGGATCCGGCGGCGCCAAG N338D / G342D / R346C 346-F-2: CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCT CTCG 346-R-2: CCGCCGCACGTCGTCGTAG N338D / G342D / R346H 346-F-3: CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCT CTCG 346-R-2 : CCGCCGCACGTCGTCGTAG N338D / G342D / R346S 1-346S-F1 : CTACGACGACGTGCGGCGGAGCGCCGGGGACGTGCT CTCG 346-R-2 : CCGCCGCACGTCGTCGTAG N338S / G342D / R346C 2-338S-F1 : CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGT GCGGC 2-338S-R1 : GGGCGGCGGCGGCGCCAAG N338S / G342D / R346H 2-338S-F1 : CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGT GCGGC 2-338S-R1 : GGGCGGCGGCGGCGCCAAG N338S / G342D / R346S 2-338S-F1 : CTTGGCGCCGCCGCCGCCCAGCTACTACGACGACGT GCGGC 2-338S-R1 : GGGCGGCGGCGGCGCCAAG N338Y / G342D / R346C 2-338Y-F2 : CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGT GCGGC 2-338S-R1 : GGGCGGCGGCGGCGCCAAG N338Y / G342D / R346H 2-338Y-F2 : CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGT GCGGC 2-338S-R1 : GGGCGGCGGCGGCGCCAAG N338Y / G342D / R346S 2-338Y-F2 : CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGT GCGGC 2-338S-R1 : GGGCGGCGGCGGCGCCAAG cqj / zn / Lznz / q / Yi P336D / G342D / R346C 2-336D-F1 : TCGAGTTCTTGGCGCCGCCGGATCCCAACTACTACGAC GAC 1-336D-R1 : CGGCGGCGCCAAGAACTCG P336D / G342D / R346H 2-336D-F1 : TCGAGTTCTTGGCGCCGCCGGATCCCAACTACTACGAC AC 1-336D-R1 2-346C-F2: CTACGACGGCGTGCGGCGGTGCGCCGGGGACGTGCT CTCGG 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338D / R346H 2-346H-F2 : ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGC TCTCGG 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338D / R346S 2-346S-F2 : ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGC TCTCGG 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338S / R346C 2-346C-F2 : CTACGACGGCGTGCGGCGGTGCCGGGGACGTGCT CTCGG 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338S / R346H 2-346H-F2 : ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGC TCTCGG CQ / yzn / Lznz / q / Yi 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338S / R346S 2-346S-F2 : ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGC TCTCGG 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338Y / R346C 2-346C-F2 : CTACGACGGCGTGCGGCGGTGCGCCGGGGACGTGCT CTCGG 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338Y / R346H 2-346H-F2 : ACTACGACGGCGTGCGGCGGCACGCCGGGGACGTGC TCTCGG 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338Y / R346S 2-346S-F2 : ACTACGACGGCGTGCGGCGGAGCGCCGGGGACGTGC TCTCGG 2-346C-R2 : CCGCCGCACGCCGTCGTAG P336D / N338D / G342D / R 346C 1-336D-F1 : TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTAC GACGACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG P336D / N338D / G342D / R 346H 1-336D-F1 : TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGAC GACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG P336D / N338D / G342D / R 346S 1-336D-F1 : TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGAC GACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG cqj / zn / Lznz / q / Yi P336D / N338S / G342D / R 346C 2-336D-F2 : TCGAGTTCTTGGCGCCGCCGGATCCCAGCTACTACGAC GACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG P336D / N338S / G342D / R 346H 2-336D-F2 : TCGAGTTCTTGGCGCCGCCGGATCCCAGCTACTACGAC GACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG P336D / N338S / G342D / R 346S 2-336D-F2 : TCGAGTTCTTGGCGCCGCCGGATCCCAGCTACTACGAC GACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG 3-336D-F3 P336D / N338Y / G342D / R 346C TCGATTCTTGGCGCCGCCGGATCCCTACTACTACGAC GACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG P336D / N338Y / G342D / R 346S 3-336D-F3 : TCGAGTTCTTGGCGCCGCCGGATCCCTACTACTACGAC GACG 1-336D-R1 : CGGCGGCGCCAAGAACTCG As shown in Figure 8, several combinations of these close mutation sites were cloned, expressed, and compared by color reactions. The three combinations with the mutation sites N338D / G342D / R346C, N338D / G342D / R346H, and N338S / G342D / R346C, respectively, were found to have the greatest resistance and still showed significant color reactions in the presence of 1000-1500 M of shuangzuocaotong metabolic product 101. These were followed by the two combinations with four close mutation sites P336D / N338D / G342D / R346C and P336D / N338D / G342D / R346H, respectively. CQ / yzn / Lznz / q / Yi (2) Six combinations were designed according to the principle to facilitate base editing, namely H141R / N338D / N420S, H141R / N338S / N420S, H141R / N338D and H141R / N420S corresponding to the same A -> G / TC, and G342D / R346C and G342D / R346H corresponding to the same C —> T / G -> A. The primers to produce these combinations and sequences thereof are listed in Table 7. cqj / zn / Lznz / q / Yi Table 7 Combinations of mutation sites designed according to the principle to facilitate base editing Combinations of mutation sites, primers, and sequences (5'^3j H141R / N338D / N4 20S 420-AGC- F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCA AGTC 420-R:GCCCTTCCCAAACCCGCCGC H141R / N338S / N4 20S 338-AGC- F:TCTTGGCGCCGCCGCCGCCCAGCTACTACGACGGCGTGC GGCG 338-R:GGGCGGCGGCGGCGCCAAGAAC H141R / N338D 338-GAC- F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGGCGTGC GGCG 338-R:GGGCGGCGGCGGCGCCAAGAAC H141R / N420S 420-AGC- F:GCGGCGGGTTTGGGGAAGGGCAGCTTCTCGGAGCTGTTCA AGTC 420-R:GCCCTTCCCAAACCCGCCGC G342D / R346C 346-F-2 : CTACGACGACGTGCGGCGGTGCGCCGGGGACGTG CTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG G342D / R346H 346-F-3 : CTACGACGACGTGCGGCGGCACGCCGGGGACGTG CTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG CQ7 / 7Π / I 7Π7 / 3 / Y After the detections, it was found that the color reaction of the six above combinations was also strong, and the color reaction could be discriminated in a culture solution of E. coligue containing herbicide 101 at a concentration of 600-1000 M. (3) Other combinations were shown in Table 8 . Table 8 Combinations of two, three, four, or more mutation sites Mutation site combinations Primers and sequences (5'^3 j H141R / N338D 338-GAC- F:TCTTGGCGCCGGCCGCCCGACTACTACGACGGCGTGCG GCG 338-R:GGGCGGCGGCGCCAAGAAC H141R / G3422D-GAC-GAC F:CGCCGCCCAACTACTACGACGACGTGCGGCGGCGCGCCG GGGAC 342-R:GTCGTAGTAGTTGGGCGGCG N338D / G342D 338-GAC-342-GAC- F:TCTTGGCGCCCCCCGCCCGACTACTACGACGACGTGGCGGCCGGGCGGGGGAGGAGGGGGGGGGGGGGGGGGGGGG3338D / G342D 338-GAC-342-GAC- K418P / G419F 418-CCG-419-TTC- F:CGGCTGCGGCGGGTTTGGGCCGTTCAACTTCTCGGAGCTG TTCAAG 418-R:CCCAAACCCGCCGCAGCCGC G419F / N420S 419-TTC-420-TCG F:GCGGCGGGTTTGGGAAGTTCTCGTTCTCGGAGCTGTTCAA G 419-TTC-420-TCG-R:GAACTTCCCAAACCCGCCGC G342D / R346C 346-F-2 : CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG G342D / R346H 346-F-3 : CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG H141R / N420S 420-AGC- F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAA GTC 420-R:GCCCTTCCCAAACCCGCCGC G338D / K418P 418-CCG- F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGC TGTTC 418-R:CCCAAACCCGCCGCAGCCGC P277N / N338D 277-AAT- F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG L276W / P277N 276-TGG- F:CAACGCGGAGACCGTGCTGTGGCCGCTCAACGAGCCGGT GC 276-R:CAGCACGGTCTCCGCGTTGTTGGCG H141R / N338D / G3 42D 338-GAC-342-GAC- F:TCTTGGCGCCGCCGCCGCCCGACTACTACGACGACGTGCG GCG 338-R:GGGCGGCGGCGGCGCCAAGAAC H141R / G342D / K4 18Ρ 418-CCG- F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGC TGTTC 418-R:CCCAAACCCGCCGCAGCCGC CQ7 / 7Π / Ι 7Π7 / 3 / Υ 5 H141R / G342D / G4 19F 419-TTC- F:GCTGCGGCGGGTTTGGGAAGTTCAACTTCTCGGAGCTGTT CAAG 419-R:CTTCCCAAACCCGCCGCAGC 338-AAC- H141R / G342D / P3 F:TCTTGGCGCCGCCGCCGCCCAACTACTACGACGGCGTGCG 86Τ GCG 10 338-R:GGGCGGCGGCGGCGCCAAGAAC 418-419-420-ACT-F : K418P / G419F / N42 GCGGCGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTCAAGT ΟΤ C 15 418-419-420-R : GAACGGCCCAAACCCGCGC 418-419-420-ACT-F : K418T / G419F / N42 GCGGCGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTCAAGT ΟΤ C 20 418-419-420-R : GAACGGCCCAAACCGCGCGC H141R / G342D / R3 46C 346-F-2 : CTACGACGACGTGCGGCGGTGCGCGGGACGTGCTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG 25 H141R / G342D / R3 46 Η 346-F-3 : CTACGACGACGTGCGGCGGCCACGCCGGGACGTGCTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG 420-AGC- 30 H141R / G342D / N4 F:GCGGCGGGTTTGGGAAGGGCAGCTTCTCGGAGCTGTTCAA 20S GTC 420-R:GCCCTTCCCAAACCGCGCGC 35 H141R / G342D / P2 77Ν 277-AAT- FGCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG CQ7 / 7Π / Ι 7Π7 / 3 / Υ H141R / G342D / P3 36 D 336-GAC- F:GAGTTCTTGGCGCCGCCGGAGACCCAACTACTACGACGACG 336-R:CGGCGGCGCCAAGAACTCGAAGCCGC GC 276 - F:GAGACAGGGCCAACCTTTTTCATTGGAGATGATACAAAGGATT GG 390-R:GAAAAAGGTTGGCCTGTCTC H141R / G342D / I37 7C 377-TGT- F:ACCAGGGGGTGTTGCTCCAGTGTTTCACCAAGCCAGTAGG AGAC 377-R:CTGGAGCAACACCCCCCTGGTC H141R / G342D / M3 92 L 392-CTG- F:GGCCAACCTTTTTCTTGGAGCTGATACAAAGGATTGGGGTGC ATG 392-R:CTCCAAGAAAAAGGTTGGCC 337-R:CGGCGGCGGCGCCAAGAACTC H141R / N338S / G3 42 D 338-AGC- F:TCTTGGCGCCGCCGCCGCCCAGCTACTACGACGGCGTGCG GCG 338-R:GGGCGGCGGCGGCGCCAAGAAC CQ / yzn / Lznz / q / Yi H141R / N338Y / G3 42 D 338-TAC- F:CTTGGCGCCGCCGCCGCCCTACTACTACGACGACGTGCG 338-R:GGGCGGCGGCGGCGCCAAGAACTCG P277N / N338D / G3 42 D 277-AAT- F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG P277N / G342D / R3 46C 277-AAT- F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG P277N / N338D / N4 20S 277-AAT- F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG N338D / G342D / K4 18P 418-CCG- F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGC TGTTC 418-R:CCCAAACCCGCCGCAGCCGC H141R / N338D / G3 42D / K418P 418-CCG- F:GCGGCTGCGGCGGGTTTGGGCCGGGCAACTTCTCGGAGC TGTTC 418-R:CCCAAACCCGCCGCAGCCGC H141R / N338D / G3 42D / G419F 419-TTC- F:GCTGCGGCGGGTTTGGGAAGTTCAACTTCTCGGAGCTGTT CAAG 419-R:CTTCCCAAACCCGCCGCAGC H141R / N338D / G3 42D / P386T 370-GAC- F:GGGTGCTCGTGGACAGGGATGACCAGGGGGTGTTGCTCCA GATC 370-R:ATCCCTGTCCACGAGCACCC cqj / zn / Lznz / q / Yi 5 H141R / N338D / G3 42D / R346C 346-F-2 : CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG H141R / N338D / G3 42D / R346H 346-F-3 : CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG 10 418-CCG-419-TTC- H141R / G342D / K4 F:CGGCTGCGGCGGGTTTGGGCCGTTCAACTTCTCGGAGCTG 18P / G419F TTCAAG 418-R:CCCAAACCCGCCGCAGCCGC 15 H141R / G342D / L2 76W / P277N 276-TGG-277-AAT- F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 276-277-R:CCACAGCACGGTCTCCGCGTTGTTGGC 418-CCG-419-TTC- H141R / N338D / G3 F:CGGCTGCGGCGGGTTTGGGCCGTTCAACTTCTCGGAGCTG 20 42D / K418P / G419F TTCAAG 418-R:CCCAAACCCGCCGCAGCCGC 25 H141R / N338D / G3 42D / G419F / N420 S 419-TTC-420-TCG- F:GCGGCGGGTTTGGGAAGTTCTCGTTCTCGGAGCTGTTCAA G 419-TTC—420—TCG-R:GAACTTCCCAAACCCGCCGC 30 H141R / N338D / G3 42D / K418P / G419F / N420S 418-419-420-TCG-F : GCGGCGGGTTTGGGCCGTTCTCGTTCTCGGAGCT GTTCAAGTC 418-419-420-R : GAACGGCCCAAACCCGCCGC 35 H141R / N338D / G3 42D / K418P / G419F / N420T 418-419-420-ACT-F : GCGGCGGGTTTGGGCCGTTCACTTTCTCGGAGCTGTTC AAGTC 418-419-420-R :GAACGGCCCAAACCCGCCGC cqj / zn / Lznz / q / Yi 5 H141R / N338D / G3 42D / R346C / K418 P / G419F / N420S 346-F-2 : CTACGACGACGTGCGGCGGTGCGCCGGGGACGTGCTCTCG 346-R-2 : CCGCCGCACGTCGTCGTAG H141R / N338D / G3 346-F-3 : 42D / R346H / K418 CTACGACGACGTGCGGCGGCACGCCGGGGACGTGCTCTCG P / G419F / N420S 346-R-2 : CCGCCGCACGTCGTCGTAG 10 P277N / P336D / N3 38D / G342D 277-AAT- F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG 15 P277N / N338D / G3 42D / R346C 277-AAT- F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG 20 P277N / N338D / K4 18P / G419F 277-AAT- F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG 277-R:CAGCAGCACGGTCTCCGCGTTGTTG H141R / P277N / N3 277-AAT- 38D / G342D / K418 F:GCGGAGACCGTGCTGCTGAATCTCAACGAGCCGGTGCACG P / G419F / N420S 277-R:CAGCAGCACGGTCTCCGCGTTGTTG 25 H141R / P277N / P3 1-336D-F1 : 36D / N338D / G342 TCGAGTTCTTGGCGCCGCCGGATCCCGACTACTACGACGAC D / K418P / G419F / N G 420S 1-336D-R1 : CGGCGGCGCCAAGAACTCG 30 H141R / G336D / G3 336-GAC- 42D / K418P / G419F F:GAGTTCTTGGCGCCGCCGGATCCCAACTACTACGACGACG / N420S 336-R:CGGCGGCGCCAAGAACTCGAAGCCGC CQ / yzn / Lznz / q / Yi After detection, the color reaction of the above combinations of two mutation sites was found to be a weak macroscopic observation, within 100 pM of compound 101 for all of them; in combinations of three, four or more sites, the color reaction of H141R / G342D / N338D / R346C, H141R / G342D / N338D / R346H, H141R / G342D / N338D / K418P, Gc2 / N338D / G419F / N420S was strong, and there was color even at the concentration of compound 101 of 1000-2000 M (as shown in figure 9). In summary, single-site mutations showed resistance at 10-20 pM; combinations of two mutation sites showed resistance at around 20-120 m, and the resistance was stronger than that of single-site mutations, and the color was lighter at 100 M; combinations of three mutation sites, namely H141R / N338D / G342D, H141R / G342D / K418P, H141R / G342D / G419F, 338D / 342D / N6 / C / H, exhibited good resistance in order, and there was still a light color up to 1000 M; Combinations of four or more mutation sites, namely H141R / N338D / G342D / K418P, H141R / G342D / K418P / G419F, H141R / N338D / G342D / R / F6 / C / N348D / R346C / R346C / H341R / N338D / G342D / R346H / C / C346 / C / C346 / C / C346 / S / G419F, H141R / N338D / G342D / G419F / N420S, H141R / N338D / G342D / K418P / G419F / N420S and the like, exhibited greater resistance, and the color was still significant at the concentration of compound 101 until 2500 pm. Example 6 Expression, isolation and purification of the OsHPPD protein The rice protein OsHPPD and the homogenate 1,2-dioxygenase (HGD) were obtained by heterologous expression in E. coli, where the gene was inserted into the pET-15b expression vector and expressed in the BL21 (DE3) expression strain, and purified by Ni-NTA resin. (1) The HPPD open reading frame (ORF) of the positive clone was cloned into the pET-15b vector to form a 6HIS-HPPD expression vector and transformed into BL21 (DE3) cells. The expression strain was inoculated into 10 mL of 2 x YT culture medium and cultured overnight on a shaker at 37 °C and 200 rpm. The 10 mL culture was inoculated into 1 L of 2 x YT culture medium and cultured until the OD600 reached 0.6–0.8, cooled to 16 °C, and subjected to overnight expression-induced with 0.2 mM IPTG (isopropyl thiogalactoside). The strains were collected by centrifugation at 2800 x g. (2) The collected strains were resuspended with buffer A (Tris 50 mM, pH 8.0, NaCl 500 mM, imidazole 20 mM), to which PMSF (phenylmethanesulfonyl fluoride) was added to a final concentration of 1 mM and 250 pL of a protease inhibitor cocktail (i.e., a mixture of multiple protease inhibitors) and mixed. The cells were disrupted by ultrasonication in an ice bath (40% of full power, working for a 3 sec / 6 sec interval, 2 x 30 mins (Ningbo Scientz Biotechnology Co., Ltd., Ningbo, China)) and centrifuged at 12000 rpm at 4 °C for 30 mins; and the supernatant was filtered using a 0.22 m filter membrane. (3) Purification with the Ni-NTA column: the supernatant was in contact with the Ni-NTA resin, then rinsed with buffer A containing 50 mM imidazole to remove impurities, and finally eluted with an elution buffer containing 400 mM imidazole. (4) The approximate purity of the protein of interest was analyzed by SDS-PAGE. The eluates containing the protein of interest were pooled and concentrated using an ultrafiltration device (10 kDa molecular weight cutoff, Amicon Ultra). The solution was replaced with a solution containing 20 mM Tris-HCl at pH 7.5 at least three times for desalination. CQ7 / 7P / I 7G>7 / 3 / YIi Total protein concentration was determined by the BCA method. All types of rice HPPD expressed and purified and several mutants thereof are shown in Table 9. Table 9 HPPD WT of rice and various combinations of mutation sites Mutant No. 1 WT 2 H141R / G342D / G419F 3 H141R / N338D / G342D 4 H141R / G342D / K418P 5 H141R / N338D / G342D / P386T 6 N338D / G342D / R346C 7 N338D / G342D / R346H 8 H141R / N338D / G342D / R346C 9 H141R / N338D / G342D / R346H 10 H141R / N338D / G342D / K418P 11 H141R / N338D / G342D / K418P / G419F / N420S 12 H141R / G342D / P277N 13 N338D / G342D 14 G342D / R346C 15 H141R / N338D / N420S (5) Dialysis or passing through a desalination column: the buffer was replaced with a stock solution of 50 mM Tris, pH 8.0 and 500 mM NaCl. The concentration was determined by the BCA method. After packaging and rapid freezing with liquid nitrogen, the eluate was stored in a refrigerator at -80 °C. Example 7 Determination of the effect of compounds on various enzymatic parameters of OsHPPD proteins 1. The activity of an HPPD enzyme was determined by detecting the conversion of 4-hydroxyphenylpyruvate (4-HPP) to homogentisic acid (HGA) catalyzed by the HPPD enzyme and the conversion of HGA to maleylacetoacetate (MAA) catalyzed by homogentisic acid dioxygenase. Maleylacetoacetate had a maximum absorption at 318 nm and an absorption constant of 14.7 OD M-1.cm-1. 2. Six pL of 4-hydroxyphenylpyruvate (4-HPP) at a concentration 50 times higher than the final substrate concentration were added to an ELSA plate, and then 294 pL of hydroxyethylpiperazinetansulfonic acid (HEPES) at a final concentration of 25 mM and pH 7.2, along with mM vitamin C, 10 mM FeSO4, 50 nM homogenized dioxygenase, and 5 to 240 nM HPPD enzyme. The final concentration of the 4-HPP reaction substrate typically ranged from 1 to 100 M. 3. The absorbance changes of the reaction wells at 318 nm were continuously monitored by a UV ELISA detector (ReadMax 1900 full wavelength microplate reader, full wavelength type) (Shanghai). 4. Determination of Km, Kcat and Kcat / Km of OsHPPDs Vmax is the maximum catalytic reaction rate achievable by enzyme catalysis. The Michaelis constant, Km, is the substrate concentration required when the enzyme catalyzes the reaction to achieve half the maximum velocity (Vmax). The Km value is a constant and independent of enzyme concentration, and it changes as the substrate type, reaction temperature, pH, and ionic strength change. Kcat is the catalytic constant of an enzyme and refers to the number of substrate molecules that can be catalyzed by one enzyme molecule or one active enzyme site per second. Kcat / Km represents the enzyme's catalytic efficiency. The enzymatic parameters of HPPD (WT) from wild-type rice and several mutants were determined, as shown in Table 10. The data in the table show that the catalytic efficiency was improved in most of the mutants. CQ / yzn / Lznz / q / Yl· Table 10 Determination of the maximum reaction velocity Vmax and Michaelis constant Km. OsHPPD Kcat Km Kcat / Km WT 914 6.7 136 20 H141R / G342D / D370N 1596 10.9 146 H141R / G342D / G419F 3211 7.9 406 H141R / N338D / G342D 2730 6.3 433 H141R / G342D / K418P 2999 30.6 98 H141R / N338D / G342D / P386T 3018 9.7 311 25 N338D / G342D / R346C 980 9.5 103 N338D / G342D / R346H 941 6.3 149 H141R / N338D / G342D / R346C 1739 7.4 235 H141R / N338D / G342D / R346H 2151 7.6 283 H141R / N338D / G342D / K418P 2001 18.8 106 30 H141R / N338D / G342D / K418P / G419F / N420S 935 23 41 H141R / G342D / P277N 186 1.1 169 N338D / G342D 206 2.1 98 G342D / R346C 220 5.9 37 H141R / N338D / N420S 823 5.1 161 35 5. Determination of the inhibitory activity (IC50) of herbicide 101 and huanbifucaotong against OsHPPD proteins The inhibitory activity of the metabolic products of shuangcaozuotong and huanbifucaotong against wild-type (WT) rice and various OsHPPD mutant proteins was determined, as shown in Figure 10 and Table 11. These results revealed that the IC50 values ​​of compound 101 and the herbicide compound huanbifucaotong were significantly improved for several mutants compared to the wild type. For example, the IC50 value of compound 101 for the H141R / N338D / G342D / K418P / G419F / N420S mutant was 13.7 times higher than that of the wild type, while the IC50 value of huanbifucaotong for the same mutant was 1.8 times higher. This increase in IC50 values ​​indicates improved tolerance of these mutants to HPPD herbicides. Due to the unique properties of each of 101 and huangbifucaotong, the degree of increase in the IC50 value is not completely consistent for the two HPPD herbicides. CQ7 / 7Π / Ι 7Γ>7 / 3 / ΥΙι Table 11 IC50 values ​​of inhibitory HPPD 101 and huanbifucaotong for WT and various OsHPPD mutants OsHPPDs IC50 101 (μΜ) Huanbifucaotong Manifold WT Manifold 7.6 1.0 1.1 1.0 H141R / G342D / D370N 41 5.4 8.7 7.9 H141R / G342D / G419F 43 5.7 4.1 3.7 H141R / N338D / G342D 24 3.2 4.9 4.5 H141R / G342D / K418P 72 9.5 13 11.8 H141R / N338D / G342D / P386T 51 6.7 14 12.7 N338D / G342D / R346C 50 6.6 5.9 5.4 N338D / G342D / R346H 85 11.2 8.7 7.9 H141R / N338D / G342D / R346C 57 7.5 4.8 4.4 H141R / N338D / G342D / R346H 72 9.5 6.8 6.2 H141R / N338D / G342D / K418P 93 12.2 6.0 5.5 H141R / N338D / G342D / K418P / G419F / N420S 104 13.7 2.0 1.8 H141R / G342D / P277N 93 12.2 27.0 24.5 N338D / G342D 122 16.1 15.0 13.6 G342D / R346C 44 5.8 3.1 2.8 H141R / N338D / N420S 18 2.4 1.0 0.9 6. Determination of the enzymatic aptitude of OsHPPD proteins to inhibitors Enzyme fitness is an indicator of an enzyme's adaptability to an inhibitor, and the higher the value, the stronger the enzyme's resistance to the inhibitor. Since the substrate concentration during the reaction is much higher than the Km value, and the reaction conditions for the different OsHPPD mutants are the same, Kcat could be replaced by the Vmax achieved by catalysis at the same enzyme concentration (500 nM). Enzyme fitness = Kcat * Km-1 * K1, K1 = IC50 / (1 + S / Km) (inhibition constant). The inhibition constants of the herbicide compounds 101 and huanbifucaotong against HPPD WT rice and various mulants, along with their corresponding enzyme fitness, were detected to further evaluate the tolerance of these mulants to the herbicides. The results mentioned in Table 12 indicate that the enzyme fitness of the mules has different levels of improvement compared to WT, confirming their greater tolerance. Table 12 Determination of the enzymatic aptitude of OsHPPD to different compounds. OsHPPD Kcat Km Kcat / K ΠΊ K¡ Enzymatic aptitude 101 Huanbi fucaoto ng 101 Huanbi Fucaoto ng WT 914 6.7 136 0.25 0.036 34 4.9 H141R / G342D / D370N 1596 10.9 146 2.12 0.450 310 66 H141R / G342D / G419F 3211 7.9 406 1.63 0.156 664 63 H141R / N338D / G342D 2730 6.3 433 0.73 0.150 318 65 H141R / G342D / K418P 2999 30.6 98 9.55 1.725 936 169 H141R / N338D / G342D / P386T 3018 9.7 311 2.36 0.648 734 201 N338D / G342D / R346C 980 9.5 103 2.27 0.268 234 28 N338D / G342D / R346H 941 6.3 149 2.60 0.266 388 40 H141R / N338D / G342D / R346C 1739 7.4 235 2.03 0.171 478 40 H141R / N338D / G342D / R346H 2151 7.6 283 2.64 0.249 746 70 H141R / N338D / G342D / K418P 2001 18.8 106 7.99 0.516 851 55 H141R / N338D / G342D / K418P / G419F / N420S 935 23 41 10.73 0.206 436 8.4 H141R / G342D / P277N 186 1.1 169 0.25 0.036 86.0 25.0 N338D / G342D 206 2.1 98 0.51 0.148 124.4 15.3 G342D / R346C 220 5.9 37 1.27 0.156 47.0 3.3 H141R / N338D / N420S 823 5.1 161 1.26 0.089 72.2 4.0 In summary, a series of enzymatic tests confirmed that the tolerance of OsHPPD rice mulants to herbicides was improved compared to the wild-type WT. Among them, the quadruple-site mutant H141R / N338D / G342D / K418P, which showed the greatest resistance in the color reaction, also showed greater resistance in in vitro enzyme activity experiments. Furthermore, the results showed that mulants with the K418P mutation exhibited significantly improved resistance but reduced substrate affinity (Km). The H141R / G342D / P277N and H141R / N338D / G342D / K418P mutants had comparable resistance, and their substrate affinity (Km) was not reduced. Additionally, the triple-site mutant H141R / N338D / G342D and the quadruple-site mutant H141R / N338D / G342D / P386T also had relatively high resistance, and its Km was not reduced. The shorter triple mutant N338D / G342D / R346H also showed good resistance and was easy to edit. N338D / G342D / R346H (the shortest, suitable for homologous replacement HDR), H141R / N338D / G342D (shortest, also suitable for homologous replacement) and H141R / N338D / N420S (suitable for base editing, stronger resistance) were considered preferred for further testing. After undergoing transgenesis and gene editing, the plants were screened for tolerance changes. Example 8 Overexpression of the OsHPPD3M triple site mutant in transgenic rice 1. Construction of the overexpression vector 1) Primers: Primers were designed according to the selected restriction sites and the nucleotide sequence of the gene itself to amplify the three-site mutant HPPD (H141R / G342D / D370N) (OsHPPD3M). The designed primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.: HPPD-F, GATAGCCGGTACGGGTTCGAGCCACC ATGCCTCCCACT CCCACCC, HPPD-R, CATCTTTGTAATCGGTACCTAGGATCCTTGAACTGTAGGG. 2) PCR amplification: The gene of interest was amplified using the synthesized primer and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplified product was assayed by agarose gel electrophoresis, and the product was recovered according to the operating instructions for the TIANquick Midi purification kit. Once recovery was complete, the concentration of extracted DNA was determined using Nanodrop. 3) Construction of a rice overexpression vector: The rice overexpression vector pCAMBIA1301-OsHPPD3M was constructed from the recovered HPPD fragments and the pCAMBIAI 301 plasmid digested by Kpnl and Hindll using the HB-in fusionTM seamless cloning kit from HanBio Biotechnology Co., Ltd., (Shanghai), and then transformed into E. coli DH5a competent to obtain a positive clone; the positive clone was transformed into Agrobacterium after sequencing and restriction endonuclease digestion. 2. Rice calluses infected with transformed Agrobacterium and occurrence of a transgenic event 1) The rice overexpression vector pCAMBIAI 301-OsHPPD3M and the empty vector pCAMBIAI 301 expressing only mCherry (a fluorescent protein marker gene) were added at 1 pg each to competent Agrobacterium EH105, respectively, placed on ice for 5 minutes, rapidly frozen by immersion in liquid nitrogen for 5 minutes, held at 37 °C for 5 minutes and finally placed on ice for 5 minutes; to which 500 I of YEB culture solution (without antibiotics) was added and cultured on a shaker at 28 °C and 200 rpm for 2-3 hours; the cells were collected by centrifugation at 3500 rpm and the collected cells were applied to the YEB (kalamicin + rifampicin) plate and cultured for 2 days in an incubator at 28 °C; Individual clones were selected, grown in a liquid medium, and stored at -80 °C. 2) Agrobacterium culture: The transformed monoclonal Agrobacterium was selected and cultured in YEB (caramycin + rifampicin) liquid medium at 28 °C until the OD600 was 0.5, colonies were collected at 3500 rpm, diluted with an equal amount of AAM (1 mL AAM + 1 pl 1000 x AS) liquid medium, and used to infect a callus. 3) Induction of callus in Zhonghua 11 rice variety: Before the preparation of Agrobacterium, the rice callus was prepared first. The rice seeds were hulled, washed with sterile water until the wash water ran clear without limiting washing times, disinfected with 70% alcohol for 30 seconds and then with 5% sodium hypochlorite, then cultured on a horizontal shaker for 20 minutes, disinfected with sodium hypochlorite and washed with sterile water 5 times, placed on sterile absorbent paper to air dry the water from the surface of the seeds and inoculated in an induction medium to cultivate the callus at 28 °C. 4) Rice callus infection with Agrobacterium: Calluses from Huaidao No. 5 with a diameter of 3 mm were selected and subcultured for 10 days, and the calluses were collected in a 50 mL centrifuge tube. An Agrobacterium bacterial solution with a modulated concentration was added to the centrifuge tube containing the calluses, and the centrifuge tube was placed on a shaker at 28 °C and 200 rpm to infect for 20 minutes; after the infection was complete, the bacterial solution was discharged and the calluses were placed on sterile filter paper and air-dried for approximately 20 minutes and co-cultured on a co-culture plate in which a sterile filter paper was moistened with an AAM.The liquid culture was covered (1 mL of AAM + 30 pL of 1000 x AS); after 3 days of infestation, Agrobacterium was washed off and removed (i.e., washed with sterile water 5 times and then washed with 500 mg / l of cephalosporin antibiotic for 20 minutes) and the calluses were cultured in 50 mg / l of a hygromycin screening medium. 5) Screening, differentiation, and rooting of resistant calli: Co-cultured calli were transferred to a screening medium for the first screening round (2 weeks). After the first screening round, the newly grown calli were transferred to a screening medium (containing 50 mg / L of hygromycin) for the second screening round (2 weeks). After screening was completed, well-grown, blond calli were selected for differentiation, and 1–5 μM of tembotrione was added to a differentiation medium for herbicide resistance testing. After 3–4 weeks, plantlets approximately 1 cm in diameter were obtained.The differentiated seedlings were transferred to a rooting medium for rooting culture; the rooted seedlings underwent an acclimatization treatment and were then transferred to a pot containing soil for cultivation in a greenhouse; and 55 seedlings or OsHPPD3M events were obtained. 3. Preliminary detection of herbicide resistance in transgenic seedlings (T0 generation): 1-5 μM of tembotrione was added to a differentiation medium, and the results showed that empty vector control seedlings were not tolerant to tembotrione, while transformed seedlings overexpressing the triple HPPD mutant at the site (H141R / G342D / D370N) were tolerant to 3 μM of tembotrione, as shown in Figure 11. 4. Redetection of herbicide resistance in transgenic seedlings (T0 generation): Transgenic seedlings of the T0 generation were transplanted into large plastic buckets in the greenhouse to obtain T1 generation seeds. Two overexpressed mutant events were randomly selected at the union stage, and herbicide resistance was detected in both events and in a non-transgenic rice variety, Zhonghua 11, at the same growth stage as the control. The herbicide used was shuangzuocaotong. The field application rate of shuangzuocaotong was generally 4 g a. / mu. In this test, the application rate of shuangzuocaotong was 8 and 16 g per mu. Results of resistance detection: On the fifth day after spraying (16 g / mu) and the seventh day after spraying (8 g / mu), non-transgenic rice seedlings began to bleach, but the overexpressed transgenic mutants, Event 1, Event 2, Event 3, and Event 4, remained green. After 32 days of spraying, the non-transgenic seedlings treated with the herbicide were almost dead, but the overexpressed transgenic mutants, treated with the herbicide at 8 g / mu or 16 g / mu, were still green, grew normally, and began to sprout (as shown in Figures 12A and 12B). 5. Redetection of herbicide resistance in transgenic seedlings (T1 generation): a) Three selected events of the overexpressed transgenic mutant HPPD, Event 20, Event 28 and Event 37 and non-transgenic wild-type Huaidao No.5 (Huaidao No.5 had a higher natural tolerance to the HPPD inhibitor Shuangzuocaotong than Zhonghua 11, and multiple resistance could not be calculated on the basis of Huaidao No. 5, and the actual resistance should be higher). b) The shuangzuocaotong rates used were 0, 4, 8, 16, 32, and 64 g / mu. Due to the low temperature and weak lighting in the greenhouse during winter, phytotoxicity symptoms appeared slowly. Fourteen days after spraying, the non-transgenic Huaidao No. 5 treated with 32 and 64 g / mu of herbicide showed symptoms, but the transgenic events were asymptomatic and remained green (Figures 12C and 12D). In conclusion, the triple-site overexpressed mutant OsHPPD3M (H141R / G342D / D370N) could increase the resistance of transgenic rice varieties to the HPPD-inhibiting herbicide by providing multiple resistance of at least 4. From the preliminary observation of growth, development, flowering, and fruiting of generation T0 and generation T1, it could be seen that most of the plants were normal. Example 9 Determination of the number of HPPD copies overexpressed in transgenic rice Hygromycin-resistant gene: The rice hppd gene (Oshppd) had a high GC content, which affected the efficiency of PCR amplification. Furthermore, there is an endogenous copy of hppd in rice. Therefore, the hygromycin-selective, hygromycin-resistant gene was chosen as an exogenous gene, and the sucrose phosphate synthase (SPS) gene was chosen as an endogenous reference gene for copy number estimation. The SPS gene was a rice-specific gene and a single copy that could serve as an endogenous reference gene for rice (Ding Jiayu, Jia Junwei, Yang Li tao et al. Validation of a rice-specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes [J].J. Agrie. Food Chem., 2004, 52: 3372-7).The number of overexpressed hppd copies could be estimated indirectly by determining the number of copies of the selective marker gene hygromycin resistant gene (hyg) from transgenic rice. CQ7 / 7Π / Ι 7Γ>7 / 3 / ΥΙι Genomic DNA: Genomic DNA from rice leaves was extracted and purified using a plant genomic DNA extraction kit from Tian'gen Biotech (Beijing) Co., Ltd., and the DNA content and purity were detected using a Nanodrop nucleic acid analyzer. When the OD260 / OD280 ratio was in the range of 1.8–2.0, purity was considered good, and when the OD260 / OD230 ratio was approximately 2.0. Primers: Two pairs of primers were designed: Hyg-F: 5'-GTACACAAATCGCCCGCAG-3' and Hyg-R: 5'-TCTATTTCTTTGCCCTCGGAC-3' were used to amplify a 111 bp fragment of the hygromycin-resistant gene in length; Sps-F: 5'-GTACACAAATCGCCCGCAG-3' and Sps-R: 5'TCTATTTCTTTGCCCTCGGAC-3' were used to amplify a 170 bp fragment of the sucrose phosphate synthase (SPS) gene. Quantitative PCR reaction system: The reaction solution (20 µL) was prepared according to the SYBR Premix ExTaq II system for real-time fluorescent quantitative PCR. PCR amplification procedure: predenaturation at 95 °C / 30 s, then at 95 °C / 5 s -> 55 °C / 30 s -> 72 °C / 30 s, 40 cycles. Standard curve plotting: A 400 bp sequence from either the SPS or HYG gene containing the PCR-amplified quantitative fragment was selected and ligated together using homologous recombination, then inserted into the pClone007 vector. The constructed standard plasmid containing the HYG and SPS genes was digested with the restriction endonuclease Pshal into linearized DNA, measured for concentration using a nucleic acid protein detector, and diluted with a ddH2O gradient to 10⁶ copies / pL, 10⁵ copies / pL, 10⁴ copies / pL, 10³ copies / pL, and 10² copies / pL. The five standard samples at different dilutions and a control were simultaneously amplified, and three technical replicates were established for each sample. PCR amplification was performed as described above. The conversion formula between concentration and number of copies was: number of copies (copy / mL) = (6.02 x 1023 copies / mol) x (DNA concentration g / mL) / (MW g / mol). Average molecular weight (MWg / mol): dsDNA = (number of bases) χ (660 dalton / bp). Calculation of the number of transgenic copies: Each analyzed sample had a cycle number (Ct) when it reached the threshold value. The Ct value was substituted into the standard curve to obtain the initial template number in the sample. The ratio of the initial template number of the gene of interest to the initial template number of the endogenous gene was the copy number of the gene of interest. The data obtained from the experiments were exported by software and analyzed using Excel. Real-time fluorescence quantification PCR: The expression levels of relevant genes in transgenic rice were analyzed using the qRT-PCR method to validate the efficiency of gene overexpression. The UBQ5 gene from rice was used as an endogenous reference gene. A reaction solution was prepared for real-time fluorescence quantification PCR. The reaction fluid (20 pL) was prepared according to the SYBR Premix ExTaq II system. The qRT-PCR amplification procedure was as follows: predenaturation at 95 °C for 30 s; denaturation at 95 °C for 5 s; annealing at 60 °C for 30 s; extension at 65 °C for 5 min, for a total of 40 cycles. CQ7 / 7Π / Ι 7O7 / 3 / YL The data obtained from the experiment were exported by software and analyzed using Excel. The relative expression levels of the genes were calculated using ΔΔCT. Three independent biological replicates were established for all samples. In this test, 54 PCR-positive plants and 4 non-transgenic plants were selected as controls, and genomic DNA was extracted using a plant genomic DNA extraction kit. Each sample had three replicates for the quantitative PCR reaction to obtain an amplification curve, where the fluorescence threshold was established in the same way to plot the gene's standard curve. The Ct value was obtained from a sample to be analyzed, and the number of initial templates of the HYG gene in the sample was calculated using the equation: HYGO = 10 (-0.260CT + 10.442). The number of initial templates of the Sps gene in this sample was calculated using the equation: SPSO = 10 (-0.260CT + 10.172).Since the endogenous reference gene of Sps rice was a homozygous diploid, and the probability of the exogenous gene of a transgenic plant being homozygous was very small, the number of copies of the gene of interest in the rice genome was equal to the value obtained by multiplying the data obtained by dividing the number of initial templates of HYG by the number of initial templates of SPS by 2. The number of initial templates of the gene of interest Hyg was compared with the number of initial templates of the endogenous reference gene of Sps rice, and the results in Table 13 showed that, among the 54 transgenic plants, 36 plants had a copy number of 1, 13 plants had a copy number of 2, 4 plants had a copy number of 3 and 1 plant had a copy number of 4, while the negative control copy number was 0. CQ / yzn / Lznz / q / Yl· Table 13 Estimation of the number of copies of the gene of interest in transgenic plants Line SPSo HYGo 2xHYGo / SPS 0 Copy number of the gene of interest Zhonghua 11 314808.9 13585.07 0.086 0 WT-4 794343.5 5099.921 0.013 0 25 WT-7 82126.33 4772.3 0.116 0 WT—8 107315 3540.487 0.066 0 2-1 86158.95 70975.65 1.648 2 2-2 116048.5 97043.28 1.672 2 2-3 98298.14 52089.59 1.060 1 30 2-4 95761.67 48540.84 1.014 1 2-5 99197.34 49539.5 0.999 1 2-6 114053.7 180145.4 3.159 3 2-8 126539 105285.7 1.664 2 2-9 98094.43 98837.9 2.015 2 2-10 87087.68 116834.4 2.683 3 35 2-11 92351.87 144727.1 3.134 3 2-12 78140.72 83886.76 2.147 2 2-13 158780.3 113069.3 1.424 1 2-14 192380.3 58948.64 0.613 1 2-15 238932 74397.84 0.623 1 2-16 161045.9 85497.1 1.062 1 5 2-17 35298.61 17620.82 0.998 1 2-18 213886.9 61843.61 0.578 1 2-19 176775.1 57200.14 0.647 1 2-20 621936.9 368999.1 1.187 1 2-21 594530.9 305098.9 1.026 1 10 2-22 224816.7 117195.8 1.043 1 2-23 77450.64 40664.82 1.050 1 2-24 269156.5 150371.3 1.117 1 2-25 208228.7 75186.45 0.722 1 2-26 169627 60077.38 0.708 1 15 2-27 56297.91 34315.9 1.219 1 2-28 653765.2 400797.1 1.226 1 2-29 80636.42 39719.64 0.985 1 2-30 82451.61 36849.85 0.894 1 2-31 201228.8 71250.85 0.708 1 2-32 101126.2 45752.07 0.905 1 2-33 278596 162471.6 1.166 1 20 2-34 114698 91280.03 1.592 2 2-35 116576.8 52873.89 0.907 1 2-36 82680.12 37455.65 0.906 1 2-37 568452.8 344492.4 1.212 1 2-38 69154.81 85884.22 2.484 2 25 2-39 105306.9 87417.86 1.660 2 2-40 239703.1 371019.4 3.096 3 2-41 278420.5 545540.6 3.919 4 2-42 238414.5 124542.9 1.045 1 2-43 228641.5 127467.9 1.115 1 30 2-44 231265.5 119998.8 1.038 1 2-45 274609.7 136861.8 0.997 1 2-46 188432.1 99115.91 1.052 1 2-47 240136.8 197426.1 1.644 2 2-48 221332.8 230365.3 2.082 2 35 2-49 236717.4 131366 1.110 1 2-50 167319.1 77703.63 0.929 1 2-51 170851.6 197936.8 2.317 2. 2-52 149266.1 132152.6 1.771 2 2-53 139016 135037 1.943 2 2-54 183699.9 77684.4 0.846 1 2-55 182604.6 98325.76 1.077 1 Note: HYGO and SPSO represented the initial number of Hyg and Sps gene templates in the PCR reaction, respectively. Example 10: Rice varieties tolerant to HPPD-inhibiting herbicides obtained by gene editing The rice HPPD gene was mutated and examined. Three mutation sites (141, 342, and 370) and combinations thereof were identified, and in vitro tolerance to HPPD-inhibiting herbicides was analyzed. Based on this, a combined OsHPPD3M mutant (H141R / G342D / D370N) was overexpressed in transgenic rice to confirm that the mutant was highly tolerant to HPPD-inhibiting herbicides. The HPPD gene was then genetically edited to obtain non-transgenic rice varieties tolerant to the HPPD-inhibiting herbicides obtained through gene editing. First, the three sites corresponding to amino acid positions 141, 342, and 370 were subjected to base editing, respectively, and then the three sites corresponding to amino acid positions 141, 342, and 370 were subjected to homologous replacement. The gene editing process and the results were as follows. (1) Base editing is a gene-editing method that uses the CRISPR / Cas9 system to direct the deaminase to a specific site in the genome to modify a specific base. This method has been successfully applied in rice. For example: Yan F., Kuang Y., Ren B., Wang J., Zhang D., Lin H., Yang B., Zhou X., and Zhou H. (2018). High-efficient AT to GC base editing by Cas9n-guided tRNA adenosine deaminase in rice. Mol. Plant. doi: 10.1016 / j.molp.2018.02.008. In this example, the rice HPPD gene site located at locus 0s02g0168100 on the second chromosome, corresponding to amino acid positions 141, 342, or 370, respectively, was edited. The histidine amino acid residue (codon CAO) at position 141 of the rice HPPD gene was edited to arginine (codon CGC; the original A was changed to G) by base editing. Similarly, the glycine amino acid residue (codon GGC) at position 342 was edited to aspartic acid (codon GAC; the original G was changed to A); the aspartic acid amino acid residue (codon GAC) at position 370 was edited to asparagine (codon AAC; the original G was changed to A). A mutant xCas9 (3.7) -ABE protein of the Cas9 protein with broader PAM compatibility was selected as an editing tool (Hu, JH et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature http: / / dx.doi.Org / 10.1038 / nature26155 (2018)). A sgRNA target site was designed according to the DNA sequence of the rice HPPD gene near the site corresponding to the amino acid position 141: GGTGCaCGCCGTGGCGCTGC-GCG, where a represented the site of action of ABE to perform the editing of G from A. The PAM of this sgRNA was GCG which met the requirements of xCas9 (3.7). Similarly, a sgRNA target site was designed according to the DNA sequence of the rice HPPD gene near the site corresponding to amino acid position 342: GCACGcCGTCGTAGTAGTTG GGC, where c represented the CBE action site for T editing of C. The PAM of this sgRNA was GGC which met the requirements of xCas9 (3.7). The DNA sequence of the rice HPPD gene near the site corresponding to the amino acid position 370 was analyzed to design a sgRNA target site: CCTGGTcATCCCTGTCCACG AGC, where c represents the CBE action site, to perform T of C editing. The PAM of this sgRNA was GGC which met the requirements of xCas9 (3.7). Accordingly, three primer pairs: 141GE-F: ggcgGTGCaCGCCGTGGCGCTGC and 141GE-R: aaacGCAGCGCCACGGCGtGCAC; 342GE-F: ggcgCACGcCGTCGTAGTAGTTG and 342GE-R: aaacCAACTACTACGACGgCGTG; 370GE-F: ggcgCCTGGTcATCCCTGTCCACG and 370GE-R: aaacCGTGGACAGGGATgACCAGG, were synthesized, then diluted to 10 M with ultrapure water and mixed in equal amounts; the mixture was placed in a boiling water bath and cooled naturally to room temperature. 1 clg of vector pQY000140 was cleaved by the enzyme Bsal at 37°C for one hour; After detection by agarose gel electrophoresis, the target fragment was recovered, then determined by ultraviolet absorption for concentration, mixed with an annealed fragment in a 1:10 ratio and ligated with DNA ligase T4 (NEB, New England Biolabs, Boston, USA) at 16 °C for 2 hours, and transformed into Trans5a competent cells (TransGen Biotech., Beijing).The transformed cells were cultured overnight at 37 °C. The monoclonal component was sequenced using the Sanger sequencing method to confirm the single-base edited vector sequence. The constructed vector pQY000141 is shown in Figure 13. The correctly sequenced E. coli was cloned, and the plasmid was extracted and transformed into Agrobacterium EH105 (Shanghai Weidi Biotechnology Co., Ltd.). Huaidao No. 5 calluses (at least 3000 calluses) were infected according to the method described above for infecting rice calluses with Agrobacterium. After infection with Agrobacterium, the infected calluses were transferred to a 50 mg / L hygienic screening medium for screening culture. After three rounds (15 days x 3) of screening, well-grown, blond calluses were selected for differentiation in a differentiation medium, and 0.2 pM tembotrione was added during the differentiation process for screening. After 3 to 4 weeks, approximately 1500 plantlets were obtained, each about 1 cm in length. Of these approximately 1500 differentiated plantlets, the vast majority had bleached, with only 4 remaining normal green. These 4 plantlets were transplanted into a rooting medium containing 0.2 pM tembotrione.4 M were cultured for 2 weeks, with two seedlings having been bleached and the other two remaining green (Figure 14A). A small amount of leaves was used to extract genomic DNA using the CTAB method. PCR was performed using the primers oshppd54F: TTCCACCACGTCGAGCTC and Oshppd356R: GGTGAACCCGGAGATGTACG. The amplified product was detected by electrophoresis on 1% agarose and sequenced using the Sanger sequencing method. CQ7 / 7Π / Ι 7Γ>7 / 3 / ΥΙι The sequencing results showed that: the two green plants (QY000141-1 and QY000141-2) were successfully edited (Figure 14B) at the amino acid 141 position, while the bleached ones were wild type. (2) CRISPR / cas9-mediated homologous replacement of the HPPD rice mutant to obtain herbicide resistance After the triple-site mutant H141R / G342D / D370N was obtained overexpressed in a transgenic event, the combination of the three mutation sites was subjected to homologous replacement to obtain non-transgenic rice with herbicide resistance. The rice hppd gene has two exons and one intron. The three target sites H141, G342, and D370 are located in the first exon. gRNA design: At least one gRNA was designed upstream of H141 and downstream of D370, respectively, and cleaved once; and all three sites were simultaneously replaced by homologous replacement. The exon 1 sequence was entered into http: / / crispor.tefor.net / to evaluate all possible gRNAs. According to the principles, if the specific score value is greater than 90 (Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, L1 Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat Biotechnol. 2013 Sep; 31(9):827-32. Doi: 10.1038 / nbt.2647. Epub 2013 Jul 21), off-target effects are avoided and the duration is shortened as much as possible.The following two gRNAs were selected: OshppdgRNA-PAM1-2: 5'GGAACGCGAGCGCCTGGAAC CGG-3' (GC = 70%) (bottom strand); and OshppdgRNA-PAM2-1 (GC = 39%): 5-CACCTCTTTCATGATGAAAA TGG-3' (top strand), where the underlined sequence was the PAM sequence and the bold G meant that when designing a DNA template to replace, this G will be changed to other bases in the replacement template to destroy the PAMs and prevent them from being cut again after replacement. The distribution of the two RNAg1-2 and RNAg2-1 in the rice genomic DNA was as shown in Figure 15. The donor model DNA design was as shown in Figure 16: according to tests performed by the Zhaoyunde Laboratory (Sun Y, Zhang X, Wu C, He Y, Ma Y, Hou H, Guo X, Du W, Zhao Y, Xia L. Engineering Herbicide-Resistant Rice Plants through CRISPR / Cas9-Mediated Homologous Recombination of Acetolactate Synthase. Mol Plant. 2016 Apr 4; 9(4): 628-31. doi: 10.1016 / j.molp.2016.01.001. Epub 2016 Jan. 6), the homologous arm at 350 bp was designed first; to increase the possibility of homologous replacement, two donor template versions were designed for each editing vector; the template was attached directly to the editing vector so that gRNA, Cas9 and the template could enter the same cell simultaneously. Once the cell's genomic target DNA was cleaved by Cas9 and RNA, the template donor DNA could be repaired in time. The other version was the free template donor DNA generated by PCR amplification.These additional repair templates were mixed with an editing vector at a 20:1 ratio (molar ratio of free repair templates: editing vector) and then bombarded with a gene gun. The length of the core replacement region for the three mutated amino acids 141-342-370 was determined by cq; / 7n / i ?n7 / =i / Yl· two selected RNA-directed cleavage sites (i.e., 1056 bp), each of the left and right homology arms was 350 bp long, 6 bp was left at each of the left and right ends after vector cleavage, and the total template length was 1768 bp; in order to facilitate rapid genotyping of the PCR product after PCR amplification, the Ncol cleavage site was removed; And to prevent it from being split again after the replacement, the PAM (NGG) was also removed from the original split site in the template. Editing vector: gRNA1-2 and gRNA2-1 were expressed respectively by the rice U3 promoter. The two gRNA expression cassettes were ligated together with a template and sent to GenScript (Nanjing) Co., Ltd. for synthesis. The synthesized DNA fragment was ligated to a pCXUN-Cas9 scaffold vector in Kpnl using a seamless cloning technique (from Huazhong Agriculture University and Dr. Yu Bing, Mol Plant. 2016 Apr 4; 9 (4): 628-31. Doi: 10.1016 / J.molp.2016.01.001. Epub 2016, Jan 6) to generate an editing vector. Gene gun transformation, detection, differentiation, rooting, and soil culture of seedlings: The previously constructed editing vector was confirmed by sequencing and multi-enzyme excisions and mixed with free template donor DNA generated by PCR amplification at a 20:1 molar ratio (free repair template: editing vector molar ratio). Huaidao No. 5 calluses were then transformed using a gene gun. Approximately 3000 calluses were transformed and transferred to a 50 mg / L hygienic selection medium for culture screening and transgenic plantlet production. After three rounds (15 days x 3) of screening, well-growing blond calluses were selected for differentiation in a differentiation medium, and 0.2 pM tembotrione was added during the differentiation process for screening. After 3–4 weeks, approximately 1000 plantlets were obtained, each approximately 1 cm in diameter.Of the approximately 1000 differentiated seedlings, the vast majority had bleached, and only 21 remained green. These 21 seedlings were transplanted into a rooting medium containing 0.4 M tembotrione and continuously cultured to promote root growth. Two weeks later, 19 seedlings bleached. The remaining two green seedlings (AW2 and AW3) were transplanted into pots and grown in the greenhouse. Photos of the green seedlings taken before transplanting are shown in Figure 17A. Identification of the hppd genotype of edited seedlings: To identify the genotype, three pairs of PCR primers were designed to amplify the region of mutation sites 342-370, the region 342-370 plus a portion of the descendant genomic DNA sequence, and the unique site 141, respectively. These primer pairs were: 290-F: AGATACAGACGTACCTGGACCACCA and 1553-R: GCCGGCAAAAAGGAACTGGG (the region of mutation sites 342-370); 90-F: AGATACAGACGTACCTGGACCACCA and output donor R: AGTGATTGTACCATCATTTGTC (region 342-370 plus a portion of the descendant genomic DNA sequences mentioned below); and 54-F: TTCCACCACGTCGAGCTC and 356-R: GGTGAACCCGGAGATGTACG (141 unique sites). The identification results showed that: the two green plants were successfully edited (Fig. 17B). The bands generated by splitting the PCR product with the Ncol enzyme were combined with the CQ / yzn / Lznz / q / Yl· expectation. The sequence results also showed that wild-type histidine His was changed to arginine Arg at position 141 (whose codon was changed from CAC to CGC), wild-type glycine Gly was changed to aspartate Asp at position 342 (whose codon was changed from GGC to GAC), and wild-type aspartic acid Asp was changed to asparagine Asn at position 370 (whose codon was changed from GAC to AAC). At the same time, numerous tests have shown that introducing the gene of the present invention into model plants such as Arabidopsis thaliana and Brachypodium distachyon leads to enhanced herbicide resistance. Editing the aforementioned mutation sites and combinations thereof using the CRISPR / Cpf1 system is also applied. Consequently, when transgenic technology or gene-editing techniques are applied to the aforementioned plants, such as food crops, legumes, oilseed crops, fiber crops, fruit crops, rhizome crops, vegetable crops, flower crops, medicinal crops, industrial crops, pasture crops, sugar crops, beverage crops, turfgrass, tree crops, nut crops, and the like, the corresponding resistance traits will be obtained, with good industrial value. All publications and patent applications mentioned in the descriptive memorandum are incorporated herein by reference, just as each publication or patent application is incorporated separately or individually by reference in this document. Although the prior invention has been described in detail through illustrations and examples for clarity, some changes and modifications may obviously be implemented within the scope of the appended claims. Such changes and modifications are within the scope of the present invention.

Claims

1. A mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof, wherein, compared to the amino acid sequence of a wild-type rice p-hydroxyphenylpyruvate dioxygenase protein, the amino acid sequence of the p-hydroxyphenylpyruvate dioxygenase (HPPD) protein has one or more of the mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 1911, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 4101, 418F, 419L, 419V, 420S, 420T, 430G and 431L in one or more positions corresponding to 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild-type rice p-hydroxyphenylpyruvate dioxygenase protein, as set out in SEQ ID NO:

2.

2. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to claim 1, wherein the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with the amino acid sequence as set forth in SEQ ID NO:

2.

3. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to claim 1, wherein the mutant p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence as set out in SEQ ID NO: 2, except that it has one or more amino acid mutations as defined in claim 1.

4. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to any of claims 1 to 3, wherein the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein has one or more of the mutations selected from the group consisting of R93S, A103S, H141R, H141K, H141T, A165V, V191I, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, I377C, P386T, L390I, M392L, E403G, K410I, K418P, G419F, G419L, G419V, N420S, N420T, E430G and Y431L in one or more positions corresponding to 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430 and 431 of the amino acid sequence of wild type rice p-hydroxyphenylpyruvate dioxygenase protein as set out in SEQ ID NO:

2.

5. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to claim 4, wherein the mutant p-hydroxyphenylpyruvate dioxygenase protein has an amino acid sequence as set forth in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: Ma / E / ZUZI / U¿ l fOO 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82 or SEQ ID NO:

84.

6. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to claim 4, wherein the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein has the following amino acid mutations: H141R / G342D, H141R / D370N, G342D / D370N, H141R / N338D, H141R / G342D, N338D / G342D, K418P / G419F, G419F / N420S, G342D / R346C, G342D / R346H, H141R / N420S, G338D / K418P, P277N / N338D, L276W / P277N, H141R / G342D / D370N, H141R / N338D / N420S, H141R / N338S / N420S, P336D / N338D / G342D, P336D / N338S / G342D, P336D / N338Y / G342D, N338D / G342D / R346C, N338D / G342D / R346H, N338D / G342D / R346S, N338S / G342D / R346O, N338S / G342D / R346H, N338S / G342D / R346S, N338Y / G342D / R346C, N338Y / G342D / R346H, N338Y / G342D / R346S, P336D / G342D / R346O, P336D / G342D / R346H, P336D / G342D / R346S, P336D / N338D / R346O, P336D / N338D / R346H, P336D / N338D / R346S, P336D / N338S / R346C, P336D / N338S / R346H, P336D / N338S / R346S, P336D / N338Y / R346C, P336D / N338Y / R346H, P336D / N338Y / R346S, H141R / N338D / G342D,H141R / G342D / K418P, H141R / G342D / G419F, H141R / G342D / P386T, K418P / G419F / N420T, K418T / G419F / N420T, H141R / G342D / R346C, H141R / G342D / R346H, H141R / G342D / N420S, H141R / G342D / P277N, H141R / G342D / P336D, H141R / G342D / L276W, H141R / G342D / R346S, H141R / G342D / L390I, H141R / G342D / I377C, H141R / G342D / M392L, H141R / P337A / G342D, H141R / N338S / G342D, H141R / N338Y / G342D, P277N / N338D / G342D, P277N / G342D / R346C, P277N / N338D / N420S, N338D / G342D / K418P, H141R / N338D / G342D / K418P, H141R / N338D / G342D / G419F, H141R / N338D / G342D / P386T, H141R / N338D / G342D / R346C, H141R / N338D / G342D / R346H, H141R / G342D / K418P / G419F, H141R / G342D / L276W / P277N, P336D / N338D / G342D / R346C, P336D / N338D / G342D / R346H, P336D / N338D / G342D / R346S, P336D / N338S / G342D / R346C, P336D / N338S / G342D / R346H, P336D / N338S / G342D / R346S, P336D / N338Y / G342D / R346O, P336D / N338Y / G342D / R346H, P336D / N338Y / G342D / R346S, P277N / P336D / N338D / G342D, P277N / N338D / G342D / R346C, P277N / N338D / K418P / G419F, H141R / N338D / G342D / K418P / G419F, H141R / N338D / G342D / G419F / N420S, H141R / G336D / G342D / K418P / G419F / N420S,H141R / N338D / G342D / K418P / G419F / N420S, H141R / N338D / G342D / K418P / G419F / N420T, H141R / N338D / G342D / R346C / K418P / G419F / N420S, H141R / N338D / G342D / R346H / K418P / G419F / N420S, H141R / P277N / N338D / G342D / K418P / G419F / N420S, o H141R / P277N / P336D / N338D / G342D / K418P / G419F / N420S., 7. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to claim 6, wherein the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein has an amino acid sequence as set forth in SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, cqj / zn / Lznz / q / Yi SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO:162, SEQ ID NO: 164,SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO:174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO:186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO:198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO:210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO:222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO:234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO:246, SEQ ID NO: 248, SEQ ID NO: 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO:258 o SEQ ID NO: 260., 8. A fusion protein comprising the mutant HPPD protein or a bioactive fragment thereof according to any one of claims 1 to 7 and an additional component fused thereto, such as a marker peptide, such as 6 x His, or a guide peptide for a plastid, such as a guide peptide for the chloroplast.

9. An isolated polynucleotide comprising a nucleic acid sequence encoding the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to any of claims 1 to 7 or the fusion protein according to claim 8, or a complementary sequence thereof, wherein the polynucleotide is preferably DNA, RNA or a hybrid thereof, and the polynucleotide is preferably single-stranded or double-stranded.

10. The polynucleotide according to claim 9, wherein a nucleic acid sequence is selected from: (1) a nucleic acid sequence encoding an amino acid sequence as shown in: SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112,SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: cq? / zn / Lznz / q / Yi 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234,SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO: 258 o SEQ ID NO: 260, o una de sus secuencias complementarias; (2 ) una secuencia de ácidos nucleicos como se establece en: SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93,SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217,SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQ ID NO: 239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQ ID NO: 251, SEQ ID NO: 253, SEQ ID NO: 255, SEQ ID NO: 257 or SEQ ID NO: 259, or one of its complementary sequences. (3) a nucleic acid sequence that hybridizes with the sequence shown in (1) or (2) under rigorous conditions; and (4) a nucleic acid sequence that encodes the same amino acid sequence as the sequence shown in (1) or (2) due to degeneracy of the genetic code, or one of its complementary sequences. cq? / zn / Lznz / q / Yii, 11. The polynucleotide according to claim 10, wherein the nucleic acid sequence is optimized for expression in a plant cell.

12. A nucleic acid construct comprising the polynucleotide according to any of claims 9 to 11 and a regulatory element operatively attached thereto.

13. An expression vector comprising the polynucleotide according to any one of claims 9 to 11 and an expression regulator element operatively attached thereto.

14. A host cell comprising the polynucleotide according to any one of claims 9 to 11, the nucleic acid construct according to claim 12 or the expression vector according to claim 13, preferably the host cell being a plant cell.

15. A method for producing a plant having improved resistance or tolerance to a herbicide, comprising regenerating the plant cell according to claim 14 in a plant.

16. A plant that is produced by the method according to claim 15.

17. A method for improving the resistance or tolerance of a plant cell, plant tissue, plant part, or plant to an HPPD-inhibiting herbicide, comprising expressing the mutant phydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to any one of claims 1 to 7 or the fusion protein according to claim 8 in the plant cell, plant tissue, plant part, or plant; or comprising crossing a plant expressing the mutant phydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to any one of claims 1 to 7 or the fusion protein according to claim 8 with another plant, and selecting a plant or a part thereof having improved resistance or tolerance to an HPPD-inhibiting herbicide;or comprising gene editing of an endogenous HPPD protein of the plant cell, plant tissue, part of the plant or plant to achieve expression of the mutant phydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to any of claims 1 to 7 or the fusion protein according to claim 8.; 18. Use of the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a bioactive fragment thereof according to any of claims 1 to 7, the fusion protein according to claim 8 or the polynucleotide according to any of claims 9 to 11 for enhancing the resistance or tolerance of a host cell, plant cell, plant tissue, plant part or plant to an HPPD-inhibiting herbicide, preferably the host cell being a bacterial cell or a fungal cell.

19. A method for controlling weeds in a plant cultivation site, comprising applying to the cultivation site an effective herbicidal amount of one or more HPPD-inhibiting herbicides, wherein the plant comprises the plant according to claim 16 or a plant produced by the method according to any of claims 15 and 17; preferably, the HPPD-inhibiting herbicide comprises at least one of the following effective ingredients: 1) triketones: sulcotrione, mesotrione, bicyclopyrone, tembotrione, tefuryltrione, and benzobiciclone; 2) diketonitriles: 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-4-trifluoromethylphenyl)propane-1,3-dione, 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-3,4- CQ7 / 7Π / Ι 707 / 3 / Yl· dichlorophenyl)propane-1,3-dione, and 2-cyano-1-[4-(methylsuifonyl)-2-trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione; 3) isoxazoles: isoxaflutol, isoxachlortol and clomazone;4) pyrazoles: topramezone, pyrazulfotol, pyrazoxyfen, pyrazolate, benzofenap, shuangzuocaotong, tolpyrylate, benzufucaotong, huanbifucaotong and sanzuohuangcaotongotong; 5) benzophenones; and 6) others: lancotrione, fenquinetrione; and more preferably, the HPPD-inhibiting herbicide comprises at least one of the following effective ingredients: tembotrione, benzufucaotong, huanbifucaotong, topramezone, mesotrione and shuangzuocaotong.

20. The plant according to claim 16, the method according to any of claims 17 and 19, or the use according to claim 18, wherein the plant is a dicotyledonous or monocotyledonous plant, such as a food crop, a legume crop, an oilseed crop, a fiber crop, a fruit crop, a rhizome crop, a vegetable crop, a flower crop, a medicinal crop, an industrial crop, a pasture crop, a sugar crop, a beverage crop, a lawn plant, a tree crop, a nut crop, and the like.

21. A method for producing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein that retains or enhances the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) in homogenate and is significantly less sensitive to HPPD-inhibiting herbicides than a wild-type HPPD, comprising the steps of: mutating a nucleic acid encoding a wild-type HPPD, fusing and ligating the mutated nucleic acid in the frame to a nucleic acid sequence encoding a solubility-enhancing component in an expression vector to form a sequence encoding a fusion protein, transforming the resulting recombinant expression vector into a host cell, expressing the fusion protein under suitable conditions containing the HPPD-inhibiting herbicide and an HPPD enzyme substrate,and selecting a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein that retains or improves the property of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogenate and has significantly reduced sensitivity to the HPPD-inhibiting herbicide; wherein the solubility-enhancing component is preferably selected from NusA, which forms a fusion protein with the mutant HPPD protein of the present invention; the expression vector is preferably selected from the pET-44a vector; and the host cell is preferably selected from a bacterial cell, a fungal cell, or a plant cell,