COMPOSITIONS COMPRISING RECOMBINANT BACILLUS CELLS AND AN INSECTICIDE
Patent Information
- Application Number
- MX2021001946
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2014-09-17
- Filing Date
- 2017-03-17
- Publication Date
- 2026-06-12
- Estimated Expiration
- 2035-09-17
AI Technical Summary
Current agricultural practices face challenges in achieving effective plant growth promotion and pest control while minimizing chemical residues and resistance development, as synthetic fertilizers and pesticides can lead to soil degradation and pest resistance, and biological control agents often fall short in efficacy.
A composition comprising recombinant Bacillus cells that express a fusion protein with a targeting sequence localizing it to the exosporium, combining plant growth-stimulating proteins or peptides with insecticides to enhance plant health and pest control synergistically.
The composition improves plant growth, health, and pest control efficacy by using recombinant Bacillus cells expressing fusion proteins, reducing chemical residues and minimizing pest resistance, while maintaining soil health.
Abstract
Description
COMPOSITIONS COMPRISING RECOMBINANT BACILLUS CELLS AND AN INSECTICIDE CROSS REFERENCE TO RELATED REQUESTS This application claims priority from US Patent Application No.: 60 / 62 / 051,919, filed September 17, 2014, the contents of which are fully incorporated herein by reference. Sequence listing reference submitted in electronic format The official copy of the sequence listing is submitted electronically via EFS-Web as a sequence listing in ASCII format in a file under the name “BCS149059WO_ST25.txt”, created on September 14, 2015, and having a size of 152 kilobytes and is presented together with the Description. The sequence listing contained in this document in ASCII format forms part of the Description and is fully incorporated herein by reference. BACKGROUND FIELD OF THE INVENTION The present invention relates to a composition comprising (i) exosporia-producing recombinant Bacillus cells that express a fusion protein comprising: (x) at least one plant growth-stimulating protein or peptide and (y) a sequence targeting agent that localizes the fusion protein in the exosporium of Bacillus cells and ii) at least one insecticide selected from the particular insecticides disclosed herein that has the ability to improve plant growth and / or health and / or activity against insects, mites, nematodes and / or plant pathogens in a synergistically effective amount. Still further, the present invention relates to the use of this composition, as well as a method for improving plant growth, promoting plant health and / or reducing overall damage to plants and plant parts. BACKGROUND OF THE INVENTION In crop protection there is a continuous need for applications that improve the health and / or growth of plants. Healthier plants generally result in higher yields and / or better quality of plants or their products. Fertilizers, based on inorganic and organic substances, are used throughout the world to promote plant health. A fertilizer can comprise a single substance or a composition, and is used to provide nutrients to plants. An important discovery in fertilizer application was the development of nitrogen-based fertilizers by Justus von Liebig around the year 1840. However, fertilizers can lead to soil acidification and a destabilization of the nutrient balance in the soil, including a reduction of minerals and enrichment in salts and heavy metals. In addition, the excessive use of fertilizers can lead to an alteration of the soil fauna, as well as to the contamination of surface water and groundwater. Furthermore, an unhealthy enrichment in substances such as nitrate can occur in plants and fruits. In addition, insecticides and fungicides are used throughout the world to control pests. Synthetic insecticides or fungicides are often non-specific and may therefore act on organisms other than the target organisms, including other naturally occurring beneficial organisms. Due to their chemical nature, they can also be toxic and non-biodegradable. Consumers around the world have become increasingly aware of the potential health and environmental problems associated with chemical residues, particularly in food products. This has resulted in increasing pressure from consumers to reduce the use or at least the amount of chemical (ie synthetic) pesticides. Therefore, there remains a need to manage the requirements of the food chain while allowing effective pest control. An additional problem that arises with the use of synthetic insecticides or fungicides is that the repeated and exclusive application of one insecticide or fungicide often leads to the selection of resistant animal pests or microorganisms. Typically, such strains also display cross-resistance against other active ingredients that have the same mode of action. Effective pathogen control will then no longer be possible with such active compounds. However, the development of active ingredients with novel mechanisms of action is difficult and expensive. The use of biological control agents (BCA), which act as plant health enhancers and / or plant protection agents, is an alternative to synthetic fertilizers and pesticides. In some cases, the effectiveness of BCAs is not at the same level as that of conventional insecticides and fungicides, especially in the case of severe infection pressure. Consequently, under some circumstances, biological control agents, their mutants, and the metabolites produced by them, particularly at low application rates, are not entirely satisfactory. Consequently, there is a constant need to develop new alternative plant health improvement compositions, including alternative plant protection and / or biological control agents used in conjunction with synthetic fungicides and insecticides in order to attempt to meet the previously mentioned requirements. QfrRLnn / Lznz / E / Yii THE INVENTION In view of this, it was a particular object of the present invention to provide compositions with a greater capacity to improve plant growth and / or to improve plant health or that present an improved activity against insects, mites, nematodes and / or phytopathogens. . Therefore, it was found that these objectives can be achieved with the compositions according to the invention defined as follows. The application of a) recombinant Bacillus exosporia-producing cells expressing a fusion protein comprising: (i) at least one plant growth-stimulating protein or peptide selected from the group consisting of an enzyme involved in the production or activation of a plant growth stimulating compound; an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source; and a protein or peptide that protects a plant against a pathogen or a pest; and (II) a targeting sequence that localizes the fusion protein in the exosporium of the Bacillus cells; and b) at least one particular insecticide disclosed herein for improving, preferably in a superadditive manner, (i) plant growth, plant yield and / or plant health and / or (ii) activity against insects, mites, nematodes and / or phytopathogens. References herein to targeting sequences, exosporium proteins, exosporium protein fragments, fusion proteins, and recombinant Bacillus exosporium-producing cells expressing such fusion proteins, are not to be construed as independent embodiments. Instead, references to targeting sequences, exosporium proteins, exosporium protein fragments, fusion proteins, and recombinant Bacillus exosporium-producing cells expressing such proteins should be construed throughout this application. Fusion compounds are only disclosed and claimed in combination (and preferably in a synergistic combination) with one or more of the particular fungicides described herein. Furthermore, references to "the fungicides disclosed herein" are intended to encompass the fungicides described below in paragraphs [000185]-[000186], The present invention is directed to a composition comprising, in synergistically effective amounts, a) exosporia-producing recombinant Bacillus cells expressing a fusion protein comprising: (i) at least one selected plant growth-stimulating protein or peptide from the group consisting of an enzyme involved in the production or activation of a plant growth-stimulating compound and an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source; or a protein or peptide that protects a plant against a pathogen; and (ii) a targeting sequence that localizes the fusion protein in the exosporium of the Bacillus cells; and b) at least one insecticide selected from the group consisting of acetamipride, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, ethoprofos, fenamiphos, fenobucarb, fenthion, fipronil, flubendiamide , flupyradifurone, fluopyram, formetanate, heptanophos, imidaclopride, methamidophos, methiocarb, methomyl, niclosamide, oxydemeton-methyl, phosalone, silafluofen, spirodiclofen, spiromesifene, spirotetramat, thiaclopride, thiodicarb, tralomethrin, triazophos, triflumuron, vamidothion, 1-{2- fluoro-4-methyl-5-[(R)-(2,2,2-triffluoroethyl)sulfin¡l]phenyl}-3-(triffluoromethyl)-1H-1,2,4triazole -5-amine, 1-(3-chloropyrid¡n-2-¡l)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3 -{[5(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole-5-carboxamide and mixtures of pesticidal terpenes comprising the three terpenes α-terpinene, p-cymene and limonene. In some embodiments, the targeting sequence comprises an amino acid sequence that exhibits at least about 43% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 2535 is of at least about 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; an addressing sequence comprising SEQ ID NO: 1; or an exosporium protein that comprises an amino acid sequence that presents at least 85% identity with SEQ ID Nº: 2. In some embodiments, the Bacillus exosporia-producing cells are cells of a member of the Bacillus cereus family such as Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis and combinations thereof. In a further embodiment, the recombinant Bacillus cells are cells of Bacillus thuringiensis strain BT013A. In certain aspects, the fusion protein comprises an enzyme involved in the production or activation of a plant growth-stimulating compound selected from the group consisting of an acetoin reductase, an indole-3-acetamide hydrolase, a tryptophan monooxygenase, an acetolactate synthetase, an α-acetolactate decarboxylase, a pyruvate decarboxylase, a diacetyl reductase, a butanediol dehydrogenase, an aminotransferase, a tryptophan decarboxylase, an amino oxidase, an indole-3-pyruvate decarboxylase, an indole-3-acetaldehyde dehydrogenase, a side chain tryptophan oxidase, a nitrile hydrolase, a nitrilase, a peptidase, a protease, an adenosine phosphate isopentenyltransferase, a phosphatase, an adenosine kinase, an adenine QfrRLnn / Lznz / E / Yii phosphoribosyltransferase, CYP735A, a 5'ribonucleotide phosphohydrolase, an adenosine nucleosidase, a zeatin cis-trans isomerase, a zeatin O-glucosyltransferase, a β-glucosidase, a cis-hydroxylase, aCKcis-hydroxylase, aCKN-glucosyltransferase, a 2,5ribonucleotide phosphohydrolase, an adenosine nucleosidase, a purine nucleoside phosphorylase, a zeatin reductase, a hydroxylamine reductase, a 2-oxoglutarate dioxygenase, a gibberellic 2B / 3B hydrolase, a gibberellin 3-oxidase, a gibberellin 20-oxidase, a chitosinase, a chitinase, a β-1,3-glucanase, a β-1,4-glucanase, a β-1,6-glucanase, an aminocyclopropan-1-carboxylic acid deaminase or an enzyme involved in the production of a nod factor. In other aspects, the fusion protein comprises an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source selected from the group consisting of a cellulase, a lipase, a lignin oxidase, a protease, a glycoside hydrolase, a phosphatase, a nitrogenase, a nuclease, an amidase, a nitrate reductase, a nitrite reductase, an amylase, an ammonia oxidase, an aligninase, a glucosidase, a phospholipase, a phytase, a pectinase, a glucanase, a sulfatase, a urease, a xylanase, and a siderophore. In yet other aspects, the fusion protein comprises a protein or peptide that protects a plant against a pathogen and the protein or peptide has insecticidal activity, helminthicidal activity, suppresses insect or worm predation, or a combination thereof. . Said protein may comprise an insecticidal bacterial toxin, an endotoxin, a Cry toxin, a protease inhibitor protein or peptide, a cysteine protease or a chitinase. The protein or peptide may comprise an insecticidal VIP toxin, a trypsin inhibitor, an arrowhead protease inhibitor, a Cry toxin (eg, a Bacillus thuringensis Cry toxin). In certain embodiments, the insecticide selected from the group consisting of acetamipride, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, ethoprofos, fenamifos, fenobucarb, fenthion, fipronil, flubendiamide, flupyradifurone, fluopyram, formetanate, heptanophos, imidaclopride, methamidophos, methiocarb, methomyl, niclosamide, oxydemeton-methyl, phosalone, silafluofen, spirodiclofen, spiromesifene, spirotetramat, thiaclopride, thiodicarb, tralomethrin, triazophos, triflumuron, 1-2vamidothion -fluoro-4-methyl-5-[(R)-(2,2,2-trifluoroethyl)sulfinyl]phenyl}-3(trifluoromethyl I)-1H-1,2,4-triazol-5-amine , 1 -(3-chloropyridin-2-yl)-N-[4-cyan ο-2-m ethyl I-6(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazole -2-yl]methyl}-1H-pyrazole-5-carboxamide and mixtures of pesticidal terpenes comprising the three terpenes α-terpinene, p-cymene and limonene. In other embodiments, the insecticide is selected from the group consisting of i nn / ι znz / e / YL clothianidin, cypermethrin, etiprole, fipronil, fluopyram, flupyradifurone, imidacloprid, methiocarb, and thiodicarb. In some embodiments, the composition of the present invention comprises a) recombinant Bacillus exosporium-producing cells expressing a fusion protein comprising: (i) at least one plant growth-stimulating protein or peptide selected from the group that consists of an enzyme involved in the production or activation of a plant growth-stimulating compound and an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source or at least one protein or peptide that protects a plant against a pathogen; and (ii) a targeting sequence that localizes the fusion protein in the exosporium of the Bacillus cells; and b) at least one insecticide selected from the group consisting of clothianidin, cypermethrin, ethiprole, fipronil, fluopyram, flupiradifurone, imidacloprid, methiocarb, and thiodicarb in a synergistically effective amount. In a particular aspect of the preceding embodiments, (i) said at least one insecticide is clothianidin; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of at least about 54%; (ii¡¡) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity with SEQ ID No: 107, 108 and 109, respectively ; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In yet another particular embodiment, the recombinant cells of a member of the Bacillus cereus family are cells of the Bacillus thuringiensis strain BT013A. In a particular aspect of the preceding embodiments, (i) said at least one insecticide is cypermethrin; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of at least about 54%; (ii¡¡) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity with SEQ ID No: 107, 108 and 109, respectively ; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In yet another particular embodiment, the recombinant cells of a member of the Bacillus cereus family are cells of the Bacillus thuringiensis strain BT013A. In a particular aspect of the preceding embodiments (i) said at least QfrRLnn / Lznz / E / Yii an insecticide is ethiprole; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of at least about 54%; (ii¡¡) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity with SEQ ID No: 107, 108 and 109, respectively ; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In yet another particular embodiment, the recombinant cells of a member of the Bacillus cereus family are cells of the Bacillus thuringiensis strain BT013A. In a particular aspect of the preceding embodiments (i) said at least one insecticide is fipronil; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of at least about 54%; (ii¡¡) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity with SEQ ID No: 107, 108 and 109, respectively ; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In yet another particular embodiment, the recombinant cells of a member of the Bacillus cereus family are cells of the Bacillus thuringiensis strain BT013A. In a particular aspect of the preceding embodiments (i) said at least one insecticide is fluopyram; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of at least about 54%; (ii¡¡) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity with SEQ ID No: 107, 108 and 109, respectively ; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In yet another particular embodiment, the recombinant cells of a member of the Bacillus cereus family are cells of the Bacillus thuringiensis strain BT013A. In a particular aspect of the preceding embodiments (i) said at least one insecticide is flupyradifurone; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of QfrRLnn / Lznz / E / Yii at least about 54%; (iii) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In a particular aspect of the preceding embodiments (i) said at least one insecticide is imidacloprid; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of at least about 54%; (iii) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity to SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In a particular aspect of the preceding embodiments (i) said at least one insecticide is methiocarb; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of at least about 54%; (iii) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity with SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In yet another particular embodiment, the recombinant cells of a member of the Bacillus cereus family are cells of the Bacillus thuringiensis strain BT013A. In a particular aspect of the preceding embodiments (i) said at least one insecticide is thiodicarb; (ii) the targeting sequence comprises an amino acid sequence that has at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is of at least about 54%; (iii) the plant growth-stimulating protein or peptide comprises an endoglucanase, a phospholipase or a chitosinase, preferably with at least 95% sequence identity with SEQ ID NO: 107, 108 and 109, respectively; and (iv) the recombinant cells of a member of the Bacillus cereus family comprise Bacillus thuringiensis or Bacillus mycoides cells. In yet another particular embodiment, the recombinant cells of a member of the Bacillus cereus family are cells of the Bacillus thuringiensis strain BT013A. QfrRLnn / Lznz / E / Yii In still other embodiments, the composition further comprises at least one fungicide. Said at least one insecticide may be synthetic. In some aspects, the composition further comprises at least one auxiliary selected from the group consisting of extenders, solvents, instant builders, carriers, emulsifiers, dispersants, frost protectants, thickeners, and adjuvants. In other aspects, the invention is directed to seed treated with any of the compositions disclosed herein. Still further, the present invention relates to the use of the disclosed compositions as a fungicide and / or an insecticide. In certain aspects, the disclosed compositions are used to reduce overall damage to plants and plant parts, as well as losses to harvested fruits or vegetables caused by insects, mites, nematodes, and / or plant pathogens. In other aspects, the disclosed compositions are used to enhance plant growth and / or to promote plant health. Additionally, the present invention is directed to a method of treating a plant, a plant part, such as a seed, a root, a rhizome, a corm, a bulb or a tuber, and / or a locus on or near the which the plant or plant parts grow, such as soil, to improve plant growth and / or to promote plant health, comprising the step of simultaneously or successively applying to a plant, to a part of plant and / or to a plant locus: a) recombinant Bacillus exosporium-producing cells expressing a fusion protein comprising: (i) at least one plant growth-stimulating protein or peptide selected from the group consisting of a enzyme involved in the production or activation of a plant growth stimulant compound; an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source; and a protein or peptide that protects a plant against a pathogen; and (ii) a targeting sequence that localizes the fusion protein in the exosporium of the Bacillus cells; and b) at least one insecticide selected from among particular fungicides disclosed herein that exhibits activity against insects, mites, nematodes, and / or phytopathogens in a synergistically effective amount. In another embodiment, the present invention is a method for reducing overall damage to plants and parts of plants, as well as losses of harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens, comprising the step of applying simultaneously or successively to a plant, a plant part, such as a seed, root, rhizome, corm, bulb, or tuber, and / or to a locus on or near which the plant or plants grow plant parts, such as soil: a) recombinant Bacillus exosporium-producing cells expressing a fusion protein comprising: (i) at least one plant growth-stimulating protein or peptide selected from the group that QfrRLnn / Lznz / E / Yii consists of an enzyme involved in the production or activation of a plant growth stimulating compound; an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source; and a protein or peptide that protects a plant against a pathogen; and (ii) a targeting sequence that localizes the fusion protein in the exosporium of the Bacillus cells; and b) at least one insecticide selected from among particular fungicides disclosed herein against insects, mites, nematodes and / or phytopathogens in a synergistically effective amount. In the preceding paragraphs, the term "comprising" or any derivative thereof (eg, comprising, comprising) may be replaced by "consisting of" or the corresponding applicable derivative thereof. BRIEF DESCRIPTION OF THE FIGURES Shown in Figure 1 is an alignment of the amino acid sequence of an amino-terminal portion of the Bacillus anthracis Sterne strain BclA and the corresponding region of several exosporium proteins from members of the Bacillus cereus family. DETAILED DESCRIPTION In general, the term "pesticide" refers to the ability of a substance to increase mortality or to inhibit the growth rate of plant pests. The term is used herein to describe the property of a substance to exhibit activity against insects, mites, nematodes and / or phytopathogens. In the sense of the present invention, the term "pests" includes insects, mites, nematodes and / or phytopathogens. NRRL is the abbreviation for the Agricultural Research Service Culture Collection, located at the National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604, USA. ATCC is the abbreviation for American Type Culture Collection, located at the ATCC Patent Depository, 10801 University Boulevard, Manassas, Virginia 10110, USA. All strains described herein and having an Accession Number prefixed with NRRL or ATCC were deposited with the respective depository institution described above in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Chemical Purposes. of the Patent Procedure. An “enzyme related to the production or activation of a plant growth-stimulating compound” includes any enzyme that catalyzes any step in a biological synthesis pathway of a plant growth-stimulating or plant structure-altering compound or any enzyme that catalyzes the conversion of an inactive or less active derivative of a plant growth promoting or plant structure altering compound into an active or more active form of the compound. Such compounds include, for example, but are not limited to, small molecule plant hormones such as auxins and QfrRLnn / Lznz / E / Yii cytokinins, bioactive peptides and small molecules that stimulate plant growth, synthesized by bacteria or fungi present in the rhizosphere (eg 2,3-butanediol). A "plant immune-stimulating protein or peptide" as used herein includes any protein or peptide that has a beneficial effect on the immune system of a plant. The term "plant growth promoting protein or peptide" as used herein includes any protein or peptide that increases plant growth in a plant exposed to the protein or peptide. The terms "promote plant growth" and "stimulate plant growth" are used interchangeably herein, and refer to the ability to improve or increase at least one of height, weight, leaf size, leaf size, of the roots or the size of the stems of the plant, to increase the protein yield in the plant or to increase the grain yield of the plant. A "protein or peptide that protects a plant against a pathogen," as used herein, includes any protein or peptide that renders a plant exposed to the protein or peptide less susceptible to infection with a pathogen. A "protein or peptide that increases stress resistance in a plant" as used herein includes any protein or peptide that renders a plant exposed to the protein or peptide more resistant to stress. The term "plant-binding protein or peptide" refers to any peptide or protein capable of binding specifically or nonspecifically to any part of a plant (for example, to the roots or aerial portions of a plant such as the foliage of leaves, stems, flowers or fruits) or to a plant material. The term "targeting sequence" as used herein refers to a sequence of a polypeptide that results in the localization of a larger polypeptide or protein in the exosporium of a member of the Bacillus cereus family. . Recombinant Bacillus exosporia-producing cells expressing fusion proteins Fusion proteins contain a targeting sequence, an exosporium protein, or a fragment of an exosporium protein that targets the fusion protein to the exosporium of a Bacillus cereus family member. (a) a plant growth-stimulating protein or peptide; (b) a protein or peptide that protects a plant against a pathogen; (c) a protein or peptide that improves the stress resistance of a plant; (d) a plant binding protein or peptide; or (e) a protein or peptide that enhances the immune system of a plant. When expressed in bacteria that are members of the Bacillus cereus family, these fusion proteins are targeted to the qhr i nn / ι znz / e / YL exosporium layer of the spore and are physically oriented such that the protein or the peptide is expressed on the outside of the spore. This Bacillus exosporium-expressing system (BEMD) can be used to deliver peptides, enzymes, and other proteins to plants (eg, foliage, fruits, flowers, stems, or roots of plants) or to a culture medium. plant growth, such as soil. Peptides, enzymes, and proteins administered into soil or other plant growth media persist there and are active in the soil for long periods of time. Introduction of recombinant Bacillus cereus exosporia-producing cells expressing the fusion proteins described herein into the soil or rhizosphere of a plant leads to beneficial enhancement of plant growth under many different soil conditions. Using the BEMD to create these enzymes allows them to continue to exert their beneficial results in the plant and in the rhizosphere during the first few months of the plants' life. Targeting Sequences, Exosporium Proteins, and Exosporium Protein Fragments For ease of reference, the SEQ ID NOs of the peptide and protein sequences referenced herein are listed in Table 1 below. απκ i nn / ι znz / e / YL Table 1: Peptide and protein sequences Protein, Protein Fragment or Targeting Sequences Sequence ID No. AA 1 -41 BclA (B. anthracis sterne) SEQ ID No.: 1* Full length BclA SEQ ID No.: 2* AA 1 -33 from BetA / BAS3290 (B. anthracis sterne) SEQ ID N2: 3 full length BetA / BAS3290 SEQ ID N2: 4 Met + AA 2-43 from BAS4623 (B. anthracis sterne) SEQ ID N2: 5 BAS4623 full length SEQ ID N2: 6 AA 1-34 from BclB (B. anthracis sterne) SEQ ID N2: 7 full length BclB SEQ ID N2: 8 AA 1-30 from BAS1882 (B. anthracis sterne) SEQ ID N2: 9 full-length BAS1882 SEQ ID N2: 10 AA 1-39 of gene 2280 (KBAB4 from B. weihenpasohensis) SEQ ID N2: 11 Full length KBAB4 gene 2280 SEQIDN2: 12 AA 1-39 of gene 3572 (KBAB4 from B. weihenpasohensis) SEQ ID N2: 13 Full length KBAB4 gene 3572 SEQIDN2: 14 AA 1-49 of exosporium leader peptide (B. cereus VD200) SEQ ID N2: 15 Exosporium full length guide peptide SEQ ID N2: 16 Exosporium guide peptide AA 1-33 (B. cereus VD166) SEQIDN2: 17 Exosporium full length guide peptide SEQIDN2: 18 AA 1-39 of the hypothetical protein IKG_04663 (VD200 from B. cereus) SEQ ID N2: 19 Hypothetical full-length protein IKG_04663, partial SEQ ID N2: 20 AA 1-39 of the YVTN β-helical protein ( KBAB4 from B. weihenpasohensis) SEQ ID N2: 21 Full-length YVTN β-helix protein from KBAB4 SEQ ID N2: 22 AA 1-30 of the hypothetical protein bcerkbab4_2363 (KBAB4 from B. weihenstepensis) SEQIDN2: 23 Hypothetical protein bcerkbab4_2363 from full-length KBAB4 SEQIDN2: 24 AA 1-30 of the hypothetical protein bcerkbab4_2131 (KBAB4 from B. weihenstepensis) SEQIDN2: 25 full-length hypothetical protein bcerkbab4_2131 SEQIDN2: 26 AA 1-36 collagen-containing triple helix repeat (KBAB4 from B. weihenstephensis) SEQIDN2: 27 Full-length collagen triple helix repeat KBAB4 SEQIDN2: 28 AA 1-39 of the hypothetical protein bmyco0001_21660 (2048 from B. mycoides) SEQIDN2: 29 ΟΉβίΠΠ / ίΖΠΖ / Ε / ΥΙ Hypothetical full-length protein bmyco0001_21660 SEQ ID N2: 30 AA 1-30 from the hypothetical protein bmyc0001_22540 (2048 from B. mycoides) SEQ ID N2: 31 Hypothetical full-length protein bmycOOOl 22540 SEQ ID N2: 32 AA 1-21 from the hypothetical protein bmyc0001_21510 (2048 from B. mycoides) SEQ ID N2: 33 Hypothetical full length protein bmyc0001_21510 SEQ ID N2: 34 AA 1-22 triple helix repeat of collagen protein (35646 from B. thuringiensis) SEQ ID N2: 35 Triple helix repeat of the full-length collagen protein SEQ ID N2: 36 AA 1-35 of the hypothetical protein WP_69652 (B. cereus) SEQ ID N2: 43 Full-length hypothetical protein WP 69652 SEQ ID N2: 44 AA 1 Exosporium Guideline -41 WP016117717 (B. cereus) SEQ ID N2: 45 Exosporium Full Length Guideline WP016117717 SEQ ID N2: 46 AA 1-49 Exosporium Peptide WP002105192 (B. cereus) SEQ ID N2: 47 Exosporium Peptide full length exosporium WP002105192 SEQ ID N2: 48 AA 1-38 of the hypothetical protein WP87353 (B. cereus) SEQ ID N2: 49 Hypothetical full-length protein WP87353 SEQ ID N2: 50 Exosporium peptide 02112369 AA 1-39 (B. cereus) SEQ ID N2: 51 Exosporium full-length peptide 02112369 SEQ ID N2: 52 QfrRLnn / Lznz / E / Yii AA1 -39 from exosporium protein WP016099770 (B. cereus) SEQ ID N2: 53 Full-length exosporium protein WP016099770 SEQIDN2:54 AA 1-36 from hypothetical protein YP006612525 (B. thuringiensis) SEQ ID N2: 55 Hypothetical protein from full length YP006612525 SEQ ID N2: 56 AA 1-136 from the hypothetical protein TIGR03720 (B. mycoides) SEQ ID NO: 57** Full length hypothetical protein TIGR03720 SEQ ID NO: 58** AA 1 -196 from BclA (B. anthracis sterne) SEQ ID N°: 59* Met + AA 20-35 from BclA (B. anthracis sterne) SEQ ID N2: 60 Met + AA 12-27 from BetA / BAS3290 (B. anthracis sterne ) SEQ ID N2: 61 Met + AA 18-33 of the 2280 gene (KBAB4 from B. weihenpasohensis) SEQ ID N2: 62 Met + AA 18-33 of the 3572 gene (KBAB4 from B. weihenpasohensis) SEQ ID Ne: 63 Met + AA 12-27 from exosporium guide peptide (VD166 from B. cereus) SEQ ID N2: 64 Met + AA 18-33 from the β-helix protein YVTN (KBAB4 from B. weihenpasohensis) SEQ ID N2: 65 Met + AA 9-24 from the hypothetical protein bcerkbab4_2363 (KBAB4 from B. weihenstepensis) SEQ ID N2: 66 Met + AA 9-24 from the hypothetical protein bcerkbab4_2131 (KBAB4 from B. weihenstepensis) SEQ ID N2: 67 Met + AA 9-24 from the hypothetical protein bmyc0001_22540 (2048 from B. mycoides) SEQ ID N2: 68 Met + AA 9-24 from BAS1882 (B. anthracis sterne) SEQ ID N2: 69 Met + AA 20-35 from exosporium guideline WP016117717 (B. cereus) SEQ ID N2: 70 Full length InhA (B. mycoides) SEQ ID N2: 71 □Ήβίπη / ίζηζ / Ε / γι Full length BAS1141 (ExsY) (B. anthracis sterne) SEQ ID N2: 72 Full length BAS1144 (BxpB / ExsFA) (B. anthracis sterne) SEQ ID N2: 73 Full length BAS1145 (CotY) (B. anthracis sterne) B. anthracis) SEQ ID N2: 74 full length BAS1140 (Sterne from B. anthracis) SEQ ID N2: 75 full length ExsFB (H9401 from B. anthracis) SEQ ID N2: 76 full length InhAI (HD74 from B. anthracis) thuringiensis) SEQ ID N2: 77 full length ExsJ (ATCC 10876 from B. cereus) SEQ ID N2: 78 full length ExsH (B. cereus) SEQ ID N2: 79 full length YjcA (Ames from B. anthracis) SEQ ID N2: 80 full-length YjcB (B. anthracis) SEQ ID N2: 81 full-length BclC (B. anthracis Sterne) SEQ ID N2: 82 full-length protein acid phosphatase (konkukian serovar strain 97-27 of Bacillus thuringiensis) SEQ ID N2: 83 full-length lnhA2 (HD74 from B. thuringiensis) SEQ ID N2: 84 AA=amino acids QfrRLnn / Lznz / E / Yii * BclA from B. anthracis strain Sterne has 100% sequence identity to BclA from B. thuringiensis. Accordingly, SEQ ID NOs: 1, 2 and 59 also represent amino acids 1-41 of B. thuringiensis BclA, full-length B. thuringiensis BclA and amino acids 1-196 of B. thuringiensis BclA, respectively. . Likewise, SEQ ID NO: 60 also represents a methionine residue plus amino acids 20-35 of BclA from B. thuringiensis. * * The B. mycoides hypothetical protein TIGR03720 has 100% sequence identity to the B. mycoides hypothetical protein WP003189234. Accordingly, SEQ ID NOs: 57 and 58 also represent amino acids 1-136 of the B. mycoides hypothetical protein WP003189234 and the full length B. mycoides hypothetical protein WP003189234, respectively. Bacillus is a genus of rod-shaped bacteria. The Bacillus cereus family of bacteria includes the species Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus toyoiensis, and Bacillus weihenpasohensis. Under environmental stress conditions, the Bacillus cereus family of bacteria undergoes sporulation and forms oval endospores that can remain dormant for long periods of time. The outermost layer of endospores is known as the exosporium and comprises a basal layer surrounded by outer fluff of hair-like projections. The filaments above the hair-like fluff are made up predominantly of the collagen-like glycoprotein BclA, while the basal layer is made up of numerous different proteins. Another collagen-related protein, BclB, is also present in the exosporium and is exposed on the endospores of members of the Bacillus cereus family. BclA, the major constituent of surface fluff, has been shown to be attached to the exosporium by its amino terminus (N-terminus) located in the basal layer and its carboxyl terminus (C-terminus) extending out from the spore. It was previously discovered that certain sequences from the N-terminal regions of BclA and BclB could be used to direct a peptide or protein into the exosporium of a Bacillus cereus endospore (see US Patent Application Publications ULJ N°: 2010 / 0233124 and 2011 / 0281316, and Thompson et al., “Targeting of the BclA and BclB Proteins to the Bacillus anthracis Spore Surface,” Molecular Microbiology, 70(2):421-34 (2008), whose complete contents are incorporated herein by reference.Bacillus anthracis protein BetA / BAS3290 was also found to localize to the exosporium. In particular, amino acids 20-35 of BclA from the Bacillus anthracis strain Sterne have been found to be sufficient for exosporium targeting. Shown in Figure 1 is an alignment of amino acid sequences 1-41 of BclA (SEQ ID NO: 1) with the corresponding N-terminal regions of several other Bacillus cereus family exosporium proteins and Bacillus cereus family proteins. from Bacillus cereus that have related sequences. As can be seen in Figure 1, there is a region of high homology among all the proteins in the region corresponding to amino acids 20-41 of BclA. However, in these sequences, the amino acids corresponding to amino acids 36-41 of BclA contain a secondary structure and are not required for the localization of a fusion protein in the exosporium. The conserved region of the BclA targeting sequence (amino acids 20-35 of SEQ ID NO: 1) is shown in bold in Figure 1 and corresponds to the minimal targeting sequence required for localization in the exosporium. There is a more highly conserved region spanning amino acids 25-35 of BclA within the QfrRLnn / Lznz / E / Yii targeting sequence which is underlined in the sequences of Figures 1, and is the recognition sequence for ExsFA / BxpB / ExsFB and their homologues, which targets and assembles the described proteins on the exosporium surface. The amino acid sequences of SEQ ID NOs: 3, 5 and 7 in Figure 1 are amino acids 1-33 of Bacillus anthracis strain BetA / BAS3290, a methionine followed by amino acids 2-43 of strain BAS4623 Bacillus anthracis sterne and amino acids 1-34 of BclB from Bacillus anthracis strain sterne, respectively. (In the case of BAS4623, replacement of the valine present at position 1 of the native protein with a methionine was found to result in better expression.) As can be seen in Figure 1, each of these sequences contains a conserved region corresponding to amino acids 20-35 of BclA (SEQ ID NO: 1; indicated in bold), and a more highly conserved region corresponding to amino acids 20-35 of BclA (underlined). There are additional proteins from members of the Bacillus cereus family that also contain the conserved targeting region. In particular, in Figures 1, SEQ ID NO: 9 comprises amino acids 1-30 of BAS1882 from the Bacillus anthracis strain Sterne, SEQ ID NO: 11 comprises amino acids 1-39 of gene product 2280 from the Bacillus weihenpasohensis KBAB4, SEQ ID NO: 13 comprises amino acids 1-39 of Bacillus weihenpasohensis KBAB4 gene product 3572, SEQ ID NO: 15 comprises amino acids 1-49 of the VD200 exosporium leader peptide from Bacillus cereus, SEQ ID NO: 17 comprises amino acids 1-33 of Bacillus cereus VD166 exosporium guide peptide, SEQ ID NO: 19 comprises amino acids 1-39 of Bacillus cereus VD200 hypothetical protein IKG_04663 , SEQ ID NO: 21 comprises amino acids 1-39 of the YVTN β-helix protein of Bacillus weihenpasohensis KBAB4, SEQ ID NO: 23 comprises amino acids 1-30 of the hypothetical KBAB4 protein bcerkbab4_2363 from Bacillus weihenpasohensis, SEQ ID NO: 25 comprises amino acids 1-30 of the hypothetical protein bcerkbab4_2131 from Bacillus weihenpasohensis KBAB4, SEQ ID NO: 27 comprises amino acids 1-36 of the collagen triple helix repeat from Bacillus weihenpasohensis KBAB4, SEQ ID NO: 29 comprises amino acids 1-39 of the hypothetical protein bmyco0001_21660 from Bacillus mycoides 2048, SEQ ID NO: 31 comprises amino acids 1-30 of the hypothetical protein bmyc0001_22540 from Bacillus mycoides 2048, SEQ ID NO: 33 comprises amino acids 1-21 of the hypothetical protein bmyc0001_21510 from Bacillus mycoides 2048, SEQ ID NO: 35 comprises amino acids 1-22 of the triple repeat Bacillus thuringiensis 35646 collagen protein helix, SEQ ID NO: 43 comprises amino acids 1-35 of the hypothetical protein WP 69652 from Bacillus cereus, SEQ ID NO: 45 comprises amino acids 1-41 of the exosporium guideline WP016117717 from Bacillus cereus, SEQ ID NO: 47 comprises amino acids 1-49 of the QfrRLnn / Lznz / E / Yii peptide from Bacillus cereus exosporium WP002105192, SEQ ID NO: 49 comprises amino acids 1-38 of the hypothetical Bacillus cereus protein WP87353, SEQ ID NO: 51 comprises amino acids 1-39 of the Bacillus cereus exosporium peptide 02112369, SEQ ID NO: 53 comprises amino acids 1-39 of the Bacillus cereus exosporium protein WP016099770, SEQ ID NO: 55 comprises amino acids 1-36 of the hypothetical protein YP006612525 from Bacillus thuringiensis, SEQ ID NO: 57 comprises amino acids 1-136 of the hypothetical protein TIGR03720 from Bacillus mycoides. As shown in Figure 1, each of the N-terminal regions of these proteins contains a region that is conserved with amino acids 20-35 of BclA (SEQ ID NO: 1), and a more highly conserved region corresponding to amino acids 25-35 of BclA. Any portion of BclA that includes amino acids 20-35 can be used as the targeting sequence. In addition, full-length exosporium proteins or fragments of exosporium proteins can be used to target fusion proteins to the exosporium. Accordingly, full length BclA or a BclA fragment including amino acids 20-35 can be used for exosporium targeting. For example, full-length BclA (SEQ ID NO: 2) or a medium-sized fragment of BclA that is devoid of the carboxyl terminus, such as SEQ ID NO: 59 (BclA amino acids 1-196). , can be used to target fusion proteins to the exosporium. Medium size fragments, such as the fragment of SEQ ID NO: 59, have less secondary structure than full length BclA and have been found to be suitable for use as a targeting sequence. The targeting sequence may also comprise much shorter portions of BclA including amino acids 20-35, such as SEQ ID NO: 1 (BclA amino acids 1-41), SEQ ID NO: 1-35 amino acids : 1, amino acids 20-35 of SEQ ID NO: 1 or SEQ ID NO: 60 (a methionine residue attached to amino acids 20-35 of BclA). Even shorter fragments of BclA that only include some of amino acids 20-35 also have the ability to target fusion proteins to the exosporium. For example, the targeting sequence may comprise amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1 . Alternatively, any portion of BetA / BAS3290, BAS4623, BclB, BAS1882, KBAB4 2280 gene product, KBAB4 2280 3572 gene product, B. cereus VD200 exosporium leader peptide, VD166 exosporium leader peptide from B. cereus, the hypothetical protein IKG_04663 from VD200 from B. cereus, the YVTN β-helix protein from KBAB4 from B. weihenstephensis, the hypothetical protein KBAB4 bcerkbab4_2363 from B. weihenstephensis, the hypothetical protein KBAB4 bcerkbab4_2131 from B. cereus. weihenstephensis, collagen containing a triple helix repeat of KBAB4 from B. weihenstephensis, the QfrRLnn / Lznz / E / Yii B. mycoides 2048 hypothetical bmyco0001_21660 protein, B. mycoides 2048 hypothetical bmyc0001_22540 protein, B. mycoides 2048 hypothetical bmyc0001_21510 protein, 35646 triple helix repeat collagen protein from B. thuringiensis, B. cereus hypothetical protein WP 69652, B. cereus exosporium WP016117717 guideline, B. cereus exosporium peptide WP002105192, B. cereus hypothetical protein WP87353, exosporium peptide 02112369 from B. cereus, B. cereus exosporium protein WP016099770, B. thuringiensis hypothetical protein YP006612525 or B. mycoides hypothetical protein TIGR03720, which includes amino acids corresponding to amino acids 20-35 of BclA, can serve as the sequence addressing. As can be seen in Figure 1, BetA / BAS3290 amino acids 12-27, BAS4623 amino acids 2338, BclB amino acids 13-28, BAS1882 amino acids 9-24, gene product amino acids 18-33 KBAB4 2280, KBAB4 gene product 3572 amino acids 18-33, B. cereus VD200 exosporium guideline peptide amino acids 28-43, B. cereus VD166 exosporium guideline peptide amino acids 12-27 , amino acids 18-33 of the hypothetical protein IKG_04663 from B. cereus VD200, amino acids 18-33 of the YVTN β-helix protein of B. weihenpasohensis KBAB4, amino acids 9-24 of the hypothetical protein bcerkbab4_2363 from B. weihenpasohensis KBAB4, amino acids 9-24 of the hypothetical protein bcerkbab4_2131 of B. weihenpasohensis KBAB4, amino acids 15-30 of the collagen triple helix repeat of B. weihenpasohensis KBAB4, amino acids 18- 33 from B. mycoides 2048 hypothetical protein bmyco0001_21660, amino acids 9-24 from B. mycoides 2048 hypothetical protein bmyc0001_22540, amino acids 1-15 from B. mycoides 2048 hypothetical protein bmyc0001_21510, amino acids 1 -16 of 35646 from the triple helix repeat of the collagen protein from B. thuringiensis, amino acids 14-29 from the hypothetical protein WP 69652 from B. cereus, amino acids 20-35 from the exosporium guideline WP016117717 from B. cereus , B. cereus exosporium peptide WP002105192 amino acids 28-43, B. cereus hypothetical protein WP87353 amino acids 17-32, B. cereus exosporium peptide 02112369 amino acids 18-33, amino acids 18- 33 of the B. cereus exosporium protein WP016099770, amino acids 15-30 of the B. thuringiensis hypothetical protein YP006612525, and amino acids 115-130 of the B. mycoides hypothetical protein TIGR03720, correspond to amino acids 20-35 of BclA. Therefore, any portion of these proteins that includes the corresponding amino acids mentioned above can serve as a targeting sequence. Still further, any amino acid sequence comprising amino acids 20-35 of BclA, or any of the corresponding amino acids mentioned above, can serve as the targeting sequence. απθ ι ηη / ι zoz / e / yl Accordingly, the targeting sequence may comprise amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, SEQ ID NO: : 60, amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1 or amino acids 20-31 of SEQ ID NO: 1. Alternatively, the sequence The targeting code consists of amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1 or SEQ ID NO: 60. Alternatively , the targeting sequence may consist of amino acids 22-31 of SEQ ID No: 1, amino acids 22-33 of SEQ ID No: 1 or amino acids 20-31 of SEQ ID No: 1. Alternatively, the exosporium protein may comprise the full-length BclA (SEQ ID NO: 2) or the exosporium protein fragment may comprise a medium-sized fragment of BclA that is devoid of the carboxyl terminus, such as SEQ ID NO: 59 (amino acids 1-196 of BclA). Alternatively, the exosporium protein fragment may consist of SEQ ID NO: 59. The targeting sequence may also comprise amino acids 1-27 of SEQ ID NO: 3, amino acids 12-27 of SEQ ID NO: 3 or SEQ ID NO: 3, or the exosporium protein may comprise the full length BetA / BAS3290 (SEQ ID NO: 4). It has also been found that a methionine residue attached to amino acids 12-27 of BetA / BAS3290 can be used as a targeting sequence. Accordingly, the targeting sequence may comprise SEQ ID NO: 61. The targeting sequence may also comprise amino acids 14-23 of SEQ ID NO: 3, amino acids 14-25 of SEQ ID NO: 3 or amino acids 12-23 of SEQ ID N°: 3. The targeting sequence may also comprise amino acids 1-38 of SEQ ID NO: 5, amino acids 23-38 of SEQ ID NO: 5 or SEQ ID NO: 5, or the exosporium protein may comprise the full length BAS4623 (SEQ ID NO: 6). Alternatively, the targeting sequence may comprise amino acids 1-28 of SEQ ID NO: 7, amino acids 13-28 of SEQ ID NO: 7 or SEQ ID NO: 7, or the exosporium protein may comprise the full length BclB (SEQ ID NO: 8). The targeting sequence may also comprise amino acids 1-24 of SEQ ID NO: 9, amino acids 9-24 of SEQ ID NO: 9 or SEQ ID NO: 9, or the exosporium protein may comprise the full length BAS1882 (SEQ ID NO: 10). A methionine residue attached to amino acids 9-24 of BAS1882 can also be used as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 69. The targeting sequence may also comprise amino acids 1-33 of SEQ ID NO: 11, amino acids 18-33 of SEQ ID NO: 11 or SEQ ID NO: 11, or the exosporium protein may comprise the full-length 2280 gene product of B. weihenpasohensis KBAB4 (SEQ ID NO: 12). A methionine residue attached □Ήβίπη / ίζηζ / Ε / γι to amino acids 18-33 of the B. weihenpasohensis KBAB4 gene product 2280 can also be used as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 62. The targeting sequence may also comprise amino acids 1-33 of SEQ ID NO: 13, amino acids 18-33 of SEQ ID NO: 13 or SEQ ID NO: 13, or the exosporium protein may comprise the full-length gene product 3572 of the B. weihenpasohensis KBAB4 (SEQ ID NO: 14). A methionine residue attached to amino acids 18-33 of the B. weihenpasohensis KBAB4 gene product 3572 can also be used as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 63. Alternatively, the targeting sequence may comprise amino acids 1-43 of SEQ ID NO: 15, amino acids 28-43 of SEQ ID NO: 15, or SEQ ID NO: 15, or the exosporium protein may understand the leader peptide of the full-length exosporium VD200 of B. cereus (SEQ ID NO: 16). The targeting sequence may also comprise amino acids 1-27 of SEQ ID NO: 17, amino acids 12-27 of SEQ ID NO: 17 or SEQ ID NO: 17, or the exosporium protein may comprise the leader peptide from the full-length exosporium VD166 of B. cereus (SEQ ID NO: 18). A methionine residue attached to amino acids 12-27 of the B. cereus VD166 exosporium leader peptide can also be used as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 64. The targeting sequence may also comprise amino acids 1-33 of SEQ ID NO: 19, amino acids 18-33 of SEQ ID NO: 19 or SEQ ID NO: 19, or the exosporium protein may comprise the hypothetical protein IKG_04663 full length from B. cereus VD200 (SEQ ID NO: 20). Alternatively, the targeting sequence comprises amino acids 1-33 of SEQ ID NO: 21, amino acids 18-33 of SEQ ID NO: 21 or SEQ ID NO: 21, or the exosporium protein may understand the full-length YVTN β-helix protein of B. weihenpasohensis KBAB4 (SEQ ID No: 22). A methionine residue attached to amino acids 18-33 of the YVTN β-helical protein of B. weihenpasohensis KBAB4 can also be used as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 65. The targeting sequence may also comprise amino acids 1-24 of SEQ ID NO: 23, amino acids 9-24 of SEQ ID NO: 23 or SEQ ID NO: 23, or the exosporium protein may comprise the hypothetical full-length bcerkbab4_2363 protein from B. weihenpasohensis KBAB4 (SEQ ID NO: 24). You can also use a residue of 0ΉβίΠΠ / ί7Π7 / Ε / ΥΙ methionine bound to amino acids 9-24 of the hypothetical protein bcerkbab4_2363 from B. weihenpasohensis KBAB4 as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 66. The targeting sequence comprises amino acids 1-24 of SEQ ID NO: 25, amino acids 9-24 of SEQ ID NO: 25 or SEQ ID NO: 25, or the exosporium protein may comprise the protein hypothetical full-length bcerkbab4_2131 from B. weihenpasohensis KBAB4 (SEQ ID NO: 26). A methionine residue attached to amino acids 9-24 of the hypothetical protein bcerkbab4_2131 from B. weihenpasohensis KBAB4 can also be used as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 67. Alternatively, the targeting sequence comprises amino acids 1-30 of SEQ ID NO: 27, amino acids 15-30 of SEQ ID NO: 27 or SEQ ID NO: 27, or the exosporium protein may understand the full-length collagen triple helix repeat of B. weihenpasohensis KBAB4 (SEQ ID NO: 28). The targeting sequence may also comprise amino acids 1-33 of SEQ ID NO: 29, amino acids 18-33 of SEQ ID NO: 29 or SEQ ID NO: 29, or the exosporium protein may comprise the B. mycoides 2048 full-length hypothetical protein bmyco0001_21660 (SEQ ID NO: 30). The targeting sequence may also comprise amino acids 1-24 of SEQ ID NO: 31, amino acids 9-24 of SEQ ID NO: 31 or SEQ ID NO: 31, or the exosporium protein may comprise the B. mycoides 2048 full-length hypothetical protein bmyc0001_22540 (SEQ ID NO: 32). A methionine residue attached to amino acids 9-24 of the B. mycoides 2048 hypothetical protein bmyc0001_22540 can also be used as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 68. Alternatively, the targeting sequence comprises amino acids 1-15 of SEQ ID NO: 33, SEQ ID NO: 33, or the exosporium protein comprises the full-length hypothetical B. mycoides 2048 protein bmyc0001_21510 ( SEQ ID NO: 34). The targeting sequence may also comprise amino acids 1-16 of SEQ ID NO: 35, SEQ ID NO: 35, or the exosporium protein may comprise the full-length collagen protein triple helix repeat of the 35646 from B. thuringiensis (SEQ ID NO: 36). The targeting sequence may comprise amino acids 1-29 of SEQ ID NO: 43, amino acids 14-29 of SEQ ID NO: 43 or SEQ ID NO: 43, or the exosporium protein may comprise the B. cereus full-length hypothetical protein WP 69652 (SEQ ID NO: 44). QfrRLnn / Lznz / E / Yii Alternatively, the targeting sequence may comprise amino acids 1-35 of SEQ ID NO: 45, amino acids 20-35 of SEQ ID NO: 45 or SEQ ID NO: 45, or the exosporium protein may comprise the B. cereus full-length exosporium guideline WP016117717 (SEQ ID NO: 46). A methionine residue attached to amino acids 20-35 of the B. cereus exosporium guideline WP016117717 can also be used as a targeting sequence. Accordingly, the addressing sequence may comprise SEQ ID NO: 70. The targeting sequence may comprise amino acids 1-43 of SEQ ID NO: 47, amino acids 28-43 of SEQ ID NO: 47 or SEQ ID NO: 47, or the exosporium protein may comprise peptide from the full-length B. cereus exosporium WP002105192 (SEQ ID NO: 48). The targeting sequence may comprise amino acids 1-32 of SEQ ID NO: 49, amino acids 17-32 of SEQ ID NO: 49 or SEQ ID NO: 49, or the exosporium protein may comprise the B. cereus full-length hypothetical protein WP87353 (SEQ ID NO: 50). Alternatively, the targeting sequence may comprise amino acids 1-33 of SEQ ID NO: 51, amino acids 18-33 of SEQ ID NO: 51 or SEQ ID NO: 51, or the exosporium protein. it may comprise the full-length exosporium peptide 02112369 from B. cereus (SEQ ID NO: 52). The targeting sequence may comprise amino acids 1-33 of SEQ ID NO: 53, amino acids 18-33 of SEQ ID NO: 53 or SEQ ID NO: 53 or the exosporium protein may comprise the protein from the full-length exosporium WP016099770 of B. cereus (SEQ ID NO: 54). Alternatively, the targeting sequence may comprise amino acids 1-30 of SEQ ID NO: 55, amino acids 15-30 of SEQ ID NO: 55 or SEQ ID NO: 55, or the exosporium protein. it may comprise the full-length B. thuringiensis hypothetical protein YP006612525 (SEQ ID NO: 56). The targeting sequence may also comprise amino acids 1-130 of SEQ ID NO: 57, amino acids 115-130 of SEQ ID NO: 57 or SEQ ID NO: 57, or the exosporium protein may comprise the hypothetical full-length B. mycoides protein TIGR03720 (SEQ ID NO: 58). Furthermore, it can be readily seen from the sequence alignment in Figure 1 that while amino acids 20-35 of BclA are conserved, and amino acids 2535 are more conserved, some degree of variation can exist in this region without affecting the ability of the targeting sequence to direct a protein to the exosporium. Figure 1 lists the percentage identity of each of the amino acids Corresponding QfrRLnn / Lznz / E / Yii of each sequence with BclA amino acids 20-35 ("20-35% identity") and with BclA amino acids 25-35 ("25-35% identity"). Thus, for example, compared to amino acids 20-35 of BclA, the corresponding amino acids of BetA / BAS3290 are approximately 81.3% identical, the corresponding amino acids of BAS4623 are approximately 50.0% identical, the corresponding amino acids of BclB are approximately 43.8% identical, the corresponding amino acids of BAS1882 are approximately 62.5% identical, the corresponding amino acids of KBAB4 gene product 2280 are approximately 81.3% identical, and the corresponding amino acids of gene product 3572 from KBAB4 are approximately 81.3% identical. Sequence identities over this region for the remaining sequences are listed in Figure 1. With respect to amino acids 25-35 of BclA, the corresponding amino acids of BetA / BAS3290 are approximately 90.9% identical, the corresponding amino acids of BAS4623 are approximately 72.7% identical, the corresponding amino acids of BclB are approximately 54 .5% identical, the corresponding amino acids of BAS1882 are approximately 72.7% identical, the corresponding amino acids of the KBAB4 2280 gene product are approximately 90.9% identical, and the corresponding amino acids of the KBAB4 3572 gene product are approximately 81 .8% identical. Sequence identities over this region for the remaining sequences are listed in Figure 1. Accordingly, the targeting sequence may comprise an amino acid sequence having at least about 43% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is of at least about 54%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and exhibiting at least about 43% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 25-35 is at least about 54%. Accordingly, the targeting sequence may comprise an amino acid sequence having at least about 50% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is of at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and exhibiting at least about 50% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 25-35 is at least about 63%. QfrRLnn / Lznz / E / Yii Accordingly, the targeting sequence may comprise an amino acid sequence having at least about 50% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is of at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and exhibiting at least about 50% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 25-35 is at least about 72%. Accordingly, the targeting sequence may comprise an amino acid sequence having at least about 56% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is of at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and exhibiting at least about 56% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence may comprise an amino acid sequence that has at least about 62% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is of at least about 72%. The targeting sequence may also consist of an amino acid sequence consisting of 16 amino acids and having at least about 62% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 20-35 of SEQ ID NO:1 amino acids 25-35 of SEQ ID NO: 1 is at least about 72%. The targeting sequence may comprise an amino acid sequence having at least 68% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is at least approximately 81%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and exhibiting at least 68% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 20-35 of SEQ ID NO:1 amino acids 25-35 is at least about 81%. The targeting sequence may also comprise an amino acid sequence that has at least about 75% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is by at least approximately 72%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having for QfrRLnn / Lznz / E / Yii at least about 75% identity to amino acids 20-35 of SEQ ID NO: 1, wherein the identity to amino acids 25-35 of SEQ ID NO: 1 is at least about 72%. The targeting sequence may also comprise an amino acid sequence that has at least about 75% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is by at least approximately 81%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and exhibiting at least about 75% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 25-35 of SEQ ID NO: 1 is at least about 81%. Accordingly, the targeting sequence may comprise an amino acid sequence having at least about 81% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is of at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and exhibiting at least about 81% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 25-35 is at least about 81%. The targeting sequence may comprise an amino acid sequence having at least about 81% identity to amino acids 20-35 of SEQ ID NO:1, wherein the identity to amino acids 25-35 is at least least about 90%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and exhibiting at least about 81% identity to amino acids 20-35 of SEQ ID NO:1, wherein identity to amino acids 25-35 is at least about 90%. The skilled person will understand that variants of the preceding sequences can also be used as targeting sequences, provided that the targeting sequence comprises amino acids 20-35 of BclA, the corresponding amino acids of BetA / BAS3290, BAS4263, BclB, BAS1882, the KBAB4 gene product 2280 or KBAB gene product 3572, or a sequence comprising any of the sequence identities noted above with amino acids 20-35 and 25-35 of BclA. In addition, it has been discovered that some exosporium proteins of the Bacillus cereus family that are devoid of regions showing homology to amino acids 25-35 of BclA can be used to target a peptide or protein to the exosporium of a family member. of Bacillus cereus. In particular, fusion proteins may comprise a QfrRLnn / Lznz / E / Yii exosporium protein comprising SEQ ID No: 71 (InhA from B. mycoides), an exosporium protein comprising SEQ ID No: 72 (BAS1141 (ExsY) from Sterne from B. anthracis), an exosporium protein comprising SEQ ID NO: 73 (BAS1144 (BxpB / ExsFA) from B. anthracis Sterne), an exosporium protein comprising SEQ ID NO: 74 (BAS1145 (CotY) from Sterne from B. anthracis), an exosporium protein comprising SEQ ID No: 75 (BAS1140 from Sterne from B. anthracis), an exosporium protein comprising SEQ ID No: 76 (H9401 ExsFB from B. anthracis ), an exosporium protein comprising SEQ ID NO: 77 (HD74 InhAI from B. thuringiensis), an exosporium protein comprising SEQ ID NO: 78 (ATCC 10876 ExsJ from B. cereus), an exosporium protein comprising exosporium comprising SEQ ID NO: 79 (ExsH from B. cereus), an exosporium protein comprising SEQ ID NO: 80 (Ames YjcA from B. anthracis), an exosporium protein comprising SEQ ID N °: 81 (YjcB from B. anthracis), an exosporium protein comprising SEQ ID No: 82 (BclC Sterne from B. anthracis), an exosporium protein comprising SEQ ID No: 83 (acid phosphatase from the konkukian serovar of Bacillus thuringiensis strain 97-27), an exosporium protein comprising SEQ ID NO: 84 (B. thuringiensis HD74 lnhA2). The inclusion of an exosporium protein comprising SEQ ID No.: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 or 84 in the fusion proteins described herein will result in targeting the exosporium of a member of the B. cereus family. Furthermore, exosporium proteins with a high degree of sequence identity to any of the previously described full-length exosporium proteins or fragments of exosporium proteins can also be used to target a peptide or protein to the exosporium. from a member of the Bacillus cereus family. Accordingly, the fusion protein may comprise an exosporium protein comprising an amino acid sequence that exhibits at least 85% identity to any of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 and 84. Alternatively, the fusion protein can comprise an exosporium protein that is at least 90%, at least 95%, by at least 98%, at least 99%, or 100% identity with any of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 , 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 59, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 , 81,82, 83 and 84. Alternatively, the fusion protein may comprise a fragment of the exosporium protein consisting of an amino acid sequence that exhibits at least 85% identity to SEQ ID NO: 59. Alternatively, the fusion protein may comprise a fragment of the exosporium protein consisting of an amino acid sequence comprising at least 90%, at least 95%, at least 98%, QfrRLnn / Lznz / E / Yii at least 99% or 100% identity with SEQ ID No: 59. In any of the targeting sequences, exosporium proteins or exosporium protein fragments described herein, the targeting sequence, exosporium protein or exosporium protein fragment may comprise the amino acid sequence GXT by its carboxyl terminus, where X is any amino acid. In any of the targeting sequences, exosporium proteins and exosporium protein fragments described herein, the targeting sequence, exosporium protein or exosporium protein fragment, may comprise an alanine residue. at the position of the addressing sequence that corresponds to amino acid 20 of SEQ ID N°: 1. fusion proteins Fusion proteins may comprise a targeting sequence, an exosporium protein or exosporium protein fragment, and at least one plant growth-stimulating protein or peptide. The plant growth-promoting protein or peptide may comprise a peptide hormone, a non-hormonal peptide, an enzyme involved in the production or activation of a plant growth-promoting compound, or an enzyme that degrades or modifies a bacterial, fungal nutrient source. or vegetable. The targeting sequence, exosporium protein or exosporium protein fragment can be any of the previously described targeting sequences, exosporium proteins or exosporium protein fragments. Fusion proteins may comprise a targeting sequence, an exosporium protein or exosporium protein fragment, and at least one protein or peptide that protects a plant against a pathogen. The targeting sequence, exosporium protein or exosporium protein fragment can be any of the previously described targeting sequences, exosporium proteins or exosporium protein fragments. The fusion protein can be made using standard molecular biology and cloning methods that are known in the art. For example, a gene encoding a protein or peptide of interest (for example, a gene encoding a plant growth-stimulating protein or peptide) can be amplified by polymerase chain reaction (PCR) and ligated with a DNA encoding any of the previously described targeting sequences to form a DNA molecule encoding the fusion protein. The DNA molecule encoding the fusion protein can be cloned into any suitable vector, eg a plasmid vector. The vector conveniently comprises a multiple cloning site into which the QfrRLnn / Lznz / E / Yii DNA molecule encoding fusion protein. Preferably, the vector also contains a selectable marker, such as an antibiotic resistance gene, so that bacteria transformed, transfected or mated to the vector can be easily identified and isolated. When the vector is a plasmid, the plasmid conveniently also comprises an origin of replication. The DNA encoding the fusion protein is conveniently under the control of a sporulation promoter that will cause expression of the fusion protein on the exosporium of an endospore of a B. cereus family member (for example, a promoter bclA native to a member of the B. cereus family). Alternatively, the DNA encoding the fusion protein can be integrated into the chromosomal DNA of a host of a B. cereus family member. The fusion protein may also comprise additional polypeptide sequences that are not part of the targeting sequence, exosporium protein, exosporium protein fragment, or plant growth-stimulating protein or peptide, shielding protein or peptide. a plant against a pathogen, the protein or peptide that improves resistance to stress in a plant or the plant binding protein or peptide. For example, the fusion protein can include tags or markers to facilitate purification or visualization of the fusion protein (eg, a polyhistidine tag or a fluorescent protein such as GFP or YFP) or visualization of recombinant spore cells. that express exosporia of Bacillus cereus. Expression of fusion proteins on the exosporium using the targeting sequences, exosporium proteins and exosporium protein fragments described in the present improvement due to the lack of secondary structure at the N-terminus of these sequences , allowing native folding of the fused proteins and retention of activity. It is possible to further improve proper folding by including a short amino acid linker between the targeting sequence, the exosporium protein, the exosporium protein fragment and the fusion partner protein. Accordingly, any of the fusion proteins described herein may comprise an amino acid linker between the targeting sequence, the exosporium protein or exosporium protein fragment, and the plant growth-stimulating protein or peptide, the exosporium protein or exosporium protein fragment. protein or peptide that protects a plant against a pathogen, protein or peptide that improves stress resistance in a plant, or plant binding protein or peptide. The linker may comprise a polyalanine linker or a polyglycine linker. A linker comprising a mixture of both alanine and glycine residues may also be used. For example, when the targeting sequence comprises SEQ ID No: 1, qhr i nn / ι 7n7 / e / YL said fusion protein may have one of the following structures: No linker: SEQ ID No: fusion partner protein Alanine linker: SEQ ID N°: 1 -fusion member protein-An Glycine linker: SEQ ID NO: Fusion member protein-1 -Gn Mixed alanine and glycine linker: SEQ ID NO: 1 - (A / G)n - fusion member protein where An, Gn and (A / G)n are any number of alanines, any number of glycines or any number of a mixture of alanines and glycines, respectively. For example, n can be between 1 and 25, and preferably between 6 and 10. When the linker comprises a mixture of alanine and glycine residues, any combination of glycine and alanine residues can be used. In the foregoing structures, a "fusion member protein" represents a plant growth-stimulating protein or peptide, a protein or peptide that protects a plant against a pathogen, a protein or peptide that enhances resistance to stress in a plant, or plant binding protein or peptide. Alternatively, or in addition, the linker may comprise a protease recognition site. Inclusion of a protease recognition site allows for targeted killing, upon exposure to a protease that recognizes the protease recognition site, of the plant growth-stimulating protein or peptide, protein or peptide that protects a protease. plant against a pathogen, the protein or peptide that enhances resistance to stress in a plant or the plant binding protein or peptide. Plant growth stimulating proteins and peptides As previously indicated, fusion proteins may comprise a targeting sequence, an exosporium protein or exosporium protein fragment, and at least one plant growth-stimulating protein or peptide. For example, the plant growth-promoting protein or peptide may comprise a peptide hormone, a non-hormonal peptide, an enzyme involved in the production or activation of a plant growth-promoting compound, or an enzyme that degrades or modifies a nutrient source. bacterial, fungal or plant. For example, when the plant growth-stimulating protein or peptide comprises a peptide hormone, said peptide hormone may comprise a phytosulfokine (eg, phytosulfokine-α), a clavata 3 (CLV3), a systemin, ZmIGF, or a SCR / SP11. When the plant growth-stimulating protein or peptide comprises a non-hormonal peptide, said non-hormonal peptide may comprise an RKN 16D10, Hg-Syv46, an eNQD40 peptide, melittin, mastoparan, Mas7, RHPP, POLARIS or Kunitz trypsin inhibitor ( KTI). The plant growth-stimulating protein or peptide may comprise an απκ ι ηη / ι zoz / e / yl enzyme involved in the production or activation of a plant growth-stimulating compound. The enzyme involved in the production or activation of a plant growth promoting compound may be any enzyme that catalyzes any step in a biological synthesis pathway of a plant growth promoting or plant structure altering compound or any enzyme that catalyzes the conversion of an inactive or less active derivative of a plant growth promoting or plant structure altering compound into an active or more active form of the compound. The plant growth-promoting compound may comprise a compound produced by the bacteria or fungi present in the rhizosphere, for example, 2,3-butanediol. Alternatively, the plant growth promoting compound may comprise a plant growth hormone, for example, a cytokinin or cytokinin derivative, ethylene, an auxin or auxin derivative, a gibberellic acid or a gibberellic acid derivative, abscisic acid or a derivative of abscisic acid or jasmonic acid or a derivative of jasmonic acid. When the plant growth stimulating compound comprises a cytokinin or cytokinin derivative, said cytokinin or cytokinin derivative may comprise kinetin, cis-zeatin, trans-zeatin, 6-benzylaminopurine, dihydroxyzeatin, N6-(D2isopentenyl)adenine, ribosylzeatin, N6-(D2-isopentenyl)adenosine, 2-methylthio-cis-ribosylzeatin, cis-ribosilzeatin, trans-ribosylzeatin, 2-methylthio-trans-ribosylzeatin, ribosylzeatin-5monophosphate, N6-methylaminopurine, N6-dimethylaminopurine, 2'-deoxyzeatin riboside , 4-hydroxy3-methyl-trans-2-butenylaminopurine, ortho-topolin, meta-topolin, benzyladenine, orthomethyltopolin, meta-methyltopolin or a combination thereof. When the plant growth stimulant compound comprises an auxin or an auxin derivative, said auxin or the auxin derivative may comprise an active auxin, an inactive auxin, a conjugated auxin, a natural auxin or a synthetic auxin, or a combination thereof. same. For example, the auxin or auxin derivative may comprise indole-3-acetic acid, indole-3-pyruvic acid, indole-3-acetaldoxime, indole-3-acetamide, indole-3-acetonitrile, indole-3-ethanol, indole- 3-pyruvate, indole-3-acetaldoxime, indole-3-butyric acid, a phenylacetic acid, 4-chloroindole-3-acetic acid, a glucose conjugated auxin, or a combination thereof. The enzyme involved in the production or activation of a plant growth-promoting compound may comprise an acetoin reductase, an indole-3-acetamide hydrolase, a tryptophan monooxygenase, an acetolactate synthetase, an a-acetolactate decarboxylase, a pyruvate decarboxylase, a diacetyl reductase, a butanediol dehydrogenase, an aminotransferase (for example, tryptophan aminotransferase), a tryptophan decarboxylase, an amino oxidase, an indole-3-pyruvate decarboxylase, an indole-3 QfrRLnn / Lznz / E / Yii acetaldehyde dehydrogenase, a tryptophan oxidase side chain, a nitrile hydrolase, a nitrilase, a peptidase, a protease, an adenosine phosphate isopentenyltransferase, a phosphatase, an adenosine kinase, an adenine phosphoribosyltransferase, CYP735A, a 5 'ribonucleotide phosphohydrolase, an adenosine nucleosidase, a zeatin cis-trans isomerase, a zeatin O-glucosyltransferase, a β-glucosidase, a cis-hydroxylase, a CK cishydroxylase, a CK N-glucosyltransferase, a 2,5-ribonucleotide phosphohydrolase, a adenosine nucleosidase, a purine nucleoside phosphorylase, a zeatin reductase, a hydroxylamine reductase, a 2-oxoglutarate dioxygenase, a gibberellic 2B / 3B hydrolase, a gibberellin 3-oxidase, a gibberellin 20-oxidase, a chitosinase, a chitinase, a β-1, 3-glucanase, a β-1,4-glucanase, a β-1,6-glucanase, an aminocyclopropan-1-carboxylic acid deaminase, or an enzyme involved in the production of a nod factor (for example, nodA, nodB, or nodl) . When the enzyme comprises a protease or peptidase, said protease or peptidase may be a protease or peptidase that cleaves proteins, peptides, proproteins or preproproteins to create a bioactive peptide. The bioactive peptide can be any peptide that exerts a biological activity. Examples of bioactive peptides include RKN 16D10 and RHPP. The protease or peptidase that cleaves proteins, peptides, proproteins or preproproteins to create a bioactive peptide may comprise subtilisin, acid protease, alkaline protease, proteinase, endopeptidase, exopeptidase, thermolysin, papain, pepsin, trypsin, pronase, a carboxylase, a serine protease, a glutamic protease, an aspartate protease, a cysteine protease, a threonine protease or a metalloprotease. The protease or peptidase can cleave proteins in a protein-rich flour (for example, soybean flour or yeast extract). The plant growth promoting protein may comprise an enzyme that degrades or modifies a bacterial, fungal or plant nutrient source. Such enzymes include cellulases, lipases, lignin oxidases, proteases, glycoside hydrolases, phosphatases, nitrogenases, nucleases, amidases, nitrate reductases, nitrite reductases, amylases, ammonia oxidases, ligninases, glycosidases, phospholipases, phytases, pectinases, glucanases, sulfatases, ureases, xylanases and siderophores. When introduced into a plant growth medium or applied to a plant, a seed or the area surrounding a plant or plant seeds, fusion proteins comprising enzymes that degrade or modify a bacterial, fungal nutrient source or plant can aid in the processing of nutrients in the vicinity of the plant and result in increased uptake of nutrients by the plant or by beneficial bacteria or fungi in the vicinity of the plant. Suitable cellulases include endocellulases (for example, an endoglucanase such as a Bacillus subtilis endoglucanase, a Bacillus thuringiensis endoglucanase, a QfrRLnn / Lznz / E / Yii endoglucanase from Bacillus cereus or an endoglucanase from Bacillus clausii), exocellulases (eg, an exocellulase from Trichoderma reesei) or β-glucosidases (eg, a β-glucosidase from Bacillus subtilis, a β-glucosidase from Bacillus subtilis, thuringiensis, a Bacillus cereus β-glucosidase or a Bacillus clausii β-glucosidase). The lipase may comprise a Bacillus subtilis lipase, a Bacillus thuringiensis lipase, a Bacillus cereus lipase or a Bacillus clausii lipase. In one embodiment, the lipase comprises a Bacillus subtilis lipase. Bacillus subtilis lipase can be amplified by POR using the following primers: ggatccatggctgaacacaatcc (forward, SEQ ID NO: 37) and ggatccttaattcgtattctggcc (reverse, SEQ ID NO: 38). In another embodiment, the cellulase is an endoglucanase from Bacillus subtilis. Bacillus subtilis endoglucanase can be amplified by PCR using the following primers: ggatccatgaaacggtcaatc (forward, SEQ ID NO: 39) and ggatccttactaatttggttctgt (reverse, SEQ ID NO: 40). In yet another embodiment, the fusion protein comprises an E. coli PtrB protease. The E. coli PtrB protease can be amplified by PCR using the following primers: ggatccatgctaccaaaagcc (forward, SEQ ID NO: 41) and ggatccttagtccgcaggcgtagc (reverse, SEQ ID NO: 42). In certain embodiments, the fusion protein contains an endoglucanase that is derived from the nucleotide sequence of SEQ ID NO: 104. The amino acid sequence of an exemplary endoglucanase that can be fused to the targeting sequence, an exosporium protein or exosporium protein fragment, and, optionally, a linker sequence, such as a poly-A linker, is as follows: fusion protein provided as SEQ ID NO: 107. In other embodiments, the fusion protein contains a phospholipase that is derived from the nucleotide sequence shown in SEQ ID NO: 105. The amino acid sequence of an exemplary phospholipase that can be fused to the targeting sequence, an exosporium protein or exosporium protein fragment, and, optionally, a linker sequence, such as a poly-A linker, is as follows: fusion protein provided as SEQ ID NO: 108. In still other embodiments, the fusion protein contains a chitosanase that is derived from the nucleotide sequence shown in SEQ ID NO: 106. The amino acid sequence of an example of a chitosanase that can be fused to the sequence of targeting, an exosporium protein or a fragment of the exosporium protein and, optionally, to a linker sequence, such as a poly-A linker, is the fusion protein provided as SEQ ID NO: 109. QfrRLnn / Lznz / E / Yii To create the fusion constructs, the genes can be fused to the native bclUn promoter of Bacillus thuringiensis DNA encoding the first 35 amino acids of BclA (amino acids 1-35 of SEQ ID NO: 1) using the cut-and-drop technique. splicing by overlapping extension (SOE). The correct amplicons are cloned into the ambivalent E. coli / Bacillus vector pHP13 and the correct clones were selected by DNA sequencing. Correct clones are incorporated by electroporation into Bacillus thuringiensis (Cry-, plasmid-) and then selected for their resistance to chloramphenicol. Correct transformants are grown in Brain Heart Infusion Broth overnight at 30°C, plated on nutrient agar plates and incubated at 30°C for 3 days. Spores expressing the fusion construct (BEMD spores) are harvested off the plates by washing in phosphate buffered saline (PBS) and purified by centrifugation and additional washings in PBS. In such fusion proteins, the endoglucanase, phospholipase, or chitosinase may comprise a nucleotide sequence encoding an amino acid sequence having at least 85% identity to SEQ ID NO: 107, 108, or 109, respectively. In such fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise an amino acid sequence having at least 90% identity to SEQ ID NO: 107, 108 or 109, respectively. In such fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise an amino acid sequence having at least 95% identity to SEQ ID NO: 107, 108 or 109, respectively. In such fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise an amino acid sequence having at least 98% identity to SEQ ID NO: 107, 108 or 109, respectively. In such fusion proteins, the endoglucanase, phospholipase or chitosinase may comprise an amino acid sequence having at least 99% identity to SEQ ID NO: 107, 108 or 109, respectively. Suitable lignin oxidases include lignin peroxidases, laccases, glyoxal oxidases, ligninases and manganese peroxidases. The protease may comprise a subtilisin, an acid protease, an alkaline protease, a proteinase, a peptidase, an endopeptidase, an exopeptidase, a thermolysin, a papain, a pepsin, a trypsin, a pronase, a carboxylase, a serine protease, a glutamic protease, an aspartate protease, a cysteine protease, a threonine protease or a metalloprotease. The phosphatase may comprise a phosphoric monoester hydrolase, a phosphomonoesterase (eg PhoA4), a phosphoric diester hydrolase, a phosphodiesterase, a qhr i nn / ι znz / e / YL a triphosphoric monoester hydrolase, a fosioryl anhydride hydrolase, a pyrophosphatase, a phytase (eg, a Bacillus subtilis EE148 phytase or a Bacillus thurium ensis BT013A phytase), a trimetaphosphatase or a triphosphatase. The nitrogenase may comprise a Nif family nitrogenase (eg NifBDEHKNXV from Paenibacillus massiliensis). Proteins and peptides that protect plants against pathogens Fusion proteins may comprise a targeting sequence, an exosporium protein or exosporium protein fragment, and at least one protein or peptide that protects a plant against a pathogen. The protein or peptide may comprise a protein or peptide that stimulates an immune response in a plant. For example, the protein or peptide that stimulates plant immune responses may comprise a protein or peptide that enhances the immune system of a plant. The plant immune system stimulating protein or peptide can be any protein or peptide that has a beneficial effect on the immune system of a plant. Suitable plant immune enhancing proteins and peptides include hairpins, α-elastins, β-elastins, systemins, phenylalanine ammonia lyase, elicitins, defensins, cryptogeins, flagellin proteins and flagellin peptides (eg flg22). Alternatively, the protein or peptide that protects a plant against a pathogen may be a protein or peptide with antibacterial activity, antifungal activity, or both antibacterial and antifungal activity. Examples of such proteins and peptides include bacteriocins, lysozymes, lysozyme peptides (eg LysM), siderophores, non-ribosomal active peptides, conalbumins, albumins, lactoferrins, lactoferrin peptides (eg LfcinB), streptavidin and TasA. The protein or peptide that protects a plant against a pathogen may also be a protein or peptide that has insecticidal activity, helminthicidal activity, that suppresses insect or worm predation, or a combination thereof. For example, the protein or peptide that protects a plant against a pathogen may comprise an insecticidal bacterial toxin (eg, a VIP insecticidal protein), an endotoxin, a Cry toxin (eg, a Bacillus thuringiensis Cry toxin), a protease inhibitory protein or peptide (eg, a trypsin inhibitor or an arrowhead protease inhibitor), a cysteine protease or a chitinase. When the Cry toxin is a Bacillus thuringiensis Cry toxin, the Cry toxin may be a Cry5B protein or a Cry21A protein. Both Cry5B and Cry21 A have insecticidal and also nematocidal activity. The protein that protects a plant against a pathogen may comprise an enzyme. Suitable enzymes include proteases and lactonases. The proteases and lactonases may be specific for a bacterial signaling molecule (eg, a bacterial homoserine lactone signaling molecule qhr i nn / ι znz / e / YL). When the enzyme is a lactonase, the lactonase may comprise 1,4-lactonase, 2-pyron-4,6-dicarboxylate lactonase, 3-oxoadipate enol-lactonase, actinomycin lactonase, A-ring deoxylimonate lactonase, gluconolactonase L-rhamno1,4-lactonase , limonin D-ring lactonase, spheroid lactonase, triacetate lactonase, or xylono-1,4-lactonase. The enzyme can also be an enzyme that is specific to a cellular component of a bacterium or a fungus. For example, the enzyme may comprise a β-1,3-glucanase, a p-1,4-glucanase, a β-1,6-glucanase, a chitosinase, a chitinase, a chitosinase-like enzyme, a lyticase, a peptidase , a proteinase, a protease (eg, an alkaline protease, an acid protease or a neutral protease), a mutanolysin, a stafolisin or a lysozyme. Proteins and peptides that improve resistance to stress in plants Fusion proteins may comprise a targeting sequence, an exosporium protein or fragment of the exosporium protein, and at least one protein or peptide that improves resistance to stress in a plant. For example, the protein or peptide that improves resistance to stress in a plant comprises an enzyme that degrades a stress-related compound. Stress-related compounds include, but are not limited to, aminocyclopropane-1-carboxylic acid (ACC), reactive oxygen species, nitric oxide, oxylipins, and phenolics. Specific reactive oxygen species include hydroxyl, hydrogen peroxide, oxygen, and superoxide. The stress-related compound degrading enzyme may comprise a superoxide dismutase, an oxidase, a catalase, an aminocyclopropane-1-carboxylic acid deaminase, a peroxidase, an antioxidant enzyme or an antioxidant peptide. The protein or peptide that improves resistance to stress in a plant may also comprise a protein or peptide that protects a plant against environmental stress. Environmental stress can comprise, for example, drought, flooding, heat, freezing, salts, heavy metals, low pH, high pH, or a combination thereof. For example, the protein or peptide that protects a plant against an environmental stress may comprise an ice nucleation protein, a prolinase, a phenylalanine ammonia lyase, an isochorismate synthase, an isochorismate pyruvate lyase or a choline dehydrogenase. Plant binding proteins and peptides Fusion proteins may comprise a targeting sequence, an exosporium protein or exosporium protein fragment, and at least one plant-binding protein and peptide. The plant-binding protein or peptide may be any protein or peptide capable of binding non-specifically or non-specifically to any part of a plant (for example, a root of a plant or an aerial portion of a plant such as a leaf, a QfrRLnn / Lznz / E / Yii stem, flower, or fruit) or to plant material. Thus, for example, the plant binding protein or peptide may be a root binding protein or peptide or a leaf binding protein or peptide. Suitable plant binding proteins and peptides include adhesins (eg richadhesin), flagellins, omptins, lectins, expansins, biofilm structural proteins (eg TasA or YuaB), fimbrial or pili proteins, curlus proteins, intimins, invasins, agglutinins and afimbrial proteins. Recombinant bacillus expressing the fusion proteins The fusion proteins described herein can be expressed by recombinant Bacillus exosporia-producing cells. The fusion protein can be any of the fusion proteins previously described. Recombinant Bacillus exosporia-producing cells can co-express two or more of any of the previously described fusion proteins. For example, the recombinant Bacillus exosporia-producing cells can co-express at least one fusion protein comprising a plant-binding protein or peptide, together with at least one fusion protein comprising a growth-stimulatory protein or peptide. plant growth, at least one fusion protein comprising a protein or peptide that protects a plant against a pathogen or at least one protein or peptide that improves stress resistance in a plant. The recombinant Bacillus exosporia-producing cells may be from Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenpasohensis, Bacillus toyoiensis, or a combination thereof. For example, the recombinant Bacillus exosporia-producing cells may comprise Bacillus cereus, Bacillus thuringiensis, Bacillus pseudomycoides or Bacillus mycoides cells. In particular, the recombinant Bacillus exosporia-producing cells may be from Bacillus thuringiensis or Bacillus mycoides. To generate recombinant Bacillus exosporia-producing cells expressing a fusion protein, any member of the Bacillus cereus family can be conjugated, transduced or transformed with a vector encoding the fusion protein using standard methods known in the art (for example, by electroporation). Bacteria can then be selected to identify transformants by any method known in the art. For example, when the vector includes an antibiotic resistance gene, bacteria can be selected for antibiotic resistance. Alternatively, the DNA encoding the fusion protein can be integrated into the chromosomal DNA of a host of a B. cereus family member. The recombinant Bacillus exosporia-producing cells can then be exposed to conditions that will induce sporulation. qhr i nn / ι zoz / e / yl Conditions suitable for inducing sporulation are known in the art. For example, recombinant Bacillus exosporia-producing cells can be plated on agar plates and incubated at a temperature of approximately 30°C for several days (eg, 3 days). Suitably, inactivated strains, non-toxic strains or genetically engineered strains of any of the foregoing species may also be used. For example, Bacillus thuringiensis devoid of the Cry toxin can be used. Alternatively, or in addition, once the recombinant spores of the B. cereus family expressing the fusion protein have been generated, they can be inactivated to prevent further germination once in use. Any method for inactivating bacterial spores known in the art can be used. Suitable methods include, but are not limited to, heat treatment, gamma irradiation, X-ray irradiation, UV-A irradiation, UV-B irradiation, chemical treatment (for example, gluteraldehyde treatment, formaldehyde, hydrogen peroxide , acetic acid, bleach, or any combination thereof) or a combination thereof. Alternatively, spores derived from non-toxicogenic strains or from genetically or physically inactivated strains may be used. Recombinant Bacillus exosporia-producing cells having plant growth promoting effects and / or other beneficial attributes Many of the strains of members of the Bacillus cereus family have inherent beneficial attributes. For example, some strains have plant growth promoting effects. Any of the fusion proteins described herein can be expressed in such strains. For example, the recombinant Bacillus exosporia-producing cells may comprise a plant growth-promoting strain of bacteria. The plant growth-promoting strain of bacteria may comprise a strain of bacteria that produces an insecticidal toxin (for example, a Cry toxin), that produces a fungicidal compound (for example, a β-1,3-glucanase, a chitosinase, a liticase or a combination thereof), which produces a nematocidal compound (e.g., a Cry toxin), which produces a bactericidal compound, which is resistant to one or more antibiotics, which comprises one or more freely replicating plasmids, which is binds to plant roots, colonizes plant roots, forms biofilms, solubilizes nutrients, secretes organic acids, or any combination thereof. For example, when the recombinant Bacillus exosporia-producing cells comprise a plant growth-promoting strain of bacteria, said plant growth-promoting strain of bacteria may comprise Bacillus mycoides strain BT155 (NRRL No: B-50921), strain Bacillus mycoides EE118 (NRRL No: B-50918), strain EE141 QfrRLnn / Lznz / E / Yii of Bacillus mycoides (NRRL No.: B-50916), Bacillus mycoides strain BT46-3 (NRRL No.: B50922), strain EE128 of a member of the Bacillus cereus family (NRRL No: B-50917), Bacillus thuringiensis strain BT013A (NRRL No: B-50924) or strain EE349 of a member of the Bacillus cereus family (NRRL No: B-50928). Bacillus thuringiensis strain BT013A is also known as Bacillus thuringiensis 4Q7. Each of these strains was deposited with the United States Department of Agriculture (USDA) Agricultural Research Service (ARS), with address at 1815 North University Street, Peoria, Illinois 61604, USA, on March 10, 2014, and is identified by the NRRL deposit number provided in parentheses. These plant growth promoting strains were isolated from the rhizospheres of several vigorous plants and identified by their 16S rRNA sequences and by biochemical assays. The strains were identified by at least the genus name using conventional biochemical and morphological indicators. Biochemical assays for confirmed Gram-positive strains, such as Bacillus, included growth on PEA medium and nutrient agar, microscopic examination, growth on 5% and 7.5% NaCI medium, growth at pH 5 and pH 9, growth at 42 °C and 50 °C, the ability to produce acid then fermentation with cellobiose, lactose, glycerol, glucose, sucrose, d-mannitol and starch; production of fluorescent pigments; gelatin hydrolysis; nitrate reduction; catalase production, starch hydrolysis; oxidase reaction, urease production and motility. For example, the recombinant Bacillus exosporia-producing cells comprising a strain of plant growth-promoting bacteria may comprise Bacillus mycoides BT155, Bacillus mycoides EE141 or Bacillus thuringiensis BT013A. Recombinant Bacillus exosporia-producing cells can express any of the fusion proteins described herein, for example, a fusion protein comprising the targeting sequence of SEQ ID NO: 60 and a non-hormonal peptide ( for example, a Kunitz trypsin inhibitor (KTI)), an enzyme involved in the production or activation of a plant growth-stimulating compound (for example, a chitosinase), a plant-binding protein or peptide (for example, , Rate); a protein or peptide that protects a plant against a pathogen (eg, TasA); or an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source (eg, a phosphatase, such as PhoA or phytase, or an endoglucanase). promoters In any of the recombinant members of the Bacillus cereus family described herein, the fusion protein can be expressed under the control of a promoter that is native to the targeting sequence, exosporium protein, or protein fragment. fusion protein exosporium protein. For example, when the fusion protein comprises a targeting sequence derived from Sterne's BclA strain of B. QfrRLnn / Lznz / E / Yii anthracis (eg, amino acids 20-35 of SEQ ID NO: 1, amino acids 1-35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID No: 60) or when the fusion protein comprises the full-length BclA (SEQ ID No: 2) or a fragment of the full-length BclA (for example, SEQ ID No: 59), the protein of fusion can be expressed under the control of a promoter that is normally associated with the BclA gene in the B. anthracis Sterne genome (eg, the promoter of SEQ ID NO: 85). Alternatively, the fusion protein can be expressed under the control of a high expression sporulation promoter. In some cases, the promoter that is native to the targeting sequence, exosporium protein, or exosporium protein fragment will be a highly expressed sporulation promoter. In other cases, the promoter that is native to the targeting sequence, exosporium protein, or exosporium protein fragment will not be a high expression sporulation promoter. In these latter cases, it may be advantageous to replace the native promoter with a highly expressing sporulation promoter. Expression of the fusion protein under the control of a high expression sporulation promoter provides increased expression of the fusion protein on the exosporium of the Bacillus cereus family member. Said high expression sporulation promoter may comprise one or more sequences of a sigma-K sporulation-specific polymerase promoter. High expression sporulating promoters suitable for use in expressing the fusion proteins in a member of the Bacillus cereus family include those listed in Table 2 below: qhr ι ηη / ι 7n7 / E / YL Table 2: Promoter sequences Promoter (SEQ ID N2) BclA Promoter Sequence (B. anthracis sterne) (SEQ ID N2: 85) TAATCACCCTTCCAAATCAATCATATGTTATACATATACTAAACT TTCCAI I I I I I IAAAI IGTTCAAGTAGTTTAAGATTTC lili CAATAAT TCAAATGTCCGTGTCAI I I ICI I ICGGI I I IGCATATGAGACTATTATGATAGATG Promotor de BetA (Sterne de B. anthracis) (SEQ ID N2: 86) ATTTATTTCATTCAAI I I I ICCIATTTAGTACCTACCGCACTCACAAAA AGCACCTCTCATTAATTTATATTATAGTCATTGAAATCTAATTTAATGA AATCATCATACTATATG lili ATAAGAAGTAAAGGTACCATACTTAA TTAATACATATCTATACACTTCAATATCACAGCATGCAGTTGAATTAT ATCCAACTTTCATTTCAAATTAAATAAGTGCCTCCGCTATTGTGAATG TCATTTACTCTCCCTACTACATTTAATAATTATGACAAGCAATCATAG GAGGTTACTACATG Promotor de B AS 1882 (Sterne de B. anthracis) (SEQ ID N2: 87) AATTACATAACAAGAACTACATTAGGGAGCAAGCAGTCTAGCGAAAG CTAACTGCI I I I I IAI IAAAIAACIAI I I IATTAAATTTCATATATACA ATCGCTTGTCCATTTCATTTGGCTCTACCCACGCATTTACTATTAGTA ATATGAAI I I I ICAGAGGIGGAI I I IATT Promotor del gene 3572 (KBAB 4 de B. weihenpasohen sis) (SEQ ID N2: 88) CTATGATTTAAGATACACAATAGCAAAAGAGAAACATATTATATAAC GATAAATGAAACTTATGTATATGTATGGTAACTGTATATATTACTACA ATACAGTATACTCATAGGAGGTAGGTATG Promotor de la proteína con βhélice YVTN (KBAB 4 de B. weihenpasohen sis) ( SEQ ID N2: 89) GGTAGGTAGATTTGAAATATGATGAAGAAAAGGAATAACTAAAAGGA GTCGATATCCGACTCC lili AGTTATAAATAATGTGGAATTAGAGTAT AAI I I IATATAGGTATATTGTATTAGATGAACGCTTTATCCTTTAATTG TGATTAATGATGGATTGTAAGAGAAGGGGCTTACAGTCCI I I I I I IAT GGTGTTCTATAAGCCTTTTTAAAAGGGGTACCACCCCACACCCAAAA A CAGGGGGGGTTATAACTACATATTGGATG I I I IGTAACGTACAAGAA T CGGTATTAATTACCCTGTAAATAAGTTATGTGTATATAAGGTAACTTT ATATATTCTCCTACAATAAAATAAAGGAGGTAATAAAGTG Promotor de Cry1A (HD-73 de B. thuringiensis) (SEQ ID N2: 90) AACCCTTAATGCATTGGTTAAACATTGTAAAGTCTAAAGCATGGATAA TGGGCGAGAAGTAAGTAGATTGTTAACACCCTGGGTCAAAAATTGAT ATTTAGTAAAATTAGTTGCACTTTGTGCATTTTTTCATAAGATGAGTC ATATGTTTTAAATTGTAGTAATGAAAAACAGTATTATATCATAATGA ATTGGTATCTTAATAAAAGAGATGGAGGTAACTTA □Ήβίπη / ίζηζ / Ε / γι Promotor de ExsY (serovar konkukian de la cepa 97-27 de B. thuringiensis (SEQID Ns: 91) TAATTCCACCTTCCCTTATCCTCTTTCGCCTATTTAAAAAAAGGTCTT G AGATTGTGACCAAATCTCCTCAACTCCAATATCTTATTAATGTAAATA CAAACAAGAAGATAAGGAGTGACATTAA Promotor de CotY (Al Hakam de B. thuringiensis) (SEQID Ns: 92) AGGATGTC1 I I I I I IATATTGTATTATGTACATCCCTACTATATAAATT CCCTGC lili ATCGTAAGAATTAACGTAATATCAACCATATCCCGTTC ATATTGTAGTAGTGTATGTCAGAACTCACGAGAAGGAGTGAACATAA Promotor de YjcA (Serovar kurstaki de la cepa HD73 de B. thuringiensis) (SEQID Ns: 93) TTAATGTCACTCCTTATCTTCTTGTTTGTATTTACATTAATAAGATATT GGAGTTGAGGAGATTTGGTCACAATCTCAAGACCI lililí IAAATAG GCGAAAGAGGATAAGGGAAGGTGGAATTA Promotor de YjcB (Serovar kurstaki de la cepa HD73 de B. thuringiensis) (SEQ ID NQ: 94) ATATA 1 1 1 ICATAATACGAGAAAAAGCGGAGTTTAAAAGAATGAGGG AACGGAAATAAAGAGTTGTTCATATAGTAAATAGACAGAATTGACAG TAGAGGAGA Promotor BxpB (Al Hakam de B. thuringiensis) (SEQID Ne: 95) AAACTAAATAATGAGCTAAGCATGGATTGGGTGGCAGAATTATCTGC CACCCAATCCATGCTTAACGAGTATTATTATGTAAATTTCTTAAAATT GGGAACTTGTCTAGAACATAGAACCTGTCC lili CATTAACTGAAAG TAGAAACAGATAAAGGAGTGAAAAACA QfrRLnn / Lznz / E / Yii Promotor de ramnosa (Al Hakam de B. thuringiensis) (SEQ ID N2: 96) ATTCACTACAACGGGGATGAGTTTGATGCGGATACATATGAGAAGTA CCGGAAAGTGTTTGTAGAACATTACAAAGATATATTATCTCCATCATA AAGGAGAGATGCAAAG Promotor de CotY / CotZ (Sterne de B. anthracis) (SEQ ID N2: 97) CGCGCACCACTTCGTCGTACAACAACGCAAGAAGAAGTTGGGGATA C AGCAGTATTCTTATTCAGTGATTTAGCACGCGGCGTAACAGGAGAAA ACATTCACGTTGATTCAGGGTATCATATCTTAGGATAAATATAATATT AAI I I IAAAGGACAAICICI ACA IG I IGAGAI IG ICCI I I I IATTTGTT CTTAGAAAGAACGATTTTTAACGAAAGTTCTTACCACGTTATGAATAT AAGTATAATAGTACACGATTTATTCAGCTACGTA Promotor de BclC (Sterne de B. anthracis) (SEQ ID N2: 98) TGAAGTATCTAGAGCTAATTTACGCAAAGGAATCTCAGGACAACACT TTCGCAACACCTATAI I I IAAATTTAATAAAAAAAGAGACTCCGGAGT CAGAAATTATAAAGCTAGCTGGGTTCAAATCAAAAATTTCACTAAAA CGATATTATCAATACGCAGAAAATGGAAAAAACGCCTTATCATAAGG CGI I I I I ICCAI I I I I ICI ICAAACAAACGAI I I IACTATGACCATTTA ACTAATTTTTGCATCTACTATGATGAGTTTCATTCACATTCTCATTAG AAAGGAGAGATTTAATG Promotor Sigma K (Sterne de B. anthracis) (SEQ ID N2: 99) TATATCATATGTAAAATTAGTTCTTATTCCCACATATCATATAGAATC GCCATATTATACATGCAGAAAACTAAGTATGGTATTATTCTTAAATTG TTTAGCACCTTCTAATATTACAGATAGAATCCGTCAI I I ICAACAGTG AACATGGATTTCTTCTGAACACAACTCTTTTTCTTTCCTTATTTCCAAA AAGAAAAGCAGCCCA lili AAAATACGGCTGCTTGTAATGTACATTA Promotor InhA (Al Hakam de B. thuringiensis) (SEQ ID N2: 100) TATCACATAACTCTTTAI I I I IAATATTTCGACATAAAGTGAAACTTT AATCAGTGGGGGCTTTGTTCATCCCCCCACTGATTATTAATTGAACC A AGGGATAAAAAGATAGAGGGTCTGACCAGAAAACTGGAGGGCATGA TTCTATAACAAAAAGCTTAATGTTTATAGAATTATGTCTTTTTATATAG GGAGGGTAGTAAACAGAGATTTGGACAAAAATGCACCGATTTATCTG AAI I I IAAGI I I IATAAAGGGGAGAAATG 0ΉβίΠΠ / ί7Π7 / Β / ΥΙ Operón 1 de la glicosiltransfera sa del agrupamiento de BclA (serovar konkukian de la cepa 97-27 de B. thuringiensis (SEQ ID N2: 101) AII I I I I ACI IAGCAG IAAAACIÜAIAICAGI I I IACIGCII I I ICATT TTTAAATTCAATCATTAAATCTTCC lili CTACATAGTCATAATGTTGT ATGACATTCCGTAGGAGGCACTTATA Operón 2 de la glicosiltransfera sa del agrupamiento de BclA (Serovar kurstaki de la cepa HD73 de B. thuringiensis) (SEQ ID N2: 102) ACATAAATTCACCTCCATAAAGCGTTCATTATATAGTAGATGCAAAAC CGAAAGAAAATGACACGGACATTTGAATTATTGAAAAGAAATCTTAA ACTACTTGAACAATTTAAAAAAATGGAAAGTTTAGTATATGTATAAC ATATGATTGATTTGGAAGAGGGTGATTA Promotor de la glicosiltransfera sa (Al Hakam de B. thuringiensis) (SEQ ID N2: 103) TTCTAI I I ICCAACAIAACAI GC l ACGAI IAAAIGGI lili IGCAAAT GCCTTCTTGGGAAGAAGGATTAGAGCGI I I I I I IATAGAAACCAAAA G TCATTAACAAI I I IAAGI IAAIGACI lili I GTTTGCCTTTAAGAGGTT TTATGTTACTATAATTATAGTATCAGGTACTAATAACAAGTATAAGTA TTTCTGGGAGGATATATCA In the promoter sequences listed in Table 2 above, the locations of sigma-K sporulation-specific polymerase promoter sequences are indicated with bold and underlined text. The Cry1A promoter (HD-73 from B. thuringiensis; SEQ ID NO: 90) has a total of four sigma-K sequences, two of which overlap, indicated by double underlining in Table 2. Preferred high-expression sporulation promoters for use in the QfrRLnn / Lznz / E / Yii expression fusion proteins in a Bacillus cereus family member include the BetA promoter (Sterne from B. anthracis; SEQ ID NO: 86), the BclA promoter (Sterne from B. anthracis ; SEQ ID No.: 85), the promoters 1 and 2 of the pooled glycosyltransferase operons of BclA (Sterne from B. anthracis; SEQ ID No.: 101 and 102), and the promoter of the YVTN β-helix protein (KBAB 4 from B. weihenstephensis; SEQ ID NO: 89). In any of the recombinant members of the Bacillus cereus family described herein, the fusion protein may be expressed under the control of a sporulation promoter comprising a nucleic acid sequence that is at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity to a nucleic acid sequence of any of SEQ ID NO: 85- 103. When the sporulation promoter comprises a nucleic acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% identity with a nucleic acid sequence of any of SEQ ID NO: 85-103, the sigma-K sporulation-specific polymerase promoter sequence(s) preferably have 100% identity to the corresponding nucleotides of SEQ ID N °: 85, 86, 87, 88, 89, 90, 91,92, 93, 94, 95, 96, 97, 98, 99,100, 101, 102 or 103. For example, as illustrated in Table 2 above , the B. anthracis Sterne BclA promoter (SEQ ID NO: 85) has sigma-K sporulation-specific polymerase promoter sequences at nucleotides 24-32, 35-43 and 129-137. Therefore, if the sporulation promoter comprises a sequence that has at least 90% identity with the nucleic acid sequence of SEQ ID NO: 85, it is preferred that the sporulation promoter nucleotides corresponding to nucleotides 2432 , 35-43 and 129-137 of SEQ ID No.: 85 have 100% identity with nucleotides 2432, 35-43 and 129-137 of SEQ ID No.: 85. In any of the methods described herein for stimulating plant growth, plants grown in the plant growth medium comprising the recombinant Bacillus exosporium-producing cells and at least one additional insecticide selected from the insecticides disclosed herein exhibit increased growth compared to growing plants in an identical plant growth medium that does not contain the recombinant Bacillus exosporium-producing cells. In any of the compositions and methods described herein for promoting plant growth, the recombinant Bacillus exosporium-producing cells may comprise any of the previously described recombinant plant growth-promoting bacterial strains. In any of the compositions and methods described herein for QfrRLnn / Lznz / E / Yii stimulate plant growth, the fusion protein can be expressed under the control of any of the previously described promoters. insecticides "Insecticides" as well as the term "insecticide" refer to the ability of a substance to increase the mortality rate or inhibit the growth rate of insects. As used herein, the term "insects" includes all organisms of the class "Insecta." The term "pre-adult" insects refers to any form of an organism prior to the adult stage, including, for example, eggs, larvae, and nymphs. As used herein, the term "insecticide" also encompasses the terms "nematocide" and "acaricide." "Nematocides" and "nematocide" refer to the ability of a substance to increase the kill rate or inhibit the growth rate of nematodes. In general, the term "nematode" encompasses eggs, larvae, juvenile forms, and mature forms of said organism. "Acaricides", and the term "acaricide", refers to the ability of a substance to increase the mortality rate or inhibit the growth rate of ectoparasites belonging to the class Arachnida, subclass Acari. The active ingredients specified herein by their “common names” are known and described, for example, in the pesticide manual (“The Pesticide Manual”, 16th Ed., British Crop Protection Council 2012) or can be consulted on the Internet ( for example, at http: / / www.alanwood.net / pesticides). In some embodiments, the insecticide is selected from the group consisting of acetamipride, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, ethoprophos, fenamifos, fenobucarb, fenthion, fipronil , flubendiamide, fluopyram, flupyradifurone, formetanate, heptanophos, imidaclopride, methamidophos, methiocarb, methomyl, niclosamide, oxydemeton-methyl, phosalone, silafluofen, spirodiclofen, spiromesifene, spirotetramat, thiaclopride, thiodicarb, tralomethrin, triazophos, triflumuron, 1-{thion, vamido 2-Fluoro-4-methyl-5-[(R)-(2,2,2-triffluoroethyl)sulf¡n¡l]phenyl}-3-(triffluoromethyl)-1H-1,2 ,4-triazol-5-amine, 1 -(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5(trifluoromethyl) -2H-tetrazol-2-¡l]methyl}-1H-pyrazole-5-carboxamide and pesticidal terpene mixtures comprising the three terpenes α-terpinene, p-cymene and limonene, and optionally minor terpene ingredients, including pesticides simulated natural ones that comprise a mixture of three terpenes, that is to say α-terpinene, p-cymene and limonene marketed as REQUIEM®. According to a preferred embodiment of the present invention, the insecticide is selected from the group consisting of clothianidin, cypermethrin, etiprole, fipronil, fluopyram, flupyradifurone, imidacloprid, methiocarb and thiodicarb. QfrRLnn / Lznz / E / Yii Compositions according to the present invention According to the present invention, the composition comprises a) recombinant Bacillus exosporium-producing cells expressing a fusion protein comprising: (i) at least one plant growth-stimulating protein or peptide selected from the group consisting of a enzyme involved in the production or activation of a plant growth stimulant compound; an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source; and a protein or peptide that protects a plant against a pathogen; and (ii) a targeting sequence that localizes the fusion protein in the exosporium of the Bacillus cells; and b) at least one particular insecticide disclosed herein in a synergistically effective amount. A "synergistically effective amount" according to the present invention means an amount of a combination of the recombinant Bacillus exosporium-producing cells expressing a fusion protein and at least one particular insecticide described herein that is most effective. against insects, mites, nematodes and / or phytopathogens than recombinant cells producing Bacillus exosporia expressing a fusion protein or said fungicide only. A "synergistically effective amount" according to the present invention also means an amount of a combination of the recombinant Bacillus exosporium-producing cells expressing a fusion protein and at least one particular insecticide disclosed herein that is more effective in improving plant growth and / or promoting plant health than recombinant Bacillus exosporium-producing cells expressing a fusion protein or the fungicide alone. The present invention encompasses any and all combinations of each of the particular insecticides disclosed herein with the recombinant Bacillus exosporia-producing cells. In a very preferred embodiment, the present invention relates to a composition comprising: a) recombinant cells producing Bacillus exosporia that express a fusion protein comprising: (i) at least one protein or peptide stimulating plant growth selected from the group consisting of an enzyme involved in the production or activation of a plant growth stimulating compound; an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source; and a protein or peptide that protects a plant against a pathogen or pest; and (ii) a targeting sequence that localizes the fusion protein in the exosporium of the Bacillus cells; and b) at least one particular insecticide disclosed herein in a synergistically effective amount and said at least one insecticide is selected from the group consisting of acetamipride, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, QfrRLnn / Lznz / E / Yii cypermethrin, deltamethrin, endosulfan, ethion, ethiprole, ethoprophos, fenamifos, fenobucarb, fenthion, fipronil, flubendiamide, fluopyram, flupyradifurone, formetanate, heptanophos, imidacloprid, methamidophos, methiocarb, methomyl, niclosamide-methyl, oxidemetonamide , phosalone, silafluofen, spirodiclofen, spiromesifene, spirotetramat, thiaclopride, thiodicarb, tralomethrin, triazophos, triflumuron, vamidothion, 1 -{2-fluoro-4-methyl-5-[(R)-(2,2,2-tr¡ fluoroethyl)sulfin¡l]phenyl}-3(trif luorom ethyl I) -1H-1,2,4-triazol-5-amine and 1 -(3-chloropyridin-2-yl)-N-[ 4-cyano-2-methyl-6(methylcarbamol)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole -5-carboxamide in a synergistically effective amount. In a preferred embodiment the composition according to the present invention further comprises at least one fungicide. In general, the term "fungicide" refers to the ability of a substance to increase mortality or to inhibit the growth rate of fungi. The term "fungus" or "fungi" includes a wide variety of nucleated spore-bearing organisms that are devoid of chlorophyll. Examples of fungi include yeasts, molds, mildews, rusts, and mushrooms. additional additives One aspect of the present invention comprises providing a composition, previously described, which additionally comprises at least one auxiliary selected from the group consisting of extenders, solvents, instant builders, vehicles, emulsifiers, dispersants, cryoprotectants, thickeners and adjuvants. Such compositions are known as formulations. Therefore, in one aspect of the present invention said formulations, and the application forms prepared with them, are provided as crop protection agents and / or as pesticidal agents, such as saturation, drip and spray liquors, comprising the composition of the invention. The forms of application may comprise other crop protection agents and / or pesticidal agents, and / or activity-enhancing adjuvants such as penetrants, of which vegetable oils such as, for example, olive oil may be mentioned as examples. rapeseed, sunflower oil, mineral oils such as, for example, liquid paraffins, alkyl esters of vegetable fatty acids, such as methyl esters of rapeseed oil or soybean oil, or alkanol alkoxylates, and / or dispersants such as e.g. example, alkylsiloxanes and / or salts, examples organic or inorganic ammonium or phosphonium salts, of which ammonium sulfate or diammonium hydrogen phosphate may be mentioned as examples, and / or retention promoters such as hydroxypropyl guar or sulfosuccinate polymers of dioctyl and / or humectants such as glycerol and / or fertilizers such as, for example, ammonium, potassium or phosphorous fertilizers. Examples of typical formulations include water soluble liquids (SL), QfrRLnn / Lznz / E / Yii emulsifiable concentrates (EC), emulsions in water (EW), suspension concentrates (SC, SE, FS, OD), water dispersible granules (WG), granules (GR) and capsule concentrates ( YOU); these and other types of possible formulations were described, for example, by Crop Life International and in the FAO Pesticide Specifications, Manual on development and use and the QMS specifications for pesticides, FAO Plant Production and Protection Papers - 173, prepared by the FAO / WHO Joint Meeting on Pesticide Specifications, 2004, ISBN: 9251048576. The formulations may comprise active agrochemical compounds other than the one or more active compounds of the invention. The formulations or forms of application in question preferably comprise auxiliaries, such as extenders, solvents, instant promoters, vehicles, emulsifiers, dispersants, cryoprotectants, diocides, thickeners and / or other auxiliaries, such as, for example, adjuvants. In this context, an adjuvant is a component that enhances the biological effect of the formulation, without the component itself having a biological effect. Examples of adjuvants are agents that promote retention, dispersion, attachment to the leaf surface, or penetration. These formulations are produced in a known manner, for example by mixing the active compounds with auxiliaries such as, for example, extenders, solvents and / or solid carriers and / or additional auxiliaries, such as, for example, surfactants. The formulations are prepared either in suitable plants or otherwise before or during application. Suitable for use as auxiliaries are substances which are suitable for imparting to the formulation of the active compound or to the application forms prepared from these formulations (such as, for example, useful crop protection agents, such as spray liquors). or coatings for seeds) particular properties such as certain physical, technical and / or biological properties. Suitable extenders are, for example, water, polar and non-polar organic chemical liquids, for example belonging to the classes of aromatic and non-aromatic hydrocarbons (such as paraffins, alkylbenzenes, alkylnaphthalenes, chlorobenzenes), alcohols and polyols (which, if appropriate, they may also be substituted, etherified and / or esterified), ketones (such as acetone, cyclohexanone), esters (including fats and oils) and (poly)ethers, unsubstituted and substituted forms of amines, amides, lactams ( such as N-alkylpyrrolidones) and lactones, sulfones and sulfoxides (such as dimethyl sulfoxide). If the extender used is water, it is also possible to use, for example, organic solvents as auxiliary solvents. In essence, the suitable liquid solvents are: aromatic compounds, such as xylene, toluene or alkylnaphthalenes, chlorinated aromatic compounds and chlorinated aliphatic hydrocarbons, such as chlorobenzenes, chloroethylenes or chloride. QfrRLnn / Lznz / E / Yii of methylene, aliphatic hydrocarbons, such as cyclohexane or paraffins, for example petroleum fractions, mineral and vegetable oils, alcohols, such as butanol or glycol, and also their ethers and esters, ketones, such as acetone , methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone, strongly polar solvents such as dimethylformamide and dimethyl sulfoxide, and also water. In principle it is possible to use all suitable solvents. Suitable solvents are, for example, aromatic hydrocarbons, such as xylene, toluene or alkylnaphthalenes, for example, chlorinated aromatic or aliphatic hydrocarbons, such as chlorobenzene, chloroethylene or methylene chloride, for example, aliphatic hydrocarbons, such as cyclohexane, for example. , paraffins, petroleum fractions, mineral and vegetable oils, alcohols such as, for example, methanol, ethanol, isopropanol, butanol or glycol and also their ethers and esters, ketones such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone, for example, strongly polar solvents, such as dimethyl sulfoxide, and water. In principle all suitable vehicles can be used. Suitable carriers are, in particular: for example ammonium salts and ground natural minerals such as kaolin, clays, talc, chalk, quartz, attapulgite, montmorillonite or diatomaceous earth, and ground synthetic minerals such as finely divided silicon, alumina and natural or synthetic silicates, resins, waxes and / or solid fertilizers. Likewise, mixtures of said vehicles can be used. Suitable carriers for granules include the following: for example, crushed and fractionated natural minerals such as calcite, marble, pumice, sepiolite and dolomite, and also synthetic granules of inorganic and organic powders, and also granules of organic materials such as sawdust, paper, coconut shells, corn cobs and tobacco stalks. Liquefied gaseous solvents or extenders may also be used. Particularly suitable are those extenders or vehicles which, at standard temperatures and under standard pressure, are gaseous, such as aerosol propellants, such as halogenated hydrocarbons, and also butane, propane, nitrogen and carbon dioxide. Examples of emulsifiers and / or foam formers, dispersing or wetting agents having ionic or non-ionic properties, or mixtures of these surface-active substances are polyacrylic acid salts, lignosulfonic acid salts, phenolsulfonic acid salts or naphthalenesulfonic acid , Polycondensates of ethylene oxide with fatty alcohols or with fatty acids or with fatty amines, with substituted phenols (preferably alkylphenols or arylphenols), salts of sulfosuccinic esters, taurine derivatives (preferably alkyltaurates), phosphoric esters of polyethoxylated alcohols or phenols, esters of fatty acid polyols, and derivatives of compounds containing sulfates, sulfonates, and phosphates, such as alkylaryl polyglycol ethers, alkylsulfonates, alkylsulfates, arylsulfonates, protein hydrolysates, sulfite-lignin waste liquors, and methylcellulose. The presence of a surface-active substance is advantageous if one of the active compounds and / or one of the inert carriers is not soluble in water and if the application takes place in water. Other auxiliaries that may be present in the formulations and application forms derived therefrom include colorants such as inorganic pigments, such as iron oxide, titanium oxide, Prussian blue, and organic colorants, such as alizarin dyes, azo dyes and metal phthalocyanine dyes and nutrients and trace nutrients, such as iron, manganese, boron, copper, cobalt, molybdenum and zinc salts. They may also contain stabilizers, such as low temperature stabilizers, preservatives, antioxidants, light stabilizers, or other agents that improve chemical and / or physical stability. Additionally they may contain foam formers or defoamers. Furthermore, the formulations and application forms derived therefrom may also comprise, as additional auxiliaries, adhesives such as carboxymethylcellulose, natural and synthetic polymers in the form of powders, granules or latexes, such as gum arabic, polyvinyl alcohol, polyvinyl acetate and also natural phospholipids, such as cephalins and lecithins, and synthetic phospholipids. Other possible auxiliaries include mineral and vegetable oils. There may possibly be other auxiliaries present in the formulations and application forms derived therefrom. Examples of such additives include fragrances, protective colloids, binders, adhesives, thickeners, thixotropes, penetrants, retention promoters, stabilizers, sequestrants, complexing agents, wetting agents, and dispersants. Generally speaking, the active compounds can be combined with any commonly used solid or liquid additive for formulation purposes. Suitable retention promoters include all those substances that reduce dynamic surface tension, such as dioctyl sulfosuccinate, or increase viscoelasticity, such as, for example, hydroxypropylguar polymers. Suitable penetrants include, in the present context, all those substances that are typically used to improve the penetration of active agrochemical compounds into plants. Penetrators are defined, in this context, because, from the application liquor (generally aqueous) and / or from the spray coating, they have the ability to penetrate the cuticle of the plant and thus increase the mobility of the active compounds in the cuticle. This property can be determined using the method described in the literature (Baur et al., 1997, Pesticide Science 51,131-152). Examples include alcohol alkoxylates such as coconut fatty ethoxylate (10) or isotridecyl ethoxylate (12), qhr i nn / ι znz / e / YL fatty acid esters such as rapeseed or soybean oil methyl esters, alkoxylates from fatty amines such as tallowamine ethoxylate (15), or ammonium and / or phosphonium salts such as, for example, ammonium sulfate or diammonium hydrogen phosphate. The formulations preferably comprise between 0.0001% and 98% by weight of active compound or, particularly preferably, between 0.01% and 95% by weight of active compound, more preferably between 0.5% and 90% by weight of the active compound, based on the weight of the formulation. The content of the active compound is defined as the sum of the exosporia-producing recombinant cells of Bacillus and said at least one particular insecticide disclosed herein. The active compound content of the application forms (crop protection products) prepared from the formulations can vary within wide ranges. The active compound concentration of the application forms can typically comprise between 0.0001% and 95% by weight of active compound, preferably between 0.0001% and 1% by weight, based on the weight of the application form. The application is carried out in the usual way but adapted to the forms of application. Still further, in one aspect of the present invention, there is provided a kit of parts comprising recombinant Bacillus exosporia-producing cells and at least one particular insecticide disclosed herein in a synergistically effective amount in a spatially separate arrangement. In a further embodiment of the present invention, the aforementioned set of parts further comprises at least one additional fungicide and / or at least one insecticide disclosed herein. The fungicide and / or insecticide may be present either in the Bacillus exosporia-producing recombinant cell component of the set of parts or in the insecticidal component of the set of parts which are spatially separated or in both components. Preferably, the fungicide and insecticide are present in the biological control agent component based on a recombinant member of the Bacillus cereus family. In addition, the set of parts elements according to the present invention may additionally comprise at least one auxiliary selected from the group consisting of extenders, solvents, instant promoters, vehicles, emulsifiers, dispersants, cryoprotectants, thickeners and adjuvants as mentioned above. forward. This at least one helper may be present either in the exosporium-producing recombinant cells of the Bacillus cereus family or in the component comprising the insecticide described herein of the set of parts elements, are spatially separate, or in both components . In another aspect of the present invention the previously described composition is used QfrRLnn / Lznz / E / Yii to reduce general damage to plants and parts of plants, as well as losses in harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens. Still further, in another aspect of the present invention the previously described composition increases the general state of health of the plant. The term "plant health status" broadly encompasses various types of plant improvements that are not related to pest control. For example, advantageous properties that may be mentioned comprise improved crop characteristics including: emergence, crop yields, protein content, oil content, starch content, more developed root system, improved root growth, improved root size maintenance, improved root efficiency, improved stress tolerance (for example against drought, heat, salts, UV, water, cold), reduced ethylene (reduction in production and / or inhibition of reception), increased shoot formation, increased in plant height, larger leaf blades, less basal leaf death, stronger suckers, greener leaf color, pigment content, photosynthesis activity, less need for applications (such as fertilizers or water), less need for seeds, more productive shoots, earlier flowering, earlier kernel maturity, fewer broken plants (overturning), more shoot growth, improved plant vigor, more standing plants, and a better and earlier germination. With respect to the use according to the present invention, an improved plant health status preferably refers to improved plant characteristics including: crop yield, more developed root system (improved root growth), improved root size maintenance, improved root efficiency, increased sucker formation, increased plant height, larger leaf blades, less basal leaf death, stronger suckers, greener leaf color, photosynthesis activity, more suckers productive, improved plant vigor and a greater number of standing plants. With regard to the present invention, an improved plant health status preferably refers in particular to improved properties of plants selected from among crop yield, more developed root system, improved root growth, improved root size maintenance, root efficiency improved, increased shoot formation and increase in plant height. The effect of a composition according to the present invention on the state of plant health as defined herein can be determined by comparison of plants grown under the same environmental conditions, where a part of said plants is treated with a composition according to the present invention and another part of said QfrRLnn / Lznz / E / Yii plants is not treated with a composition according to the present invention. Instead, said other part not treated or treated with a placebo (i.e. an application without the composition according to the invention such as an application without all the active ingredients (i.e. without a biocontrol agent based on the recombinant cells of Bacillus cereus family members described herein and without an insecticide as described herein), or an application without a biocontrol agent based on the recombinant cells of Bacillus cereus family members described herein or an application without an insecticide as described herein. The composition according to the present invention can be applied in any desired manner, such as in the form of a seed coat, drenched in the soil and / or directly in the furrow and / or as a foliar spray and can furthermore be an application pre-emergence, post-emergence or both. In other words, the composition can be applied to the seeds, the plant or harvested fruits and vegetables or to the soil where the plant grows or where it is desired to grow the plant (the growth locus of the plant). Reducing overall damage to plants and plant parts often results in healthier plants and / or increased plant vigor and yield. Preferably, the composition according to the present invention is used to treat conventional or transgenic plants or seeds thereof. The present invention also relates to methods of stimulating plant growth using any of the previously described compositions comprising recombinant Bacillus exosporium-producing cells expressing a fusion protein and at least one particular insecticide disclosed herein. The method for stimulating plant growth comprises applying to a plant, to a plant part, to the locus surrounding the plant, or where the plant will be planted (for example, in soil or in another growth medium), a composition that comprises recombinant Bacillus exosporia-producing cells expressing a fusion protein comprising: (i) at least one plant growth-stimulating protein or peptide; and (ii) a targeting sequence, an exosporium protein or exosporium protein fragment, and at least one additional particular insecticide disclosed herein in a synergistically effective amount. In another aspect of the present invention, a method is provided for reducing overall damage to plants and parts of plants, as well as losses of harvested fruits or vegetables caused by insects, mites, nematodes and / or phytopathogens, comprising the step of simultaneously or successively applying the recombinant Bacillus exosporia-producing cells and at least one particular insecticide disclosed herein in an amount QfrRLnn / Lznz / E / Yii synergistically effective. In another embodiment of the present invention, the composition comprises at least one insecticide and / or at least one insecticide in addition to the recombinant Bacillus exosporia-producing cells and the particular insecticide disclosed herein. In one embodiment, said at least one insecticide is a synthetic insecticide. The method of the present invention includes the following methods of application, namely, both the recombinant Bacillus exosporium-producing cells and said at least one particular insecticide disclosed herein as mentioned above can be formulated into a single stable composition with an agronomically acceptable shelf life (also known as “single formulation”) or they can be combined before or at the time of use (also known as “combined formulations”). If not otherwise indicated, the term "combination" represents the various combinations of the recombinant Bacillus exosporium-producing cells and said at least one particular insecticide disclosed herein, and optionally said at least one additional insecticide and / or or said at least one insecticide, in a single formulation, in a single "ready mix" form, in a combined spray mix made up of single formulations, such as a "tank mix", and especially in use combination of the individual active ingredients when applied in a successive manner, ie one after the other over a reasonably short period, such as a few hours or days, for example between 2 hours and 7 days. The order of application of the composition according to the present invention is not essential to the practice of the present invention. Therefore, the term "combination" also encompasses the presence of the recombinant Bacillus exosporium-producing cells and said at least one particular insecticide disclosed herein, and optionally said at least one additional insecticide and / or insecticide on or on a plant to be treated or its environment, habitat or storage space, for example, after simultaneously or consecutively applying the recombinant Bacillus exosporium-producing cells and said at least one particular insecticide disclosed herein, and optionally said at least one additional insecticide and / or said at least one insecticide to a plant, its environment, habitat or storage space. If the recombinant Bacillus exosporia-producing cells and said at least one particular insecticide described herein, and optionally said at least one insecticide and / or said at least one insecticide are employed or used in succession, it is preferred to treat plants or parts of plants (including seeds and plants emerging from seeds), fruits and vegetables harvested according to the following method: First, applying said at least one particular insecticide described herein and optionally said at least one additional fungicide and / or said at least one insecticide on QfrRLnn / Lznz / E / Yii the plant or plant parts, and secondly applying the recombinant Bacillus exosporium-producing cells to the same plant or plant parts. With this manner of application, the amount of insecticide / fungicide residue on the plant at harvest time is as low as possible. The periods of time between the first and the second application in a growth cycle (crop) can vary and depend on the effect that is desired to be achieved. For example, the first application is to prevent an infestation of the plant or plant part with insects, mites, nematodes and / or phytopathogens (this is particularly the case when treating seeds) or to combat infestation by insects, mites, nematodes and / or phytopathogens (this is particularly the case when plants and parts of plants are treated) and the second application is to prevent or control infestation by insects, mites, nematodes and / or phytopathogens and / or to promote plant growth. Control in this context means the recombinant Bacillus exosporia-producing cells cannot completely exterminate the phytopathogenic pests or fungi but can maintain the infestation at an acceptable level. The present invention also provides methods for increasing the activity of eliminating, inhibiting, preventing and / or repelling the compositions of the present invention through multiple applications. In some other embodiments, the compositions of the present invention are applied to a plant and / or plant part twice, during any desired developmental stage or under any predetermined pest pressure, at an interval of about 1 hour, about 5 hours, about 10 hours, about 24 hours, about two days, about 3 days, about 4 days, about 5 days, about 1 week, about 10 days, about two weeks, about three weeks, about 1 month or more. In some additional embodiments, the compositions of the present invention are applied to a plant and / or plant part more than twice, for example, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times or more, during any desired developmental stage or under any predetermined pest pressure, at intervals of about 1 hour, about 5 hours, about 10 hours, about 24 hours, about two days, about 3 days, about 4 days, about 5 days, about 1 week, about 10 days, about two weeks, about three weeks, about 1 month or more. The intervals between each application can be varied if desired. One skilled in the art will be able to determine application times and interval lengths depending on plant species, pest species, and other factors. The use of the steps mentioned above allows to achieve a very low level of residues of the biological control agent, and optionally of at least one fungicide and / or at least one □Ήβίπη / ίζηζ / Ε / γι insecticide, on the treated plant , treated plant parts and harvested fruits and vegetables. If not otherwise indicated, the treatment of harvested plants or parts of plants (including seeds and plants emerging from seeds), fruits and vegetables with the composition according to the invention is carried out directly or by action of their environments, habitats or storage spaces using common treatment methods, e.g. dipping, spraying, atomizing, irrigation, evaporation, spraying, misting, scattering, foaming, painting, surface scattering, watering (soaking) , drip irrigation. In addition, it is possible to apply the recombinant Bacillus exosporia-producing cells, said at least one additional insecticide described herein, and optionally said at least one additional insecticide and / or said at least one insecticide, as a single formulation or as combined formulations by the ultra-low volume method, or for injecting the composition according to the present invention as a composition or as single formulations into the soil (into the furrow). The term "plant to be treated" covers every part of a plant, including its root system and material - for example, soil or nutrition medium - present within a radius of at least 10 cm, 20 cm, 30 cm around of the stem or trunk of a plant to be treated or that is at least 10 cm, 20 cm, 30 cm around the root system of said plant to be treated, respectively. The amount of the recombinant Bacillus exosporia-producing cells, which is used or employed in combination with at least one particular insecticide described herein, optionally in the presence of at least one additional fungicide and / or said at least one insecticide, depends on the final formulation, as well as the size or type of plant, parts of plants, seeds, fruits and harvested vegetables to be treated. Usually, the recombinant Bacillus exosporia-producing cells to be employed or used in accordance with the invention are present in an amount between about 1% and about 80% (w / w), preferably between about 1% and about 60% (w / w). / w), more preferably between about 10% and about 50% (w / w) of the single formulation or of the combined formulation with said at least one particular insecticide, and optionally the fungicide and / or said at least one insecticide. Furthermore, the amount of said at least one particular insecticide disclosed herein that is used or employed in combination with the recombinant Bacillus exosporia-producing cells, optionally in the presence of at least one additional fungicide and / or said at least an insecticide, depends on the final formulation, as well as the size or type of plant, plant parts, seeds, fruit or harvested vegetables to be treated. Typically, the particular insecticide described herein to be employed or used in accordance with the QfrRLnn / Lznz / E / Yii invention is present in an amount between about 0.1% and about 80% (w / w), preferably between about 1% and about 60% (w / w), more preferably between about 10 % and approximately 50% (w / w) of the single formulation or of the combined formulation with the recombinant cells producing Bacillus exosporia, and optionally said at least one additional insecticide and / or said at least one insecticide. Application of the recombinant Bacillus exosporia-producing cells can be as a foliar spray, as a soil treatment and / or as a seed treatment / dressing. When used as a foliar treatment, in one embodiment, between about 1 / 16 and about 5 gallons of full mix is applied per acre. When used as a soil treatment, in one embodiment, between about 1 and about 5 gallons of complete mix is applied per acre. When used for seed treatment, about 1 / 32 to about 1 / 4 gallon of full mix is applied per acre. For seed treatment, the end-use formulation contains at least 1 x 104, at least 1 x 105, at least 1 x 106, 1 x 107, at least 1 x 108, at least 1 x 109, at least 1 x 1010 colony forming units per gram. The recombinant Bacillus exosporia-producing cells and at least one particular insecticide disclosed herein and, if present, preferably also the fungicide and / or insecticide, are used or employed in a synergistic weight ratio. The skilled artisan will be able to find the synergistic weight ratios for the present invention using routine methods. The skilled person will understand that these ratios refer to the ratio in a combined formulation, as well as the calculated ratio of the Bacillus exosporia-producing recombinant cells described herein and said at least one particular insecticide disclosed herein when both components are combined. applied as monoformulations to a plant to be treated. The specialist can calculate this relationship using simple mathematics given that the volume and quantity of the recombinant Bacillus exosporium-producing cells and said at least one particular insecticide disclosed herein, respectively, in a monoformulation as is known to the specialist. The ratio can be calculated on the basis of the amount of said at least particular insecticide disclosed herein, at the time point of application of said component of a combination according to the invention to a plant or plant part and the amount of the recombinant Bacillus exosporia-producing cells shortly before (for example, 48 hrs, 24 hrs, 12 hrs, 6 hrs, 2 hrs, 1 hrs) or at the time point of application of said component of a combination according with the invention to a plant or plant part. QfrRLnn / Lznz / E / Yii The application of the recombinant Bacillus exosporia-producing cells and said at least one particular insecticide disclosed herein to a plant or a plant part can take place simultaneously or at different times as long as both components are present on or in the plant. plant after one or more applications. In cases where the recombinant Bacillus exosporia-producing cells and the particular insecticide disclosed herein are applied at different times and the particular insecticide disclosed herein is applied before the recombinant Bacillus exosporia-producing cells, the artisan can determine the concentration of the particular insecticide disclosed herein on / in a plant by chemical assays known in the art, at or shortly before the time point of application of the recombinant Bacillus exosporium-producing cells. In contrast, when the recombinant Bacillus exosporium-producing cells are first applied to a plant, the concentration of the recombinant Bacillus exosporium-producing cells can be determined using tests that are also known in the art, at the point of time or shortly before said insecticide application time point. In particular, in one embodiment the synergistic weight ratio of the recombinant Bacillus exosporium-producing cells and said at least one particular insecticide disclosed herein is in the range of between 1:1000 and 1000:1, preferably in the range of 1:500 to 500:1, more preferably in the range of 1:300 to 500:1. Especially preferred ratios are between 20:1 and 1:20, such as 10:1, 5:1 or 2:1. It should be noted that these ratio ranges refer to the Bacillus cereus family-based recombinant member biological control agent (to be combined with at least one particular insecticide disclosed herein or with a preparation of at least a particular insecticide disclosed herein). For example, a ratio of 100:1 means that 100 parts by weight of a spore preparation of the exosporia-producing recombinant Bacillus-based biological control agent and 1 part by weight of the particular insecticide disclosed herein (either as a single formulation, a combined formulation or by separate applications to the plants so that the combination is formed on the plant). In one aspect of this embodiment, the spore preparation of the recombinant Bacillus exosporium-producing cells is a dried spore preparation containing at least about 1 x 10 4 cfu / g, at least about 1 x 10 5 cfu / g. g, at least about 1 x 106 cfu / g at least about 1 x 107 cfu / g, at least about 1 x 108 cfu / g, at least about 1 x 109 cfu / g, at least about 1 x 1010 cfu / g and at least about 1 x 1011 cfu / g. In another embodiment, the synergistic weight ratio of the recombinant cells Bacillus exosporia-producing QfrRLnn / Lznz / E / Yii and said at least one particular insecticide disclosed herein is in the range of 1:100 to 20,000:1, preferably in the range of 1:50 to 10,000 :1 or still in the 1:50 to 1000:1 range. In an embodiment of the present invention, the concentration of the recombinant Bacillus exosporium-producing cells after dispersal is at least 50 g / ha, such as 50 - 7500 g / ha, 50 - 2500 g / ha , 50 - 1500 g / ha; at least 250 g / ha (hectare), at least 500 g / ha or at least 800 g / ha. The application rate of the composition to be employed or used in accordance with the present invention may vary. The skilled person will be able to find the appropriate application rate by routine experiments. In another aspect of the present invention, a seed treated with the previously described composition is provided. The control of insects, mites, nematodes and / or phytopathogens by treatment of plant seeds has been known for a long time and is the subject of continuous improvements. However, seed treatment entails a series of problems that cannot always be resolved satisfactorily. Accordingly, it is desirable to develop methods of protecting seeds and the germinating plant that eliminate the need for, or at least significantly reduce, the additional administration of crop protection compositions during the course of storage, after sowing, or after of plant emergence. In addition, it is desirable to optimize the amount of active ingredient used in such a way as to provide the best possible protection for the seeds and the germinating plant against attack by insects, mites, nematodes and / or phytopathogens, but without the active ingredient used cause damage to the plant itself. In particular, seed treatment methods should also consider the intrinsic insecticidal and / or nematocidal properties of pest-resistant or pest-tolerant transgenic plants, in order to achieve optimal seed and germinating plant protection with use. minimum of crop protection compositions. Therefore, the present invention also relates in particular to a method for protecting seeds and germinating plants against attack by pests, by treating the seeds with the previously defined recombinant Bacillus exosporium-producing cells and at least one insecticide. particular disclosed herein in a synergistically effective amount. The method of the invention for protecting seeds and germinating plants against attack by pests encompasses a method in which the seeds are simultaneously treated in one operation with the recombinant Bacillus exosporium-producing cells and said at least one particular insecticide disclosed in herein and optionally said at least one additional insecticide and / or said at least one insecticide. QfrRLnn / Lznz / E / Yii It also encompasses a method in which seeds are treated at different times with the recombinant Bacillus exosporium-producing cells and said at least one particular insecticide disclosed herein, and optionally said at least one additional insecticide and / or said by at least one insecticide. The invention also relates to the use of the composition of the invention to treat seeds in order to protect said seeds and the resulting plants against insects, mites, nematodes and / or phytopathogens. The invention also relates to seeds which were simultaneously treated with the recombinant Bacillus exosporia-producing cells and at least one additional fungicide, and optionally at least one additional fungicide and / or said at least one insecticide. The invention further relates to seeds that were treated at different times with the recombinant Bacillus exosporia-producing cells and said at least one additional insecticide and optionally said at least one additional insecticide and / or said at least one additional insecticide. In the case of the seeds that were treated at different times with the recombinant cells producing Bacillus exosporia and said at least one additional insecticide, and optionally said at least one additional insecticide and / or said at least one insecticide, the Individual active ingredients in the composition of the invention may be present in different layers on the seeds. Still further, the invention relates to seeds which, after treatment with the composition of the invention, are subjected to a film coating process in order to prevent dust abrasion of the seeds. One of the advantages of the present invention is that, due to the particular systemic properties of the compositions of the invention, the treatment of seeds with these compositions offers protection against insects, mites, nematodes and / or phytopathogens, not only to the seeds. themselves but also to the plants originating from the seeds, after they emerged. In this way, it would not be necessary to treat the crop directly at or shortly after planting. An additional advantage is constituted by the fact that, by treating the seeds with a composition of the invention, it is possible to promote the germination and emergence of the treated seeds. It is also considered advantageous to use the composition of the invention, in particular with transgenic seeds. It is also stated that the composition of the invention can be used in combination with agents of signaling technology, as a result of which, for example, colonization with symbionts is improved, such as improving for example rhizobia, mycorrhizae and / or bacteria. endophytic, and / or nitrogen fixation is optimized. QfrRLnn / Lznz / E / Yii The compositions of the invention are suitable for protecting the seeds of any variety of plant that is used in agriculture, in greenhouses, in forestry or in horticulture. More particularly, the seeds in question are cereals (for example wheat, barley, rye, oats and millet), maize, cotton, soybeans, rice, potatoes, sunflower, coffee, tobacco, canola, oilseed rape, beets (for example , sugar beets and fodder beets), peanuts, vegetables (for example, tomato, cucumber, broad bean, Brassicas, onions and lettuce), fruit plants, lawns and ornamentals. Particularly important is the treatment of cereal seeds (such as wheat, barley, rye, and oats), corn, soybeans, cotton, canola, oilseed rape, and rice. As previously mentioned, the treatment of transgenic seeds with the composition of the invention is particularly important. Here, the seeds in question are from plants that generally contain at least one heterologous gene that controls the expression of a polypeptide that exhibits, in particular, insecticidal and / or nematocidal properties. These heterologous genes in the transgenic seeds can come from microorganisms such as Bacillus, Rhizobium, Pseudomonas, Serratia, Trichoderma, Clavibacter, Glomus or Gliocladium. The present invention is particularly suitable for the treatment of transgenic seeds containing at least one heterologous gene from Bacillus sp. With particular preference, the heterologous gene in question comes from Bacillus thuringiensis. For the purposes of the present invention, the composition of the invention is applied alone or in a formulation suitable for seeds. The seeds are preferably treated under a condition in which their stability is such that no damage occurs in the course of the treatment. Generally speaking, seeds can be treated at any point in time between harvest and sowing. Typically, seeds are used that have been separated from the plant and from which the kernels, husks, stems, hulls, hairs, or pulp have been removed. Thus, for example, seeds that have been harvested, cleaned and dried to a moisture content of less than 15% by weight can be used. As an alternative, it is also possible to use seeds that after drying have been treated, for example, with water and then dried again. When treating seeds it is necessary, in general terms, to ensure that the amount of the composition of the invention, and / or other additives, that is applied to the seeds is selected in such a way that the germination of the seeds is not adversely affected. seeds, and / or that the plants emerging from the seeds are not damaged. This is the case in particular with active ingredients that can have phytotoxic effects at certain application rates. The compositions of the invention can be applied directly, in other words, without comprising additional components and without having been diluted. as a rule QfrRLnn / Lznz / E / Yii In general, it is preferable to apply the compositions in the form of a suitable formulation to the seeds. Formulations and methods suitable for seed treatment are known to the skilled person and are described, for example, in the following documents: US Pat. No. 4,272,417 A; 4,245,432A; 4,808,430A; 5,876,739 A; US Patent Publication N22003 / 0176428 A1; WO 2002 / 080675 A1; WO 2002 / 028186 A2. The combinations that can be used according to the invention can be converted into the usual seed coating formulations, such as solutions, emulsions, suspensions, powders, foams, slurries or other seed coating compositions, and also ULV formulations. These formulations are prepared in a known manner, by mixing the composition with the usual adjuvants, such as, for example, the usual extenders and also solvents or diluents, colorants, wetting agents, dispersants, emulsifiers, antifoams, preservatives, secondary thickeners, adhesives, gibberellins. and also water. The dyes that may be present in the seed coating formulations that can be used according to the invention include all the usual dyes for that purpose. In this context it is not only possible to use pigments, which are of low water solubility, but also water-soluble dyes. Examples thereof include the dyes known under the designations Rhodamine B, C.l. Red Pigment 112 and C.l. Solvent Red 1. Humectants that may be present in the seed coating formulations that can be used in accordance with the invention include all substances that promote wetting and are common in the formulation of agrochemical active ingredients. Preferably alkylnaphthalenesulfonates may be used, such as diisopropyl or diisobutylnaphthalenesulfonates. Dispersants and / or emulsifiers that may be present in the seed coating formulations that can be used according to the invention include all nonionic, anionic and cationic dispersants that are common in the formulation of agrochemical active ingredients. Nonionic or anionic dispersants or mixtures of nonionic or anionic dispersants can preferably be used. Suitable nonionic dispersants are, in particular, ethylene oxide-propylene oxide block polymers, alkylphenol polyglycol ethers and also tristyrylphenol polyglycol ethers and the phosphated or sulfated derivatives thereof. Suitable anionic dispersants are, in particular, lignosulfonates, polyacrylic acid salts and arylsulfonate-formaldehyde condensates. Antifoams that may be present in seed coating formulations that can be used in accordance with the invention include all foam inhibitors that are common in the formulation of agrochemical active ingredients. Preferably silicone antifoams and magnesium stearate can be used. QfrRLnn / Lznz / E / Yii Preservatives that may be present in seed coating formulations that may be used in accordance with the invention include all substances that may be used for that purpose in agrochemical compositions. Examples include dichlorophene and benzyl alcohol hemiformal. Secondary thickeners that may be present in seed coating formulations that may be used in accordance with the invention include all substances that may be used for that purpose in agrochemical compositions. Those which are preferably contemplated include cellulose derivatives, acrylic acid derivatives, xanthan, modified clays and highly dispersible silicon. Adhesives that may be present in seed coating formulations that may be used in accordance with the invention include all of the usual binders that may be used in seed coating products. Polyvinylpyrrolidone, polyvinyl acetate, polyvinyl alcohol and tylose are especially preferred. Gibberellins that may be present in the seed coating formulations that can be used according to the invention preferably include the gibberellins Α1, A3 (= gibberellic acid), A4 and A7, with gibberellic acid being used with particular preference. Gibberellins are known (see, R. Wegler, "Chemie der Pflanzenschutz- und Schádlingsbekámpfungsmittel", Volume 2, Springer Verlag, 1970, pages 401-412). Seed coating formulations that can be used in accordance with the invention can be used, either directly or after dilution with water, to treat seeds of any of a wide variety of types. Therefore, the concentrates or the preparations that can be obtained from them by dilution with water can be used to coat the seeds of cereals, such as wheat, barley, rye, oats and triticale, and also the seeds of maize, rice, oilseed rape, peas, beans, cotton, sunflowers and beets, or else the seeds of any of a very wide variety of vegetables. Seed coating formulations that can be used in accordance with the invention, or diluted preparations thereof, can also be used to coat seeds of transgenic plants. In that case, additional synergistic effects can be produced by interaction with the substances formed by expression. For the treatment of seeds with the seed coating formulations that can be used according to the invention, or with the preparations produced therefrom by adding water, suitable mixing equipment includes all the equipment that can typically be employed. for seed coating. More particularly, the procedure for performing the seed coating consists of placing the seeds in a blender, adding the particular desired quantity of the seed coating formulations, either as such or after pre-dilution with water, and mixing. QfrRLnn / Lznz / E / Yii until the distribution of the formulation on the seeds is uniform. This can be followed by a drying operation. The application rate of the seed coating formulations that can be used according to the invention can vary within a relatively wide range. It is indicated by the particular amount of the biological control agent based on the exosporium-producing recombinant member of the Bacillus cereus family and said at least one particular insecticide disclosed herein in the formulations, and by the seeds. The application rates in the case of the composition are generally between 0.001 and 50 g per kilogram of seeds, preferably between 0.01 and 15 g per kilogram of seeds. The compositions according to the invention, in the case that they exhibit insecticidal and miticidal and / or nematocidal activity, in combination with a good plant tolerance and a favorable toxicity for warm-blooded animals and a good environmental tolerance, are suitable for the protection of plants and plant organs, to increase harvest yields, to improve the quality of the harvested material and for the control of animal pests, in particular insects, mites, arachnids, helminths, nematodes and molluscs, which They are found in agriculture, horticulture, animal husbandry, forestry, gardens and recreational facilities, the protection of stored products and materials, and in the hygiene sector. They can preferably be used as plant protection agents. In particular, the present invention relates to the use of the composition according to the invention as an insecticide and / or a fungicide. They are active against normally sensitive and resistant species and against all or some stages of development. Previously mentioned pests include: pests of the phylum Arthropoda, in particular of the class Arachnida, e.g. Acarus spp., Acería sheldoni, Aculops spp., Aculus spp., Amblyomma spp., Amphitetranychus viennensis, Argas spp., Boophilus spp., Brevipalpus spp., Bryobia graminum, Bryobia praetiosa, Centruroides spp., Chorioptes spp., Dermanyssus gallinae, Dermatophagoides pteronyssinus, Dermatophagoides farinae, Dermacentor spp., Eotetranychus spp., Epitrimerus pyri, Eutetranychus spp., Eriophyes spp., Glycyphagus heppapest and destructormites domesticus. , Hyalomma spp. Ixodes spp. Latrodectus spp. Loxosceles spp. Psoroptes spp., Rhipicephalus spp., Rhizoglyphus spp., Sarcoptes spp., Scorpio maurus, Steneotarsonemus spp., Steneotarsonemus spinki, Tarsonemus spp., Tetranychus spp., Trombicula alfreddugesi, Vaejovis spp., Vasates lycopersici; in particular the clover mite, brown mite, hazelnut spider mite, asparagus spider mite, wheat brown mite, legume mite, yam mite, boxwood mite, Texas citrus mite, eastern red mite, red mite Citrus, European red mite, yellow spider mite, fig spider mite, Lewis spider mite, six-spotted spider mite, Willamette mite, Yuma spider mite, spinner mite, pineapple mite, citrus green mite, spider mite crown of christ spider, red tea spider mite, southern red mite, brown avocado mite, spruce spider mite, red avocado mite, Banks grass mite, carmine spider mite, desert spider mite, spider mite Spider Mite, Swollen Spider Mite, Strawberry Spider Mite, Double-mottled Spider Mite, McDaniel Mite, Pacific Spider Mite, Chinese Hawthorn Spider Mite, Four-mottled Spider Mite, Schoenei Spider Mite, Chilean False Spider Mite, Citrus Flat Mite, privet mite, scarlet flat mite, white-tailed mite, pineapple tarsonemid mite, West Indian sugarcane mite, gladiolus mite, cyclamen mite, broad mite, winter grain mite, winter grain mite red-legged ground, large-sprouted hazel mite, grapevine vine mite, pear leaf blister mite, apple leafroller mite, peach mosaic vector mite, alder ball callus mite, red-legged ground mite Penan walnut leaf callus, pecan leafroller mite, fig bud mite, olive bud mite, citrus bud mite, lychee erineous mite, wheat leaf roll mite, flower mite and coconut, sugarcane blister mite, buffalo grass mite, bermuda grass mite, carrot shoot mite, sweet potato leaf callus mite, pomegranate leafroll mite, ash callus, maple callus mite, alder erene mite, red berry mite, cotton blister mite, cranberry bud mite, pink tea rust mite, tea stripe mite, mite citrus gray, sweet potato rust mite, buckeye rust mite, citrus rust mite, apple rust mite, grapevine rust mite, pear rust mite , flat pine needle needle mite, wild rose bud and fruit mite, berry mite, mango rust mite, azalea rust mite, plum rust mite, silvery rust mite peach, apple rust mite, tomato browning mite, citrus rose rust mite, cereal rust mite, rice rust mite; from the class Chilopoda, for example, Geophilus spp., Scutigera spp.; of the order or class Collembola, for example, Onychiurus armatus; from the class Diplopoda, for example, Blaniulus guttulatus; from the class Insecta, for example, from the order Blattodea, for example Blattella asahinai, Blattella germanica, Blatta orientalis, Leucophaea maderae, Pandora spp., Parcoblatta spp., Periplaneta spp., Supella longipalpa; from the order Coleoptera, for example, Acalymma vittatum, Acanthoscelides obtectus, Adoretus spp., Agelastica alni, Agriotes spp., Alphitobius diapennus, Amphimallon solstitialis, Anobium punctatum, Anoplophora spp., Anthonomus spp., Anthrenus spp., Apion spp., Apogonia spp., Atomaña spp., Attagenus spp., Bruchidius obtectus, Bruchus spp., Cassida spp., απκ iηη / ιzoz / e / yl Cerotoma trifurcata, Ceutorrhynchus spp., Chaetocnema spp., Cleonus mendicus, Conoderus spp., Cosmopolites spp., Costelytra zealandica, Ctenicera spp., Curculio spp., Cryptolestes ferrugineus, Cryptorhynchus lapathi, Cylindrocopturus spp., Diamestes spp., Dermestes spp. , Díchocrocis spp., Dicladispa armigera, Diloboderus spp., Epilachnas spp., Epitrix spp., Faustinus spp., Gibbium psylloides, Gnathocerus cornutus, Hellula undalis, Heteronychus arator, Heteronyx spp., Hylamorpha elegans, Hylotrupes bajulus, Hyperas posticas, Hyperas posticas Hypothenemus spp., Lachnosterna consanguínea, Lasioderma serricorne, Latheticus oryzae, Lathridius spp., Lema spp., Leptinotarsa decemlineata, Leucoptera spp., Lissorhoptrus oryzophilus, Lixus spp., Luperodes spp., Lyctus spp., Megascelis spp., Melanotus spp. , Meligethes aeneus, Melolontha spp., Migdolus spp., Monochamus spp., Naupactus xanthographus, Necrobia spp., Niptus hololeucus, Oryctes rhinoceros, Oryzaephilus surinamensis, Oryzaphagus oryzae, Otiorrhynchus spp., Oxycetonia jucunda, Phaedonphalloyphalloyaria cochle. helleri, Phyllotreta spp., Popillia japonica, Premnotrypes spp., Prostephanus truncatus, Psylliodes spp., Ptinus spp., Rhizobius ventralis, Rhizopertha dominica, Sitophilus spp., Sitophilus oryzae, Sphenophorus spp., Stegobium paniceum, Sternechus spp., Symphyletes spp. ., Tanymecus spp., Tenebrio molitor, Tenebrioides mauretanicus, Tribolium spp., Trogoderma spp., Tychius spp., Xylotrechus spp., Zabrus spp.; preferably banded cucumber beetle (Diabrotica balteata), northern corn rootworm (Diabrotica barberi), southern corn rootworm (Diabrotica undecimpunctata howardi), western cucumber beetle (Diabrotica undecimpunctata tenella ), the western spotted cucumber beetle (Diabrotica undecimpunctata undecimpunctata), the western corn rootworm (Diabrotica virgifera virgifera), the Mexican corn rootworm (Diabrotica virgifera zeae) of the order Diptera, for example, Aedes spp., Agromyza spp., Anastrepha spp., Anopheles spp., Asphondylia spp., Bactrocera spp., Bibio hortulanus, Calliphora erythrocephala, Calliphora vicina, Ceratitis capitata, Chironomus spp., Chrysomyia spp., Chrysops spp., Chrysozona pluvialis , Cochliomyia spp., Contarinia spp., Cordylobia anthropophaga, Cricotopus sylvestrís, Culex spp., Culicoides spp., Culiseta spp., Cuterebra spp., Dacus oleae, Dasyneura spp., Delía spp., Dermatobia hominis, Drosophila spp., Echinocnemus spp., Fannia spp., Gasterophílus spp., Glossina spp., Haematopota spp., Hydrellia spp., Hydrellia griseola, Hylemya spp., Hippobosca spp., Hypoderma spp., Liriomyza spp., Lucilia spp., Lutzomyia spp., Mansonia spp. Musca spp. Oestrus spp. ., Sarcophaga spp., Simulium spp., Stomoxys spp., Tabanus spp., Tetanops spp., Típula spp.; from the order Heteroptera, for example, Anasa tristis, Antestíopsis spp., Boíseas spp., Blissus qhr i nn / ι znz / e / YL spp., Calocoris spp., Campylomma livida, Cavelerius spp., Cimex spp., Collaria spp., Creontiades dilutus, Dasynus piperis, Dichelops furcatus, Diconocoris hewetti, Dysdercus spp., Euschistus spp., Eurygaster spp., Heliopeltis spp., Hordas nobilellus, Leptocorisa spp., Leptocorisa varicornis, Leptoglossus phyllopus, Lygus spp., Macropes excavatus, Miridae, Monalonion atratum, Nezara spp., Oebalus spp., Pentomidae, Piesma quadrata, Piezodorus spp., Psallus spp., Pseudacysta persea, Rhodnius spp., Sahlbergella singularis, Scaptocoris castanea, Scotinophora spp., Stephanitis nashi, Tibraca spp., Triatoma spp. .; from the order Homoptera, for example, Acizzia acaciaebaileyanae, Acizzia dodonaeae, Acizzia uncatoides, Acrida turrita, Acyrthosipon spp., Acrogonia spp., Aeneolamia spp., Agonoscena spp., Aleyrodes proletella, Aleurolobus barodensis, Aleurothrixus floccosus, Allocaridara malayensis, Amorasca spp. , Anuraphis cardui, Aonidiella spp., Aphanostigma piri, Aphis spp., Arboridia apicalis, Arytainilla spp., Aspidiella spp., Aspidiotus spp., Atanus spp., Aulacorthum solani, Bemisia tabaci, Blastopsylla occidentalis, Boreioglycaspis melaleucae, Brachyuscaudus helichry spp. Brevicoryne brassicae Cacopsylla spp. spp., Cryptomyzus ribis, Cryptoneossa spp., Ctenarytaina spp., Dalbulus spp., Dialeurodes citri, Diaphorina citri, Diaspis spp., Drosicha spp., Dysaphis spp., Dysmicoccus spp., Empoasca spp., Eriosoma spp., Erythroneura spp. ., Eucalyptolyma spp., Euphyllura spp., Euscelis bilobatus, Ferrisia spp., Geococcus coffeae, Glycaspis spp., Heteropsylla cubana, Heteropsylla spinulosa, Homalodisca coagúlala, Hyalopterus arundinis, Icerya spp., Idiocerus spp., Idioscopus striateluphax spp. , Lecanium spp., Lepidosaphes spp., Lipaphis erysimi, Macrosiphum spp., Macrosteles facifrons, Mahanarva spp., Melanaphis sacchari, Metcalfiella spp., Metopolophium dirhodum, Monellia costalis, Monelliopsis pecanis, Myzus spp., Nasonovia ribittinigri, Neppote, Nettigoniclla spectra, Nilaparvata lugens, Oncometopia spp., Orthezia praelonga, Oxya chinensis, Pachypsylla spp., Parabemisia myricae, Paratrioza spp., Parlatoria spp., Pemphigus spp., Peregrinus maidis, Phenacoccus spp., Phloeomyzus passerinii, Phroyllo humulixeras. , Pinnaspis aspidistrae, Planococcus spp., Prosopidopsyllaflava, Protopulvinaria pyriformis, Pseudaulacaspis pentagona, Pseudococcus spp., Psyllopsis spp., Psylla spp., Pteromalus spp., Pyrilla spp., Quadraspidiotus spp., Quesada gigas, Rastrococcus spp. , Saissetia spp., Scaphoideus titanus, Schizaphis graminum, Selenaspidus articulatus, Sogata spp., Sogatella furcifera, Sogatodes spp., Stictocephala festina, Siphoninus phillyreae, Tenalaphara malayensis, Tetragonocephela spp., Tinocallis caryaefoliae, Tomaspis spp., Toxoptera spp., Toxoptera spp. vaporariorum, Trioza spp., Typhlocyba spp., Unaspis spp., Viteus vitifolii, Zygina spp.; from the order Hymenoptera, for example, Acromyrmex spp., Athalia spp., qhr ι ηη / ι 7n7 / E / YL Atta spp., Diprion spp., Hoplocampa spp., Lasius spp., Monomorium pharaonis, Sirex spp., Solenopsis invicta, Tapinoma spp., Urocerus spp., Vespa spp., Xeris spp.; from the order Isopoda, for example, Armadillidium vulgare, Oniscus asellus, Porcellio scaber; from the order Isoptera, for example, Coptotermes spp., Cornitermes cumulaos, Cryptotermes spp., Incisitermes spp., Microtermes obesi, Odontotermes spp., Reticulitermes spp.; from the order Lepidoptera, for example, Achroia grisella, Acronicta major, Adoxophyes spp., Aedia leucomelas, Agrotis spp., Alabama spp., Amyelois transitella, Anarsia spp., Anticarsia spp., Argyroploce spp., Barathra brassicae, Borbo cinnara, Bucculatrix thurberiella, Bupalus piniarius, Busseola spp., Cacoecia spp., Caloptilia theivora, Capua reticulana, Carpocapsa pomonella, Carposina niponensis, Cheimatobia brumata, Chilo spp., Choritoneura spp., Clysia ambiguella, Cnaphalocerus spp., Cnaphalocrocis medinalis, Cnephasia spp., Conopomorpha spp., Conotrachelus spp., Copitarsia spp., Cydia spp., Dalaca noctuides, Diaphania spp., Diatraea saccharalis, Barias spp., Ecdytolopha aurantium, Elasmopalpus lignosellus, Eldana saccharina, Ephestia spp., Epinotia spp., Epiphyas postvittana, Etiella spp., Eulia spp., Eupoecilia ambiguella, Euproctis spp., Euxoa spp., Feltia spp., Galleria mellonella, Gracillaria spp., Grapholitha spp., Hedylepta spp., Helicoverpa spp., Heliothis spp., Hofmannophila pseudospretella, Homoeosoma spp., Homona spp., Hyponomeuta padella, Kakivoria flavofasciata, Laphygma spp., Laspeyresia molesta, Leucinodes orbonalis, Leucoptera spp., Lithocolletis spp., Lithophane antennata, Lobesias spp., Loxagrotis albicosta, Lymantrias spp., Lyonetia spp., Malacosoma neustria, Ling testulalis, Mamstra brassicae, Melanitis leda, Mocis spp., Monopis obviella, Mythimna separata, Nemapogon cloacellus, Nymphula spp., Oiketicus spp., Oria spp., Orthaga spp., Ostrinia spp., Oulema oryzae, Panolis flammea, Parnara spp. ., Pectinophora spp., Perileucoptera spp., Phthorimaea spp., Phyllocnistis citrella, Phyllonorycter spp., Pieris spp., Platynota stultana, Plodia interpunctella, Plusias spp., Plutella xylostella, Prays spp., Prodenia spp., Protoparce spp., Pseudaletia spp., Pseudaletia unipuncta, Pseudoplusia includens, Pyrausta nubilalis, Rachiplusia nu, Schoenobius spp., Scirpophaga spp., Scirpophaga innotata, Scotia segetum, Sesamia spp., Sesamia inferens, Sparganothis spp., Spodoptera spp., Spodoptera praefica, Stathmopoda spp. , Stomopteryx subsecivella, Synanthedon spp., Tecla solanivora, Thermesia gemmatalis, Tinea cloacella, Tinea pellionella, Tineola bisselliella, Tortrix spp., Trichophaga tapetzella, Trichoplusia spp., Tryporyza incertulas, Tuta absoluta, Virachola spp.; from the order Orthoptera or Saltatoria, for example, Acheta domesticus, Dichroplus spp., Gryllotalpa spp., Hieroglyphus spp., Locusta spp., Melanoplus spp., Schistocerca gregaria; from the order Phthiraptera, for example, Damalinia spp., Haematopinus spp., Linognathus spp., Pediculus spp., Ptirus pubis, Trichodectes spp.; from the order Psocoptera, for example, Lepinatus spp., Liposcelis spp.; from the order Sifonaptera, for example, Ceratophyllus spp., Ctenocephalides spp., Pulex irritans, Tunga penetrans, Xenopsylla cheopsis; of the order Tisanoptera, for example, Anaphothrips obscurus, Baliothrips biformis, Drepanothrips reuteri, Enneothrips flavens, Frankliniella spp., Heliothrips spp., Hercinothrips femoralis, Rhipiphorothrips cruentatus, Scirtothrips spp., Taeniothrips cardamomi, Thrips spp.; from the order Zigentoma (= Tisanura), for example Ctenolepismas spp., Lepisma saccharina, Lepismodes inquilinus, Thermobia domestica; from the class Simfila, for example, Scutigerella spp.; pests of the phylum Mollusca, in particular of the class Bivalvia, eg Dreissena spp., and of the class Gastropoda, eg Arion spp., Biomphalaria spp., Bulinus spp., Deroceras spp., Galba spp., Lymnaea spp. ., Oncomelania spp., Pomacea spp., Succinea spp.; animal pests of the Plathelminthes and Nematoda phyla, for example, Ancylostoma duodenale, Ancylostoma ceylanicum, Acylostoma braziliensis, Ancylostoma spp., Ascaris spp., Brugia malayi, Brugia timori, Bunostomum spp., Chabertia spp., Clonorchis spp., Cooperia spp. , Dicrocoelium spp., Dictyocaulus filarla, Diphyllobothrium latum, Dracunculus medinensis, Echinococcus granulosas, Echinococcus multilocularis, Enterobius vermicularis, Faciola spp., Haemonchus spp., Heterakis spp., Hymenolepis nana, Hyostrongulus spp., Loa Loa, Nematodirus spp. spp., Opisthorchis spp., Onchocerca volvulus, Ostertagia spp., Paragonimus spp., Schistosomen spp., Strongyloides fuelleborni, Strongyloides stercoralis, Stronyloides spp., Taenia saginata, Taenia solium, Trichinella spiralis, Trichinella nativa, Trichinella britovi, Trichinella nelsoni, Trichinella pseudopsiralis, Trichostrongulus spp., Trichuris trichuria, Wuchereria bancrofti; plant parasitic pests of the phylum Nematoda, e.g. Aphelenchoides spp., Bursaphelenchus spp., Ditylenchus spp., Globodera spp., Heterodera spp., Longidorus spp., Meloidogyne spp., Pratylenchus spp., Radopholus spp., Trichodorus spp., Tylenchulus spp., Xiphinema spp., Helicotylenchus spp., Tylenchorhynchus spp., Scutellonema spp., Paratrichodorus spp., Meloinema spp., Paraphelenchus spp., Aglenchus spp., Belonolaimus spp., Nacobbus spp., Rotylenchulus spp., Rotylenchus spp. , Neotylenchus spp., Paraphelenchus spp., Dolichodorus spp., Hoplolaimus spp., Punctodera spp., Criconemella spp., Quinisulcius spp., Hemicycliophora spp., Anguina spp., Subanguina spp., Hemicriconemoides spp., Psilenchus spp., Pseudohalenchus spp., Criconemoides spp., Cacopaurus spp., Hirschmaniella spp., Tetylenchus spp.. The fact that the composition is well tolerated by plants at the concentrations necessary to control diseases and pests in plants allows the treatment of the aerial parts of the plants, of the rhizomes of propagation and seeds, and of the soil. According to the invention, all plants and parts of plants can be treated. The term plants refers to all plants and plant populations such as desirable and undesirable wild plants, cultivars, and plant varieties (whether or not they may be protected by plant breeders' or plant varieties' rights). Plant cultivars and varieties may be plants obtained by conventional breeding and propagation methods which may be assisted or supplemented by one or more qhr i nn / ι zoz / e / yl biotechnological methods such as the use of double haploids, protoplast fusion, random and directed mutagenesis, molecular or genetic markers or by bioengineering or genetic engineering methods. The term plant parts refers to all above-ground and underground parts and organs of plants such as shoots, leaves, flowers, and roots, including, for example, leaves, needles, stems, branches, flowers, fruiting bodies, fruits, and seeds, as well as roots, underground stems, and rhizomes. Crops and vegetative and generative propagation material, eg cuttings, underground stems, rhizomes, stolons and seeds are also considered to be plant parts. The composition of the invention, when well tolerated by plants, has favorable homeothermal toxicity and is well tolerated by the environment, is suitable for the protection of plants and plant organs, to improve crop yields, to improve the quality of harvested material. Preferably it can be used as a crop protection composition. It is active against normally sensitive and resistant species and against all or some stages of development. Plants that can be treated in accordance with the invention include the following important crop plants: corn, soybean, alfalfa, cotton, sunflower, Brassica oilseeds such as Brassica napus (eg, canola, rapeseed), Brassica rapa, B júncea (eg mustard (field)) and Brassica carinata, Arecaceae sp. (e.g. oil palm, coconut), rice, wheat, sugar beet, sugar cane, oats, rye, barley, millet and sorghum, triticale, flax, walnuts, grapes and vines and various fruits and vegetables from various botanical taxa, for example Rosaceae sp. (eg fleshy fruits such as apples and pears, but also stone fruits such as apricots, cherries, almonds, plums, and peaches, and berry fruits such as strawberries, raspberries, cranberries, blackberries, and currants), Ribesioidae sp. , Juglandaceae sp., Betulaceae sp., Anacardiaceae sp., Fagaceae sp., Moraceae sp., Oleaceae sp. (eg olive tree), Actinidaceae sp., Lauraceae sp. (eg avocado, cinnamon, camphor), Musaceae sp. (for example, banana trees and plantations), Rubiaceae sp. (eg coffee), Theaceae sp. (eg tea), Sterculiceae sp., Rutaceae sp. (for example, lemons, oranges, tangerines and grapefruits); Solanaceae sp. (eg tomatoes, potatoes, peppers, bell peppers, eggplant, tobacco), Liliaceae sp., Compositae sp. (eg lettuce, artichokes and chicory - including chicory root, endive or radicchio), Umbelliferae sp. (eg carrots, parsley, celery and celeriac), Cucurbitaceae sp. (eg cucumbers - including gherkins, squash, watermelon, squash, and melons), Alliaceae sp. (eg leeks and onions), Cruciferae sp. (eg, white cabbage, red cabbage, broccoli, cauliflower, Brussels sprouts, pak choi, kohlrabi cabbage, radishes, horseradish, watercress, and bok choi), Leguminosae sp. (eg peanuts, peas, lentils and lima beans - eg broad beans and lima beans), Chenopodiaceae sp. (eg Swiss chard, fodder beet, spinach, beetroot), Linaceae sp. (eg hemp), Cannabeaceasp. (eg cannabis), Malvaceae sp. (eg okra, cocoa), Papaveraceae (eg poppy), Asparagaceae (eg asparagus); useful plants and ornamental garden and woody plants including grass, turf, grass and Stevia rebaudiana; and in each case the genetically modified types of these plants. Depending on the plant species or plant cultivars, their location and growth conditions (soils, climate, vegetation period, diet), the use or employment of the composition according to the present invention in the treatment according to the The invention can also result in superadditive ("synergistic") effects. Thus, for example, the use or use of the composition of the invention in the treatment according to the invention allows reduced application doses and / or a broadening of the spectrum of activity and / or an increase in activity with better growth. of the plant, greater tolerance to high or low temperatures, greater tolerance to drought or water or salt content of the soil, better flowering performance, easier harvest, accelerated maturation, higher harvest yields, larger fruits, greater height of the plants, greener color of the leaves, earlier flowering, higher quality and / or greater nutritional value of the harvested products, higher concentration of sugars in the fruits, greater storage stability and / or greater processability of the harvested products, which exceed the really expected effects. At certain application rates, the composition of the invention in the treatment according to the invention can also have a strengthening effect on plants. The plant's defense system is mobilized against attacks by phytopathogenic fungi and / or unwanted microorganisms and / or viruses. Substances that strengthen plants (resistance inducers), in the present context, refer to those substances or combinations of substances that have the ability to stimulate the defense system of plants in such a way that, when subsequently inoculated with phytopathogenic fungi and / or unwanted microorganisms and / or viruses, the treated plants present a substantial degree of resistance to these phytopathogenic fungi and / or microorganisms and / or viruses. Therefore, with the use or employment of the composition according to the present invention in the treatment according to the invention, it is possible to protect the plants against attacks by the above-mentioned pathogens within a certain period of time after the treatment. The time period of the protection is generally between 1 and 10 days, preferably between 1 and 7 days, after treatment of the plants with the active compounds. Plants and plant cultivars that can also preferably be treated according to the invention are resistant against one or more types of biotic stress, i.e. said plants present a better defense against animal and microbial pests, such as QfrRLnn / Lznz / E / Yii against nematodes, insects, mites, phytopathogenic fungi, bacteria, viruses and / or viroids. Plants and plant cultivars that can also be treated according to the invention are those plants that are resistant to one or more types of abiotic stress, that is to say, that already present an improved state of plant health with respect to the stress tolerance. Abiotic stress conditions may include, for example, drought, exposure to cold temperatures, exposure to heat, osmotic stress, flooding, increased soil salinity, increased mineral exposure, ozone exposure, high light exposure, limited nutrient availability. with nitrogen, limited availability of nutrients with phosphorus, avoidance of shade. Preferably, treatment of these plants and cultivars with the composition of the present invention further increases the overall health status of the plant (see above). Plants and plant cultivars that can also be treated according to the invention are those plants characterized by having improved performance characteristics, ie they already have a better state of health with respect to this trait. Increased yield in such plants may be the result, for example, of improved plant physiology, growth and development, such as water use efficiency, water retention efficiency, improved nitrogen use, improved carbon assimilation, improved photosynthesis, higher germination efficiency and accelerated ripening. Yield can be further affected by improved plant architecture (under stressed and non-stressed conditions) including, but not limited to, early flowering, flowering control for hybrid seed production, seedling vigor , plant size, number and distance of intermodes, root growth, seed size, fruit size, pod size, number of pods or ears, number of seeds per pod or ear, seed mass, filler improved seed resistance, reduced seed dispersal, reduced pod dehiscence and resistance to lodging. Other performance traits include seed composition, such as carbohydrate content, protein content, oil content and composition, nutritional value, reduction of anti-nutritional compounds, improved processability, and increased storage stability. Preferably, treatment of these plants and cultivars with the composition of the present invention further increases the overall health status of the plant (see above). The plants that can be treated in accordance with the invention are hybrid plants that already express the trait of heterosis or hybrid vigor which generally results in increased yield, vigour, health and resistance to biotic and abiotic stress factors. Such plants are typically obtained by crossing a sterile male inbred parent line (the female parent) with another fertile male inbred parent line (the male parent). Typically, hybrid seeds are harvested from the sterile male plants and marketed to growers. Male-sterile plants can sometimes be produced (for example, in the case of maize) by emasculation, that is, the mechanical removal of the male reproductive organs (or male flowers), but more typically, male sterility is the result of determinants. genes in the plant genome. In such a case, and especially when seed is the desired product to be harvested from the hybrid plants, it is typically useful to ensure a complete restoration of male fertility in the hybrid plants. This can be achieved by ensuring that the male parents contain the appropriate fertility restoration genes that are capable of restoring male fertility in hybrid plants that contain the genetic determinants responsible for male sterility. The genetic determinants of male sterility can localize in the cytoplasm. Examples of cytoplasmic male sterility (CMS) have been described, for example, in Brassica species. However, the genetic determinants of male sterility can also be located in the nuclear genome. Male sterile plants can also be obtained by methods of plant biotechnology, such as genetic engineering. A particularly useful means of obtaining male sterile plants is described in WO 89 / 10396, where, for example, a ribonuclease such as barnase is selectively expressed in tapetal cells in the stamens. Fertility can then be restored by expression in the tapetal cells of a ribonuclease inhibitor, such as barstar. Plants or plant cultivars (obtained by methods of plant biotechnology, such as genetic engineering) that can be treated according to the invention are herbicide-tolerant plants, ie plants that have been rendered tolerant to one or more given herbicides. Said plants can be obtained by genetic transformation or by selection of plants containing a mutation that imparts said tolerance to herbicides. EXAMPLES Example 1: Formula for the efficacy of the combination of multiple active ingredients There is a synergistic effect of the active ingredients when the activity of the combinations of active ingredients exceeds the total of the activities of the active ingredients when applied individually. The expected activity for a given combination of two active ingredients can be calculated as follows (see, Colby, S.R., Calculating Synergistic and Antagonistic Responses of Herbicide Combinations”, Weeds 1967, 15, 20-22): Yeah: X is the efficacy when active ingredient A is applied at an application rate of m ppm (or g / ha), Yes the efficacy when active ingredient B is applied at an application rate of n ppm (or g / ha), QfrRLnn / Lznz / E / Yii E is the efficacy when active ingredients A and B are applied at application rates of m and n ppm (or g / ha), respectively, and then If the actual activity exceeds the calculated value, then the activity of the combination is superadditive, ie there is a synergistic effect. In this case, the actual observed efficacy must be greater than the expected efficacy (E) value calculated with the aforementioned formula. For example, the formula and analysis can be applied to evaluate plant growth promotion. Said assay is evaluated for several days after the applications to the plants. 100% means that the weight of the plants corresponds to that of the untreated control plant. In this case the efficacy refers to the additional % weight of the plants compared to that of the untreated control. For example, a treatment that resulted in a plant weight that was 120% compared to the untreated control plant would have an efficacy of 20%. If the plant growth promotion effect for the combination (i.e., the efficacy observed for % shoot weights of plants treated with the combination) exceeds the calculated value, then the activity of the combination is superadditive, i.e. , there is a synergistic effect. The formula and analysis can also be used to assess synergy in disease control trials. The degree of efficacy, expressed as a %, is indicated. 0% means efficacy corresponding to the control while 100% efficacy means no disease is observed. If the actual insecticidal or fungicidal activity exceeds the calculated value, then the activity of the combination is superadditive, ie there is a synergistic effect. In this case, the actual observed efficacy must be greater than the expected efficacy (E) value calculated with the aforementioned formula. An additional way of demonstrating a synergistic effect is the Tammes method (see, "Isoboles, A Graphic Representation of Synergism in Pesticides," in Neth. J. Plant Path., 1964, 70, 73-80). Example 2: Plant growth promotion with flupyradifurone and recombinant Bacillus thuringiensis cells Experiments were conducted to test the efficacy of a combination of flupyradifurone and a fermentation product of recombinant Bacillus thuringiensis cells expressing a phospholipase C ("BEPC"). Corn seeds were grown in a sterile mixture of synthetic medium and sand in small 3-inch square pots on supports in a plant growth room at 25-28°C and 50% humidity for approximately 14 days. Two seeds were sown in each pot. At the time of sowing, the medium was soaked QfrRLnn / Lznz / E / Yii growth in each pot with the treatments described below. After 14 days, the whole plant biomass of the plants was measured. In the following table, UTO refers to an untreated control. "Calculated" refers to the expected effect that was calculated using the Colby equation described previously and "Efficacy" refers to the actual observed effect. The SIVANTO® product, containing flupyradifurone as active ingredient (17.09% flupyradifurone), was diluted in 50 ml of water and the diluted solution was used to soak the growth medium. The application rate shown below refers to the amount of the active ingredient (ie, flupyradifurone) applied to the growth medium. A recombinant member of the Bacillus cereus family (Bacillus thuringiensis BT013A) expressing a phospholipase C on its exosporium (BEPC) was generated in the following manner. To generate the plasmids for the expression of the fusion proteins in the members of the Bacillus cereus family, PCR fragments encoding the BclA promoter (SEQ ID NO: 85), a methionine start codon, and the amino acids 20-35 of BclA (SEQ ID NO: 1) followed by a six-alanine linker sequence fused in-frame with the Bacillus thuringiensis BT013A phospholipase (SEQ ID NO: 108). These PCR fragments were digested with Xhol and then ligated into the Sali site of the pSUPER plasmid to generate the pSUPER-BclA 20-35-phospholipase plasmids. Plasmid pSUPER was generated by fusing plasmid pUC57 (containing an ampicillin resistance cassette) with Bacillus plasmid pBC16-1 (containing tetracycline resistance). This 5.5 kbp plasmid can replicate in both E. coli and Bacillus spp. The pSUPER-BclA 20-35-Phospholipase plasmids were transformed and propagated in E. coli methylase negative dam strains and finally transformed into Bacillus thuringiensis BT013A. To obtain BEPC complete broth cultures, 15 mL conical flasks containing Brain Heart Infusion (BHI) medium were inoculated with BEPC and cultured for 7-8 hours at approximately 30°C with a shaker setting of 300 rpm. The following day, 250 μΙ aliquots from each flask were inoculated into 250 ml flasks containing 50 ml yeast extract-based medium and cultured at approximately 30°C. After approximately 2 days of incubation, when sporulation was at least 95% complete, the culture broth was harvested and colony-forming units calculated. The fermentation broth was diluted to 5% in 50 ml of water and the following colony-forming units were applied to each pot. QfrRLnn / Lznz / E / Yii Table 3 Treatment Application rate Biomass of whole plants (g) % found % effective % calculated UTC 3.39 100 flupyradifurone 1.36 mg / pot 3.50 103 3 BEPC 5% 7 x 108 CFU / pot 3.83 113 13 flupyradifurone + BEPC 5% 1.36 mg / pot + 7 x 108 CFU / pot 4.15 122 22 15.61 QfrRLnn / Lznz / E / Yii The results indicate a superadditive performance effect of plants when flupyradifurone and BEPC are combined. Example 3: Promotion of plant growth with Clothianidino and recombinant cells of Bacillus thuringiensis Maize seeds will be grown in clayey sand in a greenhouse at 20 °C and 70% humidity for approximately 11 days. After approximately 11 days from the time of treatment the seedlings will be cut above the ground and the fresh weight will be determined. Recombinant Bacillus thuringiensis cells expressing an endoglucanase encoded by SEQ ID No.: 107 or a phospholipase C encoded by SEQ ID No.: 108 and which were prepared as previously described at approximately 50 pg / grain will be applied. Clothianidino will also be applied at approximately 250 pg / kernel. Maize plants treated with recombinant Bacillus thuringiensis in combination with Clothianidino are expected to have % shoot weights that exceed the calculated value based on % shoot weights of maize plants treated with the two active ingredients alone. , that is, a synergistic effect will be observed. NOVELTY OF THE INVENTION
Claims
Having described the present invention as above, the following claims are considered novel and therefore claimed as property. CLAIMS 1 A composition comprising: a) recombinant exospore-producing cells of Bacillus expressing a fusion protein comprising: (i) at least one protein or peptide selected from the group consisting of a plant growth-stimulating protein or peptide and a protein or peptide with insecticidal activity; and (ii) a targeting sequence, an exospore protein, or a fragment of an exospore protein;(yb) at least one insecticide selected from the group consisting of acetamipride, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, etiprol, ethoprophos, fenamiphos, fenobucarb, fenthion, fipronil, flubendiamide, fluopyram, flupyradifurone, formetanate, heptanophos, imidacloprid, methamidophos, methiocarb, methomyl, niclosamide, oxidemeton-methyl, phosalone, silafluofen, spirodiclofen, spiromesifen, spirotetramat, thiaclopride, thiodicarb, tralomethrin, triazophos, triflumuron, vamidotithion, 1-{2-fluoro-4-methyl-5-[(R)-(2,2,2-trif luoroethyl)sulf¡n¡l]phenyl}-3-(tr¡f luoromethyl)-1 H-1,2,4triazol-5-amine and 1 -(3-chlorop¡ridín-2-¡l)-N-[4-cyane-2-methyl-6-(methylcarbamoyl)phen¡l]-3-{[5(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1 H-pyrazole-5-carboxamide in a synergistically effective amount.; 2. The composition of claim 1, wherein said at least one protein or peptide is a plant growth stimulant and is selected from the group consisting of an enzyme involved in the production or activation of a plant growth stimulant compound and an enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source.
3. The composition of claim 1, wherein the Bacillus exospore-producing cells are cells of a member of the Bacillus cereus family. 4 - The composition according to claim 3, wherein the member of the Bacillus cereus family is selected from the group consisting of Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis and combinations thereof.
5. The composition according to any of claims 1 to 4, wherein the targeting sequence or the exosporium protein comprises: QfrRLnn / Lznz / E / Yii an amino acid sequence having at least approximately 43% identity with amino acids 20-35 of SEQ ID No. 1, wherein the identity with amino acids 25-35 is at least approximately 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID No. 1; a targeting sequence comprising amino acids 20-35 of SEQ ID No. 1; a targeting sequence comprising amino acids 22-31 of SEQ ID No. 1; a targeting sequence comprising amino acids 22-33 of SEQ ID No. 1; a targeting sequence comprising amino acids 20-31 of SEQ ID No. 1; a targeting sequence comprising SEQ ID No. 1;or a protein of the exosporium comprising an amino acid sequence that has at least 85% identity with SEQ ID No.: 2; 6. The composition according to any one of claims 2 to 5, wherein the enzyme involved in the production or activation of a plant growth-stimulating compound is selected from the group consisting of an acetoin reductase, an indole-3-acetamide hydrolase, a tryptophan monooxygenase, an acetolactate synthetase, an acetolactate decarboxylase, a pyruvate decarboxylase, a diacetyl reductase, a butanediol dehydrogenase, an aminotransferase, a tryptophan decarboxylase, an amino oxidase, an indole-3-pyruvate decarboxylase, an indole-3-acetaldehyde dehydrogenase, a tryptophan oxidase side chain, a nitrile hydrolase, a nitrylase, a peptidase, a protease, an adenosine phosphate isopentenyltransferase, a phosphatase, an adenosine kinase, an adenine phosphoribosyltransferase, CYP735A, a 5'-ribonucleotide phosphohydrolase, an adenosine nucleosidase, a zeatin cis-trans isomerase, a zeatin O-glucosyltransferase,a β-glucosidase, a cis-hydroxylase, a CK cis-hydroxylase, a CKN-glucosyltransferase, a 2,5-ribonucleotide phosphohydrolase, an adenosine nucleosidase, a purine nucleoside phosphorylase, a zeatin reductase, a hydroxylamine reductase, a 2-oxoglutarate dioxygenase, a gibberellic 2B / 3B hydrolase, a gibberellin 3-oxidase, a gibberellin 20-oxidase, a chitosinase, a chitinase, a β-1,3-glucanase, a β-1,4-glucanase, a β-1,6-glucanase, an aminocyclopropane-1-carboxylic acid deaminase, and an enzyme involved in the production of a nod factor.
7. The composition of claim 6, wherein the enzyme involved in the production or activation of a plant growth-stimulating compound is a QfrRLnn / Lznz / E / Yii chitosanase. 8.- The composition of claim 7, wherein the fusion protein comprises SEQ ID No.:
109.
9. The composition according to any one of claims 2 to 5, wherein the enzyme that degrades or modifies a bacterial, fungal, or plant nutrient source is selected from the group consisting of a cellulase, a lipase, a lignin oxidase, a protease, a glucoside hydrolase, a phosphatase, a nitrogenase, a nuclease, an amidase, a nitrate reductase, a nitrite reductase, an amylase, an ammonia oxidase, a ligninase, a glucosidase, a phospholipase, a phytase, a pectinase, a glucanase, a sulfatase, a urease, a xylanase, and a siderophore.
10. The composition of claim 9, wherein the enzyme is a cellulase selected from the group consisting of an endocellulase, an exocellulase and a βglucosidase.
11. The composition of claim 10, wherein the fusion protein comprises an endoglucanase from Bacillus subtilis. 12.- The composition of claim 11, wherein the fusion protein comprises SEQ ID No.:
107.
13. The composition of claim 12, wherein the recombinant Bacillus cells are derived from the BT013A strain of Bacillus thuringiensis. 14.- The composition of claim 9, wherein the enzyme is a phospholipase. 15.- The composition of claim 14, wherein the fusion protein comprises SEQ ID No.:
108.
16. The composition according to any one of claims 1 to 15, wherein the fusion protein is expressed under the control of a native sporulation promoter for the targeting sequence, an exospore protein, or an exospore protein fragment of the fusion protein.
17. The composition according to any one of claims 1 to 16, wherein the fusion protein is expressed under the control of a highly expressive sporulation promoter.
18. The composition of claim 17, wherein the high-expression sporulation promoter comprises a sequence of a sigma-K sporulation-specific polymerase promoter.
19. The composition according to any one of claims 16 to 18, wherein the sporulation promoter comprises a nucleic acid sequence having at least 80% identity with a nucleic acid sequence from any one of the SEQ ID No.: 85-103. QfrRLnn / Lznz / E / Yii 20. The composition according to any one of claims 1 to 19, wherein at least one insecticide is selected from the group consisting of clothianidin, cypermethrin, etiprol, fipronil, flupyradifurone and methiocarb.
21. The composition according to claim 20, wherein the insecticide is flupyradifurone. 22 - The composition according to any of claims 1 to 19, wherein the insecticide is clothianidin. 23.- A seed treated with the composition according to any one of claims 1 to 22. 24.- A use of the composition according to any of claims 1 to 23 for improving plant growth and / or promoting plant health. 25.- Use according to claim 24 for treating conventional or transgenic plants or seeds thereof.
26. A method for treating a plant, a part of a plant, or the locus surrounding the plant to enhance plant growth and / or promote plant health, comprising the step of applying, simultaneously or successively: a) recombinant exospore-producing cells of Bacillus expressing a fusion protein comprising: (i) at least one plant growth-stimulating protein or peptide; and (ii) a targeting sequence, an exospore protein, or a fragment of an exospore protein;(yb) at least one insecticide selected from the group consisting of acetamipride, aldicarb, amitraz, beta-cyfluthrin, carbaryl, clothianidin, cyfluthrin, cypermethrin, deltamethrin, endosulfan, ethion, etiprol, ethoprophos, fenamiphos, fenobucarb, fenthion, fipronil, flubendiamide, fluopyram, flupyradifurone, formetanate, heptanophos, imidacloprid, methamidophos, methiocarb, methomyl, niclosamide, oxidemeton-methyl, phosalone, silafluofen, spirodiclofen, spiromesifen, spirotetramat, thiaclopride, thiodicarb, tralomethrin, triazophos, triflumuron, vamidotithion, 1-{2-fluoro-4-methyl-5-[(R)-(2,2,2-trif luoroethyl)sulfinyl]phenyl}-3-(trifluoromethyl)-1 H-1,2,4triazol-5-amine and 1 -(3-chlorop¡ridín-2-¡l)-N-[4-cyano-2-methyl¡l-6-(methylcarbamo¡l)phen¡l]-3-{[5(trifluoromethyl)-2H-tetrazol-2-¡l]methyl}-1 H-pyrazole-5-carboxamide in a synergistically effective amount.; 27. The method according to claim 26, wherein the targeting sequence or the exospore protein comprises: an amino acid sequence having at least approximately 43% identity with amino acids 20-35 of SEQ ID No. 1, wherein the identity with amino acids 25-35 is at least approximately 54%; a targeting sequence comprising amino acids 1-35 of SEQ ID No. 1; a targeting sequence comprising amino acids 20-35 of SEQ ID No. 1; a targeting sequence comprising amino acids 22-31 of SEQ ID No. 1; a targeting sequence comprising amino acids 22-33 of SEQ ID No. 1; a targeting sequence comprising amino acids 20-31 of SEQ ID No. 1; an addressing sequence comprising SEQ ID No.: 1;or an exosporium protein comprising an amino acid sequence that has at least 85% identity with SEQ ID No. 2;