FOOT-AND-MOUTH DISEASE VACCINE
Patent Information
- Application Number
- MX2021015972
- Authority / Receiving Office
- MX · MX
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2015-01-16
- Filing Date
- 2017-07-14
- Publication Date
- 2026-06-12
- Estimated Expiration
- 2036-01-15
AI Technical Summary
Current foot-and-mouth disease (FMD) vaccines face challenges such as high antigen costs, difficulty in differentiating infected from vaccinated animals, lack of cross-protection between serotypes, and persistence of the virus leading to costly herd culling practices.
An immunogenic composition comprising a foot-and-mouth disease antigen with an adjuvant component containing an oil phase, immunostimulatory oligonucleotide, and polycationic polymer, which reduces the antigen dose required for effective immunity and minimizes virus persistence.
The composition provides effective protection against FMD with reduced antigen load, allowing differentiation between infected and vaccinated animals, and reduces the frequency of virus persistence, thereby minimizing herd culling and economic impact.
Abstract
Description
FOOT-AND-MOUTH DISEASE VACCINE BACKGROUND OF THE INVENTION Foot-and-mouth disease (FMD) is an extremely contagious viral disease of cloven-hoofed ungulates, including domesticated animals (cattle, pigs, sheep, goats, and others) and various wild animals. The most prominent symptoms of the disease in livestock infected with the FMD virus include vesicular lesions of the epithelium of the mouth, tongue, udders, and feet. Although some countries, including the United States, Canada, Mexico, Australia, and most of Europe, are considered FMD-free, the disease is distributed worldwide and has a significant economic impact on the export industry. In fact, several economically devastating outbreaks have occurred on almost every continent during the last decade. Currently, foot-and-mouth disease vaccines using killed antigen are necessarily produced in facilities with costly biological containment measures. This involves culturing large volumes (thousands of liters) of virulent foot-and-mouth disease virus adapted to grow in cells, which can sometimes present challenges. This procedure has resulted in the escape of virulent virus from the manufacturing facility, causing costly outbreaks in livestock (see Cottam et al. 2008. PLoS Pathogen 4:1-8). After culturing, the virus is inactivated using chemicals, and antigen concentrates are prepared, followed by purification steps to remove contaminating proteins. Differentiating infected from vaccinated animals (DAIV) using serological diagnostic tests is difficult.There is little to no cross-protection between serotypes and subtypes, requiring proper matching between the vaccine and circulating field strains to achieve protection. Despite these drawbacks of vaccines, billions of doses are manufactured every year worldwide. Their use has been the basis for eradicating foot-and-mouth disease in Europe and controlling the disease in many parts of the world through mass vaccination campaigns. Creating genetically modified viruses with appropriate structure and restriction sites partially addresses the drawbacks of inactivated vaccines, as the restriction sites provide entry points for capsid proteins from different foot-and-mouth disease strains. However, the cost of the antigen contributes significantly to the cost of the foot-and-mouth disease vaccine and most other vaccines. The problem of controlling foot-and-mouth disease is further complicated by the phenomenon of viral persistence. In short, historically, inactivated virus foot-and-mouth disease vaccines have been unable to prevent persistence or carrier status (defined as the shedding of the virus 28 days after infection and / or exposure). Carrier animals, even if they do not exhibit any symptoms of foot-and-mouth disease, may still be a source of infection for other animals. Thus, generally accepted disease control practices require the culling of all animals in a vaccinated herd, even if they do not show clinical signs of the disease. Therefore, procedures and compositions that lead to vaccines with a lower antigenic load that do not compromise efficacy and / or that reduce or eliminate the persistence of foot-and-mouth disease are still desired. BRIEF DESCRIPTION OF THE INVENTION In one aspect, the invention provides an immunogenic composition comprising an antigenic component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oil phase, wherein said oil phase comprises at least 50% v / v of said immunogenic composition, an immunostimulatory oligonucleotide and at least one of a polycationic polymer; an aluminum source; and the antigenic component comprises a foot-and-mouth disease antigenic composition in the amount equivalent to 0.5-8 pg of foot-and-mouth disease virus per dose. In certain embodiments, the immunostimulatory oligonucleotide is a CpG-containing oligonucleotide. In certain embodiments, the cationic polymer is DEAE dextran. In different embodiments, the antigen is a composition of the foot-and-mouth disease virus and is present in the amount of 0.5-4 pg per dose, or 0.5-2 pg per dose, or 0.5-1 pg per dose, or in the amount of approximately 0.5 pg per dose. The foot-and-mouth disease virus can be inactivated or attenuated. In certain embodiments, the foot-and-mouth disease virus is an inactivated A24 Cruzeiro strain of foot-and-mouth disease. In certain embodiments, the inactivated strain is a genetically engineered strain containing a deletion of the leader (LL) coding region and, optionally, negative antigenic markers. In certain embodiments, the genetically engineered virus contains capsid proteins from a heterologous strain. In another aspect, the invention provides a method for preventing foot-and-mouth disease in an animal that requires it, wherein the method comprises administering the immunogenic composition to said animal according to the embodiments of the preceding aspect. In different embodiments, the animal is selected from cattle, sheep, pigs, and goats. ML / a / zuz i / ui oy i ¿ In another aspect, the invention provides a method for reducing the frequency of persistent foot-and-mouth disease in a ruminant infected with foot-and-mouth disease, comprising administering to said ruminant prior to infection an immunogenic composition comprising an antigenic component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oil phase, wherein said oil phase comprises at least 50% v / v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 pg per dose and a polycationic polymer in the amount of 75-200 mg per dose; and the antigenic component comprises a foot-and-mouth disease antigen in the amount equivalent to 6-10 pg of the foot-and-mouth disease virus per dose. In another aspect, the invention provides a herd management procedure comprising administering to the animals in said herd an immunogenic composition comprising an antigenic component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, wherein said oily phase comprises at least 50% v / v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 mg per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigenic component comprises a foot-and-mouth disease antigen in the amount equivalent to 6-10 pg of the foot-and-mouth disease virus per dose, wherein, upon suspicion of contact with foot-and-mouth disease infection, the vaccinated members of the herd are not slaughtered. The invention also provides a herd management procedure, comprising administering to the animals in said herd an immunogenic composition comprising an antigenic component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oily phase, wherein said oily phase comprises at least 50% v / v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 pg per dose and a polycationic polymer in the amount of 75-200 mg per dose; and the antigenic component comprises a foot-and-mouth disease antigen in the amount equivalent to 6-10 pg of the foot-and-mouth disease virus per dose, wherein, upon suspicion of contact with foot-and-mouth disease infection, the vaccinated members of the herd are quarantined for 0-62 days. The invention also provides a herd management procedure, comprising administering to the animals in said herd an immunogenic composition comprising an antigenic component and an adjuvant component, wherein the adjuvant component comprises an emulsion containing an oil phase, wherein said oil phase comprises at least 50% v / v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 pg per dose, and a polycationic polymer in the amount ML / a / zuz i / ui oy i ¿ of 75 - 200 mg per dose; and the antigenic component comprises a foot-and-mouth disease antigen in the amount equivalent to 6 - 10 pg of the foot-and-mouth disease virus per dose, wherein, after suspicion of contact with foot-and-mouth disease infection, vaccinated members of the herd are quarantined for 0-62 days. BRIEF DESCRIPTION OF THE FIGURES Figure 1 illustrates the difference in quality between antigens precipitated in PEG and those concentrated in hollow fiber. DETAILED DESCRIPTION OF THE INVENTION Definitions Around or approximately, when used in relation to a mean numerical variable, refers to the stated value of the variable and all values of the variable that lie within the experimental error of the stated value (e.g., within the 95% confidence interval for the mean) or within 10 percent of the stated value, whichever is greater, unless it is used approximately in reference to time intervals in weeks, in which case approximately 3 weeks is 17 to 25 days, and approximately 2 to approximately 4 weeks is 10 to 40 days. An adjuvant is any substance that enhances the humoral or cellular immune response to an antigen. Adjuvants are generally used to achieve two objectives: the controlled release of antigens from the injection site and the stimulation of the immune system. An antibody refers to an immunoglobulin molecule that can bind to a specific antigen as a result of an immune response to that antigen. Immunoglobulins are serum proteins composed of light and heavy polypeptide chains that have constant and variable regions and are divided into classes (e.g., IgA, IgD, IgE, IgG, and IgM) based on the composition of their constant regions. An antigen or immunogen refers to any substance recognized by an animal's immune system that elicits an immune response. The term includes dead, inactivated, attenuated, or live modified viruses, parasites, or bacteria. The term antigen also includes polynucleotides, recombinant polypeptides, recombinant proteins, synthetic peptides, protein extracts, cells (including tumor cells), tissues, polysaccharides, or lipids, or fragments thereof, individually or in any combination. The term antigen also includes antibodies, such as anti-idiotype antibodies or fragments thereof, and synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope). A buffer is a chemical system that prevents changes in the concentration of another chemical substance. For example, proton donor and acceptor systems act as buffers by preventing significant changes in hydrogen ion concentration (pH). Another example of a buffer is a solution containing a mixture of a weak acid and its salt (conjugate base), or a weak base and its salt (conjugate acid). Essentially, as applied to adjuvant formulations, it refers to a formulation that does not contain additional adjuvant or immunomodulatory agents not mentioned in the amounts at which said agent exerts measurable adjuvant or immunomodulatory effects. Dose refers to a vaccine or immunogenic composition administered to a subject. A first dose or sensitization vaccine refers to the dose of that composition administered on day 0. A second dose, a third dose, or an annual dose refers to a quantity of that composition administered after the first dose, which may or may not be the same vaccine or immunogenic composition as the first dose. The term emulsifier is used broadly in this description. It includes substances generally accepted as emulsifiers, for example, different products from the TWEEN® or SPAN® product lines (fatty acid esters and polyethoxylated sorbitol and fatty acid-substituted sorbitan surfactants, respectively) and different solubility enhancers, such as PEG-40 castor oil or other PEGylated hydrogenated oil. Humoral immune response refers to one that is mediated by antibodies. An immune response in a subject refers to the development of a humoral immune response, a cellular immune response, or a humoral and cellular immune response to an antigen. Immune responses can typically be determined using standard immunoassays and neutralization assays, which are well-established techniques. An immunologically effective quantity, or effective quantity to produce an immune response, is an amount effective in inducing an immunogenic response in the recipient. The immunogenic response may be sufficient for diagnostic or other testing purposes, or it may be adequate to prevent the signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a pathogen. Both humoral and cell-mediated immunity can be induced.An animal's immunogenic response to an immunogenic compound can be assessed, for example, indirectly through antibody titer measurement, lymphocyte proliferation assays, or directly by monitoring signs and symptoms after exposure to the wild-type strain. Protective immunity conferred by a vaccine, on the other hand, can be assessed by measuring, for example, the reduction of clinical signs such as mortality, morbidity, fever, overall physical condition, and general health and functioning of the subject. The immune response may include, among other things, the induction of cellular and / or humoral immunity. Immunogenic means that it evokes an immune or antigenic response. Therefore, an immunogenic composition would be any composition that induces an immune response. Infected facilities refers to facilities where there is a possible positive case or a confirmed positive case based on laboratory results, compatible clinical signs, the foot-and-mouth disease case definition, and international standards. Infected zone refers to an area 3 km beyond the perimeters of infected, possible, or confirmed facilities. Lipids refers to any of a group of organic compounds, including fats, oils, waxes, sterols, and triglycerides that are insoluble in water but soluble in nonpolar organic solvents, are oily to the touch, and together with carbohydrates and proteins constitute the main structural material of living cells. Pharmaceutically acceptable refers to substances that, within the scope of acceptable medical judgment, are suitable for use in contact with the tissues of subjects without excessive toxicity, irritation, allergic response and the like, consistent with a reasonable benefit / risk ratio, and effective for their intended use. TSC50 refers to the tissue culture infectious dose and is defined as the dilution of a virus required to infect 50% of a given batch of inoculated cell cultures. Several procedures can be used to calculate the TSC50, including the Spearman-Karber method, which is used throughout this report. For a description of the Spearman-Karber method, see B.W. Mahy and H.O. Kangro, Virology Methods Manual, pp. 25–46 (1996). Persistently infected animals or carriers are animals that spread the foot-and-mouth disease virus 28 days after infection or the onset of clinical disease. Adjuvant formulations and manufacturing processes This application describes several adjuvant formulations suitable for the present invention. The common feature of these adjuvants is the presence of oil and one or more emulsifiers, wherein the oil phase comprises at least 50% of the vaccine composition encompassing the described adjuvant formulations. ML / a / zuz i / ui oy i ¿ Various oils and combinations thereof are suitable for use in the present invention. These oils include, but are not limited to, animal oils, vegetable oils, and non-metabolizable oils. Non-limiting examples of vegetable oils in the present invention are corn oil, peanut oil, soybean oil, coconut oil, and olive oil. A non-limiting example of an animal oil is squalene. Suitable non-limiting examples of non-metabolizable oils include light mineral oil, saturated linear or branched chain oils, and the like. In a number of embodiments, the oil used in the adjuvant formulations of the present invention is a light mineral oil. As used herein, the term mineral oil refers to a mixture of liquid hydrocarbons obtained from petrolatum by a distillation technique. The term is synonymous with liquefied paraffin, liquid petrolatum, and white mineral oil. The term is also intended to include light mineral oil, that is, oil obtained similarly by distillation of petrolatum, but having a relative density slightly lower than that of white mineral oil. See, for example, Remington's Pharmaceutical Sciences, 18th Edition (Easton, PA: Mack Publishing Company, 1990, pages 788 and 1323). Mineral oil can be obtained from various commercial sources, for example, T. Baker (Phillipsburg, PA) or USB Corporation (Cleveland, Ohio).The preferred mineral oil is light mineral oil, which is commercially available under the trade name DRAKEOL®. In certain embodiments particularly suitable for preventing or eliminating persistent foot-and-mouth disease, the oil phase is present in an amount of 50% to 95% by volume; preferably, in an amount greater than 50% to 85%; more preferably, in an amount greater than 50% to 60%; and most preferably, in an amount greater than 50-52% v / v of the vaccine composition. The oil phase includes oil and emulsifiers (e.g., SPAN® 80, TWEEN® 80, etc.), if any of these emulsifiers are present. The volume of the oil phase is calculated as the sum of the volumes of the oil and the soluble emulsifier(s). Thus, for example, if the volume of oil is 40% and the volume of the emulsifier(s) is 12% of a composition, the oil phase would be present at 52% v / v of the composition.Similarly, if the oil is present in the amount of approximately 45% and the emulsifier(s) are present in the amount of approximately 6% of a composition, the oil phase is present in approximately 51% v / v of the composition. It should also be understood that, since the adjuvants of the present invention only form a part of the vaccines of the present invention, the oil phase is present in an amount of 50% to 95% by volume; preferably, in an amount greater than 50% to 85%; more preferably, in an amount greater than 50% to 60%, and most preferably in the amount of 50-52% v / v of each of the adjuvants of the present invention. In a subset of embodiments, the combined volume percentage of the oil and the oil-soluble emulsifier is at least 50%, for example, from 50% to 95% by volume; preferably, from more than 50% to 85%; more preferably, from 50% to 60%; and most preferably, from 50% to 52% v / v of the vaccine composition. Therefore, for example, the oil may be present in an amount of 45%, and the lipid-soluble emulsifier would be present in an amount of more than 5% v / v. Thus, the combined volume percentage of the oil and the oil-soluble emulsifier would be at least 50%. In another subset, applicable to all vaccines of the invention, the percentage by volume of the oil is more than 40%, for example, from 40% to 90% by volume; from 40% to 85%; from 43% to 60%, 44-50% v / v of the vaccine composition. Suitable emulsifiers for use in the present emulsions include natural, biocompatible emulsifiers and non-natural, synthetic surfactants. Biocompatible emulsifiers include phospholipid compounds or a mixture of phospholipids. The preferred phospholipids are phosphatidylcholines (lecithin), such as soybean or egg lecithin. Lecithin can be obtained as a mixture of phosphatides and triglycerides by washing crude vegetable oils with water and separating and drying the resulting hydrated gums. A refined product can be obtained by fractionating the mixture for acetone-insoluble phospholipids and glycolipids remaining after the triglycerides and vegetable oil have been removed by washing with acetone. Alternatively, lecithin can be obtained from various commercial sources.Other suitable phospholipids include phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, phosphatidic acid, cardiolipin, and phosphatidylethanolamine. Phospholipids can be isolated from natural sources or synthesized conventionally. In further embodiments, the emulsifiers used herein do not include lecithin or use lecithin in an amount that is not immunologically effective. Suitable synthetic non-natural emulsifiers for use in the adjuvant formulations of the present invention include sorbitan-based nonionic surfactants, for example, fatty acid-substituted sorbitan surfactants (commercially available under the names SPAN® or ARLACEL®), polyethoxylated sorbitol fatty acid esters (TWEEN®), polyethylene glycol fatty acid esters from sources such as castor oil (EMULFOR®); polyethoxylated fatty acid (for example, stearic acid available under the name Simulsol M-53), polyethoxylated isooctylphenol / formaldehyde polymer (TYLOXAPOL®), polyoxyethylene fatty alcohol ethers (BRIJ®); polyoxyethylene nonphenyl ethers (TRITON® N), isooctylphenol polyoxyethylene ethers (TRITON® X).The preferred synthetic surfactants are those available under the names SPAN® and TWEEN®, such as TWEEN-80 (polyoxyethylene sorbitan monooleate (20)) and SPAN®-80 (sorbitan monooleate). In general terms, the emulsifier(s) may be present in the vaccine composition in an amount of 0.01% to 40% by volume, preferably 0.1% to 15%, with greater preference 2% to 10%. Additional ingredients present in the present adjuvant formulations include cationic vehicles, immunostimulatory oligonucleotides, monophospholipid A and analogues thereof (MPL-A), polyinosinic:polyvitidyl acid (poly I:C), saponins, quaternary ammonium compounds, sterols, glycolipids, a source of aluminum (e.g., REHYDRAGEL® or VAC 20® wet gel) and combinations thereof. Suitable cationic vehicles include, but are not limited to, dextran, DEAE dextran (and derivatives thereof), PEG, guar gum, chitosan derivatives, polycellulose derivatives such as hydroxyethylcellulose (HEC), polyethyleneimine, polyamines such as polylysine, and the like. Suitable immunostimulatory oligonucleotides include ODN (DNA-based), ORN (RNA-based), or chimeric ODNORN structures, which may have a modified backbone, including, but not limited to, phosphorothioate modifications, halogenations, alkylation (e.g., ethyl or methyl modifications), and phosphodiester modifications. In some embodiments, polyinosinic cytidylic acid or derivatives thereof (poly I:C) may be used. CpG oligonucleotides are a recently described class of pharmacotherapeutic agents characterized by the presence of an unmethylated CG dinucleotide within specific base sequence contexts (CpG motif). (Hansel TT, Barnes PJ (eds): New Drugs for Asthma, Allergy and COPD. Prog Respir Res. Basel, Karger, 2001, vol 31, pp 229-232, incorporated herein by reference). These CpG motifs are not found in eukaryotic DNA, where CG dinucleotides are suppressed and, when present, usually methylated, but they are present in bacterial DNA, to which they confer immunostimulatory properties. In certain embodiments, the adjuvants of the present invention utilize a so-called P-class immunostimulatory oligonucleotide, more preferably modified P-class immunostimulatory oligonucleotides, and even more preferably, E-modified P-class immunostimulatory oligonucleotides. P-class immunostimulatory oligonucleotides are CpG oligonucleotides characterized by the presence of palindromes, generally 6-20 nucleotides in length. P-class oligonucleotides have the ability to spontaneously self-assemble into concatameres, either in vitro and / or in vivo. These oligonucleotides are, strictly speaking, single-stranded, but the presence of palindromes allows the formation of concatameres or, possibly, stem-and-loop structures.The total length of P-class immunostimulatory oligonucleotides is between 19 and 100 nucleotides, for example, 19-30 nucleotides, 30-40 nucleotides, 40-50 nucleotides, 50-60 nucleotides, 60-70 nucleotides, 70-80 nucleotides, 80-90 nucleotides, 90-100 nucleotides. In one aspect of the invention, the immunostimulatory oligonucleotide contains a 5' TLR activation domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and connected to the 3' palindromic region of at least 8 nucleotides in length, either directly or through a spacer. Class P immunostimulatory oligonucleotides can be modified according to known techniques. For example, modification J refers to nucleotides modified with iodine. Modification E refers to nucleotide(s) modified with ethyl. Therefore, class P immunostimulatory oligonucleotides modified with E are class P immunostimulatory oligonucleotides in which at least one nucleotide (preferably the 5' nucleotide) is ethylated. Additional modifications include the addition of 6-nitrobenzimidazole, O-methylation, modification with proynyl-dU, modification with inosine, and the addition of 2-bromovinyl (preferably to uridine). Class P immunostimulatory oligonucleotides may also contain a modified internucleotide linkage that includes, among others, phosphodiester and phosphorothioate linkages. The oligonucleotides of the present invention may be synthesized or obtained from commercial sources. ΜΛ / a / zuz i / ui oy i ¿ The oligonucleótidos de class P and the oligonucleótides de class P modified are also described in the PCT solicitation published n° WO2008 / 068638, published on 12 June 2008. Ejemplos no limiting adecuados de los oligonucleótidos inmunoestimulantes de class P modidos se proportiona a continuación (* se refiere a un enlace phosphorotioato y se refiere a un enlace fosfodiéster). SEQ ID NO: 1 5' T*CG*T*CG*A*CG*A*T*CG*G*C*G*CG*C*G*C*C*G 3' SEQ ID NO: 2 5' T*CG*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G 3' SEQ ID NO: 3 5' T*C*G*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3' SEQ ID NO: 4 5' JU*CG*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G 3' SEQ ID NO: 5 5' JU*CG*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C* G*T 3' SEQ ID NO: 6 5' JU*C*G*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C* G*T 3' SEQ ID NO: 7 5' EU*CG*A*C*G*T*C*G*A*T*C*G*G*C*G*C*G*C*G*C*C*G 3' SEQ ID NO: 8 5' JU*CG*T*C*G*A*C*G*A*T*C*G*G*C*G*G*C*C*G*C*C* G*T 3' SEQ ID NO: 9 5' JU*C*G*T*C*G*A*C*G*A*T*C*G*G*C*G*G*C*C*G*C*C* G*T 3' SEQ ID NO: 10 5' T*CG*T*CG*A*CG*A*T*CG*G*C*G*CG*C*G*C*C*G 3' SEQ ID NO: 11 5'-UUGUUGUUGUUGUUGUUGUU-3' SEQ ID NO: 12 5'-UUAUUAUUAUUAUUAUUAUU-3' SEQ ID NO: 13 5'-AAACGCUCAGCCAAAGCAG-3' SEQ ID NO: 14 dTdCdGdTdCdGdTdTdTdTrGrUrUrGrUrGrUdTdTdTdT-3' The amount of P-class immunostimulatory oligonucleotide for use in adjuvant compositions depends on the nature of the P-class immunostimulatory oligonucleotide used and the intended species. In addition to the oil and the emulsifier(s), adjuvant formulations also comprise (or essentially consist of) a combination of an immunostimulatory oligonucleotide and a polycationic vehicle. These adjuvants are referred to as TXO. In some embodiments, TXO adjuvants may also include an aluminum source, such as Al(OH)3 gel. TXO adjuvants with aluminum are designated TXOA. In some embodiments, the TXO and TXO-A adjuvants may optionally contain a steral, such as cholesterol, lanosterol, sigmasterol, etc. TXO and TXO-A adjuvants containing the steral are designated TCXO and TCXO-A, respectively. The optionally present steral may be present in the amount of up to approximately 1,000 pg (e.g., 100–1,000 pg, 200–1,000 pg, 250–700 pg, or approximately 400–500 pg per dose). In one embodiment, in the TXO adjuvants, the immunostimulatory oligonucleotide, preferably an ODN, which preferably contains a palindromic sequence and optionally a modified scaffold, may be present in the amount of 5-400 pg per dose, and the polycationic vehicle may be present in the amount of 5-400 mg per dose. For example, in certain embodiments, a dose of TXO would comprise from approximately 5 to 400 pg per dose (e.g., 6.25-200 pg or 6.25-100 mg or 6.25-50 pg or 6.25-25 pg or 6.25-10 pg or 10-200 pg or 25-200 pg or 25-100 pg or 25-50 pg or 25-100 pg or 50-100 pg per dose) of the immunostimulatory oligonucleotide, and the polycationic vehicle may be present in the amount of from approximately 5 to approximately 500 mg per dose (e.g., 6.25-200 mg or 6.25-100 mg or 6.25-50 mg or 6.25-25 mg or 6.25-10 mg or 10-200 mg or 25-200 mg or 25-100 mg or 25-50 mg or 25-100 mg or 50-100 mg per dose). In certain embodiments, the TXO adjuvants are prepared as follows: a) Sorbitan monooleate is dissolved in light mineral oil. The resulting oily solution is sterilized by filtration. b) The immunostimulatory oligonucleotide, DEAE dextran and polyoxyethylene (20) sorbitan monooleate are dissolved in aqueous phase, thus forming the aqueous solution. c) The aqueous solution is added to the oily solution in continuous homogenization, thus forming the adjuvant formulation TXO. In one embodiment, in the TXO-A adjuvants, the immunostimulatory oligonucleotide is present in the TXO adjuvant, and the aluminum source is present in an amount of up to 40% v / v (e.g., 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%). In another embodiment, the aluminum source is present at 2%–20% v / v of the vaccine composition, more preferably between approximately 5% and approximately 17% v / v. In certain embodiments, TXO-A adjuvants are prepared similarly to TXO adjuvants and the aluminum source is added to the aqueous solution. In the preparation of the adjuvants TCXO and TCXO-A, cholesterol is dissolved in the oily solution and the other steps of preparing TCXO and TCXO-A are similar to the steps used in the preparation of TXO and TXO-A, respectively. Antigens The inventors have surprisingly discovered that the adjuvants of the present invention are capable of conferring sufficient protection against foot-and-mouth disease, even when the antigen dose is reduced from 10 pg of the foot-and-mouth disease virus to 0.5 pg. Therefore, in different embodiments of the invention, the amount of foot-and-mouth disease virus can be 0.5 pg, approximately 1 pg, approximately 2 pg, approximately 3 pg, approximately 4 pg, approximately 5 pg, approximately 6 pg, approximately 7 pg, approximately 8 pg, approximately 9 pg, or approximately 10 pg. The amount of antigen can be between 0.5 and 1 pg, between 1 and 2 pg, between 2 and 3 pg, between 3 and 4 pg, between 4 and 5 pg, between 5 and 6 pg, between 6 and 8 pg, between 8 and 10 pg or of the foot-and-mouth disease virus (140 S particles). Currently, seven serotypes of foot-and-mouth disease have been isolated. Of these seven serotypes, A, C, O, Asia 1, and SAT 3 appear to be distinct lineages; SAT 1 and SAT 2 are unresolved lineages. Within each serotype, there are multiple strains. For example, A24 Cruzeiro belongs to serotype A, and OI Campos belongs to serotype O. Foot-and-mouth disease virus of any serotype may be used as an antigen in the present invention, provided that such virus is not pathogenic. Pathogenicity may be reduced by inactivating the virus, for example, by treatment with formaldehyde or BEL. In certain embodiments, the virus can be attenuated by passes of MA / a / zuz i / ui oy i ¿ cultures or by recombinant means. It has previously been shown, for example, that deletion of the coding region of the Lproda leader protein results in foot-and-mouth disease virus in which it is attenuated in cattle and pigs. See, for example, US document 5,824,316, US document 8,765,141, Virology 1997 227(1): 96-102, J.Virol 2012 86:11675-11685. Point mutations at positions 55 and 58 within the L protein domain also resulted in a viable virus that showed a mild attenuated phenotype in cell culture and was protective in the swine foot-and-mouth disease model. See, for example, US patent No. 8,846,057. In certain embodiments, the virus also contains negative antigenic markers that allow for DAIV assays (differentiation between infected and vaccinated animals). In certain embodiments, the negative antigenic markers are introduced into the 3D and / or 3B proteins. See, for example, SEQ ID NO: 19, 20, 21, 22. Like other viruses, the foot-and-mouth disease virus is constantly evolving and mutating. Therefore, one of the challenges in vaccination against the virus is the enormous variation between serotypes and even within them. There is no cross-protection between serotypes (a vaccine for one serotype will not necessarily protect against any other), and, moreover, two strains within a given serotype can have nucleotide sequences that differ by up to 30% for a given gene. This means that foot-and-mouth disease vaccines must be highly specific to the strain involved. Therefore, in certain embodiments, sites for restriction endonucleases are introduced into the virus genome, thus allowing the introduction of proteins (e.g., proteins that form the outer capsids) from heterologous foot-and-mouth disease strains. In certain embodiments, the antigenic component comprises the A24 Cruzeiro foot-and-mouth disease strain, which may be optionally modified by deletion of the leader protein, negative marker mutations in proteins 3B and / or 3D, and by the introduction of restriction endonuclease sites for easier introduction of sequences for antigens (e.g., capsid proteins) from heterologous strains. Suitable non-limiting examples of the antigens are described in US patent 8,765,141. DNA sequences corresponding to the RNA genome of a genetically modified foot-and-mouth disease virus are also provided in SEQ ID NO: 15 (A?4LL3Dyr) and SEQ ID NO: 17 (A24LL3Bpvkv3Dyr).Therefore, a DNA sequence complementary to the DNA sequence exposed in, for example, SEQ ID NO: 15 is a template, i.e., it is complementary to or coding for, the RNA genome of the foot-and-mouth disease virus (i.e., the RNA that encodes the foot-and-mouth disease virus). In certain embodiments, the virus comprises capsid protein(s) from heterologous foot-and-mouth disease strains (i.e., foot-and-mouth disease strains other than A24 Cruzeiro, including, among others, strains from lineages C, O, Asia 1, SAT3, SAT 1 and SAT 2, Turkey 06, and other lineage A ligands). MA / a / zuz i / ui oy i ¿ Non-limiting examples of such heterologous antigens are illustrated in SEQ ID NO: 23 (AsialA?4LL3Bpvkv3Dyr) and SEQ ID NO: 24 (A / Turkey / 06-A24LL3BpvKv3DYR). Additionally, 01 camposA24LL3Bpvkv3Dyr (full genome, also referred to as Olcampos), C3 Indaial-A24LL3BpvKv3DYR (full genome), and capsid Argentina 2001 iso93 (capsid and partial 2A sequence) are provided in SEQ ID NO: 25, 26, and 27, respectively. Variants of these antigens also exist. Variants are at least 80% identical (e.g., 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to a reference sequence using one of the alignment programs described with standard parameters. Multiple alignment tools are available to determine sequence identity, including, but not limited to, BLAST, CLUSTAL, and PHILIP. A person of average skill will recognize that these values can be appropriately adjusted to determine the corresponding identity of proteins encoded by two nucleotide sequences, taking into account codon degeneracy, amino acid similarity, reading frame position, and the like. In certain embodiments, variants encompass more than just specific example nucleotide or amino acid sequences and include functional equivalents of these. Alterations in a nucleic acid fragment that result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. Thus, a codon for the hydrophobic amino acid alanine can be substituted with a codon encoding a less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes that result in the substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product.Nor would it be expected that nucleotide changes resulting in alterations to the N-terminal and C-terminal portions of the polypeptide molecule would alter the polypeptide's activity. Each of the proposed modifications is well within the scope of experience with the technique, as is the determination of the retention of biological activity of the encoded products. The polypeptides of the invention can also be altered in various ways, including substitutions, deletions, truncations, and insertions of amino acids. New proteins possessing properties of interest can be created by combining elements and protein fragments of the present invention, as well as with other proteins. The procedures for such manipulations are generally known in the art. Therefore, the genes and the MA / a / zuz i / ui oy i ¿ Nucleotide sequences of the invention include both naturally occurring sequences and mutant forms. Likewise, the proteins of the invention encompass naturally occurring proteins, as well as variations and modified forms thereof. Such variants shall retain the desired modified activities of the parental foot-and-mouth disease virus. The mutations made in the DNA encoding the variant shall not place the sequence out of the reading frame and, preferably, shall not create complementary regions that could produce a secondary mRNA structure. The procedures for culturing and purifying the antigens suitable for the present invention are well known in the art and include, among others, hollow fiber filtration and PEG precipitation. These procedures yield different antigenic compositions. For example, in PEG precipitation, the antigenic composition lacks nonstructural proteins. In other procedures, such as hollow fiber filtration, the antigenic composition contains both structural and nonstructural foot-and-mouth disease proteins. Accordingly, in some embodiments, the foot-and-mouth disease antigen comprises structural proteins. In other embodiments, such as when the foot-and-mouth disease antigen is prepared by hollow fiber filtration, the foot-and-mouth disease antigen comprises both structural and nonstructural proteins, in particular the 3D protein. Using current vaccine platforms, which lack antigenic markers to differentiate vaccinated from infected animals, it is advisable to remove non-structural proteins, as this remains desirable because the presence of antibodies against these proteins identifies infected animals. However, in the context of the FMDLL3B3D platform, the presence of non-structural proteins in the antigen preparation does not prevent differentiation between vaccinated and infected animals. It is in this context that the present antigen formulation, which includes non-structural proteins and an adjuvant, provides protection against clinical disease at lower doses than purified antigen formulations and also more effectively prevents the establishment of persistent infections in ruminants. Compositions The compositions of the present invention can be formulated following accepted consensus to include suitable vehicles for animals, including humans, such as standard buffers, stabilizers, diluents, preservatives, and / or solubilizers, and can also be formulated to facilitate sustained release. Diluents include water, saline solution, dextrose, ethanol, glycerol, and the like. Additives for isotonicity include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin, among others. Those skilled in the art are aware of, or these will be obvious to, other suitable vehicles and additives, including those particularly useful in the formulation of modified live vaccines. See, for example, Remington's Pharmaceutical Science, 18th ed., 1990, Mack Publishing, which is incorporated herein by reference. The compositions of the present invention may further comprise one or more immunomodulatory components such as, for example, an additional adjuvant or cytokine. Non-limiting examples of such additional adjuvants that may be used in the vaccine of the present invention include the RIBI adjuvant system (Ribi Inc., Hamilton, Mt.), Freund's complete or incomplete adjuvants, block copolymer (CytRx, Atlanta, Ga.), QS-21 (Cambridge Biotech Inc., Cambridge, Ms.), SAFM (Chiron, Emeryville, Calif.), AMPHIGEN® adjuvant, saponin, Quil A or another saponin fraction, monophosphoryl lipid A, and avridine-amine lipid adjuvant. Other immunomodulatory agents that may be included in the vaccine include, for example, one or more interleukins, interferons, or other known cytokines. Routes of administration for adjuvant compositions include parenteral, oral, oronasal, intranasal, intratracheal, topical, subcutaneous, intramuscular, transcutaneous, intradermal, intraperitoneal, intraocular, intravenous, and lingual. Any suitable device may be used to administer the compositions, including syringes, droppers, needle-free injection devices, patches, and similar devices. The route and device selected will depend on the adjuvant composition, the antigen, and the patient, and are well known to those skilled in the technique. Given the high infectivity of foot-and-mouth disease, the measures to contain and / or eliminate an outbreak are controlled by regulatory authorities, such as national ministries of agriculture, and sanctioned by international organizations such as the OIE (World Organisation for Animal Health). Outbreak measures may include, among others, halting animal movements, implementing effective controls on the movement of animal products, including milk, meat, hides, etc., and a culling policy (slaughtering animals from the affected herd and, if appropriate, those from other herds that have been exposed to the infection through direct animal-to-animal contact or indirect contact with the pathogen). Often, animals from neighboring herds are vaccinated and then culled. The inventors have surprisingly discovered that certain immunogenic compositions described herein prevent persistence, defined as the presence or spread of foot-and-mouth disease for more than 28 days after infection. In certain embodiments, these immunogenic compositions comprise an antigenic component and an adjuvant component, wherein the adjuvant component ML / a / zuz i / ui oy i ¿ comprises (or essentially consists of or consists of) an emulsion containing an oily phase, wherein said oily phase comprises at least 50% v / v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 pg per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigenic component comprises a foot-and-mouth disease antigen in the amount equivalent to at least 6 pg of foot-and-mouth disease virus per dose. In certain embodiments, the antigen may be present in an amount equivalent to 6-20 pg of foot-and-mouth disease virus per dose, for example, 8-20, 10-20, 12-20, 14-20, 16-20, 18-20, 6-10, 6-12, 6-18, 8-12, or 8-10 pg of foot-and-mouth disease virus per dose. The amount of immunostimulatory oligonucleotide may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175, or 125-150 pg per dose. The polycationic polymer may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose. Therefore, the invention also provides a method for reducing the frequency of persistence of foot-and-mouth disease in a ruminant infected with foot-and-mouth disease, comprising administering to said ruminant prior to infection immunogenic compositions comprising an antigenic component and an adjuvant component, wherein the adjuvant component comprises (or essentially consists of) an emulsion containing an oil phase, wherein said oil phase comprises at least 50% v / v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 pg per dose, and a polycationic polymer in the amount of 75-200 mg per dose; and the antigenic component comprises a foot-and-mouth disease antigen in the amount equivalent to at least 6 pg of the foot-and-mouth disease virus per dose. In different embodiments, the amount of antigen may be equivalent to 6-20 pg of foot-and-mouth disease virus per dose, for example, 8-20, 10-20, 12-20, 14-20, 16-20, 18-20, 6-10, 6-12, 6-18, 8-12, or 8-10 pg of foot-and-mouth disease virus per dose. The amount of immunostimulatory oligonucleotide may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175, or 125-150 pg per dose. The polycationic polymer may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose. Administering these immunogenic formulations to ruminants (e.g., cattle, sheep, camels, etc.) allows for changes in herd management practices. In certain implementations, vaccinated herd members are not slaughtered following suspected contact with the foot-and-mouth disease virus. In alternative (or additional) embodiments, vaccinated animals are quarantined for a shorter period. Therefore, in certain embodiments, animals suspected of having come into contact with foot-and-mouth disease may be quarantined for less than 30 days, for example, 28 or 29 days. Additionally, designating an area as a containment zone entails severe restrictions on the movement of animals or animal products from the containment zone, typically for 30 days or more. Therefore, in certain implementations, animals suspected of having come into contact with foot-and-mouth disease may be moved from the containment zone within 30 days, for example, 28 or 29 days from the suspected exposure. In embodiments where the antigenic component comprises a genetically modified foot-and-mouth disease antigen, for example, as described above, it is possible to differentiate vaccinated animals from infected ones. Therefore, in further embodiments, herd management procedures (or procedures for reducing the frequency of persistent foot-and-mouth disease in a ruminant infected with foot-and-mouth disease) can be implemented. In other words, immunogenic compositions, in certain embodiments comprising an antigenic component and an adjuvant component, may be used, wherein the adjuvant component comprises (or essentially consists of) an emulsion containing an oil phase, wherein said oil phase comprises at least 50% v / v of said immunogenic composition, an immunostimulatory oligonucleotide in the amount of 75-200 pg per dose; and the antigenic component comprises a foot-and-mouth disease antigen in the amount equivalent to at least 6 pg of foot-and-mouth disease virus per dose for herd management, wherein, upon suspicion of contact with foot-and-mouth disease virus infection, vaccinated members of said herd are not slaughtered; and / or are quarantined for 0-30 days after suspected contact and / or are moved away from infected premises within 30 days of suspected contact. In different embodiments, the amount of antigen may be equivalent to 6-20 pg of foot-and-mouth disease virus per dose, for example, 8-20, 10-20, 12-20, 14-20, 16-20, 18-20, 6-10, 6-12, 6-18, 8-12, or 8-10 pg of foot-and-mouth disease virus per dose. The amount of immunostimulatory oligonucleotide may be, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175, or 125-150 pg per dose. The polycationic polymer may be present in the amount of, for example, 75-100, 75-125, 75-150, 75-150, 100-200, 100-150, 125-200, 125-175 or 125-150 mg per dose. The invention will be further described in the following non-limiting examples. ML / a / zuz i / ui oy i ¿ EXAMPLES EXAMPLE 1 Antigen Preparation Two procedures were used to prepare the antigens: filtration in hollow fiber and precipitation in PEG. Precipitation procedures in PEG (polyethylene glycol) are well-established in the technique. In summary, BHK-21 cells were infected with foot-and-mouth disease virus. Afterward (24–36 h), the cells were lysed by freeze-thaw cycle, and the cell lysate was clarified of cellular debris by low-speed centrifugation (500 x g). PEG (8% w / v) was added to the supernatant, which contained both structural and non-structural proteins. The mixture was incubated for 12–18 hours at 4 °C. During this incubation, the foot-and-mouth disease virus particles associated with the PEG. The antigen was recovered by centrifugation at 16,000 x g, and the precipitated pellet containing PEG and virus was collected. The supernatant, containing cellular and viral non-structural proteins, was discarded. The sediment, to which the viral particles are attached, was then washed with small volumes of buffer to elute the foot-and-mouth disease particles from the PEG. An additional procedure described herein is based on the hollow fiber concentration of foot-and-mouth disease culture supernatants. The steps of this procedure consist of a series of filtration steps to first remove cell debris and large material from the cultures (BHK-21 cells infected with the foot-and-mouth disease virus and lysed by freeze-thaw). The culture material was pumped successively through a 10 µm capsule filter, a 4.5 µm capsule filter, and then finally through a 0.8 µm / 0.2 µm filter. This filtrate was then concentrated using a hollow fiber ultrafiltration cartridge that allows particles smaller than 0.01 µm to pass through the membrane. Foot-and-mouth disease particles and many non-structural proteins remain in the column circuit, while the smaller, liquid proteins pass through the membrane into the waste.The column circuit was run until the concentrate reached the desired volume, typically ten times the concentration. Figure 1 is a Western blot illustrating the difference in quality between antigens precipitated on PEG and concentrated on hollow fiber. The antigen concentrated on hollow fiber contains large amounts of both structural and non-structural proteins, as illustrated in this figure by Western blot staining using an antibody specific for the 3D protein, the larger non-structural proteins of foot-and-mouth disease, and an antibody specific for the capsid protein (structural protein). In contrast, the antigens precipitated on PEG (lane 9) contained structural protein but no detectable levels of the 3D protein. EXAMPLE 2 Effects of foot-and-mouth disease vaccines advuved with TXO Animals and sample collection In this study, Holstein steers six to eight months old, weighing 180–230 kg, were used. The animals lacked reactive antibodies against foot-and-mouth disease, as determined by the 3D ELISA assay before vaccination and subsequently from serum samples taken on day 0. The 28 animals were housed in a pen at a BSL-3-Ag animal testing facility. The animals received a full ration of feed or alfalfa cubes, with water and salt blocks available ad libitum. The animals were acclimated to the facility for five days prior to day 0. The animals were pretreated with Bovi-Shield GOLD® 5, Micotil® 300, Liquamycin® LA-200®, and Dectomax®. Each treatment group was assigned to groups of animals (n=4 each) with consecutively numbered ear tags. No adverse events were documented following vaccination. Blood tubes with serum separators were collected from all animals on days 0 (before vaccination), 4, 7, 14, 21 (before exposure), 24, 28, 31, and 42. Serum samples were kept frozen until analysis for the presence of neutralizing antibodies against foot-and-mouth disease virus in a serum neutralization assay (reported as the reciprocal of the last serum dilution to neutralize 100 TCIDs of homologous foot-and-mouth disease virus in 50% of the wells) or to study the anti-3Dpol response (by means of a competitive enzyme-linked immunosorbent assay). As recommended by the OIE (Manual of Diagnostic Tests and Vaccines for Terrestrial Animals), exposure of vaccinated cattle to determine vaccine efficacy was performed via intradermal lingual (IDL) needle inoculation. Twenty-one days after vaccination, all vaccinated and previously unexposed animals were inoculated via IDL with 10,000 DILB50 (50% infectious dose in the bovine tongue) of the A24 Cruzeiro strain of homologous foot-and-mouth disease virus, divided into four 0.1 ml inoculations of 2,500 DILB50 / 0.1 ml. All animals were monitored for 10 days post-exposure to assess the development of clinical disease, expressed as fever, nasal discharge, salivation, loss of appetite, and / or weakness. Clinical evaluation to determine the presence of vesicles in the hoof was performed under sedation (xylazine administered IM at 0.22 mg / kg to maintain sternal recumbency ML / a / zuz 1 / ui oy 1 ¿ throughout the procedure) on day 21 (before inoculation) and on days 24, 28 and 31. The sedative was reversed with tolazoline, iv, at a dose of 2 mg / kg. Vaccines The antigens were prepared as described in Example 1. The antigen stock solutions contained either 5.51 pg / ml of antigen prepared by hollow fiber filtration (Prep. A) or 10.26 pg / ml of antigen prepared by PEG precipitation (Prep. B). Details of the immunogenic compositions administered to the animals are provided in Table 1. Each group contained four animals. TABLE 1 Studio design Antigen Group Quantity / 5 ml Adjuvant / 5 ml Injected Volume, ml, im T01 None N / A PBS (negative control) 5 T02 Foot-and-mouth disease virus (Prep. B)-Peq ppt. 8 pg Light mineral oil SPAN®80 TWEEN®80 DEAE Dextran (100 mg); SEQ ID NO: 8; 75% purity: 100 pg 5 T03 Foot-and-mouth disease virus (Prep. B)-PEG ppt. 2 pg 1.25 T04 Foot-and-mouth disease virus (Prep. B)-Peg ppt. 0.5 pg 0.3125 T05 Foot-and-mouth disease virus (Prep. A) Hollow fiber filtrate. 8 pg 5 T06 Foot-and-mouth disease virus (Prep. A) Hollow fiber filtrate. 2 pg 1.25 T07 Foot-and-mouth disease virus (Prep. A) Filtration in hollow fiber. 0.5 pg 0.3125 The immunogenic compositions of groups T02 to T06 were homogenized on the day of vaccination and administered to the animals on day 0. Persistence was measured as the presence or absence of virus (foot-and-mouth disease virus RNA and / or infectious foot-and-mouth disease virus) determined using viral isolation or quantitative rRT-PCR. The primers used for quantitative rRT-PCR were as follows: Direct (SEQ ID NO: 28): GACAAAGGTTTTGTTCTTGGTCA Reverse (SEQ ID NO: 29): TGCGAGTCCTGCCACGGA TaqMan probe: (FAM indicator, TAMRA inactivator, SEQ ID NO: 30) TCCTTTGCACGCCG TGGGAC The neutralizing serum titers of the foot-and-mouth disease virus are summarized in the Table 2. MA / a / zuz i / ui o» TABLE 2 Neutralizing titers in serum Treatment Serum Neutralizing Titer Day 0 Day 21 Day 42 T01 0.45 a 0.45 a 2.62 ab T02 0.45 a 1.64c 2.84 b T03 0.45 a 0.90 b 2.39 ab T04 0.45 a 0.76 b 2.74 ab T05 0.45 a 1.55C 2.28 a T06 0.45 a 0.81 b 2.36 ab T07 0.45 a 0.54 a 2.68 ab ab-c Treatment groups with the same letter within each day are not significantly different at alpha=0.05. Signs of foot-and-mouth disease virus were scored as presence (1) or absence (0) of vesicles on the hoof, i.e., the presence of a vesicle on a single hoof produced a score of 1, the presence of vesicles on only 2 hooves produced a score of 2, and vesicles on all 4 hooves produced a score of 4. Once an animal had received a score of 4, it was considered to have a score of 4 during the study. The scores of individual animals for each hoof and for each day of examination are shown in Table 3. Table 4 presents a summary of the scores for each animal according to whether there were any positive hooves. TABLE 3 List of individual animals with foot-and-mouth disease virus vesicle scores Study Day 21 24 28 31 Location Location Location Location FRONT LEFT REAR LEFT FRONT RIGHT REAR RIGHT FRONT LEFT REAR LEFT FRONT RIGHT REAR RIGHT FRONT LEFT REAR LEFT FRONT RIGHT REAR RIGHT Tratamiento Animal T01 R14-84 0 0 0 0 0 1 0 1 1 1 1 1 1* 1* 1* 1* R14-85 0 0 0 0 1 1 1 1 1* 1* 1* 1* 1* 1* 1* 1* R14-86 0 0 0 0 0 1 0 0 1 1 1 1 1* 1* 1* 1* R14-87 0 0 0 0 1 1 1 1 1* 1* 1* 1* 1* 1* 1* 1* T02 R14-72 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-73 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-74 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-75 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T03 R14-76 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-77 0 0 0 0 0 1 0 0 0 1 0 0 0 1 0 0 R14-78 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-79 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T04 R14-80 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-81 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-82 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-83 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T05 R14-60 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-61 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-62 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-63 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 T06 R14-64 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-65 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-66 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-67 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00 T07 R14-68 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-69 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-70 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 R14-71 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 *Automatically scored as '1' since all hooves for this animal previously had vesicles on all four hooves. TABLE 4 Foot-and-mouth disease virus vesicle scoring - Any positive hoof location Study Day 21 24 28 31 Animal Treatment T01 R14-84 No Yes Yes Yes* R14-85 No Yes Yes* Yes* R14-86 No Yes Yes Yes* R14-87 No Yes Yes* Yes* T02 R14-72 No No No No R14-73 No No No No R14-74 No No No No R14-75 No No No No T03 R14-76 No No No No R14-77 No Yes Yes Yes R14-78 No No No No R14-79 No No No No T04 R14-80 No No No No R14-81 No No No No R14-82 No No No No R14-83 No No No No T05 R14-60 No No No No R14-61 No No No No R14-62 No No No No R14-63 No No No No T06 R14-64 No No No No R14-65 No No No No R14-66 No No No No R14-67 No No No No T07 R14-68 No No No No R14-69 No No No No R14-70 No No No No R14-71 No No No No ♦Automatically marked as Yes since all hooves for this animal previously had vesicles on all four hooves ML / a / zuz i / ui oy i ¿ All animals in T01 (negative control) exhibited hoof vesicles from day 24. On days 28 and 31, all hooves in all T01 animals were found to have vesicles. In contrast, complete protection (i.e., absence of hoof vesicles) was observed for each group except T03 (2 pg dose of foot-and-mouth disease virus precipitated with PEG), where one animal (R14-77) received a score of 1 on days 24, 28, and 31. The effects of the analyzed immunogenic compositions on persistent infection are illustrated in Tables 5 and 6. Persistence was defined as the presence of infectious virus or viral RNA in esophageal-pharyngeal fluid (obtained using a Probang cup) 28 days after exposure (day 49 post-vaccination, as shown in Tables 5 and 6).Table 5 shows the quantitative rRT-PCR results for individual animals and the back-transformed least squares means by treatment group of foot-and-mouth disease virus RNA copy number per mole from probang samples. In Table 6, the results of virus isolation assays from probang samples were reported as positive or negative. Values below 1.87 in Table 5 were scored as negative due to the assay's detection limit. TABLE 5 rRT-PCR Probana - List of individual animals vs back-transformed least squares means by treatment group Day 38 Day 42 Day 49 Day 52 Treatment Number Animal Trial Result Trial Result Trial Result Trial Result T01 R14-84 4.29 4.72 <1.87 3.83 T01 R14-85 4.26 6.01 5.14 4.7 T01 R14-86 <1.87 3.62 <1.87 <1.87 T01 R14-87 <1.87 <1.87 <1.87 <1.87 Group Mean 1.999 3.130 1.432 1.992 T02 R14-72 <1.87 <1.87 <1.87 <1.87 T02 R14-73 <1.87 <1.87 <1.87 <1.87 T02 R14-74 <1.87 <1.87 <1.87 <1.87 T02 R14-75 <1.87 <1.87 <1.87 <1.87 Group average 0.935 0.935 0.935 0.935 T03 R14-76 4.98 4.68 <1.87 <1.87 T03 R14-77 5.52 3.43 <1.87 <1.87 T03 R14-78 <1.87 4.35 <1.87 5.3 T03 R14-79 <1.87 <1.87 <1.87 <1.87 Group average 2.214 2.843 0.935 1.443 T04 R14-80 <1.87 <1.87 4.88 4.59 T04 R14-81 5.08 4.01 3.98 4.65 T04 R14-82 <1.87 4.47 6.12 4.32 T04 R14-83 <1.87 <1.87 <1.87 <1.87 3.047 Group mean 1.427 1.990 3.247 T05 R14-60 <1.87 <1.87 <1.87 <1.87 T05 R14-61 <1.87 <1.87 <1.87 <1.87 T05 R14-62 4.75 <1.87 <1.87 <1.87 T05 R14-63 <1.87 <1.87 <1.87 <1.87 Group mean 1.404 0.935 0.935 0.935 T06 R14-64 <1.87 <1.87 <1.87 <1.87 T06 R14-65 4.10 4.11 <1.87 3.39 T06 T06 R14-66 R14-67 <1.87 4.14 <1.87 5.08 <1.87 5.18 <1.87 4.82 Group average 1,963 2,067 1,434 1,944 T07 R14-68 <1.87 <1.87 <1.87 <1.87 T07 R14-69 <1.87 <1.87 <1.87 <1.87 T07 R14-70 <1.87 <1.87 <1.87 <1.87 T07 R14-71 5.34 5.46 4.49 3.7 Group average 1.445 1.453 1.384 1.319. TABLE 6 Virus isolation in the Probana sample - list of individual animals MA / a / zuz i / ui oy i ¿ Study Day 38 42 49 52 Animal Treatment T01 R14-84 Pos Pos Pos Pos R14-85 Pos Pos Pos Pos R14-86 Neg Neg Neg Neg R14-87 Neg Neg Neg Neg T02 R14-72 Neg Neg Neg Neg R14-73 Neg Neg Neg Neg R14-74 Neg Pos Neg Neg R14-75 Neg Neg Neg Neg T03 R14-76 Pos Pos Neg Pos R14-77 Pos Pos Neg Neg R14-78 Pos Pos Pos Pos R14-79 Neg Neg Neg Neg T04 R14-80 Pos Neg Pos Pos R14-81 Pos Pos Pos Pos R14-82 Pos Pos Pos Pos R14-83 Pos Pos Pos Pos T05 R14-60 Neg Neg Neg Neg R14-61 Neg Neg Neg Neg R14-62 Neg Neg Neg Neg R14-63 Neg Neg Neg Neg T06 R14-64 Neg Neg Neg Neg R14-65 Pos Pos Pos Pos R14-66 Neg Neg Neg Neg R14-67 Pos Pos Pos Pos T07 R14-68 Neg Neg Neg Neg R14-69 Neg Neg Neg Neg R14-70 Neg Neg Neg Neg R14-71 Pos Pos Pos Pos For group 1 (saline control), three animals were positive at least once for foot-and-mouth disease virus by rRT-PCR and two animals were always positive for virus isolation. In group T02, no animal was ever found to be a carrier of the foot-and-mouth disease virus by rRT-PCR, but one animal (R14-74) was observed to be positive by the virus isolation assay at a single point in time (Day 42: 21 days after exposure) but negative thereafter (Days 49 and 52, indicative of the absence of persistent infection). The other animals in T02 did not carry the foot-and-mouth disease virus detectable by rRT-PCR or by virus isolation assay on Day 38 and thereafter. In group T03, one animal (R14-79) was completely protected against foot-and-mouth disease virus infection, two animals showed the presence of foot-and-mouth disease virus (by rRT-PCR or by viral isolation assay) on three or four of the days of the test, and one animal (R14-77) showed the presence of foot-and-mouth disease virus by both assays on days 38 and 42, but not thereafter. In group T04, all four animals exhibited persistence of the foot-and-mouth disease virus by one or both trials until day 52. In group T05, one animal (R14-62) showed the presence of the virus only on day 38 by rRT-PCR but not by virus isolation, and the virus was not detected thereafter by any of the assays. Foot-and-mouth disease virus was not detected by either rRT-PCR or the viral isolation assay at any time for the other three animals in group T05. In group T06, two animals were completely protected from persistence, while the other two were positive by rRT-PCR or viral isolation assay at each time point examined. In group T07, three out of four animals were completely protected while one animal (R14-71) tested positive for rRT-PCR and virus isolation at each time point. Table 7 summarizes the results of the persistence experiments. Animals were considered non-persistent if the foot-and-mouth disease virus was not detected by either the rRT-PCR assay or the viral isolation assay on day 49 (28 days post-exposure) and day 52 (31 days post-exposure). ML / a / zuz i / ui oy i ¿ TABLE 7 Frequency of persistence vs. non-persistence Treatment % Persistent % Non-persistent T01 (saline solution) 50 50 T02 (foot-and-mouth disease virus PEG ppt - 8 pq) 0 100 T02 (foot-and-mouth disease virus PEG ppt - 2 pq) 50 50 T02 (foot-and-mouth disease virus PEG ppt - 0.5 pq) 100 0 T05 (foot-and-mouth disease virus in hollow fiber - 8 pq) 0 100 T05 (foot-and-mouth disease virus in hollow fiber - 2 pq) 50 50 T05 (foot-and-mouth disease virus in hollow fiber - 0.5 pq) 25 75 Only two of the eight animals administered 8 pg of antigen (groups T02 and T05) never showed any presence of the virus, and this was only for one day (one each on days 37 and 42). The other animals in these groups were completely protected. Considering that the presence of the virus was not detected on days 28 or 31 after the invention, none of the animals administered 8 pg of antigen were considered persistently infected. Five of the eight animals administered 2 pg of antigen (groups T03 and T06) exhibited viral persistence. Four of the eight animals administered 0.5 pg of antigen (groups T04 and T07) exhibited persistence. Taken together, these results indicate protection against viral persistence of the foot-and-mouth disease virus in animals administered 8 pg of antigen. It also appears that antigen purification by hollow fiber filtration is advantageous compared to PEG precipitation. The main difference between the two antigenic formulations is the presence of non-structural proteins in addition to the structural proteins in the hollow fiber filtration formulation. Therefore, without wishing to be bound to any particular theory, it seems that the quality of the immune response elicited by vaccines in which the antigen contains both structural and non-structural proteins, and in particular the 3D protein, is more effective in preventing the persistence of the foot-and-mouth disease virus, as illustrated in Table 8. TABLE 8 Effect of the antigen preparation procedure on the immune response Treatment % Persistent % Non-persistent T01 (saline solution) 50% (2 of 4) 50% (2 of 4) Prep. A (hollow fiber, groups T05-T07 combined) 25% (3 of 12) 75% (9 of 12) Prep. B (precipitation in PEG, groups T02-T04 combined) 50% (6 of 12) 50% (6 of 12) All publications cited in this specification, whether patent publications or non-patent publications, are indicative of the level of expertise of those skilled in the art to which the present invention belongs. All such publications are incorporated herein by reference to the same extent as if each individual publication were specifically and individually indicated as incorporated by reference. Although the present invention has been described with reference to particular embodiments, it should be understood that these embodiments are merely illustrative of the principles and applications of the present invention. Therefore, it should be understood that numerous modifications can be made to the illustrative embodiments and that other arrangements can be conceived without departing from the spirit and scope of the present invention as defined in the following claims.
Claims
1. The use of an immunogenic composition in the manufacture of a vaccine for herd management, wherein said composition comprises: a) an antigenic component comprising between 6 and 20 pg of the foot-and-mouth disease virus composition per dose; b) an emulsion containing an oil; c) 75-200 pg of an immunostimulatory oligonucleotide containing CpG per dose; d) 75-200 mg of a polycationic vehicle per dose, wherein the vaccine is adapted to be administered to each member of said herd, and wherein, furthermore, after suspicion of contact with foot-and-mouth disease infection, the vaccinated members of said herd are not slaughtered.
2. The use of an immunogenic composition in the manufacture of a vaccine for herd management, wherein said composition comprises: a) an antigenic component comprising between 6 and 20 pg of the foot-and-mouth disease virus composition per dose; b) an emulsion containing an oil; c) 75-200 pg of an immunostimulatory oligonucleotide containing CpG per dose; d) 75-200 mg of a polycationic vehicle per dose, wherein the vaccine is adapted to be administered to each member of said herd and wherein, additionally, after suspected contact with foot-and-mouth disease infection, vaccinated members of said herd are quarantined for 0-30 days.
3. The use of an immunogenic composition in the manufacture of a vaccine for herd management, wherein said composition comprises: a) an antigenic component comprising between 6 and 20 pg of the foot-and-mouth disease virus composition per dose; b) an emulsion containing an oil; c) 75-200 pg of an immunostimulatory oligonucleotide containing CpG per dose; d) 75-200 mg of a polycationic vehicle per dose, wherein the vaccine is adapted to be administered to each member of said herd and wherein, additionally, after suspected contact with foot-and-mouth disease infection, the vaccinated members of said herd are moved out of the infected premises.
4. Use as claimed in claim 1, wherein vaccinated members of the herd are not slaughtered and are quarantined for 0-30 days.
5. The use as claimed in any of claims 1 to 4, wherein said composition comprises 6-18 pg of the foot-and-mouth disease virus composition per dose.
6. The use as claimed in any of claims 1 to 4, wherein said composition comprises 6-12 pg of the foot-and-mouth disease virus composition per dose.
7. The use as claimed in any of claims 1 to 4, wherein said composition comprises 8-12 pg of the foot-and-mouth disease virus composition per dose.
8. The use as claimed in any of claims 1 to 4, wherein the polycationic polymer is diethylaminoethyl (DEAE) dextran.
9. The use as claimed in claim 8, wherein said composition comprises 6-18 pg of the foot-and-mouth disease virus composition per dose.
10. The use as claimed in claim 8, wherein said composition comprises 6-12 pg of the foot-and-mouth disease virus composition per dose.
11. The use as claimed in claim 8, wherein said composition comprises 8-12 pg of the foot-and-mouth disease virus composition per dose.
12. The use as claimed in claim 8, wherein the immunostimulatory oligonucleotide comprises CpG.
13. The use as claimed in claim 12, wherein the immunostimulatory oligonucleotide comprises at least 15 contiguous nucleotides of SEQ ID NO:
8.
14. The use as claimed in any of claims 1 to 4, wherein the oil is a light mineral oil.
15. The use as claimed in claim 14, wherein the oil phase comprises 50.01%-55% v / v of the composition.
16. The use as claimed in claim 14, wherein the polycationic polymer is diethylaminoethyl (DEAE) dextran.
17. The use as claimed in claim 16, wherein the immunostimulatory oligonucleotide comprises CpG.
18. The use as claimed in claim 17, wherein the immunostimulatory oligonucleotide comprises at least 15 contiguous nucleotides of SEQ ID NO:
8.
19. The use as claimed in claim 17, wherein said composition comprises 6-18 pg of the foot-and-mouth disease virus composition per dose.
20. The use as claimed in claim 17, wherein said composition comprises 6-12 pg of the foot-and-mouth disease virus composition per dose.
21. The use as claimed in claim 17, wherein said composition comprises 8-12 pg of the foot-and-mouth disease virus composition per dose.
22. An immunogenic composition for use in herd management, wherein said composition comprises: a) an antigenic component comprising between 6 and 20 pg of the foot-and-mouth disease virus composition per dose; b) an emulsion containing an oil; c) 75-200 pg of an immunostimulatory oligonucleotide containing CpG per dose; d) 75-200 mg of a polycationic vehicle per dose, wherein the immunogenic composition is adapted to be administered to each member of said herd, and wherein, additionally, after suspicion of contact with foot-and-mouth disease infection, the vaccinated members of said herd are not slaughtered.
23. An immunogenic composition for use in herd management, wherein said composition comprises: a) an antigenic component comprising between 6 and 20 pg of the foot-and-mouth disease virus composition per dose; b) an emulsion containing an oil; c) 75-200 pg of an immunostimulatory oligonucleotide containing CpG per dose; d) 75-200 mg of a polycationic vehicle per dose, wherein the immunogenic composition is adapted to be administered to each member of said herd and wherein, additionally, after suspected contact with foot-and-mouth disease infection, vaccinated members of said herd are quarantined for 0-30 days.
24. An immunogenic composition for use in herd management, wherein said composition comprises: a) an antigenic component comprising between 6 and 20 pg of the foot-and-mouth disease virus composition per dose; b) an emulsion containing an oil; c) 75-200 pg of an immunostimulatory oligonucleotide containing CpG per dose; d) 75-200 mg of a polycationic vehicle per dose, wherein the immunogenic composition is adapted to be administered to each member of said herd, and wherein, furthermore, after suspected contact with foot-and-mouth disease infection, vaccinated members of said herd are moved out of the infected premises.
25. The immunogenic composition for use in accordance with claim 22, wherein the vaccinated members of the herd are not slaughtered and are quarantined for 0-30 days.
26. The immunogenic composition for use in accordance with any of claims 22 to 25, wherein said composition comprises 6-18 pg of the foot-and-mouth disease virus composition per dose.
27. The immunogenic composition for use in accordance with any of claims 22 to 25, wherein said composition comprises 6-12 pg of the foot-and-mouth disease virus composition per dose.
28. The immunogenic composition for use in accordance with any of claims 22 to 25, wherein said composition comprises 8-12 pg of the foot-and-mouth disease virus composition per dose.
29. The immunogenic composition for use in accordance with any of claims 22 to 25, wherein the polycationic polymer is diethylaminoethyl (DEAE) dextran.
30. The immunogenic composition for use according to claim 29, wherein said composition comprises 6-18 pg of the foot-and-mouth disease virus composition per dose.
31. The immunogenic composition for use according to claim 29, wherein said composition comprises 6-12 pg of the foot-and-mouth disease virus composition per dose.
32. The immunogenic composition for use according to claim 29, wherein said composition comprises 8-12 pg of the foot-and-mouth disease virus composition per dose.
33. The immunogenic composition for use according to claim 29, wherein the immunostimulatory oligonucleotide comprises CpG.
34. The immunogenic composition for use in accordance with claim 33, wherein the immunostimulatory oligonucleotide comprises at least 15 contiguous nucleotides of SEQ ID NO:
8.
35. The immunogenic composition for use in accordance with any of claims 22 to 25, wherein the oil is a light mineral oil.
36. The immunogenic composition for use in accordance with claim 35, wherein the oily phase comprises 50.01%-55% v / v of the composition.
37. The immunogenic composition for use in accordance with claim 35, wherein the polycationic polymer is diethylaminoethyl (DEAE) dextran.
38. The immunogenic composition for use in accordance with claim 37, wherein the immunostimulatory oligonucleotide comprises CpG.
39. The immunogenic composition for use in accordance with claim 38, wherein the immunostimulatory oligonucleotide comprises at least 15 contiguous nucleotides of SEQ ID NO:
8.
40. The immunogenic composition for use in accordance with claim 38, wherein said composition comprises 6-18 pg of the foot-and-mouth disease virus composition per dose.
41. The immunogenic composition for use according to claim 38, wherein said composition comprises 6-12 pg of the foot-and-mouth disease virus composition per dose.
42. The immunogenic composition for use according to claim 38, wherein said composition comprises 8-12 pg of the ML / a / zuz i / ui oy i foot-and-mouth disease virus composition per dose.