IDENTIFICATION OF RESISTANCE GENES FROM WILD RELATIVES OF THE BANANA AND THEIR USES IN THE CONTROL OF PANAMA DISEASE

Abstract

The present invention relates to a nucleic acid construct, characterized in that it comprises a nucleic acid sequence encoding a peptide that confers resistance to Fusarium oxysporum race 4 when expressed in a banana plant, wherein said nucleic acid sequence is selected from the group consisting of a nucleic acid sequence having at least 97% sequence identity with SEQ ID NO: 9 and SEQ ID NO: 11, wherein nucleotide positions 148, 323, 344, and 347 of the nucleic acid sequence are G, A, C, and T, respectively, and wherein the nucleic acid sequence is operatively linked to a promoter capable of directing the expression of the nucleic acid sequence.

Description

IDENTIFICATION OF RESISTANCE GENES FROM WILD RELATIVES OF THE BANANA AND THEIR USES IN THE CONTROL OF PANAMA DISEASE CROSS REFERENCE TO RELATED REQUESTS This application claims the benefit of United States Provisional Patent Application no. 62 / 866,872, filed June 26, 2019, and United States Provisional Patent Application no. 62 / 912,010, filed on October 7, 2019, the full contents of which are incorporated herein by reference. FIELD OF THE INVENTION The present description generally refers to the field of agricultural industry, especially the production of consumer crops with resistance to pathogens. More particularly, the present description relates to compositions and methods for generating plants that possess traits resistant to fungal pathogens such as Fusarium fungi originating from the soil and / or that show resistance to diseases caused by said fungal pathogens. DESCRIPTION OF ELECTRONICALLY SENT TEXT FILE The sequence listing associated with this application is provided in text format rather than in hard copy. The contents of the attached electronically submitted text file are incorporated herein by reference in their entirety: a machine-readable copy of the sequence listing (file name: EVOL_009_02WO_SeqList_ST25.txt, registration date: May 28, 2020 , file size: » 26.9 kilobytes). BACKGROUND OF THE DESCRIPTION Bananas are one of the largest fruit crops in the world, totaling more than 100 million metric tons. Bananas are the most popular fruit in developed countries and are an important source of food and income for a large percentage of the world, providing food security in many tropical and subtropical nations. In fact, bananas are the fourth most important food crop in developing countries, where the vast majority of bananas are produced and consumed locally. The main producing countries are India, China, Ecuador, Brazil and some African countries. Approximately 15 percent of banana production is traded on the global market, generating approximately $8 billion annually. The main exporting countries are Ecuador, the Philippines, Costa Rica and Colombia. However, this important crop is now severely threatened by Fusarium wilt, also known as Panama disease, caused by the fungus Fusarium oxysporumt. sp. cover (Foc). Half of commercial banana cultivation worldwide and even up to 90% of banana exports in some countries consists of a single group of cultivars, the Cavendish genotypes, which are clonally propagated. Additionally, most marketed bananas and many locally consumed bananas are grown clonally with a single crop in a given area, known as monoculture. Monoculture has been widely practiced by farmers to mass produce highly in-demand crops such as banana, which is easily affected by a range of fungal, viral, bacterial and nematode diseases. Clearly, the current expansion of the Panama disease epidemic is particularly destructive due to the massive monoculture of susceptible Cavendish bananas. Cavendish bananas are the fruit of one of several banana cultivars belonging to the Cavendish subgroup of the AAA banana cultivar group. The same term is also used to describe the plants on which bananas grow. They include commercially important cultivars such as dwarf Cavendish (1888) and Grand Nain (the Chiquita banana). Williams is a giant Cavendish type cultivar in the Cavendish subgroup. It is one of the most widely grown cultivars in commercial plantations. Formosana is another name for the somaclonal variant GCTCV-218, which has some resistance to Fusarium wilt TR4. Other representative commercial cultivars include Masak Hijau and Robusta. Since the 1950s, these cultivars have been the most internationally traded bananas. They replaced the Gros Michel banana (commonly known as Kampala banana in Kenya and Bogoya in Uganda) after it was devastated by Panama disease. Therefore, there is an urgent need in the art for bananas that are resistant to Fusarium wilt or Panama disease. BRIEF DESCRIPTION OF THE INVENTION THE present description solves the aforementioned Panama disease problem by identifying the underlying genetic architecture that gives rise to resistance. Furthermore, the disclosure teaches a methodology by which this genetic architecture of resistance can be imported into disease-susceptible bananas and thus render these bananas resistant to the disease. The importation of this genetic architecture can take many forms, as detailed herein, including: traditional plant breeding, transgenic genetic manipulation, next generation plant breeding (CRISPR, base editing, MAS, etc.), and other methods. In some embodiments, as provided herein, nucleic acid molecules are isolated comprising the nucleic acid sequence SEQ ID NO: 14 that encodes susceptibility to Fusarium oxysporum race 4 when expressed in a plant, wherein SEQ ID NO: 14 is modified by one, two, three or four nucleic acid substitutions so that the resulting nucleic acid sequence encodes resistance to Fusarium oxysporum race 4 when expressed in a plant. In some embodiments, the isolated nucleic acid molecule includes nucleic acid substitutions comprising replacing aT corresponding to position 148 of SEQ ID NO: 14 with aG (148T>G). In some embodiments, the isolated nucleic acid molecule includes nucleic acid substitutions comprising replacing a T corresponding to position 323 of SEQ ID NO: 14 with an A (323T>A). In some embodiments, the isolated nucleic acid molecule includes nucleic acid substitutions comprising replacing a G corresponding to position 344 of SEQ ID NO: 14 with a C (344G>C). In some embodiments, the isolated nucleic acid molecule includes nucleic acid substitutions comprising replacing an A corresponding to position 347 of SEQ ID NO: 14 with a T (347A>T). In some embodiments, the isolated nucleic acid molecule includes nucleic acid substitutions comprising replacing a T corresponding to position 323 with an A (323T>A), replacing a G corresponding to position 344 with a C (344G>C) and replacing an A corresponding to position 347 with a T (347A>T), and wherein all positions are based on SEQ ID NO: 14. In some embodiments, the nucleic acid molecule isolated from SEQ ID NO: 14 encodes an amino acid sequence of SEQ ID NO: 15 and wherein nucleic acid substitutions result in the replacement of a leucine corresponding to position 50 of SEQ ID NO: 15 with a valine (50L>V). In some embodiments, the isolated nucleic acid molecule includes SEQ ID NO: 14 which encodes an amino acid sequence of SEQ ID NO: 15 and wherein nucleic acid substitutions result in the replacement of a valine corresponding to the position 108 of SEQ ID NO: 15 by a glutamic acid (108V>E). In some embodiments, the isolated nucleic acid includes a SEQ ID NO: 14 that encodes an amino acid sequence of SEQ ID NO: 15 and wherein the nucleic acid substitutions result in the replacement of an arginine corresponding to position 115 of the SEQ ID NO: 15 for a proline (115R>P). In some embodiments, the isolated nucleic acid molecule includes a SEQ ID NO: 14 that encodes an amino acid sequence of SEQ ID NO: 15 and wherein the nucleic acid substitutions result in the replacement of an aspartic acid corresponding to the position 116 of SEQ ID NO: 15 for a valine (116D>V). In some embodiments, the isolated nucleic acid molecule includes a SEQ ID NO: 14 that encodes an amino acid sequence of SEQ ID NO: 15 and wherein the nucleic acid substitutions result in the replacement of a valine corresponding to position 108 of SEQ ID NO: 15 by a glutamic acid (108V>E), an arginine corresponding to position 115 of SEQ ID NO: 15 by a proline (115R>P) and an aspartic acid corresponding to position 116 of the SEQ ID NO: 15 for a valine (116D>V). In some embodiments, expression occurs in a plant cell, plant tissue, plant cell culture, plant tissue culture, or whole plant. In some embodiments, expression occurs in a Musa cell, tissue, cell culture, tissue culture, or whole plant. In some embodiments, expression occurs in a cell, tissue, cell culture, tissue culture, or whole plant of Musa acu mi nata. In some embodiments, a nucleic acid construct comprises the nucleic acid sequences of the present invention that are operably linked to a promoter capable of directing expression of the nucleic acid sequence. In some embodiments, the promoter is a plant promoter. In some embodiments, the promoter is a 35S promoter. In some embodiments, the promoter is encoded by SEQ ID NO: 31. In some embodiments, a transformation vector comprises the nucleic acid constructs of the present invention. In some embodiments, provided herein is a method of transforming a plant cell comprising introducing the transformation vectors of the present invention into a plant cell, whereby the transformed plant cell expresses the nucleic acid sequence encoding the resistance. a Fusarium oxysporum race 4. In some embodiments, the method uses a plant cell that is a Musa plant cell. In some embodiments, the method uses a plant cell that is a Musa acuminata plant cell. In some embodiments, the transformed plant tissue is produced from the transformed plant cell. In some embodiments, a transformed seedling is produced from the transformed plant tissue. In some embodiments, a clone is produced from the transformed seedling. In some embodiments, the method comprises growing the transformed seedling or clone of the transformed seedling into a mature transformed plant. In some embodiments, the transformed mature plant is a Musa plant and the transformed mature Musa plant is capable of producing fruit. In some embodiments, the methods of the present invention include further producing clones of the transformed mature Musa plant. In some embodiments, the transformed mature Musa plant or the clone of the transformed mature Musa plant are used in breeding methods. In some embodiments, the present invention provides an isolated amino acid molecule comprising an amino acid sequence of SEQ ID NO: 15 that encodes a protein that when produced in a plant results in susceptibility to Fusarium oxysporum race 4, wherein SEQ ID NO: 15 is modified by substitutions of one, two, three or four amino acids so as to encode a protein that when produced in a plant results in resistance to Fusarium oxysporum race 4. In some embodiments, the amino acid substitutions comprise replacing a leucine corresponding to position 50 of SEQ ID NO: 15 by a valine (50L>V). In some embodiments, amino acid substitutions comprise replacing a valine corresponding to position 108 of SEQ ID NO: 15 with a glutamic acid (108V>E). In some embodiments, amino acid substitutions comprise replacing an arginine corresponding to position 115 of SEQ ID NO: 15 with a proline (115R>P). In some embodiments, amino acid substitutions comprise replacing an aspartic acid corresponding to position 116 of SEQ ID NO: 15 with a valine (116D>V). In some embodiments, amino acid substitutions comprise replacing a valine corresponding to position 108 of SEQ ID NO: 15 with a glutamic acid (108V>E), an arginine corresponding to position 115 of SEQ ID NO: 15 with a proline (115R>P) and an aspartic acid corresponding to position 116 of SEQ ID NO: 15 for a valine (116D>V). In some embodiments, protein production occurs in a plant cell, plant tissue, plant cell culture, plant tissue culture, or whole plant. In some embodiments, protein production occurs in a Musa cell, tissue, cell culture, tissue culture, or entire plant. In some embodiments, protein production occurs in a Musa acuminata cell, tissue, cell culture, tissue culture, or whole plant. In some embodiments, the nucleic acid constructs of the present invention comprise a nucleic acid sequence encoding resistance to Fusarium oxysporum race 4 when expressed in a plant, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 24 and SEQ ID NO: 29, and where The nucleic acid sequence is operably linked to a promoter capable of directing expression of the nucleic acid sequence. In some embodiments, the promoter is a plant promoter. In some embodiments, the promoter is a 35S promoter. In some embodiments, the promoter is encoded by SEQ ID NO: 31. In some embodiments, a transformation vector comprises the nucleic acid constructs of the present invention. In some embodiments, the present invention provides methods for transforming a plant cell comprising introducing the transformation vector into a plant cell, whereby the transformed plant cell expresses the nucleic acid sequence encoding resistance to Fusarium oxysporum race 4. In In some embodiments, the plant cell is a Musa plant cell. In some embodiments, the plant cell is a Musa acuminata plant cell. In some embodiments, the methods further comprise producing transformed plant tissue from the transformed plant cell. In some embodiments, a transformed seedling is produced from the transformed plant tissue. In some embodiments, the methods further comprise producing a clone of the transformed seedling. In some embodiments, the methods further comprise growing the transformed seedling or clone of the seedling MA / a / ZUZZ / UUUI oz transformed into a mature transformed plant. In some embodiments, the transformed mature plant is a Musa plant and the transformed mature Musa plant is capable of producing fruit. In some embodiments, the methods further comprise producing clones of the transformed mature Musa plant. In some embodiments, the transformed mature Musa plant or the clone of the transformed mature Musa plant is used in a breeding method. In some embodiments, the invention provides a method of banana improvement comprising crossing a first Musa plant comprising a nucleic acid sequence encoding resistance to Fusarium oxysporum race 4 with a second Musa plant that is susceptible to Fusarium oxysporum race 4. 4 and select the progeny resulting from the crossing based on their resistance to Fusarium oxysporum race 4, wherein said nucleic acid sequence encoding resistance to Fusarium oxysporum race 4 is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO : 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 24 and SEQ ID NO: 29. In some embodiments, the banana improvement methods comprise also produce clones from the progeny resulting from the cross where the clones are selected based on their resistance to Fusarium oxysporum race 4. In some embodiments, the first and second Musa plants are from different Musa species. In some embodiments, the first and second Musa plants are of the same Musa species. In some embodiments, the first and / or second Musa plant is a Musa acuminata plant. In some embodiments, the progeny of the cross showing resistance to Fusarium oxysporum race 4 are selected through the use of molecular markers that are designed based on the nucleic acid sequence encoding resistance to Fusarium oxysporum race 4 that is present in the first plant. of Musa used in the crossing. In some embodiments, the present invention provides methods for obtaining a Musa acuminata plant cell with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4, where the method comprises introducing a double-strand break at at least one site in an endogenous gene encoded by SEQ ID NO: 14 to produce a Musa acuminata plant cell with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4. In some embodiments, the methods further comprise generating a Musa acuminata plant from of the Musa acuminata plant cell with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4 to produce a Musa acuminata plant with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4. In some embodiments, the methods comprise In addition, the use of the Musa acuminata plant with a silenced endogenous gene that encodes susceptibility to Fusarium oxysporum race 4 in a banana improvement program. In some embodiments, the methods of the present invention use a plant cell that is the plant cell of Musa acuminata with a silenced endogenous gene that encodes susceptibility to Fusarium oxysporum race 4. In some embodiments, the double strand break is induced by a nuclease selected from the group consisting of a TALEN, a meganuclease, a zinc finger nuclease and a CRISPR-associated nuclease. In some embodiments, the double-strand break is induced by a CRISPR-associated nuclease and where a guide RNA is provided. In some embodiments, the present invention provides methods for producing a plant cell resistant to Fusarium oxysporum race 4 comprising introducing at least one genetic modification into one or more endogenous nucleic acid sequences encoding susceptibility to Fusarium oxysporum race 4, wherein the Genetic modification confers resistance to Fusarium oxysporum race 4 to the plant cell. In some embodiments, at least one genetic modification is introduced using a TALEN, a meganuclease, a zinc finger nuclease, or a CRISPR-associated nuclease. In some embodiments, the at least one genetic modification is introduced via a CRISPR-associated nuclease and an associated guide RNA. In some embodiments, the at least one genetic modification is selected from the list that consists of replacing a T corresponding to position 148 of SEQ ID NO: 14 with a G (148T>G), replacing a T corresponding to position 323 of SEQ ID NO: 14 with an A (323T>A), replace a G corresponding to position 344 of SEQ ID NO: 14 with a C (344G>C), and replace an A corresponding to position 347 of SEQ ID NO: 14 for a T (347A>T). In some embodiments, the at least one genetic modification results in a change in an amino acid selected from the group consisting of replacing a leucine corresponding to position 50 of SEQ ID NO: 15 with a valine (50L>V), replacing a valine corresponding to position 108 of SEQ ID NO: 15 with a glutamic acid (108V>E), replace an arginine corresponding to position 115 of SEQ ID NO: 15 with a proline (115R>P), and replace a aspartic acid corresponding to position 116 of SEQ ID NO: 15 by a valine (116D>V). In some embodiments, the plant cell is a Musa plant cell. In some embodiments, the plant cell is a Musa acuminata plant cell. In some embodiments, the methods further comprise producing transformed plant tissue from the transformed plant cell. In some embodiments, the methods MA / a / 2U22 / UUU1 02 also include producing a transformed seedling from the transformed plant tissue. In some embodiments, the methods further comprise producing a clone of the transformed seedling. In some embodiments, the methods further comprise growing the transformed seedling or clone of the transformed seedling into a mature transformed plant. In some embodiments, the transformed mature plant is a Musa plant and the transformed mature Musa plant is capable of producing fruit. In some embodiments, the methods further comprise producing clones of the transformed mature Musa plant. In some embodiments, the methods further comprise the use of the transformed mature Musa plant or the clone of the transformed mature Musa plant in a breeding method. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates aligned banana FusFH coding sequences. The initiation (start) and termination (stop) codons are underlined. FusR1 nucleotide base substitutions between Musa species are in bold. Substitutions that encode the replacement of amino acid residues (i.e., are not synonymous) are shown in bold with an asterisk (*); silent substitutions are shown in bold with a dot (·). The first 96 bases encode a leader peptide (shown in lowercase) that is cleaved from the mature protein. This is known to be common for Bowman-Birk proteins (Barbosa et al., 2007). The inventor confirmed the extension of the leader sequence by using two different bioinformatics tools, SignalP-5.0 (Armenteros et al., 2019) and PrediSi (Hiller et al., 2004), which both identified the same leader peptide. Using the bioinformatics tool DeepLoc-1.0 (Armenteros et al., 2017), the inventor then established that the mature FUSR1 protein is localized in the cell cytoplasm (probability of 0.9732). The bases are shown in an ALL CAPS code for the mature protein. A missing base, shown as a dash (-), in the M. balbisiana FusR1 sequence results in a premature stop codon (shown in underlined lowercase letters, in italics), relative to the other FusR1 sequences. As described in the text, FusR1 mRNAs from all M. balbisiana accessions that the inventor examined have an unspliced ​​(i.e., expressed) intron; For clarity in the Figure and to focus on sequence similarities / differences in the FusR1 coding sequences of different banana species, the intron sequence has been removed here from M. balbisiana, although the inventor has not seen that happen. . Therefore, SEQ ID NO: 27 is a hypothetical coding sequence. The M. itinerans FusR1 sequence was obtained from multiple accessions (ITC1526, ITC1571, and PT-BA00223), all of which are resistant to FW. The M. acuminata FusR1 sequence labeled as FW-resistant was obtained from multiple FW-resistant accessions, including ITC0896 (M. a. subspecies banksil) and PT-BA-00281 (Pisang Bangkahulu). The M. acuminata sequence labeled as sensitive comes from the FW-susceptible accessions ITC0507, ITC0685, PT-BA-00304, PT-BA-00310, and PT-BA-00315. These accessions include multiple samples of banana cultivars such as Pisang Madu, Pisang Pipit and Pisang Rojo Uter, all of which have been well characterized as sensitive to FW. MA / a / ZUZZ / UUUI (Chen et al., 2019). The M. balbisiana sequence included here was obtained from ITC1016. FusR1 of M. basjoo is from FW-resistant accessions (ITC0061 and PD #3064). Examination of Figure 1 reveals that our banana FusR1 sequences are well conserved in the region encoding the leader peptide, as expected. However, the FusR1 sequence encoding the mature FUSR1 protein shows an unusually high number of nonsynonymous substitutions. This is the result of a strong selective pressure on these proteins, which is reflected in the high Ka / Ks ratios observed for these genes. (See below) The inventor found 2 FW-resistant alleles for FusR1 of M. itinerans. These differ very slightly and for simplicity, only allele 1 (SEQ ID NO: 2) of M. itinerans is shown in Figure 1. The coding sequence for allele 2 of M. itinerans is included in the sequence listing as SEQ ID NO: 5. Similarly, the inventor found 2 FW-resistant alleles for FusR1 in M. acuminata. These differ only by a single silent base substitution. Again, for simplicity, Figure 1 shows only one of these alleles (SEQ ID NO: 9). The second allele, not shown in Figure 1, is recorded in the sequence listing as SEQ ID NO: 11. Figure 2 illustrates the aligned banana FUSR1 protein sequences. Amino acid residues that differ between banana FUSR1 protein sequences are underlined. The first 32 residues constitute a leader peptide that is cleaved from the mature protein. Residues of the leader sequence are shown in lower case and residues of the mature protein in UPPER CASE. The functionally folded banana FUSR1 protein consists of two subdomains: subdomain 1 is indicated by light gray shading; subdomain 2 is indicated by dark gray shading. As in other Bowman-Birk proteins, the structure of banana FUSR1 is maintained by 14 disulfide bonds. The cysteine ​​residues that form these disulfide bonds are shown in bold. Each subdomain contains a reactive site, shown in italics. Residues that are specific for trypsin (subdomain 1) and chymotrypsin (subdomain 2) are indicated by an asterisk (*). For M. acuminata, residues that differ between the Foc4-sensitive FusR1 allele and the Foc-4-resistant alleles are shown by a dot (·), with the arginine residue (number 115) that accounts for the sensitivity to Foc4 shown in bold with a dot (·). Figure 3 provides a phylogenetic tree for several banana species, based on the nucleotide sequences of the C2H2 gene. The tree topology shown here was recovered from the analysis of our banana C2H2 nucleotide sequences. This topology is identical to that recovered from the analysis of the C2H2 protein sequence. The same tree was recovered from our TOPO6 protein and nucleotide sequences. The topology shown here is also similar to the references. It is important to note that, in contrast, the topologies recovered from the protein sequences of FusR1 and the protein coding regions of the FusR1 gene give a different topology, which is clearly the result of the selective pressures imposed on FusR1 during adaptation due to Fusarium challenge. The non-coding regions of FusR1 have the same topology as the phylogenetic trees of C2H2 and TOPO6. MA / a / 4U44 / UUU1 04 Evolutionary history was inferred by using the maximum parsimony method. The only tree with the most parsimony is shown. The consistency index is 1.000000, the retention index is 1.000000, and the composite index is 1.000000 for all sites. The MP tree was obtained using the SubtreePruning-Regrafting (SPR) algorithm with search level 0 in which the initial trees were obtained by randomly adding sequences (10 replicates). This analysis involved 5 nucleotide sequences. Codon positions included were 1a+2a+38+Non-coding. All positions with less than 95% site coverage were removed, i.e., less than 5% alignment gaps, missing data, and ambiguous bases were allowed at any position (partial deletion option). A total of 218 positions existed in the final data set. Evolutionary analyzes were performed in MEGA X (Kumar et al., 2018). Figure 4 provides a phylogenetic tree for several banana species, based on FUSR1 protein sequences. Note that this tree links Musa acuminata and M. basjoo, on the other hand, to their actual phylogenetic relationship. M. acuminata is most closely related to M. balbisianana, with M. basjoo as sister taxon to these 2 species. However, due to the strong effects of positive selection, the sequence of FusR1 proteins from M. acuminata and M. basjoo cluster together. (In fact, these protein sequences are identical.) Evolutionary history was inferred by using the maximum parsimony method. The single most parsimonious tree is shown with length = 55. The consistency index is 0.963636, the retention index is 0.875000, and the composite index is 0.843182 for all sites. The MP tree was obtained using the Subtree-Pruning-Regrafting (SPR) algorithm with search level 0 in which the initial trees were obtained by randomly adding sequences (10 replicates). Evolutionary analyzes were performed in MEGAX. Figure 5 provides the FusR1 mRNA sequence alignment of FW-sensitive Musa balbisiana accessions. The sequences included here were obtained from many M. balbisiana accessions, including ITC1016, ITC0545, ITC0080, ITC1527, ITC0565, ITC1781, ITC1580, and several others. FusR1 nucleotide base substitutions among Musa balbisiana accessions are in italics. Start and stop (stop) codons are shown in lower case. Insertions, with respect to other M. balbisínana accessions (as well as FusR1 sequences from all other plants analyzed by the inventor), are in bold. Nucleotide deletions are shown by the colon symbol (:). The 85 base pair deletion in FusR1 of accessions ITC0545 and ITC1781 is exclusive to M. balbisiana. As the FusR1 sequence of ITC1781 is identical to that of ITC0545, ITC1781 is not presented in Figure 5. Similarly, the single base pair deletion found in these FW-susceptible M. balbisiana accessions has not been found. in no other FusR1 sequence. However, it exists in all the accessions of M. balbisianana analyzed by the inventor. This single base pair deletion results in a premature stop codon relative to the FusR1 sequences of FW-resistant banana accessions. MA / a / ZUZZ / UUUI oz All of the M. balbisiana accessions that the inventor examined had one of the 4 types of alleles shown here. Several accessions shared identical FusR1 alleles. Therefore, for simplicity, only 4 accessions are shown in this figure. These 4 FusR1 alleles are all very similar in nucleotide sequence. There are transcriptional variants between accessions, but all of these variants have the expressed unspliced ​​intron. All accessions also have a single base pair deletion. Three accessions also have an 85 base pair deletion and several have a 4 base pair insertion. Therefore, all of these FusR1 sequences are disrupted and all encode non-functional FusR1 proteins. Significantly, all of these M. balbisiana accessions are sensitive to FW. DETAILED DESCRIPTION OF THE INVENTION The present disclosure provides a solution for fungal, viral, bacterial and / or nematode-caused diseases by inducing a defense response to many invading pathogens. The present disclosure provides methods for identifying genetic materials that can drive disease resistance and / or fungal resistance in plants, including banana, and in plants and plant parts. Furthermore, the present disclosure provides methods for transferring genetic materials to susceptible banana cultivars to give rise to disease and / or fungal resistance traits. Furthermore, the present disclosure teaches newly identified genetic components and methods for generating genetically modified plants, plant cells, tissues and seeds, having modified disease resistance. I. Definitions Unless otherwise defined, all technical and scientific terms used in the present description have the same meaning as commonly understood by one skilled in the art to which the description pertains. Although the following terms are believed to be well understood by one skilled in the art, the following definitions are set forth to facilitate explanation of the subject matter described herein. Although any methods and materials similar or equivalent to those described herein may be used in practice or in testing of the present disclosure, preferred methods and materials are described. The following terms are defined below. These definitions are for illustrative purposes and are not intended to limit the common art meaning of the defined terms. The term one or one refers to one or more of that entity, that is, it can refer to a plural referent. As such, the terms one, one or more, and at least one may be used interchangeably herein. Furthermore, reference to an element in the indefinite article a or an does not exclude the possibility of more than one of the elements being present, unless the context clearly requires that one and only one of the elements exist. As used herein, the term and / or is used in this description to mean either and or or, unless otherwise indicated. MA / a / 4U44 / UUU1 04 Throughout this specification, unless the context otherwise requires, the words comprises, or variations such as comprise or comprising, will be understood to imply the inclusion of an element or whole number or group of elements or established integers, but not the exclusion of any other element or integer or group of elements or integers. As used in this application, the terms approximately and around are used as equivalents. Any numbers used in this application with or without approximately / approximately are intended to cover any normal fluctuations appreciated by one skilled in the relevant art. In certain embodiments, the term “about” or “about” refers to a range of values ​​that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%. 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less than) of the established reference value unless otherwise indicated or evident from the context (except where such a number would exceed 100% of a possible value). As used herein, the term at least a portion or fragment of a nucleic acid or polypeptide means a portion having the minimum size characteristics of such sequences, or any larger fragment of the full-length molecule, up to and including which includes the full length molecule. A fragment of a polynucleotide of the invention may encode a biologically active portion of a genetic regulatory element. A biologically active portion of a genetic regulatory element can be prepared by isolating a portion of one of the polynucleotides of the invention comprising the genetic regulatory element and evaluating the activity as described herein. Similarly, a portion of a polypeptide may be 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, etc., increasing up to the full length polypeptide. The length of the portion to be used will depend on the particular application. A portion of a nucleic acid useful as a hybridization probe can be as short as 12 nucleotides; In some embodiments, it is 20 nucleotides. A portion of a polypeptide useful as an epitope can be as short as 4 amino acids. A portion of a polypeptide that performs the function of the full-length polypeptide would generally have more than 4 amino acids. In some embodiments, a fragment of a polypeptide or polynucleotide comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%. 98% or 99% of the total length of the reference polypeptide or polynucleotide. In some embodiments, a polypeptide or polynucleotide fragment may contain 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000 or more nucleotides or amino acids. As used herein, the term "codon optimization" implies that the codon usage of a DNA or RNA is tailored to that of a cell or organism of interest to improve the rate of transcription of said recombinant nucleic acid in the cell or organism. of interest. One skilled in the art is well aware of the fact that a target nucleic acid may be modified at one position due to codon degeneracy, while this modification will still lead to the same amino acid sequence at that position after translation, which It is achieved through codon optimization by taking into account the species-specific codon usage of a target cell or organism. As used herein, the term endogenous or endogenous gene refers to the naturally occurring gene, at the location where it is naturally found within the genome of the host cell. Endogenous gene is synonymous with native gene as used herein. An endogenous gene as described herein may include alleles of naturally occurring genes that have been mutated according to any of the methods of the present disclosure, that is, an endogenous gene could have been modified at some point by traditional methods of plant breeding and / or next generation plant breeding methods. As used herein, the term exogenous refers to a substance that comes from some source other than its native source. For example, the terms exogenous protein or exogenous gene refer to a protein or gene from a non-native source and that has been artificially supplied to a biological system. As used herein, the term exogenous is used interchangeably with the term heterologous and refers to a substance that comes from some source other than its native source. The terms engineered host cell, recombinant host cell, and recombinant strain are used interchangeably herein and refer to host cells that have been genetically modified by the methods of the present disclosure. The terms therefore include a host cell (e.g. bacteria, yeast cell, fungal cell, CHO, human cell, plant cell, plant-derived protoplast, callus, etc.) that has been genetically altered, modified or manipulated. , so that it presents an altered, modified or different genotype and / or phenotype (for example, when the genetic modification affects coding nucleic acid sequences), compared to the host cell of natural origin from which it is derived. The terms are understood to refer not only to the particular recombinant host cell in question, but also to the progeny or potential progeny of said host cell. As used herein, the term heterologous refers to a substance that comes from some source or location other than its native source or location. In some embodiments, the term heterologous nucleic acid refers to a nucleic acid sequence that is not found naturally in the particular organism. For example, the term heterologous promoter can refer to a promoter that has been taken from a source organism and used in another organism, in which the promoter is not found naturally. However, the term heterologous promoter can also refer to a promoter that comes from the same source organism, but has simply moved to a new location, where said promoter is not normally located. Heterologous gene sequences can be introduced into a target cell through the use of an expression vector, which may be a eukaryotic expression vector, for example, a plant expression vector. The methods used to construct vectors are well known to those skilled in the art and are described in various publications. In particular, techniques for constructing suitable vectors, including a description of functional components such as promoters, enhancers, termination and polyadenylation signals, selection markers, origins of replication, and splicing signals, are described. MA / a / ZUZZ / UUUI oz review in the previous technique. Vectors may include, but are not limited to, plasmid vectors, phagemids, cosmids, artificial chromosomes / minichromosomes (e.g., ACE) or viral vectors such as baculovirus, retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, retrovirus, bacteriophage. . Eukaryotic expression vectors will typically also contain prokaryotic sequences that facilitate propagation of the vector in bacteria such as origin of replication and antibiotic resistance genes for selection in bacteria. A variety of eukaryotic expression vectors, containing a cloning site at which a polynucleotide can be operatively linked, are well known in the art and some are commercially available from companies such as Stratagene, La Jolla, California; Invitrogen, Carlsbad, California; Promega, Madison, Wis. or BD Biosciences Clontech, Palo Alto, California. In one embodiment, the expression vector comprises at least one nucleic acid sequence that is a regulatory sequence necessary for the transcription and translation of nucleotide sequences encoding a peptide / polypeptide / protein of interest. As used herein, the term naturally occurring as applied to a nucleic acid, polypeptide, cell or organism, refers to a nucleic acid, polypeptide, cell or organism found in nature. The term naturally occurring may refer to a gene or sequence derived from a naturally occurring source. Therefore, for the purposes of this description, a non-naturally occurring sequence is a sequence that has been synthesized, mutated, manipulated, edited or otherwise modified to have a sequence different from known natural sequences. In some embodiments, the modification may be at the protein level (e.g., amino acid substitutions). In other embodiments, the modification may be at the DNA level (e.g., nucleotide substitutions). As used herein, the term nucleotide change or nucleotide modification refers, for example, to the substitution, deletion and / or insertion of nucleotides, as is well understood in the art. For example, such nucleotide changes / modifications include mutations containing alterations that produce silent substitutions, additions or deletions, but do not alter the properties or activities of the encoded protein or how the proteins are made. As another example, such nucleotide changes / modifications include mutations containing alterations that produce replacement substitutions, additions or deletions, which alter the properties or activities of the encoded protein or how proteins are made. As used herein, the term protein modification refers to, for example, amino acid substitution, modification, deletion and / or insertion of amino acids, as is well understood in the art. The term next generation plant breeding refers to a series of plant breeding tools and methodologies that are available to breeders today. A key distinguishing feature of next-generation plant breeding is that the breeder is no longer limited to relying on observed phenotypic variation to infer the underlying genetic causes of a given trait. Rather, next-generation plant breeding may include the use of molecular markers and marker-assisted selection (MAS), so that the breeder can directly observe the movement of alleles and genetic elements of interest of a plant in the breeding population. , and is not limited to the mere observation of the phenotype. Furthermore, next-generation plant breeding methods are not limited to using the natural genetic variation found within a plant population. Rather, the breeder using next generation plant breeding methodology can access a series of modern genetic manipulation tools that directly alter / change / edit the underlying genetic architecture of the plant in a targeted manner, to generate a phenotypic trait of interest. In some respects, plants bred using a next-generation breeding methodology are indistinguishable from a plant that was bred traditionally, as the resulting end-product plant could theoretically be developed by either method. In particular aspects, a next generation breeding methodology may result in a plant comprising: a genetic modification that is a deletion or insertion of any size; a genetic modification that is a substitution of one or more base pairs; a genetic modification that is an introduction of nucleic acid sequences from within the natural gene pool of the plant (for example, any plant that can be crossed or improved with a plant of interest) or from the editing of nucleic acid sequences in a plant that correspond to a sequence that is known to occur in the natural gene pool of the plant; and offspring of said plants. As used herein, the term operatively linked refers to the association of nucleic acid sequences into a single nucleic acid fragment such that the function of one is regulated by the other. For example, a promoter is operably linked to a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). Coding sequences may be operably linked to regulatory sequences in a sense or antisense orientation. In another example, the complementary RNA regions of the disclosure may be operably linked, either directly or indirectly, upstream of the target mRNA, or downstream of the target mRNA, or within the target mRNA, or a first complementary region is upstream and its complement is downstream of the target mRNA. The terms polynucleotide, nucleic acid and nucleotide sequence, used interchangeably in the present description, refer to a polymeric form of nucleotides of any length, whether ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers to the primary structure of the molecule and therefore includes double- and single-stranded DNA, as well as double- and single-stranded RNA. This term includes, but is not limited to, single-, double-, or multiple-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other modified natural nucleotide bases. chemically or biochemically, non-natural or derivatized. It also includes modified nucleic acids such as methylated and / or capped nucleic acids, nucleic acids containing modified bases, backbone modifications, and the like. Oligonucleotide generally refers to polynucleotides of between about 5 and about 100 nucleotides of single-stranded or double-stranded DNA. However, for the purposes MA / a / ZUZZ / UUUI oz of this description, there is no upper limit for the length of an oligonucleotide. Oligonucleotides are also known as oligomers or oligos and can be isolated from genes or chemically synthesized by methods known in the art. It should be understood that the terms polynucleotide, nucleic acid and nucleotide sequence include, as applicable to the embodiments described, single-stranded (such as sense or antisense) and double-stranded polynucleotides. The terms peptide, polypeptide and protein are used interchangeably herein and refer to a polymeric form of amino acids of any length, which may include encoded and non-encoded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having peptide backbones. modified. As used herein, the phrases recombinant construct, expression construct, chimeric construct, construct, and recombinant DNA construct are used interchangeably herein. A recombinant construct comprises an artificial combination of nucleic acid fragments, for example, regulatory and coding sequences that do not occur together in nature. For example, a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature. Such a construct can be used by itself or can be used in conjunction with a vector. If a vector is used, then the choice of vector depends on the method that will be used to transform the host cells, as is well known to those skilled in the art. For example, a plasmid vector can be used. The person skilled in the art is well aware of the genetic elements that must be present in the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the description. One skilled in the art will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., (1985) EMBO J. 4:2411-2418; De Almeida et al., (1989) Mol. Gen Genetics 218:78-86) and, therefore, multiple events must be screened to obtain lines that show the desired level and pattern of expression. Said screening can be performed by Southern analysis of DNA, Northern analysis of mRNA expression, immunoblot analysis of protein expression or phenotypic analysis, among others. The vectors can be plasmids, viruses, bacteriophages, pro-viruses, phagemids, transposons, artificial chromosomes and the like, which replicate autonomously or can integrate into a chromosome of a host cell. A vector may also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of DNA and RNA within the same strand, a polylysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome conjugate DNA, or similar, that does not replicate autonomously. As used herein, the term expression refers to the production of a functional end product, for example, an mRNA or a protein (precursor or mature). The term traditional plant breeding refers to the use of natural variation found within a plant population as a source of alleles and genetic variants that impart a trait of interest to a given plant. Traditional breeding methods make use of crossing procedures that rely heavily on observed phenotypic variation to infer causal allele association. That is, traditional plant breeding relies on observations of the expressed phenotype of a given plant to infer the underlying genetic cause. These observations are used to inform the breeding procedure in order to move allelic variation to the germplasm of interest. Furthermore, traditional plant breeding has also been characterized by comprising random mutagenesis techniques, which can be used to introduce genetic variation into a given germplasm. These random mutagenesis techniques may include radiation-based and / or chemical mutagenesis procedures. Consequently, a key feature of traditional plant breeding is that the breeder does not use a genetic engineering tool that directly alters / changes / edits the underlying genetic architecture of the plant in a targeted manner, in order to introduce genetic diversity and produce a trait. phenotypic of interest. A CRISPR-associated effector, as used herein, can be defined as any nuclease, nickase or recombinase associated with CRISPR (clustered regularly interspaced short palindromic repeats), which has the ability to introduce single- or double-strand cleavage into a genomic target site, or that has the ability to introduce a targeted modification, including a point mutation, insertion or deletion, into a genomic target site of interest. At least one CRISPR-associated effector can act alone or in combination with other molecules as part of a molecular complex. The CRISPR-associated effector may be present as a fusion molecule, or as individual molecules that associate or are associated by at least one of a covalent or non-covalent interaction with gRNA and / or target site such that the components of the complex associated with CRISPR are brought into close physical proximity. A base editor, as used herein, refers to a protein or a fragment thereof that has the same catalytic activity as the protein from which it is derived, where said protein or fragment thereof, alone or when provided as a molecular complex, referred to as base editing complex in the present description, it has the ability to mediate a targeted base modification, that is, the conversion of a base of interest that results in a point mutation of interest, which It can in turn result in a directed mutation, if the base conversion does not cause a silent mutation, but rather a conversion of an amino acid encoded by the codon comprising the position to be converted with the base editor. At least one base editor according to the present description temporarily or permanently linked to at least one CRISPR-associated effector, or optionally to a component of at least one CRISPR-associated effector complex. The term Cas9 nuclease and Cas9 may be used interchangeably herein, which refer to an RNA-guided DNA endonuclease enzyme associated with CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), which includes the Cas9 protein or fragments thereof (such as a protein comprising an active DNA cleavage domain of Cas9 and / or a gRNA binding domain of Cas9). Cas9 is a component of the editing system of the MA / a / ZUZZ / UUUI oz CRISPR / Cas genome, which targets and cleaves a target DNA sequence to form DNA double-strand breaks (DSBs) under the guidance of a guide RNA. The term CRISPR RNA or crRNA refers to the RNA strand responsible for hybridizing with target DNA sequences and recruiting CRISPR endonucleases and / or CRISPR-associated effectors. The crRNAs may be naturally occurring or may be synthesized according to any known RNA production method. The term tracrRNA refers to a small trans-encoded RNA. TracrRNA is complementary and base pairs with crRNA to form a crRNA / tracrRNA hybrid, capable of recruiting CRISPR endonucleases and / or CRISPR-associated effectors to target sequences. The term guide RNA or gRNA, as used herein, refers to an RNA sequence or combination of sequences capable of recruiting a CRISPR endonuclease and / or CRISPR-associated effectors to a target sequence. Typically, gRNA is composed of crRNA and tracrRNA molecules that form complexes through partial complementation, where the rcRNA comprises a sequence that is sufficiently complementary to a target sequence for hybridization and directs the CRISPR complex (i.e. hybrid Cas9-crRNA / tracrRNA) to specifically bind to the target sequence. Furthermore, a single guide RNA (sgRNA) can be designed, which comprises the characteristics of both crRNA and tracrRNA. Therefore, as used herein, a guide RNA may be a natural or synthetic crRNA (e.g., for Cpf1), a natural or synthetic crRNA / tracrRNA hybrid (e.g., for Cas9), or a guide RNA. unique (gRNA). The term guide sequence or sword sequence refers to the portion of a crRNA or guide RNA (gRNA) that is responsible for hybridizing with the target DNA. The term protospacer refers to the DNA sequence directed by a crRNA or gRNA guide sequence. In some embodiments, the protospacer sequence is hybridized with the crRNA or gRNA guide (sword) sequence of a CRISPR complex. The term CRISPR landing site as used herein refers to a DNA sequence capable of being targeted by a CRISPR-Cas complex. In some embodiments, a CRISPR landing site comprises a proximally positioned protospacer / adjacent protospacer motif combination sequence that is capable of being cleaved by a CRISPR complex. The term CRISPR complex, CRISPR endonuclease complex, CRISPR Cas complex or CRISPR-gRNA complex are used interchangeably herein. CRISPR complex refers to a Cas9 nuclease and / or CRISPR-associated effectors that form a complex with a guide RNA (gRNA). Therefore, the term CRISPR complex refers to a combination of CRISPR endonuclease and guide RNA capable of inducing a double-strand break at a CRISPR landing site. In some embodiments, the CRISPR complex of the present disclosure refers to a combination of catalytically dead Cas9 protein and guide RNA capable of targeting a target sequence, but not capable of inducing a double-strand break at a CRISPR landing site because it loses a nuclease activity. In other embodiments, the CRISPR complex of the present description refers to a ινΐΛ / a / zuzz / uuu i nickase combination Cas9 and guide RNA capable of introducing gRNA-targeted single-strand breaks into DNA instead of double-strand breaks created by wild-type Cas enzymes. As used herein, the term targeting sequence-specific binding in the context of CRISPR complexes refers to the ability of a guide RNA to recruit a CRISPR endonuclease and / or CRISPR-associated electors to a CRISPR landing site. As used herein, the term deaminase refers to an enzyme that catalyzes the deamination reaction. In some embodiments of the present disclosure, the deaminase refers to a cytidine deaminase, which catalyzes the deamination of a cytidine or a deoxycytidine to a uracil or a deoxyuridine, respectively. In other embodiments of the present description, deaminase refers to an adenosine deaminase, which catalyzes the deamination of an adenine to form hypoxanthine (in the form of its nucleoside inosine), which is read as guanine by DNA polymerase. As used herein, the term glycosylase refers to a family of enzymes involved in base excision repair, classified under the EC number: EC 3.2.2. Base excision repair is the mechanism by which damaged bases in DNA are removed and replaced. DNA glycosylases catalyze the first stage of this process. They remove the damaged nitrogenous base while leaving the sugar-phosphate structure intact, creating an apurinic / apyrimidinic site, commonly known as the AP site. This is achieved by flipping the damaged base out of the double helix followed by cleavage of the N-glycosidic bond. In some embodiments of the present disclosure, with the expectation of providing a mutation introduction tendency different from that of deaminase and the like, a base cleavage reaction by hydrolysis of the N-glycosidic bond of DNA, and then induction is used of the introduction of mutation in a cell repair process. In aspects, an enzyme that has cytosine-DNA glycosylase (CDG) or thymine-DNA glycosylase (TDG) activity is used. In aspects, a yeast mitochondrial uracil-DNA glycosylase mutant (UNG 1) is used as the enzyme that performs said base cleavage reaction. US 2017 / 0321210 A1 to Nishida et al., published on November 9, 2017, is incorporated herein by reference. As used herein, the term targeted refers to the expectation that an element or molecule will interact with another element or molecule with a degree of specificity, to exclude non-targeted elements or molecules. For example, a first polynucleotide that targets a second polynucleotide, according to the present disclosure, has been designed to hybridize to the second polynucleotide in a sequence-specific manner (e.g., by Watson-Crick base pairing). In some embodiments, the selected hybridization region is designed to make the hybridization unique to one or more target regions. A second polynucleotide may no longer be a target of a first targeting polynucleotide, if its targeting sequence (hybridization region) is mutated, or otherwise deleted / separated from the second polynucleotide. Furthermore, targeted can be used interchangeably with site-specific or site-directed, which refers to a molecular biology action that uses information about the sequence of a genomic region of interest to be modified, and that is also based on information from the mechanism of action of molecular tools, for example, nucleases, including CRISPR nucleases and variants thereof, TALEN, ZFN, meganucleases or ινΐΛ / a / zuzz / uuu i recombinases, DNA-modifying enzymes, including base-modifying enzymes such as cytidine deaminase enzymes, histone modifying enzymes and the like, DNA-binding proteins, crRNA / tracrRNA, guide RNA and the like. The term seed region refers to the critical portion of a crRNA or guide RNA sequence that is most susceptible to mismatch with its targets. In some embodiments, a single mismatch in the seed region of a crRNA / gRNA can render a CRISPR complex inactive at that binding site. In some embodiments, seed regions for Cas9 endonucleases are located along the last ~12 nt of the 3' portion of the guide sequence, which correspond (hybridize) to the portion of the protospacer target sequence that is adjacent to the PAM. In some embodiments, seed regions for Cpf 1 endonucleases are located along the first ~5 nt of the 5' portion of the guide sequence, which correspond (hybridize) to the portion of the protospacer target sequence adjacent to the PAM. The term sequence identity refers to the percentage of bases or amino acids between two polynucleotide or polypeptide sequences that are the same and in the same relative position. As such, one polynucleotide or polypeptide sequence has a certain percentage of sequence identity compared to another polynucleotide or polypeptide sequence. For sequence comparison, typically one sequence acts as a reference sequence, against which the test sequences are compared. The term reference sequence refers to a molecule with which a test sequence is compared. When using percent sequence identity in reference to proteins, it is recognized that the positions of residues that are not identical often differ by conservative amino acid substitutions, where amino acid residues are replaced by other amino acid residues with chemical properties. similar (for example, charge or hydrophobicity) and, therefore, do not modify the functional properties of the molecule. When sequences differ by conservative substitutions, the percent sequence identity can be adjusted upward to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have sequence similarity or similarity. Those skilled in the art are well aware of the means for making this adjustment. Typically, this involves scoring a conservative substitution as a partial rather than a complete mismatch, thereby increasing the percentage of sequence identity. Therefore, for example, when an identical amino acid receives a score of 1 and a non-conservative substitution receives a score of zero, a conservative substitution receives a score between zero and 1. The score for conservative substitutions is calculated, for example, from according to the algorithm of Meyers and Miller, Computer Applic. Biol. Sci. 4:11-17 (1988). Complementary refers to the ability to pair, through base stacking and specific hydrogen bonding, between two sequences comprising natural or non-natural bases or analogs thereof. For example, if a base at one position in a nucleic acid is capable of forming hydrogen bonds with a base at the corresponding position in a target, then the bases are considered complementary to each other at that position. Nucleic acids may comprise universal bases or inert abasic spacers that do not provide any positive or negative contribution to hydrogen bonding. Base pairings may include canonical Watson-Crick base pairings and non-Watson-Crick base pairings (for example, Wobble base pairings and Hoogsteen base pairings). It is understood that for complementary base pairs, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary. to guanosine (G) type bases, and that universal bases such as 3-nitropyrrole or 5-nitroindole can hybridize and are considered complementary to any A, C, U or T. Nichols et al., Nature, 1994; 369:492493 and Loakes et al., Nucleic Acids Res., 1994; 22:4039-4043. Inosine (I) has also been considered in the art as a universal base and is considered complementary to any A, C, U or T. See Watkins and Santa Lucia, Nucí. Acids Research, 2005; 33(19):6258-6267. As mentioned in the present description, a complementary nucleic acid sequence is a nucleic acid sequence that comprises a nucleotide sequence that allows it to bind non-covalently to another nucleic acid in a sequence-specific antiparallel manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid) under the appropriate in vitro and / or in vivo conditions of temperature and ionic strength of the solution. Sequence alignment methods for comparison and determination of percent sequence identity and percent complementarity are well known in the art. The optimal alignment of sequences for comparison can be performed, for example, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, using the similarity search method of Pearson and Lipman, (1988) Proc. Nat'l. Academic Sel. USA 85:2444, by computer implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), by manual alignment and visual inspection (see, for example , Brent et al., (2003) Current Protocols in Molecular Biology), using algorithms known in the art including the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402; and Altschul et al., (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information. Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, United Kingdom), ALIGN Plus (Scientific and Educational Software, Pennsylvania), and AlignX (Vector NTI, Invitrogen, Carlsbad, CA). Another alignment program is Sequencher (Gene Codes, Ann Arbor, Michigan), using default parameters, and MUSCLE (Multiple Sequence Comparison by Record Exception; a computer software licensed in the public domain). In the present description, the term hybridize refers to the pairing between complementary nucleotide bases (for example, adenine (A) forms a base pair with thymine (T) in a DNA molecule and with uracil (U) in a molecule of RNA, and guanine (G) forms a base pair with cytosine (C) in DNA and RNA molecules) to form a double-stranded nucleic acid molecule. (See, for example, Wahl and Berger (1987) Methods Enzymol. 152:399; Kimmel, (1987) Methods Enzymol. 152:507). Furthermore, it is also known in the art that for hybridization between two RNA molecules (e.g., dsRNA), guanine (G) forms a base pair with uracil (U). For example, G / U base pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of anti-codon base pairing of tRNA with codons in mRNA. In the context of this disclosure, a guanine (G) of a protein binding segment (dsRNA duplex) of a guide RNA molecule is considered complementary to a uracil (U) and vice versa. As such, when a G / U base pair can form at a given nucleotide position, a protein-binding segment (dsRNA duplex) of a guide RNA molecule, the position is not considered non-complementary, but rather is considered to be It is complementary. It is understood in the art that the polynucleotide sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Additionally, a polynucleotide may hybridize over one or more segments such that intermediate or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). A polynucleotide may comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% sequence complementarity with a target region within the target nucleic acid sequence to which they go. The term modified refers to a substance or compound (for example, a cell, a polynucleotide sequence and / or a polypeptide sequence) that has been altered or changed compared to the corresponding unmodified substance or compound. Isolated refers to a material that is free to varying degrees of the components that normally accompany it as found in its native state. The term gene-edited plant, part or cell, as used herein, refers to a plant, part or cell that comprises one or more endogenous genes that are edited by a gene editing system. The gene editing system of the present description comprises a targeting element and / or an editing element. The targeting element is capable of recognizing a target genomic sequence. The editing element is capable of modifying the target genomic sequence, for example, by substitution or insertion of one or more nucleotides in the genomic sequence, deletion of one or more nucleotides in the genomic sequence, alteration of genomic sequences to include regulatory sequences, insertion of transgenes into a safe harbor genomic site or other specific location in the genome, or any combination thereof. The targeting element and the editing element may be on the same nucleic acid molecule or on different nucleic acid molecules. In some embodiments, the editing element is capable of precisely editing the genome by replacing a single nucleotide through the use of a base editor, such as the cytosine base editor (CBE) and / or the cytosine base editor (CBE). adenine (ABE), which is fused directly or indirectly to a CRISPR-associated effector protein. The term plant refers to complete plants. The term plant part includes differentiated and undifferentiated tissues including, but not limited to: plant organs, plant tissues, roots, stems, buds, rootstocks, shoots, stipules, petals, leaves, flowers, ovules, pollens, bracts, petioles, internodes, bark, pubescence, tillers, rhizomes, fronds, laminae, stamens, fruits, seeds, tumor tissue and plant cells (e.g., single cells, protoplasts, embryos and ΜΛ / a / ZUZZ / UUU 1 oz callus tissue). Plant cells include, without limitation, seed cells, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores. Plant tissue can be in a plant or in a plant organ, tissue or cell culture. As used herein, when discussing plants, the term ovule refers to the female gametophyte, while the term pollen means the male gametophyte. As used herein, the term plant tissue refers to any part of a plant. Examples of plant organs include, but are not limited to, the leaf, stem, root, tuber, seed, branch, pubescence, node, leaf axil, flower, pollen, stamen, pistil, petal, peduncle, stalk, stigma , style, bract, fruit, trunk, carpel, sepal, anther, ovule, pedicel, needle, cone, rhizome, stolon, bud, pericarp, endosperm, placenta, berry, stamen and leaf sheath. As used herein, the term phenotype refers to the observable characteristics of an individual cell, cell culture, organism (e.g., a plant), or group of organisms that results from the interaction between the genetic makeup of that individual ( that is, genotype) and the environment. The terms transgene or transgenic as used herein refer to at least one nucleic acid sequence that is taken from the genome of an organism, or produced synthetically, and which is then introduced into a cell or host organism or tissue. interest and which is subsequently integrated into the host genome through transformation or stable transfection approaches. In contrast, the term transformation or transfection or transient introduction refers to a way of introducing molecular tools that include at least one nucleic acid (DNA, RNA, single-stranded or double-stranded or a mixture thereof) and / or at least one sequence. of amino acids, optionally comprising suitable chemical or biological agents, to achieve a transfer to at least one compartment of interest of a cell, including, but not restricted to, the cytoplasm, an organelle, including the nucleus, a mitochondria, a vacuole, a chloroplast, or in a membrane, which results in the transcription and / or translation and / or association and / or activity of the at least one introduced molecule without achieving stable integration or incorporation and, therefore, the inheritance of the respective at least one molecule introduced into the genome of a cell. The term transgene-free refers to a condition in which the transgene is not present or found in the genome of a cell or tissue or host organism of interest. As used herein, the term tissue culture indicates a composition comprising isolated cells of the same or a different type or a collection of such cells organized into parts of a plant. Illustrative types of tissue cultures are protoplasts, calluses, plant groups and plant cells that can generate tissue cultures that are intact in plants or plant parts, such as embryos, pollen, flowers, seeds, leaves, stems, roots, tips radicals, anthers, pistils, meristematic cells, axillary buds, ovaries, seed coat, endosperm, hypocotyls, cotyledons and the like. The term plant organ refers to plant tissue or a group of tissues that constitute a morphologically and functionally distinct part of a plant. Progeny comprises any subsequent generation of a plant. MA / a / 4U44 / UUU1 04 General methods of molecular and cellular biochemistry can be found in standard textbooks such as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., HaRBor Laboratory Press 2001);, Short Protocols in Molecular Biology 4th Ed. (Ausubel et al. , eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al., eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the descriptions of which are incorporated herein by reference. As used herein, the term AGAMOUS Ciado Transcription Factor or AG Ciado Transcription Factor is a member of the AGAMOUS (AG) subfamily of MIKC-type MADS box genes. MIKC-like proteins represent a class of MADS domain transcription factors and are defined by a unique domain structure: (1) 'M' - a highly conserved DNA-binding MADS domain, (2) T - a domain, ( 3) 'K' - a keratin-like K domain, and (4) 'C - a C-terminal domain. In some embodiments, the Ciado Transcription Factor AGAMOUS or Ciado Transcription Factor AG further comprises an N-terminal region. In other embodiments, Ciado Transcription Factor AGAMOUS or Ciado Transcription Factor AG comprises the AG, SHP1, SHP2 and STK genes in plants of the present description, each of which has an NN motif in the M domain, a motif YQQ in the K domain and / or an R / Q (R or Q) in the C domain. By biologically active portion is meant a portion of a full-length parental peptide or polypeptide whose portion retains an activity of the parent molecule. For example, a biologically active portion of the polypeptide of the invention will retain the ability to confer disease resistance, especially resistance to fungal pathogens such as Fusarium. As used herein, the term biologically active portion includes deletion mutants and peptides, for example, of at least about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21,22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150, 300, 400, 500, 600, 700, 800, 900 or 1,000 contiguous amino acids , which comprise an activity of a parent molecule. Portions of this type can be obtained by applying standard recombinant nucleic acid techniques or synthesized by using conventional liquid or solid phase synthesis techniques. For example, reference may be made to solution synthesis or solid phase synthesis as described, for example, in Chapter 9 entitled Peptide Synthesis by Atherton and Shephard, which is included in a publication entitled Synthetic Vaccines edited by Nicholson and published by Blackwell Scientific Publications. Alternatively, the peptides may be produced by digestion of a peptide or polypeptide of the disclosure with proteinases such as endoLys-C, endoArg-C, endoGlu-C and staphylococcus V8-protease. The digested fragments can be purified, for example, by high performance liquid chromatography (HPLC) techniques. Recombinant nucleic acid techniques may also be used to produce such portions. By corresponds to or corresponding to is meant a polynucleotide (a) that has a nucleotide sequence that is substantially identical or complementary to all or a part of a reference polynucleotide sequence or (b) that encodes an amino acid sequence identical to a reference polynucleotide sequence. of amino acids in a peptide or protein. This phrase also includes within its scope a peptide or polypeptide that has an amino acid sequence that is substantially identical to an amino acid sequence in a reference peptide or protein. The terms growth or regeneration, as used herein, mean growing a complete and differentiated plant from a plant cell, a group of plant cells, a part of the plant (including seeds) or a part of the plant (for example, from a protoplast, callus or part of tissue). As used herein, the term derived from refers to the origin or source, and may include naturally occurring, recombinant, unpurified or purified molecules. A nucleic acid or an amino acid derived from an origin or source may have all types of nucleotide changes or protein modification as defined elsewhere in the present description. By obtained from is meant that a sample such as, for example, a nucleic acid extract or a polypeptide extract is isolated from, or derived from, a particular source. For example, the extract can be isolated directly from plants, especially monocotyledonous plants and more especially non-grass monocotyledonous plants such as banana. The term pathogen is used herein in its broadest sense to refer to an organism or infectious agent whose infection of viable plant tissue cells elicits a disease response. By variant polypeptide is meant a polypeptide derived from the native protein by deletion (called truncation) or addition of one or more amino acids to the N-terminal and / or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein. The variant proteins encompassed by the present disclosure are biologically active, that is, they still possess the desired biological activity of the native protein, that is, the modulatory or regulatory activity as described herein. Such variants may result from, for example, genetic polymorphism or human manipulation. Biologically active variants of a native R protein of the disclosure will have at least 40%, 50%, 60%, 70%, generally at least 75%, 80%, 85%, preferably about 90% to 95% or more, and more preferably about 98% or more sequence identity with the amino acid sequence for the native protein as determined by sequence alignment programs described elsewhere herein using predetermined parameters. A biologically active variant of a protein of the disclosure may differ from that protein by as few as 1-15 amino acid residues, as few as 1-10, as many as 6-10, as few as 5, as many as 4, 3, 2, or even 1. amino acid residue. The proteins of the disclosure can be altered in a variety of ways, including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants of R proteins can be prepared by mutations in DNA. Methods for mutagenesis and ινΐΛ / a / zuzz / uuu 102 nucleotide sequence alterations are well known in the art. See, for example, Kunkel (1985) Proc. Nati. Academic Sci USA 82:488-492; Kunkel et al (1987) Methods in EnzymoL 154:367-382; United States Patent No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Nati. Biomed. Res. Found., Washington, D.C.), incorporated herein by reference. Conservative substitutions may be preferred, such as exchanging one amino acid for another having similar properties. Deletions or additions of individual substitutions that alter, add or eliminate a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 1%) in an coded sequence are conservatively modified variations, where the alterations give rise to the replacement of an amino acid by a chemically similar amino acid. Conservative substitution tables that provide functionally similar amino acids are well known in the art. The following five groups each contain amino acids that are conservative substitutions for each other, Aliphatic: Glycine (G), Alanine (A), Valine (V), Leucine (L), Isoleucine (I); Aromatic: Phenylalanine (F), Tyrosine (Y), Tryptophan (W); With sulfur content: Methionine (M), Cysteine ​​(C); Basic: Arginine I, Lysine (K), Histidine (H); Acid: Aspartic acid (D), Glutamic acid (E), Asparagine (N), Glutamine (Q). See also, Creighton, 1984. Additionally, individual substitutions, deletions, or additions that alter, add, or delete a single amino acid or a small percentage of amino acids in a coded sequence are also conservatively modified variations. Expression cassette, as used herein, means a DNA sequence capable of directing the expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest that is operably linked. linked to termination signals. It also typically comprises sequences necessary for proper translation of the nucleotide sequence. The coding region typically encodes a protein of interest, but may also encode a functional RNA of interest, for example, antisense RNA or an untranslated RNA, in the sense or antisense direction. The expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette may also be one of natural origin but which has been obtained in a recombinant form useful for heterologous expression. Expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or an inductive promoter that initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a multicellular organism, the promoter may also be specific for a particular tissue or organ or developmental stage in animals and / or plants, including banana species. As used herein, the term vector, plasmid or construct generally refers to any plasmid or virus that encodes an exogenous nucleic acid. The term MA / a / ZUZZ / UUUI oz should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acid to virions or cells, such as, for example, polylysine compounds and the like. The vector may be a viral vector that is suitable as a delivery vehicle for the administration of the nucleic acid, or mutant thereof, to a cell, or the vector may be a non-viral vector that is suitable for the same purpose. Examples of viral and non-viral vectors for delivery of DNA to cells and tissues are well known in the art and are described, for example, in Ma et al. (1997, Proc. Nati. Acad. Sci. USA 94: 12744- 12746). Examples of viral vectors include, but are not limited to, recombinant plant viruses. Non-limiting examples of plant viruses include, TMV-mediated (transient) transfection in tobacco (Tuipe, T-H. et al. (1993), J. Virology Meth, 42:227-239), ssDNA genome viruses (e.g. , family Geminiviridae), reverse transcription viruses (e.g., families Caulimoviridae, Pseudoviridae and Metaviridae), viruses with dsRNA (e.g., families Reoviridae and Partltiviridae), viruses with ssRNA (-) (e.g., families Rhabdoviridae and Bunyaviridae), viruses with ssRNA (+) (e.g. families Bromoviridae), Closteroviridae, Comovirídae, Luteoviridae, Potyviridae, Sequiviridae and Tombusviridae) and viroids (e.g. families Pospiviroldae and Avsunviroidae). Detailed information on the classification of plant viruses can be found in Fauquet et al. (2008, Geminivirus strain demarcation and nomenclature). Archives of Virology 153:783-821, incorporated herein by reference in its entirety), and Khan et al. (Plant viruses as molecular pathogens; Publisher Routledge, 2002, ISBN 1560228954, 9781560228950). Examples of non-viral vectors include, but are not limited to, liposomes, polyamine derivatives of DNA and the like. In addition, vector is defined to include, among others, any plasmid, cosmid, phage or binary vector of Agrobacterium in linear or circular, double-stranded or single-stranded form, which may or may not be self-transmissible or mobilizable, and which can transform host prokaryotes or eukaryotes, either by integration into the cellular genome or existing extrachromosomally (e.g., autonomously replicating plasmid with an origin of replication). Specifically included are shuttle vectors, by which we mean a DNA carrier capable, naturally or by design, of replicating in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotes (e.g., cells). from higher plants, mammals, yeasts or fungi). Preferably, the nucleic acid in the vector is under the control of and is operably linked to an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial cell, for example, bacterial or plant. The vector may be a bifunctional expression vector that functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell. Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites into which foreign DNA sequences can be inserted in a given manner without loss of the essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes providing tetracycline resistance, hygromycin resistance or ampicillin resistance. As used herein, the term resistant, or resistance, describes a plant, line or cultivar that shows fewer or reduced symptoms of a pest or biotic pathogen than a plant, line or variety susceptible (or more susceptible) to that biotic pest or pathogen. These terms are variously applied to describe plants that do not show symptoms, as well as plants that exhibit some symptoms but can still produce a marketable product with an acceptable yield. Some lines referred to as resistant are so only in the sense that they can still produce a crop, although the plants may appear visually stunted and yield is reduced compared to uninfected plants. As defined by the International Seed Federation (ISF), a non-profit, non-governmental organization representing the seed industry (see Definition of the Terms Describing the Reaction of Plants to Pests or Pathogens and to Abiotic Stresses for the Vegetable Seed Industry, May 2005), recognizing whether a plant is affected or subject to a pest or pathogen may depend on the analytical method used. The ISF defines resistance as the ability of plant types to restrict the growth and development of a specific pest or pathogen and / or the damage they cause compared to susceptible plant varieties under similar environmental conditions and pest or pathogen pressure. Hardy plant types may still show some symptoms of disease or damage. Two levels of resistance are defined. The term high / standard resistance is used for plant varieties that greatly restrict the growth and development of the specified pest or pathogen under normal pest or pathogen pressure compared to susceptible varieties. “Moderate / intermediate resistance” applies to plant types that restrict the growth and development of the specified pest or pathogen, but exhibit a greater range of symptoms or damage compared to plant types with high resistance. Plant types with intermediate resistance will show less severe symptoms than susceptible plant varieties, when grown under similar field conditions and pathogen pressure. Methods for evaluating resistance are well known to those skilled in the art. Such evaluation can be done by visually observing a plant or plant part (e.g., leaves, roots, flowers, fruits, etc.) to determine the severity of symptoms. For example, when each plant is assigned a resistance score on a scale of 1 to 5 based on the severity of the reaction or symptoms, with 1 being the resistance score applied to the most resistant plants (e.g., without symptoms or with the least symptoms), and 5 the score applied to the plants with the most severe symptoms, then a line is classified as resistant when at least 75% of the plants have a resistance score at a level 1, 2 or 3, while susceptible lines are those with more than 25% of plants scoring 4 or 5. If a more detailed visual evaluation is possible, then a scale of 1 to 10 can be used to widen the range of scores and hopefully provide a greater distribution of scores among the plants being evaluated. MA / a / 2U22 / UUU1 02 Another scoring system is a root inoculation test based on the development of necrosis after inoculation and its position towards the cotyledon (such as one derived from Bosland et al., 1991), where 0 represents no symptoms after inoculation. infection; 1 represents a small necrosis in the hypocotyl after infection; 2 necrosis is found under the cotyledons after infection; 3 means necrosis above the cotyledons after infection; 4 represents necrosis above the cotyledons along with wilting of the plant after infection, while finally 5 represents a dead plant. In addition to such visual assessments, disease assessments can be performed by determining the biodensity of the pathogen in a plant or plant part by electron microscopy and / or by molecular biological methods, such as protein hybridization (e.g., ELISA , pathogen protein density measurement) and / or nucleic acid hybridization (e.g., PCR-RT, pathogen RNA density measurement). Depending on the particular pathogen / plant combination, a plant may be determined to be resistant to the pathogen, for example, if it has a pathogen RNA / DNA and / or protein density of about 50%, about 40%, or about 30%, or about 20%, or about 10%, or about 5%, or about 2%, or about 1%, or about 0.1%, or about 0.01%, or about 0.001%, or approximately 0.0001% of the RNA / DNA and / or protein density in a susceptible plant. The methods used in breeding plants for disease resistance are similar to those used in breeding other traits. It is necessary to know as much as possible about the nature of the inheritance of resistant characters in the host plant and the existence of physiological races or strains of the pathogen. As used herein, the term total resistance refers to the complete lack of development of the pathogen after infection, and may be the result of lack of entry of the pathogen into the cell (no initial infection) or may be the result of failure of the pathogen to multiply in the cell and infect subsequent cells (no subliminal infection, no dissemination). The presence of complete resistance can be determined by establishing the absence of pathogenic protein or pathogenic RNA in the plant cells, as well as the absence of any disease symptoms in said plant, after exposure of said plant to an infectious dose of pathogen. (i.e. after 'infection'). Among breeders, this phenotype is often called immune. Immunity, as used herein, therefore refers to a form of resistance characterized by the absence of pathogen replication even when the pathogen is actively transferred into cells, for example, by electroporation. As used herein, the term partial resistance refers to reduced multiplication of the pathogen in the cell, reduced (systemic) movement of the pathogen, and / or reduced development of symptoms after infection. The presence of partial resistance can be determined by establishing the systemic presence of low concentration of pathogenic protein or pathogenic RNA in the plant and the presence of decreased or delayed disease symptoms in said plant after exposure to said plant. MA / a / ZUZZ / UUUI oz plant to an infectious dose of pathogen. The protein concentration can be determined by using a quantitative detection method (for example, an ELISA method or a quantitative reverse transcriptase polymerase chain reaction (RT-PCR)). Among breeders, this phenotype is often called intermediate resistance. As used herein, the term tolerant is used herein to indicate a phenotype of a plant where disease symptoms remain absent upon exposure of said plant to an infectious dose of pathogen, whereby the presence of a systemic or local pathogenic infection, multiplication of pathogens, at least the presence of genomic sequences of pathogens in cells of said plant and / or genomic integration thereof can be established. Therefore, tolerant plants are resistant to the expression of symptoms, but asymptomatic carriers of the pathogen. Sometimes pathogen sequences can be present or even multiply in plants without causing disease symptoms. This phenomenon is also known as latent infection. In latent infections, the pathogen may exist in a truly latent non-infectious occult form, possibly as an integrated genome or an episomal agent (so that the pathogen protein cannot be found in the cytoplasm, while PCR protocols can indicate the presence of nucleic acid sequences of the pathogen) or as an infectious and continuously replicating agent. A reactivated pathogen can spread and start an epidemic among susceptible contacts. The presence of a latent infection is indistinguishable from the presence of a tolerant phenotype in a plant. As used herein, the term "susceptible" is used herein to refer to a plant with no or virtually no resistance to the pathogen, resulting in entry of the pathogen into the plant and multiplication and dissemination. of the pathogen, resulting in symptoms of disease. Therefore, the term susceptible is equivalent to not resistant. As used herein, the term offspring refers to any plant resulting from a vegetative or sexual reproduction of one or more parent plants or descendants thereof. For example, a progeny plant can be obtained by cloning or selfing a parent plant or by crossing two parent plants and include selfing as well as F1 or F2 or even subsequent generations. An F1 is a first generation offspring produced from parents, at least one of which is used for the first time as a donor of a trait, while offspring from the second generation (F2) or later generations (F3, F4, etc.) are specimens produced from self-fertilizations of F1, F2, etc. An F1 can be (and usually is) a hybrid resulting from a cross between two true breeding parents (the true breeding is homozygous for a trait), while an F2 can be (and usually is) an offspring resulting from self-pollination of said F1 hybrids. As used herein, the terms dicotyledon, dicot, and dicots refer to a flowering plant that has an embryo containing two seed halves or cotyledons. Examples include tobacco; tomato; legumes, which include peas, alfalfa, clover and soybeans; Oak trees; maples; roses; mints; pumpkins; daisies; walnuts; Cactus; violets and buttercups. As used herein, the terms monocotyledon, monocot or monocots refer to any subclass (Monocotyledoneae) of flowering plants that have an embryo containing only one seed leaf and that generally have parallel-veined leaves, flower parts in multiples of three, and have no secondary growth on stems and roots. Examples include plantain, daffodils, sugarcane, ginger, lily, orchid, rice, corn, grasses, such as tall fescue, goatgrass, and Kentucky bluegrass; cereals, such as wheat, oats and barley; lilies; onion and palm. As used herein, the term gene refers to any segment of DNA associated with a biological function. Therefore, genes include, but are not limited to, coding sequences and / or regulatory sequences necessary for their expression. Genes may also include unexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesis from known or predicted sequence information, and can include sequences designed to have desired parameters. As used herein, the term genotype refers to the genetic composition of an individual cell, cell culture, tissue, organism (e.g., a plant), or group of organisms. As used herein, the term allele or alleles means any one or more alternative forms of a gene, which are related to at least one trait or characteristic. In a diploid cell, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. Since the present description refers to QTL, that is, genomic regions that may comprise one or more genes or regulatory sequences, in some cases it is more accurate to refer to haplotype (that is, an allele of a chromosomal segment) instead of allele. However, in those cases, the term allele should be understood to include the term haplotype. Alleles are considered identical when they express a similar phenotype. Differences in sequence are possible, but not important as long as they do not influence the phenotype. As used herein, the term locus (plural: loci) refers to any site that has been genetically defined. A locus can be a gene, or part of a gene, or a DNA sequence that has some regulatory function and can be occupied by different sequences. As used herein, the term molecular marker or genetic marker refers to an indicator that is used in methods to visualize differences in the characteristics of nucleic acid sequences. Examples of these indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNP), insertion mutations, microsatellite markers (SSR), sequence characterized amplified (SCAR), cleaved amplified polymorphic sequence (CAPS) markers or enzyme markers or combinations of the markers described herein, which define a specific genetic and chromosomal location. The mapping of MA / a / ZUZZ / UUUI 04 molecular markers in the vicinity of an allele is a procedure that can be performed quite easily by an average person skilled in molecular biology techniques, techniques that are described, for example, in Lefebvre and Chevre, nineteen ninety five; Lorez and Wenzel, 2007, Srivastava and Narula, 2004, Meksem and Kahl, 2005, Phillips and Vasil, 2001. General information on AFLP technology can be found in Vos et al. (1995, AFLP: a new technique for DNA fingerprinting, Nucleic Acids Res. 1995 November 11; 23(21): 4407-4414). As used herein, the term hemizygous refers to a cell, tissue or organism in which a gene is present only once in a genotype, such as a gene in a haploid cell or organism, a sex-linked gene in the heterogametic sex, or a gene on a chromosome segment in a diploid cell or organism where its associated segment has been deleted. As used herein, the term heterozygous refers to an individual diploid or polyploid cell or plant that has different alleles (forms of a given gene) present at at least one locus. As used herein, the term heterozygous refers to the presence of different alleles (forms of a given gene) at a particular gene locus. As used herein, the term homozygous refers to an individual cell or plant that has the same alleles at one or more loci. As used herein, the term homozygous refers to the presence of identical alleles at one or more loci on homologous chromosome segments. As used herein, the term homolog or homologs are known in the art and refers to related sequences that share a common ancestor or family member and is determined based on the degree of sequence identity. The terms homology, homologous, substantially similar and substantially corresponding are used interchangeably herein. Homologs generally control, mediate, or influence the same or similar biochemical pathways, but particular homologs may give rise to different phenotypes. Therefore, it is understood, as those skilled in the art will appreciate, that the description encompasses more than the specific exemplary sequences. These terms describe the relationship between a gene found in one species, subspecies, variety, crop or strain and the corresponding or equivalent gene in another species, subspecies, variety, crop or strain. For the purposes of this description, homologous sequences are compared. The term homolog is sometimes used to apply to the relationship between genes separated by the speciation event (see ortholog) or the relationship between genes separated by the gene duplication event (see paralog). The term homeologous refers to a homeologous gene or chromosome, which results from polyploidy or chromosome duplication events. This contrasts with the more common term homologue, which was defined above. The term ortholog refers to genes from different species that evolved from a common ancestral gene by speciation. Normally, orthologs retain the same function in the course of evolution. Identification of orthologs is critical for reliable prediction of gene function in newly sequenced genomes. ΜΛ / a / ZUZZ / UUU 1 oz The term paralog refers to genes related by duplication within a genome. While orthologs generally retain the same function in the course of evolution, paralogs can develop new functions, even if they are related to the original. Homologous sequences or homologs or orthologs are believed or known to be functionally related. A functional relationship can be indicated in several ways, including, but not limited to: (a) degree of sequence identity and / or (b) same or similar biological function. Preferably, both (a) and (b) are indicated. The degree of sequence identity may vary, but in one embodiment, it is at least 50% (when using standard sequence alignment programs known in the art), at least 60%, at least 65%, at least 70%. at least 75%, at least 80%, at least 85%, at least 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95% at least about 96%, at least about 97%, at least about 98%, or at least 98.5%, or at least about 99%, or at least 99.5%, or at least 99.8%, or at least 99.9%. Homology can be determined by using software programs readily available in the art, such as those discussed in Current Protocols in Molecular Biology (FM Ausubel et al., Eds., 1987) Supplement 30, section 7.718, Table 7.71. Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, United Kingdom) and ALIGN Plus (Scientific and Educational Software, Pennsylvania). Other non-limiting alignment programs include Sequencher (Gene Codes, Ann Arbor, Michigan), AlignX, and Vector NTI (Invitrogen, Carlsbad, CA). As used herein, the term hybrid refers to any individual cell, tissue or plant resulting from a cross between parents that differ in one or more genes. As used herein, the term inbred or inbred line refers to a relatively authentic breeding strain. The term single-allele converted plant, as used herein, refers to those plants that are developed by a breeding technique called backcrossing, where essentially all of the desired morphological and physiological characteristics of an inbreed are recovered in addition to the single allele transferred to inbreeding by the backcrossing technique. As used herein, the term line is used broadly to include, but is not limited to, a group of plants vegetatively propagated from a single parental plant, by tissue culture techniques, or a group of inbred plants that They are genetically very similar due to descent from common parent(s). A plant is said to belong to a particular line if (a) it is a primary transformant plant (T0) regenerated from material from that line; (b) has a pedigree composed of a T0 plant from that line; or (c) is genetically very similar due to a common ancestor (for example, by inbreeding or selfing). In this context, the term pedigree denotes the lineage of a plant, for example, in terms of affected sexual crosses such that a gene or combination of genes, in heterozygous (hemyzygous) or homozygous condition, imparts a desired trait to the plant. . MA / a / 4U44 / UUU1 04 As used herein, the terms introgression or introgressed refer to the process by which genes from one species, variety or crop are moved into the genome of another species, variety or crop, by crossing those species. The crossing can be natural or artificial. The process can optionally be completed by backcrossing to the recurrent parent, in which case introgression refers to the infiltration of the genes of one species into the gene pool of another through repeated backcrossing of an interspecific hybrid with one of its parents. An introgression can also be described as heterologous genetic material stably integrated into the genome of a recipient plant. As used herein, the term population means a genetically homogeneous or heterogeneous collection of plants that share a common genetic derivation. As used herein, the term variety or cultivar means a group of similar plants that by structural characteristics and performance can be identified from other varieties within the same species. The term variety, as used in this description, has a meaning identical to the corresponding definition in the International Convention for the Protection of New Varieties of Plants (UPOV Treaty), of December 2, 1961, revised in Geneva on December 10. November 1972, October 23, 1978 and March 19, 1991. Therefore, variety means a grouping of plants within a single botanical taxon of the lowest known rank, which grouping, regardless of whether the conditions are fully met for the granting of a breeder's right, it can i) be defined by the expression of the characteristics resulting from a certain genotype or combination of genotypes, i) be distinguished from any other group of plants by the expression of at least one of said characteristics and iii) considered as a unit in terms of its suitability to propagate unaltered. As used herein, the term mass selection refers to a form of selection in which individual plants are selected and the next generation is propagated from the aggregate of their seeds. Further details of dough selection are described in the specifications of this description. As used herein, the term open pollination refers to a plant population that is freely exposed to some gene flow, as opposed to a closed one in which there is an effective barrier to gene flow. As used herein, the terms open-pollinated population or open-pollinated variety refer to plants normally capable of at least some cross-fertilization, selected according to a standard, that may show variation but that also have one or more genotypic characteristics. or phenotypic characteristics by which the population or variety can be differentiated from others. A hybrid, which has no barriers to cross-pollination, is an open-pollinated population or an open-pollinated variety. As used herein, the term self-crossing or self-pollination means that pollen from a flower on a plant is applied (artificially or naturally) to the ovule (stigma) of the same or different flower on the same plant. MA / a / ZUZZ / UUUI oz As used herein, the terms crossing, crossing or cross-pollination or “cross-breeding” refer to the process by which pollen from a flower on a plant is applied (artificially or naturally) to the ovule (stigma) of a plant. flower on another plant. As used herein, the term derived from refers to the origin or source, and may include naturally occurring, recombinant, unpurified or purified molecules. A nucleic acid or an amino acid derived from an origin or source may have all types of nucleotide changes or protein modification as defined elsewhere in the present description. The term primer, as used herein, refers to an oligonucleotide that is capable of hybridizing with the amplification target allowing a DNA polymerase to bind, and thus serves as a starting point for the synthesis of DNA when placed under conditions in which synthesis of the primer extension product is induced, that is, in the presence of nucleotides and a polymerizing agent such as DNA polymerase and at a suitable temperature and pH. The (amplification) primer is preferably single-stranded for maximum amplification efficiency. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be long enough to prime the synthesis of extension products in the presence of the polymerizing agent. The exact lengths of the primers will depend on many factors, including the temperature and composition (the A / T and G / C content) of the primer. A bidirectional primer pair consists of a forward and a reverse primer as commonly used in the art of DNA amplification, such as PCR amplification. A probe comprises an identified isolated nucleic acid that recognizes a target nucleic acid sequence. A probe includes a nucleic acid that is bound to a target location, a detectable marker or other reporter molecule and that hybridizes with a target sequence. Typical labels include radioactive isotopes, enzyme substrates, cofactors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in choosing appropriate labels for various purposes are discussed, for example, in Samórook et al., (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Coid Spring Hardor Ladoratory Press, Coid Spring Hardor, NY, 1989 and Ausudel et al. Short Protocols in Molecular Biology, 4,hed., John Wiley & Sons, Inc., 1999. Methods for preparing and using nucleic acid probes and primers are described, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nded., vol. 1-3, Coid Spring Harbor Laboratory Press, Coid Spring Harbor, NY, 1989; Ausubel et al., Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999; and Innis et al., PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990. Amplification primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose, such as PRIMER (Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge, MA). One skilled in the art may understand that the specificity of a particular probe or primer increases with its length. In this way, to obtain greater specificity, probes and primers can be selected that comprise at least 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of a sequence. target nucleotides. For PCR amplifications of the polynucleotides described herein, oligonucleotide primers can be designed for use in PCR reactions to amplify the corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are described in Sambrook et al., (2001) Molecular Cloning: A Laboratory Manual (3rd ed., Coid Spring Harbor Laboratory Press, Plainview, New York). . See also Innis et al., eds. (1990 PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known PCR methods include, but are not limited to, methods using paired primers, nested primers, single-specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially poorly matched and similar. The present description provides an isolated nucleic acid sequence comprising a sequence selected from the group consisting of FusR 1, FusR1 homologs, FusR1 orthologs, FusR1 paralogs and fragments and variations thereof. In one embodiment, the present disclosure provides an isolated polynucleotide that encodes a protein produced by the nucleic acid sequence for FusR1, comprising a nucleic acid sequence that shares at least 70%, at least 75%, at least 80%, at at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97 %, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identity with FusR1. Methods of aligning sequences for comparison are well known in the art. Various alignment programs and algorithms are described in: Smith and Waterman (Adv. Appl. Math., 2:482, 1981); Needleman and Wunsch (J. Mol. Biol., 48:443, 1970); Pearson and Lipman (Proc. Nati. Acad. Sel., 85:2444, 1988); Higgins and Sharp (Gene, 73:237-44, 1988); Higgins and Sharp (CABIOS, 5:151-53, 1989); Corpet et al., (Nuc. Acids Fies., 16:10881-90, 1988); Huang et al., (Comp. Appls Biosci., 8:155-65, 1992); and Pearson et al., (Meth. Mol. Biol., 24:307-31, 1994). Altschul et al., (Nature Genet., 6:119-29, 1994) presents a detailed consideration of sequence alignment methods and homology calculations. The present disclosure also provides a chimeric gene comprising the isolated nucleic acid sequence of any of the polynucleotides described above operably linked to suitable regulatory sequences. The present description also provides a recombinant construct comprising the chimeric gene as described above. In one embodiment, said recombinant construct is a gene silencing construct, such as used in RNAi gene silencing. In another embodiment, said recombinant construct is a gene editing construct, such as used in the CRISPR-Cas gene editing system. The expression vectors of the present disclosure may include at least one selectable marker. Such markers include genes for dihydrofolate reductase, G418 or neomycin resistance for culture of eukaryotic cells and resistance to tetracycline, kanamycin or ampicillin for culture in E. coli and other bacteria. The present description also provides a transformed host cell comprising the chimeric gene as described above. In one embodiment, said host cell is selected from the group consisting of bacteria, yeast, filamentous fungi, algae, animals and plants including, but not limited to, the genus Musa. These sequences allow the design of gene-specific primers and probes for FusR1, FusR1 homologs, FusR1 orthologs, FusR1 homeologs, FusR1 paralogs, and fragments and variations thereof. II. Modulation of disease resistance The present description refers to polynucleotides and / or polypeptides of recently identified FusR1 (Fusarium Resistance 1) and methods to modulate, stimulate or improve resistance to diseases in plants, caused by pathogens. Pathogens of the disclosure include, but are not limited to, bacteria, fungi, viruses or viroids, nematodes, insects and the like. Bacterial pathogens include, but are not limited to, Pseudomonas Avenae subsp. Avenae, Xanthomonas campestris pv. holcicola, Enterobacter dissolvens, Erwinía dissolvens, Ervinia carotovora subsp. carotovora, Erwinía chrysanthemi pv. zeae, Pseudomonas andropogonis, Pseudomonas syringae pv. coronafaciens, Clavibacter michiganensis subsp., Corynebacteríum michiganense pv. nebraskense, Pseudomonas syringae pv. syringae, herniparasitic bacteria (see fungi), Bacillus subtilis, Erwinía stewartii and Spiroplasma kunkelii. Pathogens include, but are not limited to: Collelotrichum graminicola, Glomerella graminicola Politis, Glomerella lucumanensis, Aspergillus flavus, Rhizoctonia solani Kuhn, Thanatephorus cucumeris, Acremonium strictum l / U. Gams, Cephalosporium acremonium Auct. non Corda Black Lasiodiplodia theobromae=Bolr odiplodia y theobromae White border Marasmiellus sp., Physoderma maydis, Cephalosporium Corticium sasakii, Curvularia clavata, C. maculans, Cochhobolus eragrostidis, Curvularia inaequahs, C. intermedia (teleomorph: Cochhobolus intermedius), Curvularia lunata (teleomorph : Cochliobolus lunatus), Curvularia pallescens (teleomorph: ochliobolus pallescens), Curvularia senegalensis, C. luberculata (teleomorph: Cochliobolus tuberculatus), Didymella exítalis Diplodiaftumenti (teleomorph: Botryosphaeriafestucae), Diplodia maydis=Stenocarpella maydis, Stenocarpella macrospora=Diplodia macrospor a, Sclerophthora rayssiae var. zeae, Sclerophthora macrospora=Sclerospora macrospora, Sclerospora graminicola, Peronosclerospora maydis=Sclerospora maydis, Peronosclerospora phih'ppinensis, Sclerospora philippinensis, Peronosclerospora sorghi=Sclerospora sorghi, Peronosclerospora spontanea=Sclerospora spontanea, But nosclerospora sacchari=Sclerospora sacchari, Nigrospora oryzae (teleomorph: Khuskia oryzae ) A. alternating ternary=A. tenuis, Aspergillus glaucus, A. niger, Aspergillus spp., Botrytis cinerea, Cunninghamella sp., Curvulariapallescens, Doratomyces slemonitis=Cephalotrichum slemonitis, Fusarium culmorum, Gonatobotrys simplex, Pithomyces maydicus, Rhízopus microsporus Tiegh., R. stolonifer=R. nigricans, Scopulariopsis brumptii, Claviceps gigantea (anamorph: Sphacelia sp.) Aureobasidium zeae=Kabatiella zeae, Fusarium subglutinans=F. moniliforme var. subglutinans, Fusarium moniliforme, Fusarium gallinaceum (teleomorph: Gibberella gallinacea), Botryosphaeria zeae=Physalospora zeae (anamorph: Allacrophoma zeae), Cercospora sorghi=C. sorghi var. maydis, Helminthosporium pedicellatum (teleomorph: Selosphaeriapedicellata), Cladosporium cladosporioides=Hormodendrum cladosporioides, C. herbarum (teleomorph: Mycosphaerella tassiana), Cephalosporium maydis, A. Iternaria alternata, A. scochyta maydis, A. tritici, A. zeicola, Bipolaris victoriae, Helminthosporium victoriae (teleomorph: Cochhoholus victoriae), C. sativus (anamorph: Bipolaris sorokiniana=H. sorokinianum=H. sativum), Epicoccum nigrum, Exserohilum prolatum=Drechslera prolata (teleomorph: Setosphaeriaprolata), Graphium penicillioides, Leptosphaeria maydis, Leptothyrium zeae, Ophiosphaerella herpotricha (anamorph: Scolecosporiella sp.), Pataphaeosphaeria michotü, Phoma sp., Septoria zeae, S. zeicola, S. zeina Setosphaeria turcica, Exserohilzim turcicum=Helminthosporium furcicum, Cochhoholus carbonum, Bipolaris zeicola=Helminthosporíum carhonum, Penicil hum spp., P chrysogenum, P. expansum, P. oxalicum, Phaeocytostroma ambiguum, Phaeocylosporella zeae, Phaeosphaeria maydis=Sphaerulina nmaydis, Botryosphaeriafestucae=Physalospora zeicola (anamorph: Diplodiaftumenfi), Herniparasitic bacteria and fungi Pyrenochaeta Phoma terrestris=Pyrenochaeta terrest ris, Pythiumn spp., P. arrhenomanes, P. graminicola, Pythium aphanidermatum=P. hutleri L., Rhizoctonia zeae (teleomorph: Waitea circinata), Rhízoctonia solani, minorA Iternaria altérnala, Cercospora sorghi, Dictochaetaftrtilis, Fusarium acuminatum (teleomorph: Gihherella acuminata), E. equiseti (teleomorph: G. intricans), E. oxysporum, E. pallidoroseum, E. poae, E. roseum, G. cyanogena (anamorph: E. sulphureum), Microdochium holleyi, Mucorsp., Periconia circinata, Phytophthora cactorum, P. drechsleri, P. nicotianae var. parasitica, Phytophthora spp., Rhízopus arrhizus, Setosphaeria rostrata, Exserohilum rostratum=Helminthosporium rostratum, Puccinia sorghi, Physopella pallescens, P. zeae, Sclerotium rofsii Sacc. (teleomorph: Athelia rotfsii), Bipolaris sorokiniana, B. zeicola=Helminthosporium carbonum, Diplodia maydis, Exserohilum pedicillatum, Exserohilum furcicum=Helminthosporium turcicum, Fusarium gallinaceum, E. culmorum, E. moniliforme, Gibberella zeae (anamorph—E. graminearum), Macrophominaphaseolina, Penicillium spp., Phomopsis sp., Pythium spp., Rhizoctonia solani, R. zeae, Sclerotium rolfsfi, Spicaria sp., Selenophoma sp., Gaeumannomyces graminis, Myrothecium gramineum, Monascus purpureus, M. ruber Smut, Ustilago zeae=U . maydis Smut, Ustilaginoidea virens Smut, Sphacelotheca reiliana=Sporisorium holci, Cochliobolus heterostrophus (anamorph: Bipolaris maydis=Helminthosporium maydis), Stenocarpella macrospora=Diplodia macrospora, Cercospora sorghi, Fusarium episphaeria, E. merismoides, F. oxysporum Schlechtend, Fusarium oxysporum f. sp. cubense (Foc), Fusarium spp., E. poae, E. roseum, E. solani (teleomorph: Nectria haematococca), F. tricincturn, Maríannaea elegans, Mucor sp., Rhopographus zeae, Spicaria sp., Aspergillus spp., Penicillium spp., Trichoderma viride=T. teleomorphic lignorum: Hypocrea sp., Stenocarpella maydis=Diplodia zeae, Ascochyta WlAiai4V44IVUUl Ό4 ischaemi, Phyllosticta maydis (teleomorph: Mycosphaerella zeae-maydis), Mycosphaerella fijiensis, Pseudocercospora (Paracercospora) fijiensi and Gloeocercospora sorghi. Viruses or viroids include, but are not limited to: American wheat streak mosaic virus (AWSMV), barley streak mosaic virus (BSMV), barley yellow dwarf virus (BYDV), banana cluster virus, Brome mosaic virus (BMV), cereal chlorotic mottle virus (CCMV), corn chlorotic vein band virus (CCVBV), corn chlorotic mottle virus (MCMV), corn dwarf mosaic virus (MDMV), A or B, wheat streak mosaic virus (WSMV), cucumber mosaic virus (CMV), cynodon chlorotic streak virus (CCSV), Johnsongrass mosaic virus (JGMV), corn bushy stunt or mycoplasma-like organism (NILO), corn chlorotic dwarf virus (MCDV), corn chlorotic mottle virus (MCMV), corn dwarf mosaic virus (MDMV) A strains, D, E and F, corn leaf spot virus (MLFV), corn line virus (NELV), corn mosaic virus (MMV), corn mottle and chlorotic dwarf virus, maize pellucid ringspot virus (MPRV), maize thick streak virus (MRGV), maize fine streak virus (MRFV), maize red leaf and red streak virus (MRSV), mottle virus corn ring virus (MRMV), corn river quarter virus (MRCV), corn rough dwarf virus (MRDV), corn sterile dwarf virus (barley yellow streak virus strains), corn streak virus (MSV), corn chlorotic streak, corn leaf, corn white streak virus, corn stunt virus, corn tassel abortion virus (MTAV), corn vein virus (MVEV), Maize wallaby ear (MAVEV), Maize white leaf virus, Maize white line mosaic virus (NTVVLMV), Red millet leaf virus (NMV), Nanoviridae family virus, Maize mosaic virus northern cereal virus (NCMV), oat pseudorosette virus, oat sterile dwarf virus (OSDV), rice black striped dwarf virus (RBSDV), rice stripe virus (RSV), mosaic virus sorghum (SrMV), formerly sugarcane mosaic virus (SCMV) strains Η, I and M, sugarcane Fiji disease virus (FDV), sugarcane mosaic virus (SCMV ) strains A, B, D, E, SC, BC, Sabi and NM vein viruses and wheat spot mosaic virus (WSMV). Parasitic nematodes include, but are not limited to: Awl Dolichodorus spp., D. heterocephalus Bulb and stem (Europe), Ditylenchus dipsaci Burrower Radopholus similis Cyst Heterodera gallinae, H. zeae, Punctodera chalcoensis Dagger Xiphinema spp., X. americanum, Christmas tree , P. thornei, P. zeae Needle Longidorus spp., L. breviannulatus Ring Criconemella spp., C ornata Root Knot Meloidogyne spp., M. chitwoodi, M. incógnita, M. javanica Spiral Helicotylenchus spp., Belonolaimus spp. , B. longicaudatus Stubby root Paratrichodorus spp., P. christiei, P. minor, Ouinisulcius aculus and Trichodorus spp. Insect pests include insects selected from the orders Coleoptera, Diptera, Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera, Orthoptera, Thysanoptera, Dermaptera, Isoptera, Anoplura, Siphonaptera, Trichoptera, etc., particularly Coleoptera and Lepidoptera. In some embodiments, the plant pathogen is selected from fungi, especially soil fungi such as Fusarium oxysporum, water and air viruses such as Mycosphaerella fijiensis (Morelet), Mycosphaerella musicola (Leach ex Mulder), Pseudocercospora (Paracercospora) fijiensi, Verticillium dahliae. , Cladosporium and fialstone Solanaceum. In some embodiments, said disease is Fusarium wilt, also known as Panama disease, which is a lethal fungal disease caused by the fungus Fusarium oxysporum I. sp. cubense (Foc) that is transmitted through the soil. This disease can also be known as Panama disease TR4, Foc, Panama disease Tropical Race 4 or TR4. In some embodiments, resistance to TR4 is combined within a single cultivar with genetic resistances or tolerances to one or more additional diseases, such as resistance to diseases caused by bacteria, other fungi, viruses, nematodes, insects, and the like. Fusarium wilt is one of the most destructive and notorious diseases of banana. It is also known as Panama disease, in recognition of the extensive damage it caused to the export plantations of this Central American country. By 1960, Fusarium wilt had destroyed approximately 40,000 ha of ’Gros Michel' (AAA), causing the export industry to convert to Cavendish subgroup (AAA) cultivars (Ploetz and Pegg, 2000). Fusarium wilt is caused by the soil hyphomycete, Fusarium oxysporum Schlect. fsp. cover up It is one of more than 120 formae speciales (special forms) of F. oxysporum that cause vascular wilt of flowering plants. This pathogen affects species of Musa and Heliconia, and the strains have been classified into four physiological races based on pathogenicity to host cultivars in the field (race 1, 'Gros Michel'; race 2, 'Bluggoe'; race 3, Heliconia spp. .; and race 4, Cavendish cultivars and all cultivars susceptible to races 1 and 2). Four races of Fusarium oxysporum have been named, from race 1 to race 4. Race 1 is a critical pathogen of many banana cultivars. Race 2 attacks kitchen bananas. Race 3 affects banana relatives in the Americas, but does not appear to affect plantain. The current threat comes from the spread of Fusarium oxysporum race 4, also known as TR4 (Tropical Race 4), which is designated as 'Foc-TR4'. Race 4 has two subgroups, TR4 and SR4 (subtropical race 4). Until recently, race 4 had only been recorded causing severe losses in the subtropical regions of Australia, South Africa, the Canary Islands and Taiwan. Plantain growers and banana companies have repeatedly stated that if this breed were to become established in the Americas, global export industries would be severely affected as there is no widely accepted replacement for Cavendish cultivars (Bentley et al., 1998). ). Very recently (Stokstad, 2019), race 4 of Panama disease (Fusarium wilt) was detected in the Western Hemisphere. The disease was found in four plantations in Colombia. These four plantations were immediately quarantined. However, a substantial part of the banana market consists of exports from Central and South America to the United States. This market is now in serious danger, making a quick solution to the crisis even more urgent. The recent emergence of Panama disease TR4 in the Western Hemisphere makes a quick solution to the crisis even more urgent. MA / a / 4U44 / UUU1 04 In some embodiments, Fusarium Wilt or FW may be used interchangeably, designating the disease as displayed on infected banana plants. In the 1950s and 1960s, a single variety, Gros Michel, was widely cultivated. It was very sensitive to the easily spread fungus Fusarium oxysporum f sp. cover up In particular, it was Fusarium Tropical Race 1 (Foc-TR1) that caused a fatal wilt disease, and the global banana industry was almost destroyed. The Cavendish variety was found to be highly resistant to Foc-TR1 and replaced Gros Michel in global banana production. In the 1990s, growers began finding banana plants infected with Foc-TR4, an emerging race. Foc-TR4 also spreads easily and is found in banana plantations in Asia, the Middle East and Africa, once again threatening global banana cultivation. The recent identification of Foc-TR4 in the Caribbean has sparked widespread concern, meaning that the fungus now has a beachhead in the Western Hemisphere, and therefore threatens Latin American banana production. In some embodiments, the present disclosure provides a solution to serious problems in bananas caused by FocTR4. In some embodiments, the solution is directed toward identifying disease-resistant genetic materials and / or architectures and importing said genetic materials and architectures into banana varieties that are susceptible to pathogenic fungi (e.g., Foc-TR4). Bananas are also susceptible to other fungal pathogens, particularly Mycosphaerella fijiensis (Morelet), which causes black leaf streak disease (also known as Black Sigatoka), and M. musicola, which causes black leaf spot disease. Yellow Sigatoka. These fungi (M. fijiensis and M. musicola) are known to be controlled with fungicides, but fungicides are ineffective against Foc-TR4. The present description teaches a method to modulate, stimulate or improve resistance to diseases in plants, caused by pathogens such as Foc-TR4 through the use of next generation plant breeding techniques, also known as new breeding techniques. New breeding techniques (NBT) refer to various new technologies developed and / or used to create new traits in plants through genetic variation, the objective of which is targeted mutagenesis, targeted introduction of new genes or gene silencing. (RdDM). The following breeding techniques are within the scope of NBTs: Specific sequence changes facilitated through the use of zinc finger nuclease (ZFN) technology (ZFN-1, ZFN2 and ZFN-3, see US patent United States No. 9,145,565, incorporated by reference in its entirety), oligonucleotide-directed mutagenesis (ODM, also known as site-directed mutagenesis), cisgenesis and intragenesis, epigenetic approaches such as RNA-dependent DNA methylation (RdDM, which does not necessarily change the nucleotide sequence but can change the biological activity of the sequence), grafting (on GM rhizome), reverse breeding, agroinfiltration for transient gene expression (agroinfiltration sensu stricto, agroinoculation, floral dip), transcription activator-type effector nucleases (TALEN , see US Patents 8,586,363 and 9,181,535, incorporated by reference in their entirety), the CRISPR / Cas system (see US Patent Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,895,308; MA / a / 2U22 / UUU1 02 8,906,616; 8,932,814; 8,945,839; 8,993,233; and 8,999,641, which are incorporated herein by reference), genetically engineered meganuclease, genetically reengineered self-targeting endonucleases, DNA-guided genome editing (Gao et al., Nature Biotechnology (2016), doi: 10.1038 / nbt.3547, incorporated by reference in their totality) and synthetic genomics. An important part of today's targeted genome editing, another designation for new breeding techniques, are applications to induce a DNA double-strand break (DSB) at a selected location in the genome where the modification is intended. Targeted repair of the DSB allows for targeted genome editing. Such applications can be used to generate mutations (e.g., targeted mutations or precise editing of native genes) as well as precise insertion of genes (e.g., cisgenes, intragenes, or transgenes). Applications that lead to mutations are often identified as site-directed nuclease (SDN) technology, such as SDN1, SDN2, and SDN3. For SDN1, the result is a targeted nonspecific genetic deletion mutation: the DSB DNA position is precisely selected, but DNA repair by the host cell is random and results in small nucleotide deletions, additions, or substitutions. . For SDN2, an SDN is used to generate a targeted DSB and a DNA repair template (a short DNA sequence identical to the DNA sequence of the targeted DSB except for one or a few nucleotide changes) is used to repair the DSB. - This results in a predetermined point mutation in the desired gene of interest. As for SDN3, SDN is used in conjunction with a DNA repair template that contains a new DNA sequence (e.g., a gene). The result of the technology would be the integration of that DNA sequence into the plant's genome. The most likely application illustrating the use of SDN3 would be the insertion of cisgenic, intragenic, or transgenic expression cassettes into a selected genomic location. A complete description of each of these techniques can be found in the report prepared by the Joint Research Center (JRC) of the Institute for Prospective Technological Studies of the European Commission in 2011 and entitled “New plant breeding techniques - State-of-the-art and prospects for commercial development”, which is incorporated by reference in its entirety. In some embodiments, various approaches have been taken to prevent or treat FocTR4 infection. The present disclosure teaches that a key approach to preventing or treating Foc-TR4 is to (1) find resistant banana cultivars, (2) identify resistance genes and / or traits of selected banana cultivars, and (3) breed / introduce resistance genes and / or traits in sensitive banana cultivars. Zuo et al (2018) evaluated 129 banana accessions and found 10 that are highly resistant to Foc-TR4, providing naturally existing resistant cultivars for study. Li and others (2012) analyzed the transcriptomes and expression profiles of roots of a resistant mutant and compared them with susceptible wild-type Brazilian Cavendish bananas at two time points after challenge with Foc-TR4. They found about 88,000 unigenes, with 5,000 related to defense pathways in other plants. They concluded that about 2,600 genes were differentially expressed in the resistant mutant, including some plant cell lignification genes that were expressed at equal or lower levels in the resistant mutant. Similarly, Bai and others (2013) compared the root transcriptomes of the Foc-TR4-susceptible Brazilian cultivar with the Yueyoukangl cultivar, which is known to have much lower disease severity. Bai et al found differential expression in 500 to 2000 different unigenes at different time points, and these could be grouped into 11 different types of metabolic pathways. Bai et al found genes connected to cell wall lignification that were differentially regulated between sensitive and resistant cultivars, specifically 4-coumarate: CoA ligase (4CL), glutathione Stransferase (GST), cellulose synthase, Caffeoyl-CoA O-methyltransferase (CCoAM), and cinnamyl alcohol dehydrogenase (CAD) were expressed at higher levels in the resistant cultivar and concluded that cell wall lignification could be one of the mechanisms involved in resistance to Foc-TR4. Bai et al noted that this was inconsistent with the result found in Lí et al (2012) and concluded that different plants could have different resistance mechanisms and that more work is required to decipher how banana cultivars can resist Foc-TR4. Wang et al (2017) also analyzed differential gene expression in roots at the time of flower bud differentiation and found 107 genes differentially expressed in roots between a susceptible and a susceptible banana cultivar. Zhang and others (2018) showed that Foc-TR4 infection proceeds similarly in the roots of a resistant cultivar (Pahang) and a susceptible cultivar (Brazilian) until reaching the corm, where the fungal biomass and degree of necrosis were significantly lower in Pahang. (The banana 'corm' is an underground stem, or rhizome, from which roots grow.) Van der Berg and others (2007) used quantitative RT-PCR to identify genes that were upregulated in the FW-tolerant banana cultivar GCTCV-218 after infection with Foc-4. Its control was the Williams cultivar sensitive to FW. They found that several genes were upregulated in FW-tolerant GCTCV-218 compared to FW-sensitive Williams. As expected, many of the upregulated genes were homologous to known defense-associated genes, including genes that strengthen the cell wall. They reported 13 genes that were upregulated in roots. While stating that the results shed light on the genes involved in defense and provide a step towards understanding banana Fusarium wilt and thus developing an effective disease management strategy, the paper does not suggest that none of the 13 genes they deposited in GenBank can be used to control Fusarium wilt. No particular strategy is provided for the use of these genes to control Fusarium wilt. Vishnevetsky and others (2009) (U.S. Patent No. 7,534,930) describe a method for genetically engineering banana plants to confer exogenous disease resistance traits, including resistance to Black and Yellow Sigatoka and Botrytis cinerea. Vishnevetsky and others manipulated three polynucleotides in banana plants, including genes encoding endochitinase, stilbene synthase, and superoxide dismutase. ΜΛ / a / ZUZZ / UUU 1 oz Paul and others (2011) isolated a gene from the nematode C. elegans that, when stably transformed into the banana cultivar 'Lady finger', conferred resistance to race 1 of Panama disease in greenhouse trials. Although transforming bananas with a nematode-derived gene is unlikely to be accepted by consumers, follow-up work by Dale's group with a banana-derived gene shows promise for achieving Fusarium resistance in GMO-transformed bananas. For example, Peraza-Echeverria and others (2009) isolated a gene analogous to the resistance gene (RGA2) from a wild banana. Musa acuminata malaccensis. This gene is a member of the large family of NB-LRR type resistance genes. When transformed into FW-susceptible Cavendish plants (Dale et al., 2017), the gene appears to confer resistance to Fusarium. Dale et al (2017) conducted field trials on transgenic banana plants for 3 years. At the conclusion of the trial, between 67% and 100% of the FW-susceptible control plants were dead or infected. However, in four lines of bananas transfected with their candidate gene, less than 30% of the transformed bananas showed signs of severe infection (i.e., >70% showed some tolerance or resistance). A line transformed with RGA2 appeared to be immune to TR4. While this is good evidence that the gene may confer some resistance to FW, the gene was first isolated more than a decade ago and it is unclear whether the banana industry will ever adopt the RGA2 gene. It is important to note that it is believed (unpublished communications with breeders and banana industry scientists) that there may be up to four genes in the Musa genome that contribute to some degree of resistance to Fusarium, so it is unlikely that RGA2 by if only it solves the current crisis, even if it is accepted by the producers. Even if RGA2 finds acceptance, the industry has a great need for multiple genes to control TR4. The inventor clarifies that FusR1 of the present description is not related to RGA2 at all. The two genes have completely different nucleotide sequences (i.e., no sequence identity), are located on different chromosomes, have different biochemistries, and have different mechanisms of action in the plant. Wu and others (2016) sequenced a disease-resistant relative of the wild banana, Musa itinerans, found in subtropical China. Ks values ​​were calculated to estimate speciation and paleoploidization events in the genus Musa. Ka / Ks values ​​were also calculated to show that, as expected, most genes in the Musa itinerans genome have undergone purifying selection. It was suggested that M. itinerans is known to be disease resistant, so its genome could be mined for disease resistance genes. In some embodiments, the present disclosure provides methods for finding, identifying and selecting genes resistant to diseases, such as Fusarium wilt, of FW-resistant banana cultivars. In other embodiments, the present disclosure provides nucleotide and polypeptide sequences of Fusarium resistance genes (e.g., FusFH gene) identified from the methods of the present disclosure. In additional embodiments, the present disclosure teaches methods for generating and / or producing banana varieties having resistance genes and / or traits through the use of next generation plant breeding technology, including, but not limited to, the described CRISPR technology. in this description. III. Identification of the FusFH gene of the genus Musa Cultivated bananas are generally triploid (although some are diploid) as a result of their complex evolutionary and domestication history, which involved a series of interspecific and intraspecific hybridization events, both natural and human-made. Cultivated edible bananas are largely the result of hybridization between two wild diploid species, Musa acuminata and Musa balbisiana (Christelová et al., 2017). Human domestication of bananas began about 7000 years ago in Southeast Asia (D'Hont et al. 2012). Banana genomes derived from M. acuminata are known as A genomes, while bananas derived from M. balbisiana are B genomes (D'Hont et al., 2012). Therefore, the genome structure of the diploid M. acuminata is called AA and the genomic structure of the diploid M. balbisiana is BB. Therefore, edible banana cultivars may have triploid AAA genomes (such as Cavendish or Gros Michel), AAB genomes (as in many bananas), or ABB genomes (such as the local variety Cachaco). M. acuminata probably arose in Malaysia or Indonesia (Christelová et al., 2017). In contrast, M. balbisiana is believed to have originated in India, Thailand, or the Philippines (Christelová et al., 2017). Therefore, these two species were originally allopatric and geographic isolation provided an opportunity for each species to develop unique traits. When humans subsequently moved M. acuminata cultivars to areas populated by M. balbisiana, interspecific hybridization occurred. The economically critical Cavendish cultivar, which accounts for at least 99% of commercial banana export production, exhibits triploid-induced sterility. This, combined with parthenocarpy, results in edible seedless fruits, but seriously hinders breeding, so Cavendish bananas are propagated vegetatively (clonally). The Cavendish genotype has three A genomes derived from M. acuminata. In some embodiments, the inventor identified genes that effectively control Fusarium wilt in banana. For example, the present disclosure teaches that a gene, which is named FusR1 (Fusarium Resistance 1) was identified by using the inventor's molecular evolutionary analysis approach. The present description teaches that the FusFH gene is a native gene in Musa species, including the cultivated bananas, M. itinerans, M. acuminata, M. balbisiana, M. basjoo, as well as Musella lasiocarpa, the only member of a closely related genus. The ortholog (two alleles) of the wild banana relative, Musa itinerans, is provided here as SEQ ID NO: 1 and SEQ ID NO: 4. The M. itinerans FusFH sequences were obtained from multiple accessions (including, but not limited to, ITC1526, ITC1571 and PT-BA-00223). All M. itinerans accessions are extremely resistant to FW (Li et al. 2015; Wu et al. 2016). The present description teaches that the inventor identified two alleles of FusFH in M. itinerans. SEQ ID NO: 1 gives allele #1 of the FusFH mRNA sequence. SEQ ID NO: 2 gives the coding sequence of allele #1. SEQ ID NO: 4 gives allele #2 of the FusFH mRNA sequence. SEQ ID NO: 5 gives the coding sequence of allele #2. Alleles 1 and 2 are very similar in sequence: they encode only four amino acid differences. A second M. itinerans- FusR1 transcript (SEQ ID NO: 7) was identified, this transcript has an expressed (i.e., unspliced) intron that results in disruption of the proper reading frame. This is expressed at very low levels. M. itinerans is naturally extremely resistant to the effects of Fusarium wilt (Li et al., 2015; Wu et al., 2016). In some embodiments, the M. itinerans FusR1 gene is responsible for resistance to Fusarium wilt. The present description further teaches that the inventor identified three alleles of FusR1 in M. acuminata. Two of these alleles were isolated from FW-resistant accessions of M. acuminata. The third allele was isolated from an FW-sensitive M. acuminata accession. The FW-resistant sequences of M. acuminata FusR1 were obtained from multiple FW-resistant accessions, including ITC0896 (M. a. subspecies banksii) and PT_BA-00281 (Pisang Bangkahulu). The FW-sensitive sequence of M. acuminata comes from the FW-sensitive accessions ITC0507, ITC0685, PT-BA-00304, PT-BA-00310, and PT-BA-00315. SEQ ID NO: 8 gives the mRNA sequence of allele 1 of the FW-resistant FusR1 gene of M. acuminata. SEQ ID NO: 10 gives the mRNA sequence of allele 2 of the FW-resistant FusR1 gene of M. acuminata. The coding sequence for the FW resistant allele 1 of M. acuminata is given in SEQ ID NO: 9. SEQ ID NO: 11 gives the coding sequence for the FW resistant allele 2 of M. acuminata. SEQ ID NO: 13 gives the mRNA sequence of the FW-sensitive FusR1 allele of M. acuminata. (The FW-sensitive sequence of M. acuminata was identified from accessions ITC0507, ITC0685, PT-BA-00304, PT-BA-00310 and PT-BA-00315. These accessions include multiple samples of banana cultivars such as Pisang Madu, Pisang Pipit, and Pisang Rojo Uter, all of which have been well characterized as sensitive to FW (Chen et al., 2019). The inventor identified a putative core promoter for FusR1 from M. acuminata. The inventor used two different promoter prediction applications in an attempt to find congruent predictions from different algorithms / software. As a first step, the inventor amplified and sequenced a 753 bp sequence fragment (SEQ ID NO: 31), which begins upstream of the coding region of the FW-resistant allele of the FusR1 gene derived from M. acuminata. This fragment is 100% identical to pb7868911 - pb7869210 and bp7869341 - bp7869743 from GenBank accession number NC_025206 (Musa acuminata subsp. Malaccensis chromosome 5, ASM31385v2, complete genome sequence), which is located on chromosome 5 of M. acuminata. The inventor first analyzed the upstream region of FusR1 by using the Neural Network Promoter Prediction (NNPP), which is available from the Berkeley Drosophila Genome Project (BDGP). BDGP is a consortium of the Drosophila Genome Center, funded by the National Human Genome Research Institute, the National Cancer Institute, and the Howard Hughes Medical Institute. The NNPP software was trained on human and Drosophila melanogaster promoter sequences, but has been shown to be generally effective at identifying promoter sequences, even in plants (Reese, 2001). NNPP analysis successfully identified a core promoter for FusR1. Below are the results of the analysis. The first 189 bases of SEQ ID NO: 31 (shown in lowercase) are non-coding upstream sequences, which include the 5' UTR sequence of FusR1; the next 423 bases are coding sequences (shown in CAPITAL LETTERS). This coding sequence is identical to SEQ ID NO: 9. The last 141 bases are 3' UTRs (shown in lower case). Bases 92141 of SEQ ID NO: 31 (atcgtggcactataaataggacaagaggagggatgaggtaaaacgcactc) are the promoter sequence predicted by NNPP, shown in bold and lowercase. The transcription start site (TSS) at base pair 132 is shown in lowercase and bold underlined. NNPP assigns a score of .88 (i.e., 88% confidence level) to this promoter. SEQ ID NO: 31: gtagagacacttgagttgaattctgaatccattatttcttctcatgaacgcatacgtcccaccatacacaccaaatcttaatggctcaagcatcgtggca ctataaataggacaagaggagggatgaggtaaaacgcactccctcatacttgcacaggtacgttgtgatagaaagttcagaggtaagcgAT GGCTGGAGGAGGCAAAAAGGGTGAAGCGTCGTCTCTTCTACT TGTGACGCTGCTCGTGACGTTGTT GGCTTTCTTCGCCACCAACTCCTCGGCAGCCCGTGTCACACCCCGTCCGCAATCCCTCGCCAGAGC GGCACTGAGTGCGGTGGGGGCAAGGCAAGATGAGCCGTGCTGCAGATGCGCGTGTCCTCTCATTTA CCCACCTACTTGGTGCATTTGCGGCGGCATATGGCAAGGCTCCTGCCCTTCCGCCTGCAACAACTGC CAGTGTGTCCTCAACGAGTGCACTTG CCTCGATCTTATGGACCCCAAGGTCTGCGAGGCCAACTCCT GTCCCTGGCCTGTTGCAGCCCCCAAAGTAGAGCCGGCGCAGCAGTGGGCTATCGAAGAAACCGGTG GGAAATTAGCGATGATGGTGTGAtccaattgtgtttgtgatcgcctgtcgtcttctctcgctccgtcctatccatctatccatccatctacttat aatctatgtcgtg taccgtcgtgtggtgttgctttgcttcagtaataaaaataaaatgcttctgctttt The inventor then analyzed the upstream region of FusR1 of M. acuminata by using the Prediction of PLANT Promoters (TSSP) software, which is specifically aimed at the identification of plant promoter sequences (Solovyev and Shahmuradov, 2003). This is part of a suite of sequence analysis software produced by Softberry, Inc. TSSP identified the transcription start site (TSS) as position 132 in SEQ ID NO: 31, which is identical to the software results. NNPP (see above). TSSP located the TATA box of FusR1 (shown above in lowercase italics) at bases 102-107 of SEQ ID NO: 31. Therefore, the TATA box of FusR1 is located, as expected, 25 base pairs upstream of the TSS. As these 2 different promoter prediction applications give congruent results, the inventor identified the correct promoter sequence for M. acuminata. The present disclosure teaches methods for introducing the newly identified FusR1 gene and its variants into cultivated bananas, particularly the Fusarium-sensitive cultivar Cavendish in order to render these crops resistant to Fusarium wilt. In some embodiments, the present disclosure teaches that traditional breeding methods can be used to introduce the M. itinerans FusR1 gene / trait into Cavendish and other cultivated bananas. In other embodiments, the present disclosure teaches that next generation breeding methods can be used to introduce the M. itinerans FusR1 gene / trait into Cavendish and other cultivated bananas. In additional embodiments, the present disclosure teaches methods for introducing the M. itinerans FusR1 gene / trait into MA / a / ZUZZ / UUUI oz Cavendish and other bananas cultivated by using genome editing techniques such as targeted genome editing system using zinc finger nucleases (ZFN), transcription activator like effector nucleases (TALEN) or CRISPR system technology / Cas9 that exploits the endonuclease activity of CRISPR-associated (Cas) proteins with sequence specificity directed by CRISPR RNA (crRNA). Given the likely extinction threat to Cavendish, the present disclosure provides a rapid, efficient and precise genome editing approach using the adapted CRISPR / Cas9 system for the production of minimally gene-edited bananas having a Fusarium-resistant gene / trait. , which will be accepted especially in developing countries where the banana provides fundamental economic and food security. The present description teaches that the transfer of the native FusR1 gene from M. itinerans to cultivated bananas can be best achieved with CRISPR technology, which allows for a targeted, clean and efficient transfer and which, compared to more traditional gene editing techniques, minimizes possible side effects. In some embodiments, useful FusR1 alleles (SEQ ID NO: 8 and SEQ ID NO: 10) are identified from naturally FW-resistant M. acuminata populations. These alleles confer resistance to FW. The present description teaches that the FusR1 allele derived from M. acuminata can be used, in combination with FusR1 alleles derived from M. itinerans (SEQ ID NO: 2 and SEQ ID NO: 5), to improve resistance to FW in cultivated bananas, particularly Cavendish. The present description teaches gene stacking with at least two FusR1 genes identified by the inventor described in the present description. Both the M. itinerans ortholog FusR1 (SEQ ID NO: 2 and SEQ ID NO: 5) and the FW-resistant alleles of M. acuminata (SEQ ID NO: 8 and SEQ ID NO: 10) can be used in traditional plant breeding and / or new generation plant breeding approaches. Next-generation breeding approaches include, among others, marker-assisted selection (MAS) and / or genome editing techniques in cultivated bananas. Some M. balbisiana accessions have been rigorously characterized as highly resistant to FW, while others are extremely sensitive to FW. While wild accessions of M. balbisiana might be expected to be resistant to a pathogen such as Fusarium, it has been difficult for researchers to understand why closely related accessions differ so significantly in terms of resistance to FW. The inventor discovered a structural difference of the nucleotide sequences of the FusR1 gene in FW-sensitive M. balbisiana accessions as shown in Figure 5. All FW-sensitive M. balbisiana accessions analyzed by the inventor contain a FusR1 transcript. broken. This analysis is limited to the disrupted FusR1 genes found in all FW-susceptible accessions that were examined. FusR1 mRNAs in all M. balbisiana accessions that the inventor examined had an unspliced ​​expressed intron that disrupts the proper reading frame. Furthermore, the inventor found (i) a long deletion of 82 or 84 bp in several FusR1 mRNAs (2) in all accessions, a smaller deletion of 1 bp, or (i), in some accessions, an insertion of 4 bp, each of which MA / a / ZUZZ / UUUI oz also disrupts the open reading frame, which encodes a mutated, non-functional FUSR1 protein. All FW-susceptible M. balbisiana accessions have one or more of these frameshift disruptors described above, resulting in a non-functional protein. In some embodiments, the present disclosure teaches that some accessions of M. balbisiana have all four frame disruptors. See Figure 5. In other embodiments, the inventor also discovered another significant difference when studying FW-resistant versus FW-sensitive M. acuminata accessions. In some embodiments, FusR1 in M. acuminata provides resistance versus sensitivity depending on the FusR1 alleles. The present description teaches that two alleles, which turned out to be resistant alleles, confer resistance to FW; SEQ ID NO: 8 and SEQ ID NO: 10. These two alleles are very similar in sequence to the FusR1 ortholog derived from the FW-resistant wild banana spaces, M. basjoo (SEQ ID NO: 17 and SEQ ID NO: 20. The third allele, the FW-sensitive allele, is found only in FW-sensitive M. acuminata accessions (SEQ ID NO: 13). The M. balbisiana FusR1 sequence (SEQ ID NO: 26 and SEQ ID NO: 27) does not confer resistance to FW, because this gene is damaged (as it is in all FW-sensitive M. balbisiana accessions examined) by indels that disrupt the reading frame and / or expressed unspliced ​​introns that cause loss of resistance to FW. In additional embodiments, FusR1 sequences derived from FW-resistant M. acuminata accessions (SEQ ID NO: 8 and SEQ ID NO: 10) have very high sequence similarity to the FusR1 ortholog derived from M. basjoo (SEQ ID NOT: 17). M. basjoo is a wild banana species highly resistant to FW (Li et al. 2015). In other embodiments, the FusR1 sequence (SEQ ID NO: 13) of FW-sensitive M. acuminata accessions differs from the FW-resistant M. acuminata alleles (SEQ ID NO: 8 and SEQ ID NO: 10). The present description teaches that resistance to FW in M. acuminata depends on the allele being found only in FW-resistant accessions. Although M. acuminata and M. balbisiana are more closely related to each other than to M. itinerans or M. basjoo, the FusR1 sequences that control FW resistance cluster in direct contrast to how the species are actually related. In other embodiments, the FusRI gene has been adapted (i.e., positively selected) so that FusRI does not reflect actual relationships within the Musa species. The present description shows two independent adaptive events (convergent evolution) or perhaps the FW-resistant version of FusRI has been traded among various Musa species (gene transfer). The inventor confirmed the true phylogenetic relationships between these Musa species by sequencing two different, conserved, single-copy genes, C2H2 and TOPO6, from several Musa species. C2H2-type zinc finger proteins play an important role in plant development and growth, as well as resistance to abiotic stresses, including fruit ripening in banana (Han et al., Front. Plant Sci., Vol. 11, article 115:1-13, February 20, 2020; Han et al., Postharvest Biology and Technology, 116:8-15, June 2016). TOPO6, a nuclear gene marker region of the B subunit of the plant homolog of archaeal topoisomerase VI, occurs as a single-copy locus in the haploid genome of most plant groups (Frank R. MA / a / ZUZZ / UUU 1 Ό4 Blattner, Plant Systematics and Evolution, Vol. 302:239 -244, 2016). These two genes (whose biochemical functions are well known) have no role in pathogen control, making them ideal as 'controls' to understand the adaptive changes imposed on plantain FusR1 as a result of Fusarium exposure. Therefore, the description teaches that the consensus in the literature that M. acuminata and M. balbisiana are sister species is correct, which means that significant changes have occurred in our recently identified gene, FusR1, in these banana species, providing even more evidence that FusR1 confers resistance to FW. See the phylogenetic trees provided in Figures 3 and 4. The present disclosure teaches the critical sequence differences between the strongly FW-resistant FusR1 alleles of M. itinerans, allowing the inventor to determine the exact few nucleotides that make FusR1 capable of controlling FW. Based on the inventor's findings, the present disclosure teaches a method of using the CRISPR / Cas system to confer FW resistance in FW-susceptible Cavendish (as well as all other cultivated bananas), by precisely changing only a few critical nucleotides in FusR1. Furthermore, the present disclosure also teaches a method of using these critical nucleotides to create a new FusR1 sequence with greater resistance to FW than the native gene. IV. FusR1 gene and variants thereof The present description is based, in part, on the isolation of the new FusR1 gene from banana varieties and species. The nucleotide sequences of this FusR1 gene and its ortholog sequences are presented in SEQ ID NO: 1-2, 4-5, 7-11, 13-14, 16-18, 20-21,23-24 and 26- 31, respectively. In some embodiments, SEQ ID NO: 1 is a partial mRNA sequence for allele 1 of FusR1 from Musa itinerans, the wild banana species most resistant to Fusarium. SEQ ID NO: 4 is a partial mRNA sequence for allele 2 of FusR1 from Musa itinerans. The aforementioned FusR1 alleles from M. itinerans (SEQ ID NO: 1 and SEQ ID NO: 4) encode slightly different proteins, which are SEQ ID NO: 3 and SEQ ID NO: 6, respectively. The translated polypeptide of SEQ ID NO: 1 is presented as SEQ ID NO: 3. The translated polypeptide of SEQ ID NO: 4 is presented as SEQ ID NO: 6. These are only slightly different, and the few different amino acid residues are all biochemically conservative. In some embodiments, 5 different accessions of M. itinerans were sequenced and all accessions had these same two FusR1 alleles. In some embodiments, SEQ ID NO: 8 and SEQ ID NO: 10 are partial mRNAs (which includes the complete coding sequences). These are the FW-resistant alleles of FusR1 from Musa acuminata ssp. banksia (accession number ITC0896) and PT_BA-00281 (Pisang Bankahulu). These two alleles differ at only one silent site. In other embodiments, SEQ ID NO: 13 represents the FW-sensitive allele of M. acuminata. In additional embodiments, SEQ ID NO: 9 and SEQ ID NO: 11 represent the coding sequence for the FW resistant alleles of M. acuminata. Furthermore, SEQ ID NO: 12 represents the FW resistance protein sequence of M. acuminata, which is a polypeptide sequence translated from SEQ ID NO: 8 and SEQ ID NO: 10. MA / a / ZUZZ / UUUI oz In some embodiments, SEQ ID NO: 17 and SEQ ID NO: 20 are partial allele sequences of FusR1 mRNA from M. basjoo, a wild banana species that is resistant to Fusarium. In other embodiments, SEQ ID NO: 23 is the FusR1 sequence from another wild banana relative, Musella lasiocarpa. It is noted that all of the mRNA sequences reported by the inventors in the present description are technically partial, as they lack a bit of the 5' UTR and usually some bases from the end of the 3' UTR. The vast majority of the mRNAs described herein are very close to being complete sequence. In some embodiments, SEQ ID NO: 26 and SEQ ID NO: 28-30 are the partial FusR1 mRNA sequences from several different M. balbisiana accessions. SEQ ID NO: 27 is the coding sequence of FusR1 from M. balbisiana. In some embodiments, a large number of FW-susceptible M. balbisianaa accessions were examined. In all FusR1 sequences from FW-susceptible M. balbisianaa accessions, the structure of the FusR1 sequence is disrupted and / or damaged. All FW-susceptible M. balbisiana accessions had a FusR1 coding sequence with a 1-bp deletion at position 340 of the coding sequence. All FW-susceptible M. balbisiana accessions also had a long unspliced ​​intron expressed in the coding sequence. Several also had a long deletion (8284 bp), some had another 4 bp deletion, and in all cases a one base pair deletion (relative to FusR1 from other plant species, including all other banana accessions While it is true that 84 bp, as a multiple of three, does not disrupt the reading frame, it removes 28 amino acid residues from the primary structure of the protein, potentially disrupting the tertian structure of the folded protein and therefore , negatively affects function. In any case, based on our findings, the ubiquitous 1 bp deletion always results in reading frame disruption. The inventor included mRNA sequences from Musa balbisiana accessions from which the inventor sequenced FusR1. These illustrate the various ways in which FusR1 is 'cleaved' in M. balbisiana. The inventor notes in the present description that ALL M. balbisiana accessions that the inventor analyzed have a broken FusR1 mRNA transcript. Figure 5 shows these aligned M. balbisínana FusR1 sequences. The M. balbisianaa accession ITC1016 (SEQ ID NO: 26) contains an expressed unspliced ​​intron of 82 base pairs. This intron disrupts the reading frame, resulting in a premature stop codon located 8 bp into the intron, causing a truncated 141 bp coding sequence (as opposed to the proper 423 bp coding sequence). Furthermore, this accession (and indeed all M. balbisianana accessions) also has a one base pair deletion, located approximately 90 bp 5' from the true stop codon, which (even if the intron had been correctly spliced) results in a premature stop codon, giving a truncated coding sequence. The M. balbisianaa accession ITC0545 (SEQ ID NO: 28) contains the same expressed, unspliced ​​intron of 82 base pairs. This intron interrupts the reading frame, resulting in a MA / a / ZUZZ / UUUI oz premature stop located 8 bp in the intron, resulting in a truncated 141 bp coding sequence (as opposed to the proper 423 bp coding sequence). Another 27 bp downstream of the expressed intron is an 85 bp deletion. While this in combination with the expressed 84 bp intron would mathematically restore the correct reading frame (85 bp -82 bp = 3 bp), as explained above, it results in the loss of 28 amino acid residues found in a functionally criticism of the folded FusR1 protein. In addition, this accession also has a base pair deletion, located approximately 90 bp 5' from the true stop codon, which (even if the intron had been spliced ​​correctly) results in a premature stop codon, which gives a truncated coding sequence. Finally, the FusFH mRNA from this accession also has a 4-bp insertion that disrupts the downstream frame. The M. balbisiana accession ITC0080 (SEQ ID NO: 29) contains the same expressed unspliced ​​intron as the previous accessions, except that this version of the unspliced ​​intron is 84 bp long. Although this expressed intron does not disrupt the reading frame, it introduces an additional 28 amino acid residues that are located in a functionally critical region of the folded protein and therefore most likely prevents proper folding of the FusR1 protein. In addition, this accession also has a base pair deletion, located approximately 90 bp 5' from the true stop codon, which (even if the intron had been spliced ​​correctly) results in a premature stop codon, which gives a truncated coding sequence. The M. balbisiana accession ITC1527 (SEQ ID NO: 30) contains the same unspliced ​​expressed intron as the previous accessions, this time 82 bp in length. Again, this intron disrupts the reading frame, resulting in a premature stop codon located 8 bp into the intron, causing a truncated coding sequence of 141 bp (as opposed to the proper coding sequence of 423 bp). ). Furthermore, the FusRI mRNA from this accession has a 4 bp further downstream insertion. In addition, this accession also has a base pair deletion, located approximately 90 bp 5' from the true stop codon, which (even if the intron had been spliced ​​correctly) results in a premature stop codon, which gives a truncated coding sequence. All M. balbisiana accessions analyzed by the inventor have some combination of one or more of these various defects in their FusRI mRNA. Table 1 summarizes the sequence information of the present description. Table 1. Summary of sequence information SEQ ID NO. Sequence Type Origin Brief Description SEQ ID NO: 1 Musa itinerans nucleotide Partial mRNA sequence for FW*-resistant FusRI transcript 1, Musa itinerans allele 1 SEQ ID NO: 2 Musa itinerans nucleotide FW-resistant coding sequence of allele 1 from FusRI from M. itinerans SEQ ID NO: 3 Musa itinerans protein Protein sequence of FW-resistant FUSR1 allele 1 of M. itinerans SEQ ID NO: 4 Musa itinerans nucleotide Partial mRNA sequence for FW-resistant FusFH transcript 1 allele 2 of Musa itinerans SEQ ID NO: 5 Musa itinerans nucleotide Coding sequence of the FW-resistant allele 2 of FusRI of M. itinerans SEQ ID NO: 6 Musa itinerans protein Protein sequence of FUSR1 resistant to FW allele 2 of M. itinerans SEQ ID NO: 7 Musa itinerans nucleotide Partial mRNA sequence for FusRI transcript 2 from Musa itinerans SEQ ID NO: 8 Nucleotide Musa acuminata ssp. banksii Partial mRNA sequence for the FW-resistant FusRI allele 1 of M. acuminata SEQ ID NO: 9 Nucleotide Musa acuminata ssp. banksii Coding sequence of the FW-resistant FusRI allele 1 of M. acuminata SEQ ID NO: 10 Nucleotide Musa acuminata ssp. banksii Partial mRNA sequence for the FW-resistant FusRI allele 2 of M. acuminata SEQ ID NO: 11 Nucleotide Musa acuminata ssp. banksii Coding sequence of the FW-resistant FusRI allele 2 of M. acuminata SEQ ID NO: 12 Protein Musa acuminata ssp. banksii Protein sequence of FW-resistant FUSR1 from M. acuminata SEQ ID NO: 13 Musa acuminata nucleotide Partial mRNA sequence for the FW-sensitive FusRI allele from M. acuminata SEQ ID NO: 14 Musa acuminata nucleotide Allele coding sequence FW-sensitive FusRI from M. acuminata SEQ ID NO: 15 Musa acuminata protein Protein sequence of FW-sensitive FusRI from M. acuminata SEQ ID NO: 16 Musa acuminata nucleotide Partial mRNA sequence of the FW-sensitive FusR1 transcript 2 of M. acuminata SEQ ID NO: 17 Musa basjoo nucleotide Partial mRNA sequence of the FW-resistant FusR1 allele 1 of M. basjoo SEQ ID NO: 18 Musa basjoo Nucleotide Coding sequence of FusR1 resistant to FW allele 1 of M. basjoo SEQ ID NO: 19 Musa basjoo protein Protein sequence of FusR1 resistant to FW allele 1 of Musa basjoo SEQ ID NO: 20 Musa basjoo Nucleotide Sequence of partial mRNA of FW resistant allele 2 of FusR1 of M. basjoo SEQ ID NO: 21 M. basjoo nucleotide Partial coding sequence of FusR1 resistant to FW allele 2 of M. basjoo SEQ ID NO: 22 M. basjoo protein Sequence of partial proteins of the FW-resistant allele 2 of FusR1 from M. basjoo SEQ ID NO: 23 Musella lasiocarpa nucleotide Partial mRNA sequence of FusR1 from Musella lasiocarpa SEQ ID NO: 24 Musella lasiocarpa nucleotide FusRI coding sequence from M. lasiocarpa SEQ ID NO: 25 Musella lasiocarpa protein M. lasiocarpa FUSR1 protein sequence SEQ ID NO: 26 M. balbisiana nucleotide Partial FusRI mRNA sequence from M. balbisiana accession ITC1016 SEQ ID NO: 27 M. balbisiana nucleotide Coding sequence hypothesis of M. balbisiana accession ITC1016 SEQ ID NO: 28 M. balbisiana nucleotide Partial FusRI mRNA sequence of M. balbisiana accession ITC0545 SEQ ID NO: 29 M. balbisiana nucleotide Partial mRNA sequence of FusR1 from the M. balbisiana accession ITC0080 SEQ ID NO: 30 M. balbisiana nucleotide Partial FusR1 mRNA sequence from the M. balbisiana accession ITC1527 SEQ ID NO: 31 Nucleotide M. acuminata ssp. banksii Upstream sequence, including the promoter sequence, of the FW-resistant allele 1 of FusR1 from M. acuminata SEQ ID NO: 32 M. balbisiana protein Protein sequence of FUSR1 from M. balbisiana ινΐΛ / a / zuzz / uuu i *FW - Fusarium wilt According to the present disclosure, the novel FusR1 gene and its orthologs will be useful in facilitating the construction of crop plants that are resistant to pathogenic diseases, especially diseases caused by fungal pathogens, viruses, nematodes, insects and the like. The FusR1 genes of the present disclosure can also be used as markers in genetic mapping, as well as to evaluate disease resistance in a plant of interest. Therefore, the sequences can be used in breeding programs. See, for example, Gentzbittel et al (1998, Theor. Api. Genet. 96:519-523). Additional uses of the sequences of the disclosure include using the sequences as bait to isolate other signaling components in defense / resistance pathways and to isolate corresponding promoter sequences. The sequences can also be used to modulate plant developmental processes, such as pollen development, organ shape regulation, aleurone and shoot epidermis differentiation, embryogenic competition, and cell / cell interactions. cell. See, generally, Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Coid Spring Harbor Laboratory Press, Plainview, N.Y.). The sequences of the present disclosure can also be used to generate variants (e.g., by domain swapping) for the generation of new resistance specificities. The description encompasses compositions of isolated or substantially purified proteins or nucleic acids. An isolated or purified nucleic acid or protein molecule, or a biologically active portion thereof, is substantially or essentially free of components that normally accompany or interact with the nucleic acid or protein molecule found in its natural environment. Therefore, an isolated or purified polynucleotide or polypeptide is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Suitably, an isolated polynucleotide is free of sequences (especially protein-coding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide It was derived. For example, in various embodiments, the isolated polynucleotide may contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally flank the polynucleotide in the genomic DNA of the cell from which the polynucleotide was derived. A polypeptide that is substantially free of cellular material includes protein preparations that have less than about 30%, 20%, 10%, 5% (by dry weight) contaminating protein. When the protein of the invention or the biologically active portion thereof is produced recombinantly, the culture medium suitably represents less than about 30%, 20%, 10% or 5% (by dry weight) of chemical or chemical precursors of proteins that are not of interest. A portion of a FusFil nucleotide sequence encoding a biologically active portion of a FusFH polypeptide of the disclosure will encode at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150, 300, 400, 500, 600, 700, 800, 900 or 1000 contiguous amino acid residues, or almost up to the total number of amino acids present in a full-length FUSR1 polypeptide of the disclosure (e.g., 140 amino acid residues for SEQ ID NO: 3, 6, 12, 19, or 22, respectively). Portions of a FusR1 nucleotide sequence that are useful as hybridization probes or PCR primers generally do not need to encode a biologically active portion of a FUSR1 polypeptide. Therefore, a portion of a FusR1 nucleotide sequence may encode a biologically active portion of a FUSR1 polypeptide, or may be a fragment that can be used as a hybridization probe or PCR primer using standard methods known in the art. A biologically active portion of a FUSR1 polypeptide can be prepared by isolating a portion of one of the FusR1 nucleotide sequences of the disclosure, expressing the encoded portion of the FUSR1 polypeptide (e.g., by recombinant expression in vitro), and by evaluation of the activity of the encoded portion of the FUSR1 polypeptide. Nucleic acid molecules that are portions of a FusR1 nucleotide sequence comprise at least about 15, 16, 17, 18, 19, 20, 25, 30, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600 or 650 nucleotides, or almost up to the number of nucleotides present in a full-length FusR1 nucleotide sequence described herein (for example, approximately 350 to 650 nucleotides for SEQ ID NO: 1-2, 4-5, 8-10, 1718 or 20-21, respectively). The description also contemplates variants of the nucleotide sequences described. Nucleic acid variants may be of natural origin, such as allelic variants (same locus), homologs (different locus), and orthologs (different organism), or they may be of non-natural origin. Naturally occurring variants such as these can be identified using well-known molecular biology techniques, such as, for example, polymerase chain reaction (PCR) and hybridization techniques as are known in the art. Unnatural variants can be prepared by mutagenesis techniques, including those applied to polynucleotides, cells or organisms. Variants may contain nucleotide substitutions, deletions, inversions and insertions. Variation can occur in one or both coding and noncoding regions. The variations can produce both conservative and non-conservative (compared to the encoded product) amino acid substitutions. For nucleotide sequences, conservative variants include those sequences that, due to degeneracy of the genetic code, encode the amino acid sequence of one of the FUSR1 polypeptides of the disclosure. Vanant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, through the use of site-directed mutagenesis but still encoding a FUSR1 polypeptide of the disclosure. Generally, variants of a particular nucleotide sequence of the disclosure will have at least about 30%, 40%, 50%, 55%, 60%, 65%, 70%, generally at least about 75%, 80%, 85%. , suitably about 90% to 95% or more, and more suitably about 98% or more of sequence identity with that particular nucleotide sequence determined by the sequence alignment programs described elsewhere herein using default parameters. Nucleotide sequence variants also encompass sequences derived from mutagenic or recombinant procedures such as DNA shuffling that can be used to exchange domains in a polypeptide of interest with domains from other polypeptides. With DNA shuffling, one or more different FusR1 coding sequences can be manipulated to create a new FusR1 sequence possessing the desired properties. In this method, libraries of recombinant polynucleotides are generated from a population of related polynucleotides that comprise sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, by using this approach, sequence motifs encoding a domain of interest can be shuffled between the FusR1 gene of the disclosure and other known FusR1 genes to obtain a new gene encoding a protein with an improved property of interest, such as a broad spectrum of resistance to a disease. Strategies for DNA shuffling are known in the art. See, for example: Stemmer (1994, Proc. Nati. Acad. Sci. USA 91:10747-10751; 1994, Nature 370:389-391); Crameri et al., (1997, Nature Biotech. 15:436-438); Moore et al., (1997, J. Mol. Biol. 272:336-347); Zlang et al., (1997 Proc. Nati. Acad. Sci. USA 94:450-44509); Crameri et al., (1998, Nature 391:288-291); and United States Patent Nos. 5,605,793 and 5,837,458. The present disclosure provides nucleotide sequences comprising at least a portion of the isolated proteins encoded by nucleotide sequences for FusR1, FusR1 homologs, FusR1 orthologs, FusR1 paralogs, and fragments and variations thereof. In some embodiments, the present disclosure provides a nucleotide sequence encoding FUSR1 and / or functional fragments and variations thereof comprising a nucleotide sequence that is at least about 70%, about 75%, about 80% shared. about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90% about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98 MA / a / ZUZZ / UUUI oz % or approximately 99%, approximately 99.1%, approximately 99.2%, approximately 99.3%, approximately 99.4%, approximately 99.5%, approximately 99.6%, approximately 99.7% about 99.8%, or about 99.9% sequence identity with respect to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 17 or SEQ ID NO: 18. In some embodiments, a nucleotide sequence encoding FUSR1 has the sequence nucleic acid of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 17 or SEQ ID NO: 18. In some embodiments, the present disclosure provides nucleotide sequences for FusR1, FusFH homologs, FusR1 orthologs, FusR1 paralogs, and fragments and variations thereof comprising nucleotide sequences that share at least about 70%, about 75%. , approximately 80%, approximately 81%, approximately 82%, approximately 83%, approximately 84%, approximately 85%, approximately 86%, approximately 87%, approximately 88%, approximately 89% , approximately 90%, approximately 91%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98% or approximately 99% , about 99.1%, about 99.2%, about 99.3%, about 99.4%, about 99.5%, about 99.6%, about 99.7%, about 99.8% or about 99.9% sequence identity with regarding SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 17 or SEQ ID NO: 18. In some embodiments, the nucleotide sequences for FusR1, FusR1 homologs, FusR1 orthologs, FusR1 paralogs and fragments and variations thereof have the nucleic acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO : 17 or SEQ ID NO: 18. In some embodiments, nucleotide sequences for FusR1, FusR1 homologs, FusR1 orthologs, FusR1 paralogs, and fragments and variations thereof may be used to be expressed in plants. In some embodiments, said nucleotide sequences can be used to be incorporated into an expression cassette, which is capable of directing the expression of a nucleotide sequence for FusR1, FusR1 homologs, FusR1 orthologs, FusR1 paralogs and fragments and variations thereof. themselves in a plant cell, for example, banana varieties described in the present description. This expression cassette comprises a promoter operably linked to the nucleotide sequence of interest (i.e., FusR1, FusR1 orthologs, and fragments and variations thereof) that is operably linked to termination signals. It also typically comprises sequences necessary for proper translation of the nucleotide sequence. The coding region generally encodes a protein of interest (i.e., FUSR1). In some embodiments, the expression cassette comprising the nucleotide sequence of FusR1, FusR1 homologs, FusR1 orthologs, FusR1 paralogs and ινΐΛ / a / zuzz / uuu fragments and variations thereof is chimeric, such that at at least one of its components is heterologous with respect to at least one of its other components. In other embodiments, the expression cassette is one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. Expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus. Furthermore, expression of the nucleotide sequence in the expression cassette may be under the control of a tissue-specific promoter. In the case of a multicellular organism, the promoter may also be specific for a particular tissue or organ or developmental stage in animals and / or plants, including banana species. The present disclosure provides polypeptides and amino acid sequences comprising at least a portion of the proteins encoded by nucleotide sequences for FusR1, FusR1 homologs, FusRI orthologs, FusRI paralogs, and fragments and variations thereof. The present disclosure also provides an amino acid sequence encoded by the nucleic acid sequences of FusR1, FusR1 homologs, FusR1 orthologs, FusR1 paralogs and / or fragments and variations thereof. In some embodiments, the present disclosure provides an isolated polypeptide comprising an amino acid sequence that shares at least about 70%, about 75%, about 80%, about 85%, at least about 90%, about 91%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, approximately 99%, approximately 99.1%, approximately 99.2%, about 99.3%, about 99.4%, about 99.5%, about 99.6%, about 99.7%, about 99.8% or about 99.9% identity with respect to an amino acid sequence encoded by the sequences of FusRI nucleic acid, FusR1 homologs, FusR1 orthologs, FusRI paralogs and / or fragments and variations thereof. In one embodiment, the present disclosure provides an isolated polypeptide comprising an amino acid sequence that encodes an amino acid sequence that shares at least about 85%, about 86%, about 87%, about 88%, about 89%. %, approximately 90%, approximately 91%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, approximately 99% %, approximately 99.1%, approximately 99.2%, approximately 99.3%, approximately 99.4%, approximately 99.5%, approximately 99.6%, approximately 99.7%, approximately 99.8% or approximately 99.9% identity with respect to to an amino acid sequence encoded by the FusRI nucleic acid sequences, FusRI homologs, FusRI orthologs, FusRI paralogs and / or fragments and variations thereof. MA / a / 2U22 / UUU1 02 The disclosure also encompasses variants and protein fragments of an amino acid sequence encoded by the nucleic acid sequences of FusR1, FusR1 homologs, FusR1 orthologs and / or FusR1 paralogs. Variants may contain alterations in the amino acid sequences of the constituent proteins. The term "vanant with respect to a polypeptide" refers to an amino acid sequence that is altered by one or more amino acids with respect to a reference sequence. The variant may have conservative changes or non-conservative changes, for example, analogous minor variations may also include amino acid deletions or insertions, or both. Functional fragments and variants of a polypeptide include those fragments and variants that maintain one or more functions of the original polypeptide. It is recognized that the gene or cDNA encoding a polypeptide can be mutated considerably without materially altering one or more of the functions of the polypeptide. First, it is recognized that the genetic code is degenerate and therefore different codons code for the same amino acids. Second, even when an amino acid substitution is introduced, the mutation may be conservative and have no material impact on the essential function(s) of a protein. See, for example, Stryer Biochemistry 3rd Ed., 1988. Third, part of a polypeptide chain can be removed without altering or eliminating all of its functions. Fourth, insertions or additions can be made to the polypeptide chain, for example, adding epitope tags, without altering or eliminating its functions (Ausubel et al., J. Immunol. 159(5): 2502-12, 1997). Other modifications that can be made without materially impairing one or more functions of a polypeptide may include, for example, chemical and biochemical modifications in vivo or in vitro or the incorporation of unusual amino acids. Such modifications include, but are not limited to, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquination, labeling, for example, with radionucleotides, and various enzymatic modifications, as will be readily appreciated by those skilled in the art. A variety of methods for labeling polypeptides and labels useful for such purposes are well known in the art and include radioactive isotopes such as 32P, ligands that bind or are linked by specific binding partners labeled (for example, antibodies), fluorophores, agents chemiluminescents, enzymes and anti-ligands. Fragments and functional variants can be of variable length. For example, some fragments have at least 10, 25, 50, 75, 100, 200 or even more amino acid residues. These mutations can be natural or intentionally changed. In some embodiments, mutations containing alterations that produce silent substitutions, additions or deletions, but do not alter the properties or activities of the proteins or how the proteins are made are one embodiment of the disclosure. Conservative amino acid substitutions are those substitutions that, when made, interfere least with the properties of the original protein, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Conservative substitutions generally maintain (a) the structure of the polypeptide chain in the area of ​​the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c ) most of the side chain. More information on conservative substitutions can be found, for example, in Ben Bassat et al., (J. MA / a / 4U44 / UUU 1 04 Bacteriol., 169:751 757, 1987), O'Regan et al., (Gene, 77:237 251, 1989), Sahin Toth et al., (Protein Sci., 3:240 247,1994), Hochuli et al., (Bio / Technology, 6:1321 1325,1988) and in widely used genetics and molecular biology textbooks. Blosum matrices are commonly used to determine the relatedness of polypeptide sequences. Blosum matrices were created by using a large database of reliable alignments (the BLOCKS database), in which pairwise sequence alignments related by less than some threshold percent identity were counted (Henikoff et al. , Proc. Nati. Acad. Sci. USA, 89:10915-10919, 1992). An identity threshold of 90% was used for the highly conserved target frequencies of the BLOSUM90 matrix. An identity threshold of 65% was used for the BLOSUM65 matrix. Scores of zero and above on the Blosum matrices are considered conservative substitutions in the selected percent identity. Table 2 below shows illustrative conservative amino acid substitutions. MA / a / zuzz / uuui oz Table 2. Illustrative conservative amino acid substitutions listed. Original residue Very highly conserved substitutions Highly conserved substitutions (from Blosum90 matrix) Conserved substitutions (from Blosum65 matrix) Ala Ser Gly, Ser, Thr Cys, Gly, Ser, Thr, Val Arg Lys Gln, His, Lys Asn, Gln, Glu, His, Lys Asn Gln; His Asp, Gln, His, Lys, Ser, Thr Arg, Asp, Gln, Glu, His, Lys, Ser, Thr Asp Glu Asn, Glu Asn, Gln, Glu, Ser Cys Ser None Ala Gln Asn Arg, Asn, Glu , His, Lys, Met Arg, Asn, Asp, Glu, His, Lys, Met, Ser Glu Asp Asp, Gln, Lys Arg, Asn, Asp, Gln, His, Lys, Ser Gly Pro Ala Ala, Ser His Asn; Gln Arg, Asn, Gln, Tyr Arg, Asn, Gln, Glu, Tyr lie Leu; Val Leu, Met, Val Leu, Met, Phe, Val Leu He; Val He, Met, Phe, Val lie, Met, Phe, Val Lys Arg; Gln; Glu Arg, Asn, Gln, Glu Arg, Asn, Gln, Glu, Ser, Met Leu; lie Gln, lie, Leu, Val Gln, lie, Leu, Phe, Val Phe Met; Leu; Tyr Leu, Trp, Tyr lie, Leu, Met, Trp, Tyr Ser Thr Ala, Asn, Thr Ala, Asn, Asp, Gln, Glu, Gly, Lys, Thr Thr Ser Ala, Asn, Ser Ala, Asn, Ser, Val Trp Tyr Phe, Tyr Phe, Tyr Tyr Trp; Phe His, Phe, Trp His, Phe, Trp Val He; Leu lie, Leu, Met Ala, lie, Leu, Met, Thr In some examples, variants may not have more than 3, 5, 10, 15, 20, 25, 30, 40, 50, or 100 conservative amino acid changes (such as very highly conserved or highly conserved amino acid substitutions). In other examples, one or more hydrophobic residues (such as Leu, lie, Val, Met, Phe, or Trp) in a variant sequence may be replaced with a different hydrophobic residue (such as Leu, lie, Val, Met, Phe, or Trp). ) to create a variant functionally similar to the described amino acid sequences encoded by the FusFH nucleic acid sequences, FusFH homologs, FusFH orthologs and / or FusFH paralogs, and / or fragments and variations thereof. In some embodiments, variants may differ from the disclosed sequences by altering the coding region to conform to the codon usage bias of the particular organism into which the molecule is to be introduced. In other embodiments, the coding region may be altered by taking advantage of the degeneracy of the genetic code to alter the coding sequence such that, although the nucleotide sequence is substantially altered, it nevertheless encodes a protein having an amino acid sequence substantially similar to that described. , amino acid sequences encoded by the FusFH nucleic acid sequences, FusFH homologs, FusFH orthologs and / or FusFH paralogs, and / or fragments and variations thereof. In some embodiments, functional fragments derived from the FusFH orthologs of the present disclosure are provided. Functional fragments can still confer resistance to pathogens when expressed in a plant. In some embodiments, the functional fragments contain at least the conserved region or Bowman-Birk inhibitory domain of a wild-type FusFH ortholog, or functional variants thereof. In some embodiments, the functional fragments contain one or more conserved regions shared by two or more FusFH orthologs, shared by two or more FusFH orthologs in the same plant genus, shared by two or more FUSFH orthologs from dicots and / or shared by two or more monocot FusFH orthologs. The conserved regions or domains of the Bowman-Birk inhibitor can be determined by any suitable computer program, such as the NCBI protein BLAST program and the NCBI Alignment program, or equivalent programs. In some embodiments, the functional fragments are 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49, 50 or more amino acids shorter compared to the FusFH orthologs of the present description. In some embodiments, functional fragments are obtained by removing one or more amino acids from the FusFH orthologs of the present disclosure. In some embodiments, the functional fragments share at least 80%, 85%, 907o, 957o, 967o, 977o, 987o, 997o or more identity with respect to the FusFH orthologs of the present disclosure. In some embodiments, chimeric or synthetic functional polypeptides derived from the FusFH orthologs of the present disclosure are provided. Chimeric or synthetic functional polypeptides can still confer resistance to pathogens when expressed in a plant. In some embodiments, functional synthetic or chimeric polypeptides contain at least the conserved region or Bowman-Birk inhibitory domain of an orthologous wild-type FUSFH, or functional variants thereof. In some embodiments, functional synthetic or chimeric polypeptides contain one or more conserved regions shared by two or more FUSR1 orthologs, shared by two or more FusRI orthologs in the same plant genus, shared by two or more monocot FusRI orthologs. and / or shared by two or more dicot FUSR1 orthologs. Illustrative non-limiting conserved regions are shown in Figure 2. The conserved regions or domains of the Bowman-Birk inhibitor can be determined by any suitable computer program, such as the NCBI protein BLAST program and the NCBI Alignment program, or equivalent programs. In some embodiments, the functional synthetic or chimeric polypeptides share at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with respect to the FusRI orthologs herein. description. Sequences from conserved regions unique to FW-responsive alleles can also be used to downgrade one or more FusRI orthologs. In some embodiments, conserved region sequences can be used to generate gene silencing molecules to target one or more FusRI orthologs. In some embodiments, the gene silencing molecules are selected from the group consisting of double-stranded polynucleotides, single-stranded polynucleotides, or mixed duplex oligonucleotides. In some embodiments, the gene silencing molecules comprise a DNA / RNA fragment of approximately 10 bp, 15 bp, 19 bp, 20 bp, 21 bp, 25 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp. , 80 bp, 90 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp or more polynucleotides, in wherein the DNA / RNA fragment shares at least 90%, 95%, 99% or more identity with respect to a conserved region of the FusRI ortholog sequences of the present disclosure, or complementary sequences thereof. V. Plant transformation The present polynucleotides encoding FLJSR1, FusRI homologs, FusRI orthologs and / or FusRI paralogs, and / or fragments and variations thereof of the present description can be transformed into banana or other plant genera. Methods for producing transgenic plants are well known to those skilled in the art. Transgenic plants can now be produced by a variety of different transformation methods, including, but not limited to, electroporation; microinjection; microprojectile bombardment, also known as particle acceleration or biolistic bombardment; virus-mediated transformation; and Agrobacterium-mediated transformation. See, for example, United States Patent Nos. 5,405,765; 5,472,869; 5,538,877; 5,538,880; 5,550,318; 5,641,664; 5,736,369 and 5,736,369; International Patent Application Publications nos. WO2002 / 038779 and WO / 2009 / 117555; Lu et al., (Plant Cell Reports, 2008,27:273-278); Watson et al., Recombinant DNA, Scientific American Books (1992); Hinchee et al., Bio / Tech. 6:915-922 (1988); McCabe et al., Bio / Tech. 6:923-926 (1988); Toriyama et al., Bio / Tech. 6:1072-1074 (1988); Fromm et al., Bio / Tech. 8:833-839 (1990); Mullins and others, Bio / Tech. 8:833839 (1990); Hiei et al., Plant Molecular Biology 35:205-218 (1997); Ishida et al., Nature Biotechnology 14:745-750 (1996); Zhang et al., Molecular Biotechnology 8:223-231 (1997); Ku et al., Nature Biotechnology 17:76-80 (1999); and Raineri et al., Bio / Tech. 8:33-38 (1990)), each of which is expressly incorporated herein by reference in its entirety. Agrobacterium tumefaciens is a naturally occurring bacteria that is capable of inserting its DNA (genetic information) into plants, resulting in a type of plant damage known as crown gall. Most plant species can now be transformed using this method, including cucurbit species. Microprojectile bombardment is also known as particle acceleration, bioIistic bombardment and gene gun (Biolistic® Gene Gun). The gene gun is used to shoot pellets that are coated with genes (for example, for desired traits) into plant seeds or plant tissues so that the plant cells express the new genes. The gene gun uses a real explosive (.22 caliber target) to propel the material. Compressed air or steam can also be used as a propellant. The Biolistic® gene gun was invented in 1983-1984 at Cornell University by John Sanford, Edward Wolf and Nelson Alien. Both it and its trademark are now the property of Ε.Ι. du Pont de Nemours and Company. Most plant species have been transformed by using this method. The most common method for introducing new genetic material into a plant genome involves using live cells of the bacterial pathogen Agrobacterium tumefaciens to literally inject a fragment of DNA, called T-DNA or transfer DNA, into individual plant cells (usually after tissue injury) where it is directed to the plant nucleus for chromosome integration. There are numerous patents governing Agrobacterium-mediated transformation and particular DNA delivery plasmids designed specifically for use with Agrobacterium — for example, US4536475, EP0265556, EP0270822, WO8504899, WO8603516, US5591616, EP0604662, EP0672752, WO860377 6, WO9209696, WO9419930, WO9967357, US4399216, WO8303259, US5731179, EP068730, WO9516031, US5693512, US6051757 and EP904362A1. Agrobacterium-mediated plant transformation involves as a first step the placement of DNA fragments cloned into plasmids into living Agrobacterium cells, which are then used for transformation into individual plant cells. Agrobacterium-mediated plant transformation is therefore an indirect method of plant transformation. Methods of Agrobacterium-mediated plant transformation involving the use of non-T-DNA vectors are also well known to those skilled in the art and may have applicability herein. See, for example, United States Patent no. 7,250,554, which uses P-DNA instead of T-DNA in the transformation vector. A transgenic plant formed by using Agrobacterium transformation methods typically contains a single gene on one chromosome, although multiple copies are possible. Such transgenic plants may be referred to as hemizygous for the added gene. A more accurate name for such a plant is an independent segregant, because each transformed plant represents a unique T-DNA integration event (US Patent No. 6,156,953). A transgenic locus is generally characterized by the presence and / or absence of the transgene. A heterozygous genotype in which one allele corresponds to the absence of the transgene is also designated as hemizygous (U.S. Patent No. 6,008,437). Methods of direct plant transformation using DNA are also reported. The first of these to be reported historically is electroporation, which uses an electrical current applied to a solution containing plant cells (Μ. E. Fromm et al., Nature, 319, 791 (1986); H. Jones et al., Plant Mol. Biol., 13, 501 (1989) and H. Yang et al., Plant Cell Reports, 7, 421 (1988). Another direct method, called biolistic bombardment, uses ultrafine particles, usually tungsten or gold, which are coated with DNA and then sprayed onto the surface of a plant tissue with enough force to cause the particles to penetrate the plant cells, including the thick cell wall, membrane, and nuclear envelope, but without killing at least some of them ( (US 5,204,253, US 5,015,580). A third direct method uses metal or ceramic fibrous forms that consist of sharp, porous or hollow needle-like projections that literally pass through the cells, and also the nuclear envelope of the cells. Both the fibers Silicon carbide and aluminum borate have been used for plant transformation (Mizuno et al., 2004; Petolino et al., 2000; US5302523 US Application 20040197909) and also for the transformation of bacteria and animals (Kaeplery et al., 1992; Raloff, 1990; Wang, 1995). There are other reported methods and no doubt additional methods will be developed. However, the efficiencies of each of these indirect or direct methods of introducing foreign DNA into plant cells are invariably extremely low, making it necessary to use some method for selecting only those cells that have been transformed and, furthermore, allowing the growth and regeneration in plants of only those cells that have been transformed. For efficient plant transformation, a selection method must be employed such that entire plants are regenerated from a single transformed cell and each cell of the transformed plant carries the DNA of interest. These methods may employ positive selection, whereby a foreign gene is supplied to a plant cell that allows it to use a substrate present in the medium that it could not otherwise use, such as mannose or xylose (e.g., see papers US 5767378; US 5994629). However, negative selection is more typically used because it is more efficient, using selective agents such as herbicides or antibiotics that kill or inhibit the growth of untransformed plant cells and reduce the possibility of chimeras. Resistance genes that are effective against negative selection agents are provided in the introduced foreign DNA that is used for plant transformation. For example, one of the most popular selective agents used is the antibiotic kanamycin, along with the resistance gene neomycin phosphotransferase (nptll), which confers resistance to kanamycin and related antibiotics (see, for example, Messing & Vierra, Gene 19 :259-268 (1982); Bevan et al., Nature 304:184-187 (1983). However, many different antibiotics and antibiotic resistance genes can be used for transformation purposes (see US 5034322, US 6174724 and US 6255560). Additionally, several herbicides and herbicide resistance genes can be used for transformation, including the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., Nucí Acids Res 18: 1062 (1990), Spencer et al. ΜΛ / a / ZUZZ / UUU 1 oz others, Theor Appl Genet 79: 625-631(1990), US 4795855, US 5378824 and US 6107549). Additionally, the dhfr gene, which confers resistance to the anticancer agent methotrexate, has been used for selection (Bourouis et al., EMBOJ. 2(7): 1099-1104(1983). The expression control elements that are used to regulate the expression of a given protein may be the expression control element that is normally associated with the coding sequence (homologous expression element) or it may be an expression control element. heterologous. A variety of homologous and heterologous expression control elements are known in the art and can readily be used to generate expression units for use herein. Transcription initiation regions, for example, may include any of the various opine initiation regions, such as octopine, mannopine, nopaline and the like found on Agrobacterium tumefaciens Ti plasmids. Alternatively, plant viral promoters, such as the 19S and 35S promoters of cauliflower mosaic virus (CaMV 19S and CaMV 35S promoters, respectively) can also be used to control gene expression in a plant (U.S. Patents Nos. 5,352,605; 5,530,196 and 5,858,742, for example). Enhancer sequences derived from CaMV can also be used (US Patent Nos. 5,164,316; 5,196,525; 5,322,938; 5,530,196; 5,352,605; 5,359,142; and 5,858,742, for example). Finally, plant promoters such as the prolifera promoter, fruit-specific promoters, Ap3 promoter, heat shock promoters, seed-specific promoters, etc. can also be used. Either a gamete-specific promoter, a constitutive promoter (such as the CaMV or Nos promoter), an organ-specific promoter (such as the tomato E8 promoter), or an inducible promoter typically binds to the protein or antisense coding region via the use of standard techniques known in the art. The expression unit can be further optimized by employing supplementary elements such as transcription terminators and / or enhancer elements. Therefore, for expression in plants, the expression units will typically contain, in addition to the protein sequence, a plant promoter region, a transcription initiation site and a transcription termination sequence. Unique restriction enzyme sites are typically included at the 5' and 3' ends of the expression unit to allow easy insertion into a pre-existing vector. In the construction of heterologous promoter / structural gene or antisense combinations, the promoter is preferably located at the same distance from the heterologous transcription start site as from the transcription start site in its natural environment. However, as is known in the art, some variation in this distance can be accommodated without loss of promoter function. In addition to a promoter sequence, the expression cassette may also contain a transcription termination region downstream of the structural gene to provide efficient termination. The termination region can be obtained from the same gene as the promoter sequence or can be obtained from different genes. If the mRNA encoded by the structural gene is to be processed efficiently, DNA sequences that direct polyadenylation of the RNA are also commonly added to the vector construct. Polyadenylation sequences include, but are not limited to, the MA / a / ZUZZ / UUUI oz octopine synthase from Agrobacterium (Gielen et al., EMBO J 3:835-846 (1984)) or nopaline signal synthase (Depicker et al., Mol. and Appl. Genet. 1:561- 573 (1982)). The resulting expression unit is joined or otherwise constructed to include it in a vector that is appropriate for the transformation of higher plants. One or more expression units may be included in the same vector. The vector will typically contain a selectable marker gene expression unit by which transformed plant cells can be identified in culture. Generally, the marker gene will encode resistance to an antibiotic, such as G418, hygromycin, bleomycin, kanamycin or gentamicin, or to a herbicide, such as glyphosate (Round-Up) or glufosinate (BASTA) or atrazine. Generally, replication sequences, of bacterial or viral origin, are also included to allow the vector to be cloned into a bacterial or phage host; preferably, a wide host range is included for the prokaryotic origin of replication. A bacterial selectable marker may also be included to allow selection of bacterial cells carrying the desired construct. Suitable prokaryotic selectable markers include resistance to antibiotics such as ampicillin, kanamycin or tetracycline. Other DNA sequences that encode additional functions may also be present in the vector, as is known in the art. For example, in the case of transformations by Agrobacterium, T-DNA sequences will also be included for subsequent transfer to plant chromosomes. To introduce a desired gene or set of genes using conventional methods, a sexual cross between two lines is required, and then repeated backcrossing between the hybrid offspring and one of the parents until a plant with the desired characteristics is obtained. This process, however, is restricted to plants that can hybridize sexually, and other genes will be transferred in addition to the desired gene. Recombinant DNA techniques allow plant researchers to circumvent these limitations by allowing plant geneticists to identify and clone specific genes for desirable traits, such as improved fatty acid composition, and introduce these genes into already popular plant varieties. tools. Once foreign genes are introduced into a plant, this plant can then be used in plant breeding schemes (e.g., pedigree breeding, single-seed offspring breeding schemes, recurrent reciprocal selection) to produce progeny that also contains the gene of interest. Genes can be introduced into the site in a site-directed manner through the use of homologous recombination. Homologous recombination allows site-specific modifications in endogenous genes and, therefore, inherited or acquired mutations can be corrected and / or new alterations can be introduced into the genome. Homologous recombination and site-directed integration in plants is discussed, for example, in United States Patent Nos. 5,451,513; 5,501,967 and 5,527,695. According to Ploetz (2015, Phytopathology 105:1512-1521), “Genetic transformation of bananas has become commonplace, and disease resistance is one of the most sought-after traits [citations omitted]. Techniques for transforming and regenerating banana plants are well known in the art. See, for example, United States Patent no. 7,534,930; United States Patent No. 6,133,035; Sagi et al., Bio / Technology 13, 481-485, 1995; May et al., Bio / Technology 13, 485492, 1995; Vishnevetsky et al., Transgenic Res. 20(1):61-71,2011; Paul et al. (2011); Zhong et al., Plant Physiol. 110, 1097-1107, 1996; and Dugdale et al., Journal of General Virology 79:2301-2311, 1998, each of which is expressly incorporated herein by reference in its entirety. For summaries and history, see, for example, Mohán and Swennen (eds.), 2004, Banana improvement: cellular, molecular biology, and induced mutations, Science Publishers, Inc.; and, Remy et al., 2013, Genetically modified bananas: Past, present and future, Acta Hortícolae 974:71-80, each of which is expressly incorporated herein by reference in its entirety. In reducing the present invention to practice, the inventor can construct an expression construct that includes nucleotide sequences encoding FUSR1, FusRI homologs, FusRI orthologs and / or FusRI paralogs, and / or fragments and variations thereof. The expression construct of the present invention can be introduced into the embryogenic callus of commercial banana and the resulting transformed cells can be regenerated into plants. Transgenic banana plants are expected to have expression of the FW-resistant FUSR1 protein and resistance to pathogens. According to one aspect of the present invention, there is provided a method of producing a disease resistant banana plant. The method is carried out by transforming a banana cell with at least one exogenous polynucleotide encoding a polypeptide (such as FW-resistant FusRI) capable of conferring disease resistance to a banana plant. According to another aspect of the present invention, there is provided a method of producing a disease resistant banana plant. The method is carried out by transforming a banana cell with at least one exogenous expression cassette containing polynucleotides that encode a CRISPR-associated effector protein and a guide RNA capable of targeting at least one FW-sensitive FusRI allele, which confers This way disease resistance to a banana plant. The banana cell of the present invention may be any banana variety or cultivar, including, but not limited to, commercially important M. acuminata (Cavendish, Dwarf Cavendish, Grand Nain, etc.). Preferably, the banana cell used for transformation is an embryogenic cell that is capable of forming a complete plant. More preferably, the banana cell is an embryogenic callus cell. The phrase embryogenic callus cell used in the present description refers to an embryogenic cell contained in a cell mass produced in vitro. Banana embryogenic callus cells suitable for transformation can be generated by using a well-known methodology. For example, immature male flowers (inflorescences) can be dissected and incubated in M1 medium (see contents in Table 1 of the present description below) under reduced light intensity (50-100 lux) at 25 ° C. After 3-5 months of incubation in M1 medium, yellow embryogenic calli are transferred to M2 medium (see contents in Table 1 below) and incubated at 27SC in the dark for at least four months to promote embryogenesis. MA / a / 4U44 / UUU 1 04 As mentioned above, said banana embryogenic callus cells are suitable for transformation with a nucleic acid construct that includes at least one polynucleotide encoding a disease-resistant polypeptide. The phrases polypeptide capable of conferring resistance to disease and polypeptide of disease resistance are used interchangeably in the present description to refer to any peptide, polypeptide or protein that is capable of protecting a banana plant (expressing the polypeptide) from pathogen infection or the harmful effects resulting from pathogen infection. A suitable disease resistance polypeptide may also be a polypeptide capable of inducing or enhancing resistance in plants as described, for example, in United States Patent Nos. 6,091,004 and 6,316,697. As mentioned above, the method of the present invention is carried out by transforming a banana cell with at least one polynucleotide that encodes a polypeptide capable of conferring disease resistance to a banana plant. In some embodiments, the banana cell is transformed with a polynucleotide sequence encoding the Musa itinerans FUSR1 protein, an example of which is set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 5. In some embodiments, the banana cell is transformed with a polynucleotide sequence encoding the Musa acuminata FUSR1 protein, an example of which is set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11. In some embodiments, the banana cell is transformed with a polynucleotide sequence encoding the Musa basjoo FUSR1 protein, an example of which is set forth in SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 20 and SEQ ID NO: 21. In some embodiments, the banana cell is transformed with a polynucleotide sequence that encodes the FUSR1 protein from Musella lasíocarpa, an example of which is set forth in SEQ ID NO: 23. In some embodiments, the banana cell is transformed with a polynucleotide sequence encoding the Musa balbisiana FUSR1 protein, an example of which is set forth in SEQ ID NO: 26. In some embodiments, plants transformed with a single exogenous disease resistance polypeptide, such as FUSR1, may exhibit only partial and short-lived protection (see, for example, in Jach et al., Plant J. 8:97- 108, 1995). In other embodiments, the banana cell / plant of the present invention preferably expresses a plurality of exogenous disease resistance polypeptides and is, therefore, substantially more resistant to disease than unmodified plants. Various approaches can be used to transform and co-express these polynucleotides in plant cells. Although less preferred, each of the polynucleotide sequences described above can be introduced separately into a banana cell through the use of three separate nucleic acid constructs. In some embodiments, all three polynucleotide sequences can be introduced and co-expressed in the banana cell through the use of a single nucleic acid construct. MA / a / ZUZZ / UUUI 04 Said construct can be designed with a single promoter sequence that can transcribe a polycistronic message that includes the three polynucleotide sequences. To allow co-translation of the three polypeptides encoded by the polycistronic message, the polynucleotide sequences may be interconnected by an internal ribosome entry site (IRES) sequence that facilitates translation of polynucleotide sequences located downstream of the IRES sequence. . In this case, a transcribed polycistronic RNA molecule encoding the three polypeptides described above will be translated from both the 5' capped end and the two internal IRES sequences of the polycistronic RNA molecule to thus produce in the cell the three polypeptides. Alternatively, the polynucleotide segments encoding the plurality of polypeptides capable of conferring disease resistance may be translationally fused via a protease recognition site cleaved by a protease expressed by the cell to be transformed with the nucleic acid construct. . In this case, a translated chimeric polypeptide will be cleaved by a protease expressed in cells to thereby generate the plurality of polypeptides. In other embodiments, the present invention utilizes a nucleic acid construct that includes three promoter sequences, each capable of directing transcription of a polynucleotide sequence specific to the polynucleotide sequences described above. Suitable promoters that can be used with the nucleic acid of the present invention include constitutive, inducible or tissue-specific promoters. Suitable constitutive promoters include, for example, the CaMV 35S promoter (Odell et al., Nature 313:810-812, 1985); maize Ubi 1 (Christensen et al., Plant Sol. Biol. 18:675-689, 1992); rice actin (McEIroy et al., Plant Cell 2:163-171, 1990); pEMU (Last et al., Theor. ApL Genet. 81:581-588, 1991); and Synthetic Super MAS (Ni et al., The Plant Journal 7:661-76,1995). Other constituent promoters include those of United States Patent Nos. 5,659,026, 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463 and 5,608,142. Suitable inducible promoters may be pathogen-inducible promoters such as, for example, the alfalfa PR10 promoter (Coutos-Thevenot et al., Journal of Experimental Botany 52: 901910, 2001 and the promoters described by Marineau et al., Plant Mol Biol. 9:335-342,1987; Matton et al., Molecular Plant-Microbe Interactions 2:325-331, 1989; Somsisch et al., Proc. Nati. Acad. Sel. USA 83:2427-2430,1986: Somsisch et al., Mol. Gen. Genet. 2:93-98, 1988; and Yang, Proc. Nati. Acad. Sci. USA 93:14972-14977, 1996. Suitable tissue-specific promoters include, but are not limited to, leaf-specific promoters such as those described, for example, by Yamamoto et al., Plant J. 12:255-265, 1997; Kwon et al., Plant Physiol. 105:357-67, 1994; Yamamoto et al., Plant Cell Physiol. 35:773-778, 1994; Gotor et al., Plant J. 3:509-18, 1993; Orozco et al., Plant Mol. BioL 23:1129-1138, 1993; and Matsuoka et al., Proc. Nati. Academic Sci. USA 90:9586-9590, 1993. The nucleic acid construct of the present invention may also include at least one selectable marker such as, for example, nptll. Preferably, the nucleic acid construct is a shuttle vector, which can both be propagated in E. coli (where the construct comprises an appropriate selectable marker and an origin of replication) and is compatible for propagation in cells. The construct according to the present invention may be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome, preferably a plasmid. The nucleic acid construct of the present invention can be used to stably transform banana cells. The main methods to cause the stable integration of exogenous DNA into the banana genome include two main approaches: (i) Agrobacterium-mediated gene transfer: Klee et al., (1987) Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds. Schell, J. and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 225; Gatenby, in Plant Biotechnology, eds. Kung, S. and Arntzen, C. J., Butterworth Publishers, Boston, Mass. (1989) p. 93-112. (II) Direct DNA uptake: Paszkowski et al., in Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes eds. Schell, J. and Vasil, L. K., Academic Publishers, San Diego, Calif. (1989) p. 52-68; including methods for direct DNA uptake into protoplasts, Toriyama, K. et al., (1988) Bio / Technology 6:1072-1074. DNA uptake induced by brief electric shock of plant cells: Zhang et al., Plant Cell Rep. (1988) 7:379-384. Fromm et al., Nature (1986) 319:791-793. DNA injection into plant cells or tissues by particle bombardment, Klein et al., Bio / Technology (1988) 6:559-563; McCabe et al., Bio / Technology (1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; through the use of micropipette systems: Neuhaus et al., Theor. Api. Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990) 79:213-217; glass fibers or transformation of cell cultures by silicon carbide fibers, embryos or callus tissue, US Patent 5,464,765 or by direct incubation of DNA with germinating pollen, DeWet et al., in Experimental Manipulation of Ovule Tissue, eds . Chapman, G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Nati. Academic Sci. USA (1986) 83:715-719. The Agrobacterium system includes the use of plasmid vectors containing defined DNA segments that integrate into the plant's genomic DNA. Plant tissue inoculation methods vary depending on the plant species and the Agrobacterium administration system. One widely used approach is the leaf disc procedure, which can be performed with any tissue explant that provides a good source for the initiation of whole plant differentiation. Horsch et al., in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A complementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. Suitable Agrobacterium-mediated procedures for introducing exogenous DNA into banana cells are described by Dougale et al. (Journal of General Virology, 79:2301-2311, 1998) and in United States Patent no. 6,395,962. There are various methods of direct transfer of DNA to plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field. In microinjection, DNA is mechanically injected directly into cells by using very small micropipettes. In microparticle bombardment, DNA is adsorbed onto microprojectiles, such as sodium sulfate crystals. MA / a / ZUZZ / UUUI oz magnesium or tungsten particles, and the microprojectiles are physically accelerated toward plant cells or tissues. Alternatively, the nucleic acid construct of the present invention can be introduced into banana cells by microprojectile bombardment. In this technique, tungsten or gold particles coated with exogenous DNA are accelerated toward target cells. Suitable banana transformation procedures by microprojectile bombardment are described by Sagi et al. (Biotechnology 13:481-485, 1995) and by Dougale et al., (Journal of General Virology, 79:2301-2311, 1998). Preferably, the nucleic acid construct of the present invention is introduced into banana cells by a microprojectile bombardment method as described in Example 4 herein below. After transformation, the transformed cells are micropropagated to provide rapid and consistent reproduction of the transformed material. Micropropagation is a process of growing new generation plants from a single piece of tissue that is excised from a selected parent plant or crop. This process allows the mass reproduction of plants that have the preferred tissue that expresses the fusion protein. The new generation plants that are produced are genetically identical and have all the characteristics of the original plant. Micropropagation allows the mass production of quality plant material in a short period of time and offers rapid multiplication of selected cultivars while preserving the characteristics of the original transgenic or transformed plant. The advantages of plant cloning are the speed of plant multiplication and the quality and uniformity of the plants produced. Micropropagation is a multi-stage procedure that requires alteration of the culture medium or growth conditions between stages. Therefore, the micropropagation process involves four basic stages: stage one, initial tissue culture; stage two, tissue culture multiplication; stage three, differentiation and formation of the plant and stage four, greenhouse cultivation and hardening. During stage one, initial tissue culture, the tissue culture is established and certified as free of contaminants. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the tissue samples grown in stage two are divided and grown into individual seedlings. In stage four, the transformed seedlings are transferred to a greenhouse for hardening off, where the plants' light tolerance is gradually increased so they can grow in the natural environment. Therefore, transformed banana cells can be micropropagated and regenerated into plants using methods known in the art such as those described, for example, in United States Patent No. 6,133,035 and Novak et al., 1989; Dhed'a et al., 1991; Cote et al., 1996; Becker et al., 2000; Sagi et al., Plant Cell Reports 13:262-266, 1994; Grapin et al., Cell Dev. Biol. Plant. 32:66-71,1996; Marroquin et al., In Vivo Cell. Div. Biol. 29P:43-46,1993; and Escalant et al., In Vivo Cell Dev. Biol. 30:181-186, 1994). Stable integration of the exogenous DNA sequence into the genome of transformed plants can be determined by using standard molecular biology techniques well known in the art such as PCR and Southern blot hybridization. Although stable transformation is currently preferred, the present invention also contemplates the transient transformation of cultured cells, leaf cells, meristematic cells or the entire plant. Transient transformation can be carried out by any of the direct DNA transfer methods described above or by viral infection using modified plant viruses. Viral infection is preferred as it allows avoiding micropropagation and regeneration of a whole plant from cultured cells. Viruses that have been shown to be useful for the transformation of host plants include CaMV, TMV, and BV. Transformation of plants using plant viruses is described in United States Patent No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application no. 63-14693 (TMV), EPA 194.809 (BV), EPA 278.667 (BV); and Gluzman et al. (Communications in Molecular Biology: Viral Vectors, Coid Spring Harbor Laboratory, New York, pp. 172-189, 1988). Pseudovirus particles are described in WO 87 / 06261 for use in the expression of foreign DNA in many hosts, including plants. The construction of plant RNA viruses for the introduction and expression of exogenous non-viral nucleic acid sequences in plants is demonstrated by the above references, as well as by Dawson et al. (Virology 172:285-292, 1989; Takamatsu et al., EMBO J. 6:307-311, 1987; French et al., (Science 231:1294-1297, 1986); and Takamatsu et al., (FEBS Letters 269: 73-76, 1990). When the virus is a DNA virus, appropriate modifications can be made to the virus itself. Alternatively, the virus can first be cloned into a bacterial plasmid to facilitate construction of the desired viral vector with the foreign DNA. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the envelope protein that encapsulates the viral DNA. If the virus is an RNA virus, the virus is usually cloned as a cDNA and inserted into a plasmid. The plasmid is then used to create all constructs. The RNA virus is then produced by transcribing the viral sequence from the plasmid and translating the viral genes to produce the envelope protein(s) that encapsulate the viral RNA. The construction of plant RNA viruses for the introduction and expression in plants of exogenous non-viral nucleic acid sequences, such as those included in the construct of the present invention, is demonstrated by the references above, as well as in the Patent of the United States no. 5,316,931. In one embodiment, a plant viral nucleic acid is provided in which the native envelope protein coding sequence was deleted from a viral nucleic acid, a non-native plant viral envelope protein coding sequence and a non-native promoter were inserted. , preferably, the subgenomic promoter of the coding sequence of the non-native coat protein, capable of being expressed in the plant host, of packaging the recombinant plant viral nucleic acid and of guaranteeing a systemic infection of the host by the recombinant plant viral nucleic acid. Alternatively, the coat protein gene can be inactivated by inserting the non-native nucleic acid sequence into it, so that a protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and is unable to recombine with each other and with native subgenomic promoters. Non-native (foreign) nucleic acid sequences may be inserted adjacent to the native plant viral subgenomic promoter or the native and non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. Non-native nucleic acid sequences are transcribed or expressed in the host plant under the control of the subgenomic promoter to produce the desired products. In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment, except that the coding sequence of the native coat protein is placed adjacent to one of the subgenomic promoters of the non-native coat protein instead of a coding sequence of the non-native coat protein. In a third embodiment, a recombinant plant viral nucleic acid is provided in which the native envelope protein gene is adjacent to its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a host plant and are unable to recombine with each other and with native subgenomic promoters. The non-native nucleic acid sequences can be inserted adjacent to the non-native subgenomic viral promoters of the plant, such that the sequences are transcribed or expressed in the host plant under the control of the subgenomic promoters to produce the desired product. In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment, except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence. The viral vectors are encapsulated by the envelope proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or the recombinant plant virus is used to infect the appropriate host plants. The recombinant plant viral nucleic acid is capable of replicating in the host, disseminating systemically in the host and transcribing or expressing the foreign genes (isolated nucleic acid) in the host to produce the desired protein. In addition to the above, the nucleic acid molecule of the present invention can also be introduced into a genome of a chloroplast thereby allowing chloroplast expression. A technique is known to introduce exogenous nucleic acid sequences into the chloroplast genome. This technique involves the following procedures. First, plant cells are chemically treated to reduce the number of chloroplasts per cell to about one. The exogenous nucleic acid is then introduced by particle bombardment into the cells with the aim of introducing at least one molecule of exogenous nucleic acid into the chloroplasts. The exogenous nucleic acid is selected so that it can be integrated into the chloroplast genome through homologous recombination that is easily carried out by enzymes inherent to the chloroplast. For this purpose, the exogenous nucleic acid includes, in addition to a gene of interest, at least one stretch of nucleic acid that is derived from the chloroplast genome. Furthermore, the exogenous nucleic acid includes a selectable marker, which serves by sequential selection procedures to verify that all or substantially all copies of the chloroplast genomes after said selection will include the exogenous nucleic acid. More details regarding this technique can be found in United States Patent Nos. 4,945,050; and 5,693,507 which are incorporated herein by reference. Therefore, a polypeptide can be produced by the chloroplast protein expression system and integrated into the inner membrane of the chloroplast. In case the exogenous polypeptide confers disease resistance to the plant, expression can be determined based on increased resistance or tolerance to pathogens, preferably, compared to a similar wild-type (non-transformed) plant. Comparative evaluation of plants to determine their resistance or tolerance to pathogens can be carried out through the use of in vitro or in vivo bioassays well known in the art of plant pathology such as those described, for example, by Agrios, G. N., ed. (Plant Pathology, Third Edition, Academic Press, New York, 1988). The evaluation of plant resistance or tolerance to pathogens can be carried out by exposing a pathogen to an extract obtained from plant tissue and determining the effect of the extract on the growth of the pathogen in vitro. In some embodiments, evaluation of plant resistance or tolerance to pathogens is accomplished by exposing a pathogen to a plant tissue (e.g., leaf tissue). In other embodiments, the evaluation of plant resistance or tolerance to pathogens is carried out by exposing a pathogen to a whole plant. For example, the evaluation of plant resistance or tolerance to Fusarium oxysporum f. sp. Cúbense (Foc) (the causal agent of Panama disease) can be affected by planting transformed banana plants in an open field near non-transformed plants that are infected with the pathogen (used as a source of inoculum). The severity of the disease that subsequently develops in transformed plants is evaluated comparatively with non-transformed plants. Disease severity is preferably assessed visually (damage generally appears on shoots that have at least 5-12 leaves) and statistically analyzed to determine significant differences in resistance or tolerance between plant lines to the disease. Panama. Therefore, the present invention provides nucleic acid constructs that include one or more polynucleotides encoding disease resistance polypeptides, transformed banana cells and transformed banana plants that express exogenous disease resistance traits, and methods for producing them. SAW. Improvement methods MA / a / ZUZZ / UUUI oz Open-pollinated populations. Improving open-pollinated populations of crops such as rye, many maizes and sugar beets, herbaceous grasses, legumes such as alfalfa and clover, and tropical tree crops such as cocoa, coconuts, oil palm and some rubber, depends essentially on changes in gene frequencies towards the fixation of favorable alleles while maintaining a high (but far from the maximum) degree of heterozygosity. Uniformity in such populations is impossible and correspondence to type in an open-pollinated variety is a statistical characteristic of the population as a whole, not a characteristic of individual plants. Therefore, the heterogeneity of open-pollinated populations contrasts with the homogeneity (or nearly so) of inbred lines, clones and hybrids. Population improvement methods naturally fall into two groups, those based on purely phenotypic selection, usually called mass selection, and those based on selection with progeny testing. Interpopulation breeding uses the concept of open breeding populations; allowing genes to flow from one population to another. Plants from a population (cultivar, strain, ecotype or any germplasm source) are crossed naturally (e.g. by wind) or by hand or by bees (commonly Apis mellifera L. or Megachile rotundata F.) with plants from other populations. Selection is applied to improve one (or sometimes both) populations by isolating plants with desirable traits from both sources. There are basically two main methods of open-pollinated population improvement. First, there is the situation where a population changes en masse through a chosen selection procedure. The result is an improved population that propagates indefinitely by random mating within itself in isolation. Secondly, the synthetic variety achieves the same final result, which is the improvement of the population, but it is not itself propagable as such; it has to be reconstructed from parental lines or clones. These plant breeding procedures for improving open-pollinated populations are well known to those skilled in the art, and numerous texts and articles provide comprehensive reviews of breeding procedures commonly used to improve cross-pollinated plants, which includes: Allard, Principles of Plant Breeding, John Wiley & Sons, Inc. (1960); Simmonds, Principles of Crop Improvement, Longman Group Limited (1979); Hallauer and Miranda, Quantitative Genetics in Corn Breeding, Iowa State University Press (1981); and Jensen, Plant Breeding Methodology, John Wiley & Sons, Inc. (1988). For population improvement methods specific to soybeans, see, for example, J.R. Wilcox, editor (1987) SOYBEANS: Improvement, Production, and Uses, Second Edition, American Society of Agronomy, Inc., Crop Science Society of America, Inc., and Soil Science Society of America, Inc., editors, 888 pages. Mass Selection. In mass selection, suitable individual plants are chosen, harvested and the seed composed without testing the progeny to produce the next generation. Since selection is based solely on the maternal parent and there is no control over pollination, mass selection is equivalent to a form of random mating with selection. As indicated MA / a / 4U44 / UUU1 04 above, the purpose of mass selection is to increase the proportion of superior genotypes in the population. Synthetics. A synthetic variety is produced by crossing with each other a number of genotypes that are selected for their good combinability in all possible hybrid combinations, with subsequent maintenance of the variety through open pollination. Whether the parents are (more or less inbred) lines propagated by seeds, as in some sugar beets and beans (Vicia) or clones, as in herbaceous grasses, clovers and alfalfa, there is no difference in principle. Parents are selected on the basis of general combinability, sometimes by test crosses or superior crosses, more usually by multiple crosses. Parental seed lines may be deliberately inbred (e.g., through selfing or sibling crossing). However, even if the parents are not deliberately inbred, selection within the lines during line maintenance will ensure that some inbreeding occurs. The clonal parents, of course, will remain unchanged and highly heterozygous. Whether a synthetic seed can be passed directly from the parent seed production plot to the farmer or must first undergo one or two multiplication cycles depends on seed production and the scale of seed demand. In practice, grasses and clovers are generally multiplied once or twice and thus deviate considerably from the original synthetic. While mass selection is sometimes used, testing progeny for multiple crossings is generally preferred, due to its operational simplicity and its obvious relevance to the objective, i.e., the exploitation of general combinability in a synthetic . The number of parental lines or clones that go into a synthetic varies widely. In practice, the number of parental lines varies from 10 to several hundred, where 100-200 is the average. Broad-based synthetics formed from 100 or more clones are expected to be more stable during seed multiplication than narrow-based synthetics. Hybrids. As discussed above, the hybrid is an individual plant resulting from a cross between parents of different genotypes. Commercial hybrids are now widely used in many crops, including corn (corn), sorghum, sugar beets, sunflowers, and broccoli. Hybrids can be formed in several different ways, including by crossing two parents directly (single-cross hybrids), by crossing a single-cross hybrid with another parent (triple-cross or three-way hybrids), or by cross two different hybrids (double or four-way cross hybrids). Strictly speaking, most individuals in an outbred (that is, open-pollinated) population are hybrids, but the term is generally reserved for cases in which the parents are individuals whose genomes are sufficiently distinct to be recognized. as different species or subspecies. Hybrids can be fertile or sterile depending on the qualitative and / or quantitative differences in the genomes of the two parents. Heterosis, or hybrid vigor, is generally associated with greater heterozygosity resulting in greater growth vigor, survival, and fertility of the hybrids compared to the parental lines that were used to form the hybrid. Maximum heterosis is usually achieved by crossing two genetically different and highly inbred lines. Hybrid production is a well-developed industry, involving the isolated production of both parental lines and hybrids resulting from crossing those lines. For a detailed analysis of the hybrid production process, see, for example, Wright, Commercial Hybrid Seed Production 8:161-176, in Hybridization of Crop Plants. Bulk segregation analysis (BSA). BSA, also known as clustering segregation analysis, or segregant clustering analysis, is a method described by Michelmore et al. (Michelmore et al., 1991, Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proceedings of the National Academy of Sciences, USA 99:9828-9832) and Quarrie et al. (Quarrie et al., Bulk segregant analysis with molecular markers and its use for improving drought resistance in maize, 1999, Journal of Experimental Botany, 50(337):1299-1306). For BSA of a trait of interest, parental lines with certain different phenotypes are chosen and crossed to generate F2, double haploid or inbred recombinant populations with QTL analysis. The population is then phenotyped to identify individual plants or lines that have high or low expression of the trait. Two pools of DNA, one from individuals having one phenotype (e.g., resistant to pathogens) and the other from individuals having the reverse phenotype (e.g., susceptible to pathogens), are prepared and analyzed to determine the frequency allelic with molecular markers. Only a few individuals are required in each cluster (e.g. 10 plants each) if the markers are dominant (e.g. RAPDs). More individuals are needed when the markers are co-dominant (e.g., RFLPs). Markers linked to the phenotype can be identified and used for breeding or QTL mapping. Gene pyramiding. The method of combining a number of target genes identified in different parents into a single genotype is often called gene pyramiding. The first part of a gene pyramiding breeding is called a pedigree and aims to accumulate one copy of all the target genes into a single genotype (called the root genotype). The second part is called fixation stages and aims to fix the target genes in a homozygous state, that is, to derive the ideal genotype (ideotype) from the root genotype. Gene pyramiding can be combined with marker-assisted selection (MAS, see Hospital et al., 1992, 1997a and 1997b, and Moreau et al., 1998) or marker-based recurrent selection (MBRS, see Hospital et al., 2000). . Banana breeding programs, especially for edible bananas, are hampered by high sterility, triploidy, and lack of seeds. Few diploid banana clones produce viable pollen, and the germplasm of commercial banana clones is both male and female sterile. Despite these problems and challenges, important progress has been made in the genetic improvement of Musa in recent years, and banana improvement programs continue to offer new varieties (Escalant and Jain, Chapter 30, Banana improvement with MA / a / ZUZZ / UUUI oz cellular and molecular biology, and induced mutations: future and perspectives, 8 pages, In Jain and Swennan, editors, Banana Improvement: Cellular, Molecular Biology, and Induced Mutations, 2004, Food and Agriculture Organization of the United Nations, Science Publishers, Inc.). For information on banana breeding, see, for example, Heslop-Harrison and Schwarzacher, Annals of Botany 100:1073-1084, 2007; Bakry et al., Chapter 1, Genetic Improvement in Banana, 50 pages, In Breeding Plantation Trae Crops: Tropical Species, 2009; Heslop-Harrison et al., Genomics, Banana Breeding and Superdomestication, Acta Hort. 897:55-62, 2011; Jenny et al., In Jacome et al., editors, Mycosphaerella leaf spot diseases of banana: present status and Outlook, Proceedings of the 2ndInternational Workshop on Mycosphaerella leaf spot diseases held in San José, Costa Rica, May 20-23, 2002, session 4, pages 199-208; Ortiz et al., Banana and Plantain Breeding, Chapter 10, pages 110-146, In Gowen et al., editor, Bananas and Plantains, World Crop Series, Springer Link, 1995; Batte et al., Frontiers in Plant Science, Vol. 10, article 81.9 pages, February 2019. Vile. Gene Editing As used herein, the term "gene editing system" refers to a system comprising one or more DNA-binding domains or components and one or more DNA-modifying domains or components, or isolated nucleic acids, e.g. , one or more vectors, which encode said DNA binding and modification domains or components. Gene editing systems are used to modify the nucleic acid of a target gene and / or to modulate the expression of a target gene. In known gene editing systems, for example, the one or more DNA-binding domains or components are associated with the one or more DNA-modifying domains or components, such that the one or more DNA-binding domains direct the one or more modifying domains or components of DNA to a specific nucleic acid site. Methods and compositions for enhancing gene editing are well known in the art. See, for example, United States Patent Application Publication no. 2018 / 0245065, which is incorporated by reference in its entirety. Certain gene editing systems are known in the art, and include, but are not limited to, zinc finger nucleases, transcription activator-like effector nucleases (TALENs); clustered regularly interspaced short palindromic repeats (CRISPR) / Cas systems, meganuclease systems, and viral vector-mediated gene editing. In some embodiments, the present disclosure teaches methods for gene editing / cloning using DNA nucleases. CRISPR complexes, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), and Fokl restriction enzymes, which are some of the sequence-specific nucleases used as gene editing tools. These enzymes can direct their nuclease activities to desired target loci through interactions with guide regions that are genetically manipulated to recognize sequences of interest. In some embodiments, the present disclosure teaches CRISPR-based gene editing methods for genetically manipulating the genome of the banana species of the present disclosure to stimulate, enhance, or modulate disease resistance of pathogens. MA / a / ZUZZ / UUUI 04 (i) CRISPR Systems CRISPR (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (cas) endonucleases were originally discovered as adaptive immunity systems developed by bacteria and archaea to protect against viral and plasmid invasion. Natural CRISPR / Cas systems in bacteria are composed of one or more Cas genes and one or more CRISPR arrays consisting of short palindromic repeats of base sequences separated by genome targeting sequences acquired from previously found viruses and plasmids (termed spacers). . (Wiedenheft, B. et al., Nature. 2012; 482:331; Bhaya, D. et al., Annu. Rev. Genet. 2011; 45:231; and Terms, M.P. et al., Curr. Opin. Microbiol. 2011; 14:321). Bacteria and archaea possessing one or more CRISPR loci respond to viral or plasmid challenge by integrating short fragments of foreign sequence (protospacers) into the host chromosome at the proximal end of the CRISPR array. Transcription of CRISPR loci generates a library of CRISPR-derived RNAs (crRNAs) containing sequences complementary to previously found invading nucleic acids (Haurwitz, RE, et al., Science. 2012:329;1355; Gesner, E.M., et al. , Nat. Struct. Mol. BioL 2001:18.688; Jinek, M., et al., Science. 2012:337; 816-21). Target recognition by crRNAs occurs through complementary base pairing with the target DNA, which directs the cleavage of foreign sequences by Cas proteins. (Jinek et al., 2012 “A Programmable dualRNA-guided DNA endonuclease in adaptive bacterial immunity.” Science. 2012:337; 816-821). There are at least five main types of CRISPR systems (Type I, II, III, IV and V) and at least 16 different subtypes (Makarova, K.S., et al., Nat Rev Microbiol. 2015. Nat. Rev. Microbiol. 13, 722 -736). CRISPR systems are also classified based on their effector proteins. Class 1 systems possess multi-subunit crRNA-effector complexes, while in Class 2 systems all functions of the effector complex are carried out by a single protein (e.g., Cas9 or Cpf 1). In some embodiments, the present disclosure provides for the use of type II and / or type V single subunit effector systems. As these occur naturally in many different types of bacteria, the exact arrangement of CRISPR and the structure, function and number of Cas genes and their product differ somewhat from species to species. Haft et al (2005) PLoS Comput. Bioi. 1:e60; Kunin et al (2007) Genome Bioi. 8: R61; Mojica et al. (2005) J. Mol. Evol. 60: 174-182; Bolotin et al (2005) Microbiol. 151: 2551-2561; Pourcel et al (2005) Microbiol. 151: 653-663; and Stern et al (2010) Trends. Genet. 28: 335-340. For example, Cse (Cas subtype, E. coli) proteins (e.g., CasA) form a functional complex, Cascade, that processes CRISPR RNA transcripts into repeating sword units that Cascade retains. Brouns et al (2008) Science 321: 960-964. In other prokaryotes, Cas6 processes the CRISPR transcript. CRISPR-based phage inactivation in E. coli requires Cascade and Cas3, but not Casi or Cas2. Cmr proteins (Cas RAMP module) in Pyrococcus furiosus and other prokaryotes form a functional complex with small CRISPR RNAs that recognize and cleave complementary target RNAs. A simpler CRISPR system is based on the Cas9 protein, which is a nuclease with two active cutting sites, one MA / a / ZUZZ / UUUI oz for each chain of the double helix. The combination of Cas9 and modified CRISPR loco RNA can be used in a system for gene editing. Pennisi (2013) Science 341: 833-836. (i) CPISPR / Cas9 In some embodiments, the present disclosure provides methods of gene editing using a Type II CRISPR system. Type II systems are based on a i) single endonuclease protein, i) a transactive crRNA (tracrRNA), and iii) a crRNA where a ~20 nucleotide (nt) portion of the 5' end of the crRNA is complementary to a target nucleic acid. The region of a CRISPR crRNA strand that is complementary to its target DNA protospacer is called the guide sequence here. In some embodiments, the tracrRNA and crRNA components of a Type II system can be replaced by a single guide RNA (sgRNA), also known as guide RNA (gRNA). The sgRNA may include, for example, a nucleotide sequence comprising a sequence of at least 12-20 nucleotides complementary to the target DNA sequence (guide sequence) and may include a common scaffold RNA sequence at its 3' end. As used herein, a common scaffold RNA refers to any RNA sequence that mimics the tracrRNA sequence or any RNA sequence that functions as a tracrRNA. Cas9 endonucleases produce blunt-ended DNA breaks, and are recruited to target DNA by a combination of crRNA and tracrRNA oligos, which bind the endonuclease through complementary hybridization of the CRISPR RNA complex. In some embodiments, recognition of DNA by the crRNA / endonuclease complex requires additional complementary base pairing with an adjacent protospacer motif (PAM) (e.g., 5'-NGG-3j located on a 3' portion of the target DNA, downstream of the target protospacer (Jinek, M. et al., Science. 2012, 337:816-821) In some embodiments, the PAM motif recognized by a Cas9 varies for different Cas9 proteins. In some embodiments, the Cas9 described herein may be any variant derived or isolated from any source. In other embodiments, the Cas9 peptide of the present disclosure may include one or more of the mutations described in the literature, including, but not limited to, the functional mutations described in: Fonfara et al., Nucleic Acids Res. February 2014 ;42(4):2577-90; Nishimasu H. et al., Cell. 27 Feb 2014, 156(5):935-49; Jinek M. et al. Science. 2012 337:81621; and Jinek M. et al., Science. March 14, 2014, 343 (6176); see also United States Patent Application no. 13 / 842,859, filed March 15, 2013, which is incorporated herein by reference; also, see United States Patent Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233; and 8,999,641, which are hereby incorporated by reference. Therefore, in some embodiments, the systems and methods described herein can be used with the wild-type Cas9 protein that has double-stranded nuclease activity, Cas9 mutants that act as single-stranded nicases, or other mutants with modified nuclease activity. In accordance with the present disclosure, Cas9 molecules from, derived from, or based on Cas9 proteins from a variety of species can be used in the methods and compositions described herein. For example, Cas9 molecules from, derived from or based on, for example, Cas9 molecules from S. pyogenes, S. thermophilus, Staphylococcus aureus and / or Neisseria meningitidis, can be used in the systems, methods and compositions described herein. . Additional Cas9 species include: Acidovorax gallinae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp, denitrificans cycliphilus, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp, Blastopirellula marina, Bradyrhiz obium sp, Brevibacillus latemspor us, Campylobacter coli, Campylobacter jejuni, Campylobacter lad, Candldatus Puniceispirillum, Clostridiu cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter sliibae, Eubacterium dolichum, gamma proteobacteria, Gluconacetobacler diazotrophicus, Haemophilus parainfluen zae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, llyobacler polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacteria, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinérea, Neisseria flavescens, Neisseria lactamica. Neisseria species ensis, Streptococcus sp., Subdoligranulum sp., Tislrella mobilis, Treponema sp. or Verminephrobacter eiseniae. In some embodiments, the present disclosure teaches the use of tools for genome editing techniques in plants such as crops and gene editing methods using CRISPR-associated (cas) endonucleases, including SpyCas9, SaCas9, St1Cas9. These powerful genome editing tools, which can be applied to editing a plant genome, are well known in the art. See example, Song et al (2016), CRISPR / Cas9: A powerful tool for crop genome editing, The Crop Journal 4: 75-82, Mali et al (2013) RNA-guided human genome engineering via cas9, Science 339: 823 -826; Ran et al (2015) In vivo genome editing using staphylococcus aureus cas9, Nature 520: 186-191; Esvelt et al (2013) Orthogonal cas9 proteins for rna-gulded gene regulation and editing, Nature methods 10(11): 1116-1121, each of which is incorporated herein by reference in its entirety for all purposes. (iii) CRISPR / Cpf1 In other embodiments, the present disclosure provides gene editing methods using a Type V CRISPR system. In some embodiments, the present disclosure provides gene editing methods using CRISPR from Prevotella, Francisella, Acidaminococcus, Lachnospiraceae , and Moraxella (Cpf1). The CRISPR Cpf 1 systems of the present disclosure comprise i) a single endonuclease protein, and ii) a crRNA, wherein a portion of the 3' end of the crRNA contains the guide sequence complementary to a target nucleic acid. In this system, the Cpf1 nuclease is directly recruited by the crRNA to the target DNA. In some embodiments, the guide sequences for Cpf 1 must be at least 12 nt, 13 nt, 14 nt, 15 nt or 16 nt to achieve detectable DNA cleavage, and a minimum of 14 nt, 15 nt, 16 nt, 17nt or 18nt for efficient DNA cleavage. The Cpf 1 systems of the present disclosure differ from Cas9 in a variety of ways. First, unlike Cas9, Cpf1 does not require a separate tracrRNA for cleavage. In some embodiments, Cpf 1 crRNAs can be as short as approximately 42-44 bases in length, of which 23-25 ​​nt is the guide sequence and 19 nt is the constitutive direct repeat sequence. In contrast, the combined synthetic Cas9 crRNA and tracrRNA sequences can be approximately 100 bases long. Second, certain Cpf 1 systems prefer a TTN PAM motif that is located 5' upstream of their target. This contrasts with the “NGG” PAM motifs located 3' of the target DNA for common Cas9 systems such as Streptococcus pyogenes Cas9. In some embodiments, the uracil base immediately preceding the guide sequence cannot be substituted (Zetsche, B. et al., 2015. “Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System” Cell 163, 759 -771, which is incorporated herein by reference in its entirety for all purposes). Third, the cleavage sites for Cpf1 are staggered by approximately 3-5 bases, creating sticky ends (Kim et al., 2016. “Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells” published online on 6 June 2016). These sticky ends with 3- to 5-nt overhangs are thought to facilitate NHEJ-mediated ligation, and enhance gene editing of DNA fragments with matching ends. The cutting sites are at the 3' end of the target DNA, distal to the 5' end where the PAM is. Cleavage positions typically follow base 18 on the unhybridized strand and the corresponding base 23 on the complementary strand hybridized to the crRNA. Fourth, in Cpf1 complexes, the seed region is located within the first 5 nt of the guide sequence. The crRNA seed regions of Cpf1 are very sensitive to mutations, and even single base substitutions in this region can dramatically reduce cleavage activity (see Zetsche B. et al. 2015 “Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System” Cell 163, 759-771). Critically, unlike the Cas9 CRISPR target, the cleavage sites and seed region of the Cpf1 systems do not overlap. Additional information on the design of oligos targeting Cpf1 crRNA is available in Zetsche B. et al. 2015. (“Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System” Cell 163, 759-771). (iv) guide RNA (gRNA) In some embodiments, the guide RNA of the present disclosure comprises two coding regions, encoding crRNA and tracrRNA, respectively. In other embodiments, the guide RNA is a synthetic crRNA / tracrRNA hybrid of the single guide RNA (gRNA). In other embodiments, the guide RNA is a crRNA for a Cpf1 endonuclease. Those skilled in the art will appreciate that, unless otherwise indicated, all references to a single guide RNA (sgRNA) in the present description can be read as references to a guide RNA (gRNA). Therefore, the embodiments described herein that refer to a single guide RNA (gRNA) will also be understood to refer to a guide RNA (gRNA). The guide RNA is designed to recruit the CRISPR endonuclease to a target DNA region. In some embodiments, the present disclosure teaches methods for identifying viable CRISPR landing target sites, and designing guide RNAs to target the sites. For example, in some embodiments, the present disclosure teaches algorithms designed to facilitate the identification of CRISPR landing sites within target DNA regions. In some embodiments, the present disclosure teaches the use of computer programs designed to identify candidate CRISPR target sequences on both strands of an input DNA sequence based on the desired guide sequence length and a CRISPR motif (PAM, adjacent motif) sequence. protospacer) for a specified CRISPR enzyme. For example, target sites for Cpf1 from Francisella novicida U112, with TTN PAM sequences, can be identified by searching for 5'TTN-3' in both the input sequence and the reverse complement of the entry. The target sites for Cpf1 from the bacteria Lachnospiraceae and Acidaminococcus sp., with TTTN PAM sequences, can be identified by searching for 5'-TTTN-3' in both the input sequence and the reverse complement of the entry. Likewise, target sites for Cas9 of S. thermophilus CRISPR, with PAM sequence NNAGAAW, can be identified by searching for 5'-Nx-NNAGAAW-3' in both the input sequence and the reverse complement of the entry. The PAM sequence for Cas9 from S. pyogenes is 5'-NGG-3'. Since multiple occurrences in the genome of the target DNA site can lead to nonspecific genome editing, after all potential sites are identified, sequences can be filtered based on the number of times they appear in the relevant reference genome or in the CRISPR modular construct. For those CRISPR enzymes for which sequence specificity is determined by a seed sequence (such as the first 5 bp of the guide sequence for Cpf1-mediated cleavage), the filtering step may also take into account sequence limitations. seed. In some embodiments, algorithmic tools can also identify potential off-target sites for a particular guide sequence. For example, in some embodiments, CasOffinder can be used to identify potential off-target sites of Cpf 1 (see Kim et al., 2016. “Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells” Nature Biotechnology 34, 863-868). . Any other publicly available CRISPR design / identification tool can also be used, including, for example, the crispr.mit.edu tool from the Zhang lab (see Hsu, et al., 2013 “DNA targeting specificity of RNAguided Cas9 nucleases” Nature Biotech 31, 827-832). In some embodiments, the user may be allowed to choose the length of the seed sequence. The user may also be allowed to specify the number of occurrences of the seed sequence: the PAM sequence in a genome for the purpose of passing the filter. The default is to search for unique sequences. The level of filtering is modified by changing both the length of the seed sequence and the number of occurrences of the sequence in the genome. The program may additionally or alternatively provide the sequence of a guide sequence complementary to the reported target sequence(s) by providing the reverse complement of the identified target sequence(s). In guide RNA, the “spacer / guide sequence” sequence is complementary to the “protospacer” sequence in the target DNA. The Cas9 protein recognizes the gRNA scaffold for a single-stranded gRNA structure. In some embodiments, the transgenic plant, plant part, plant cell or plant tissue culture taught herein comprises a recombinant construct, comprising at least one nucleic acid sequence encoding a guide RNA. In some embodiments, the nucleic acid is operably linked to a promoter. In other embodiments, a recombinant construct further comprises a nucleic acid sequence encoding a regularly interspaced short palindromic repeat (CRISPR) endonuclease. In other embodiments, the guide RNA is capable of forming a complex with said CRISPR endonuclease, and said complex is capable of binding and creating a double-strand break in a genomic target sequence of said plant genome. In other embodiments, the CRISPR endonuclease is Cas9. In other embodiments, the target sequence is a nucleic acid for FusFH, FusR1 homologs, FusR1 orthologs and / or FusR1 paralogs, and / or fragments and variations thereof. In some embodiments, the present disclosure teaches gene editing of FusR1 in FW-susceptible banana varieties susceptible to Fusarium pathogens using genetic engineering techniques described herein. The present disclosure teaches targeted gene editing techniques to modulate, stimulate and enhance disease resistance by converting FW-susceptible alleles to FW-resistant alleles based on the sequence information provided herein. The present description teaches sequence information for both FW-resistant alleles and FW-susceptible alleles. By using the CRISPR / Cas system, FW-resistant traits are introduced into FW-sensitive banana varieties. In some embodiments, FW-responsive FusR1 alleles should be targeted for inactivation. In some embodiments, sequences from conserved regions responsible for the FW sensitivity trait can be used to make gene editing machineries (such as CRISPR-associated effector proteins, ZFN, TALEN, etc.) to target one or more FusR1 orthologs. . In some embodiments, altering the expression of endogenous FW-responsive alleles is accomplished by gene editing technology. In some embodiments, inactivation of FW-responsive alleles is carried out by gene editing technology. In some embodiments, base editing of FW sensitive alleles into FW resistant alleles is carried out by gene editing technology. In some embodiments, the gene editing technology is a ZFN. In other embodiments, the gene editing technology is a TALEN. In other embodiments, the gene editing technology is a CRISPR / Cas system. In other embodiments, said CRISPR system comprises a nucleic acid molecule and an enzyme protein, wherein the nucleic acid molecule is a MA / a / ZUZZ / UUUI oz guide RNA (gRNA) molecule and enzyme protein is a Cas protein or a Cas ortholog. In other embodiments, at least two expression cassettes are stacked in tandem in the expression vector. In some embodiments, the modified plant cells comprise one or more modifications (e.g., insertions, deletions or mutations of one or more nucleic acids) in the genomic DNA sequence of an endogenous target gene resulting in altered function of the gene. endogenous, which in this way modulates, stimulates, or enhances resistance to diseases. In such embodiments, the modified plant cells comprise a modified endogenous target gene. In some embodiments, modifications to the genomic DNA sequence cause mutation, thereby altering the function of the FW-sensitive FUSR1 protein to the FW-resistant FUSR1 protein. In some embodiments, modifications to the genomic DNA sequence result in amino acid substitutions, thereby altering the normal function of the encoded protein. In some embodiments, modifications in the genomic DNA sequence encode a modified endogenous protein with modulated, altered, stimulated or enhanced disease / pathogen resistance function compared to the unmodified (i.e., FW sensitive) version of the protein. endogenous in banana accessions sensitive to FW. In some embodiments, the modified plant cells described herein comprise one or more modified endogenous target genes, wherein the one or more modifications result in altered function of a gene product (i.e., a protein) encoded by the gene. endogenous target compared to an unmodified plant cell. For example, in some embodiments, a modified plant cell demonstrates expression of a FW-resistant FUSR1 protein or upregulated expression of such protein. In some embodiments, expression of the gene product (such as FW-resistant FusRI engineered from FW-sensitive FusRI) in a modified plant cell is enhanced by at least 0.5%, 1%, 2%, 3%, 4%. %, 5% or more compared to the expression of the gene product (such as FW-responsive FusRI) in an unmodified plant cell. In other embodiments, expression of the gene product (such as genetically modified FW-resistant FusRI) in a modified plant cell is enhanced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%. , 80%, 90% or more compared to the expression of the gene product (such as FW-responsive FusRI) in an unmodified plant cell. In some embodiments, the modified plant cells described herein demonstrate enhanced expression and / or function of gene products encoded by a plurality (e.g., two or more) of endogenous target genes compared to expression of the gene products in an unmodified plant cell. For example, in some embodiments, a modified plant cell demonstrates enhanced expression and / or function of gene products from 2, 3, 4, 5, 6, 7, 8, 9, 10 or more endogenous target genes compared to the expression of gene products in an unmodified plant cell. In some embodiments, the modified plant cells described herein comprise one or more modified endogenous target genes, wherein one or more modifications to the target DNA sequence result in the expression of a protein with reduced or altered function (e.g. , a modified endogenous protein) compared to the function of the corresponding protein expressed in an unmodified plant cell (e.g., an unmodified endogenous protein). In some embodiments, the modified plant cells described herein comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified endogenous target genes encoding 2, 3, 4, 5, 6, 7 , 8, 9, 10 or more modified endogenous proteins. In some embodiments, the modified endogenous protein demonstrates enhanced or altered binding affinity for another protein expressed by the modified plant cell or expressed by another cell; enhanced or altered signaling capacity; enhanced or altered enzyme activity; enhanced or altered DNA binding activity; or reduced or altered ability to function as a scaffolding protein. EXAMPLES The present invention is further illustrated by the following examples which should not be construed as limiting. The content of all references, patents, and published patent applications cited throughout this application, as well as the Figures, are incorporated herein by reference in their entirety for all purposes. Example 1: Methods and materials for sequencing (1) Material Fresh and freeze-dried banana leaf tissues were obtained from Bioversity International (Leuven, Belgium), Inter-TROP CRB Plantes Tropicales (Guadeloupe), and the UTA Genebank (Ibadan, Nigeria), Plant Delights Nursery (Raleigh, NC), and The Flower Bin (Longmont, CO). (2) RNA Total RNA was extracted from fresh, frozen, and freeze-dried banana leaves using a modified Ishihara protocol (Ishihara et al., 2016). About 100 mg of fresh or frozen banana tissue was ground to a powder by using a clean mortar and pestle, cooled with dry ice, which was treated with RNase AwayTM (Invitrogen, Carlsbad, CA). About 20 to 30 mg of freeze-dried banana tissue was homogenized in a Lysing Matrix D tube (MP Bio, Santa Ana, CA) without liquid. One milliliter of polyphenol lysis buffer (800 μΙ RLT buffer (Qiagen, Germantown, MD), 200 μΙ Fruit-mate (Takara, Mountain View, CA), and 10 μΙ βmercaptoethanol) was added to each sample. Fresh and frozen samples were homogenized for 40 seconds on speed setting 6 of a FastPrep 120 (ThermoFisher Scientific, Waltham, MA), while freeze-dried samples were vertex-vortexed at high speed for 1 minute. All samples were incubated on ice for 4 minutes and then centrifuged for 2 minutes at 8000 x g. The supernatant was transferred to a new 2.0 ml tube and another 1.0 ml of polyphenol lysis buffer was added to the supernatant. Samples were vertex-vortexed at high temperature for 1 min, incubated on ice for 4 min, and centrifuged for 2 min at 8000 × g. The supernatant was split between two QIAshredder columns (Qiagen, Germantown, MD) and centrifuged at maximum speed for 2 minutes until all of the supernatant was processed. The remaining steps of RNA extraction were carried out according to the Ishihara protocol. The optional RNA cleanup and in-solution DNase digestion protocol was also performed as detailed in the RNeasy Mini protocol (Qiagen, Germantown, MD). MA / a / 2U22 / UUU1 02 Sample concentration and purity were determined by using the NanoDropTM One spectrophotometer (ThermoFisher Scientific, Waltham, MA). (3) DNA Total DNA was extracted from fresh, frozen, and freeze-dried banana leaves using a modified protocol of the PowerPlant Pro DNA Isolation Kit (MO BIO, Carlsbad, CA). About 40 mg of fresh or frozen banana tissue was ground to a powder by using a clean mortar and pestle cooled with dry ice that was treated with RNase AwayTM (Invitrogen, Carlsbad, CA). About 10 to 20 mg of IiofiIized banana tissue was homogenized in a Lysing Matrix D tube (MP Bio, Santa Ana, CA) without liquid. The remaining steps of DNA extraction were carried out according to the MO BIO protocol. Phenolic stripping solution was added to the lysis buffer and 250 μΙ of PD3 buffer was used. Sample concentration and purity were determined by using the NanoDropTM One spectrophotometer (ThermoFisher Scientific, Waltham, MA). (4) cDNA cDNA was synthesized from 1.0 pg of total RNA by using the 1st Strand cDNA Synthesis Kit (Epicenter, Madison, WI). The adapter primer (AP) from the Invitrogen 3'-RACE kit (Invitrogen, Carlsbad, CA) was used instead of the poly dT primer. (5) Primers Primer sequences were designed against homologous regions of putative target genes with annealing temperatures of 57°-64°C by using the OligoAnalyzer Tool program (IDT, Coralville, IA). Primers were purchased from IDT. (6) PCR PCR reactions were performed in 25 μΙ reactions containing a final concentration of 1X Phusion® HF buffer, 300 μΜ of each dNTP, 0.3 μΜ of each forward and reverse primer, 0.5 units of 1X Phusion® high fidelity DNA polymerase ( ThermoFisher Scientific, Waltham, MA) in a Veriti thermocycler (Applied Biosystems, Carlsbad, CA). General PCR conditions were 98°C for 2 minutes, followed by 35 cycles of 98°C for 10 seconds, 55°-62°C for 30 seconds (depending on primer Ta), and 72°C for 30 seconds. before a final extension at 72°C for 10 minutes and hold at 4°C. PCR products were run on a 1.5% agarose gel and visualized using GeIRed® Nucleic Acid Stain (Biotium, Hayward, CA) on an Alpha Imager EC (Alpha Innotech, San Leandro, CA). (7) Cloning PCR fragments were cloned by using the Zero Blunt TOPO PCR Cloning Kit (Invitrogen, Carlsbad, CA) using 4 μΙ of PCR product, according to the manufacturer's protocol. The ligated vector was transformed into Top10 One Shot chemically competent cells (Invitrogen, Carlsbad, CA) by using the chemical transformation protocol. Transformed E. coli cells were plated on LB agar plates containing 50 pg / ml kanamycin and the plates were grown overnight at 37°C. (8) Colony PCR MA / a / 4U44 / UUU1 04 Colonies containing recombinant plasmids were detected by using PCR with M13 forward and reverse primers. PCR reactions were performed in 15 μΙ volumes containing 60 mM Tris-SO4 (pH 8.9), 18 mM ammonium sulfate, 2.0 mM magnesium sulfate, 0.2 mM of each dNTP, 0.2 μΜ of each forward and reverse primer, 0.3 units of Taq H¡ Fidelity platinum (Invitrogen, Carlsbad, CA) in a Veriti thermocycler (Applied Biosystems, Carlsbad, CA). Colonies were picked and inoculated into the PCR reaction, followed by an inoculation of 50 μΙ of LB-kanamycin. Colony PCR conditions were 94°C for 2 minutes, followed by 35 cycles of 94°C for 30 seconds, 50°C for 30 seconds, and 68°C for 1 minute, before a final extension at 68°C. for 10 minutes and maintenance at 4 °C. PCR products were run on a 1.5% agarose gel and visualized by using GeIRed® nucleic acid staining (Biotium, Hayward, CA) on an Alpha Imager EC (Alpha Innotech, San Leandro, CA). PCR reactions from colonies that produced products of the expected size were sequenced. (9) Sequencing Five microliters of each PCR product was prepared for sequencing by enzymatic treatment using 2 μΙ of high-throughput ExoSAP-IT (Affymetrix, Santa Clara, CA). Reactions were incubated at 37°C for 15 minutes, followed by 15 minutes at 80°C. The template was labeled for sequencing by using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Carlsbad, CA) as follows: 2 μΙ of the template and 2 μΙ of a 0.8 sequencing primer were added μΜ to a mixture of BigDye Terminator sequencing buffer, BigDye Terminator v3.1 prepared reaction mix, and water, in a 10 μΙ reaction. The BigDye sequencing reaction conditions were as follows: 96°C for 1 minute, followed by 25 cycles of 96°C for 10 seconds, 50°C for 5 seconds, and 60°C for 75 seconds. Unincorporated BigDye terminators were removed by using the BigDye XTerminator purification kit (Applied Biosystems, Carlsbad, CA). Reactions were sequenced by using the Applied Biosystems 3500 Genetic Analyzer (Applied Biosystems, Carlsbad, CA). (10) Sequence alignment Sequence files from the ABI 3500 Genetic Analyzer were imported into Sequencher v4.8 Build 3767 (Gene Codes, Ann Arbor, MI). The vector sequence was trimmed by using the Clip Vector tool. The sequences were then automatically aligned and manually edited to sequence artifacts. Example 2: Identification of structural differences between genes resistant to Fusarium wilt (FW) and genes sensitive to Fusarium wilt (FW) In this example, Fusarium wilt resistance genes were discovered by analysis, as described below, of DNA sequences retrieved from GenBank. Nucleotide sequences of several banana species (i.e., Musa itinerans, Musa acuminata, Musa basjoo, Musella lasiocarpa, Musa balbisiana) were downloaded. The M. itinerans FusR1 sequence was obtained from multiple accessions (ITC1526, ITC1571, and PT-BA-00223), all of which are resistant to FW. The M. acuminata FusRI sequence labeled 'FW-resistant' was obtained from multiple FW-resistant accessions, including ITC0896 (M. a. subspecies banksii) and PTBA-00281 (Pisang Bangkahulu). The M. acuminata sequence labeled 'sensitive' is from the FW-susceptible accessions (ITC0507, ITC0685, PT-BA-00304, PT-BA-00310 and PT-BA-00315). These accessions include multiple samples of banana cultivars such as Pisang Madu, Pisang Pipit and Pisang Rojo Uter, all of which have been well characterized as sensitive to FW (Chen et al., 2019). The M. balbisiana sequence was obtained from several FW-susceptible accessions, including ITC1016, ITC0545, ITC0080, and ITC0565. FusR1 of M. basjoo is from FW-resistant accessions (ITC0061 and PD #3064). Automated bioinformatic analysis was then applied to each pairwise comparison and only those sequences containing a nucleotide change (or changes) that produce evolutionarily significant changes were retained for further analysis. This allowed the identification of genes that have evolved to confer some evolutionary advantage, as well as the identification of specific evolved changes. Any of several different molecular evolutionary analyzes or Ka / Ks-type methods can be employed to quantitatively and qualitatively assess the evolutionary significance of nucleotide changes identified between homologous gene sequences from related species (Kreitman and Akashi, 1995; Li, 1997). . For example, positive selection in proteins (i.e., adaptive evolution at the molecular level) can be detected in protein-coding genes through pairwise comparisons of the ratios of nonsynonymous nucleotide substitutions per nonsynonymous site (Ka) / synonymous substitutions per site. synonym (Ks) (Li et al., 1985; Li, 1993). Any comparison of Ka and Ks can be used, although it is particularly convenient and more effective to compare these two variables as a relationship. Sequences are identified by showing a statistically significant difference between Ka and Ks using standard statistical methods. In some aspects, the Ka / Ks analysis of Li et al. (1993) is used to carry out the present description, although other analysis programs that can detect genes positively selected between species can also be used (Li et al., 1985; Li, 1993; Messiery Stewart, 1997; Nei, 1987). The Ka / Ks method, which involves a comparison of the rate of nonsynonymous substitutions per nonsynonymous site with the rate of synonymous substitutions per synonymous site between regions of homologous protein-coding genes in terms of a ratio, is used to identify substitutions of sequence that may be driven by adaptive selection as opposed to neutral substitutions during evolution. A synonymous (silent) substitution is one that, due to the degeneration of the genetic code, does not modify the encoded amino acid sequence; a nonsynonymous substitution results in an amino acid replacement. The extent of each type of change can be estimated as Ka and Ks, respectively, the number of synonymous substitutions per synonymous site and nonsynonymous substitutions per nonsynonymous site. Ka / K calculations can be performed manually or by using computer software. An example of suitable programs are L¡93 (Li, 1993) or MEGA For the purpose of estimating Ka and Ks, complete or partial protein coding sequences are used to calculate the total number of synonymous and nonsynonymous substitutions, as well as synonymous and nonsynonymous sites. The length of the polynucleotide sequence analyzed can be any length MA / a / ZUZZ / UUUI appropriate oz. Preferably, the entire coding sequence is compared in order to determine any and all significant changes. Publicly available computer programs such as LI93 (Li, 1993), or MEGA peers. This analysis can be further adapted to examine sequences in a sliding window fashion so that a small number of important changes are not masked by the entire sequence. Sliding window refers to the examination of consecutive overlapping subsections of the gene (subsections can be any length). The comparison of synonymous and nonsynonymous substitution rates is commonly represented by the Ka / Ks ratio. Ka / Ks has been shown to be a reflection of the degree to which adaptive evolution has worked in the sequence under study. Full-length or partial segments of a coding sequence can be used for Ka / Ks analysis. The higher the Ka / Ks ratio, the more likely it is that a sequence has undergone adaptive evolution and the nonsynonymous substitutions are evolutionarily significant. See, for example, Messier and Stewart (1997). Ka / Ks ratios significantly greater than one (1.0) strongly suggest that positive selection has fixed a greater number of amino acid replacements than would be expected as a result of chance alone and contrast with the more commonly observed pattern where the ratio is less than or equal to one (Nei, 1987; Hughes and Nei, 1988; Messier and Stewart, 1994; Kreitman and Akashi, 1995; Messier and Stewart, 1997). Ratios less than one generally signify the role of negative or purifying selection, indicating that there is strong pressure on the primary structure of functional and effective proteins to remain unchanged. All methods for calculating Ka / Ks ratios are based on a pairwise comparison of the number of nonsynonymous substitutions per nonsynonymous site with the number of synonymous substitutions per synonymous site for the protein-coding regions of homologous genes from related species. Each method implements different corrections to estimate multiple hits (i.e., more than one nucleotide substitution at the same site). Each method also uses different models of how DNA sequences change over evolutionary time. Therefore, preferably, a combination of results from different algorithms is used to increase the level of sensitivity for the detection of positively selected genes and the confidence in the result. It is understood that the methods described herein could lead to the identification of banana polynucleotide sequences that are functionally related to banana protein coding sequences. Such sequences may include, but are not limited to, non-coding sequences or coding sequences that do not encode proteins. These related sequences may be, for example, physically adjacent to banana protein coding sequences in the banana genome, such as introns or 5' and 3' flanking sequences (which includes control elements such as promoters and enhancers). . These related sequences can be obtained by searching a public genome database such as GenBank or, alternatively, by screening and sequencing an appropriate genomic library with a protein coding sequence as a probe. After the candidate genes were identified, the nucleotide sequences of the genes in each orthologous gene pair were carefully verified by standard DNA sequencing techniques, and then the Ka / Ks analysis was repeated for each carefully sequenced candidate gene pair. More specifically, the computer program performed all possible pairwise comparisons between the putative orthologs of each gene from the cultivated banana, Musa acuminata (AAA subgr. Cavendish) compared to orthologs from the wild species, searching for high Ka / ratios. Ks. The software BLASTed (in an automated manner) each cultured banana mRNA sequence against each sequence in the transcriptome that was sequenced from a wild relative, for example, M. balbisiana. The software then performed a Ka / Ks analysis for each gene pair (i.e., each ortholog set), by marking gene pairs with high Ka / Ks scores. The computer program then compared each cultivated banana sequence with each sequence from another wild relative, for example, M. basjoo, again by doing a series of BLASTs and then screening for high Ka / Ks scores. Therefore, it does this for the transcriptome sequence of all wild species in succession. This provides a set of candidates (see below) for further analysis. The software then compared each gene sequence in the M. balbisiana transcriptome with each M. basjoo sequence, again by doing a series of BLASTs and then screening for high Ka / Ks scores. Therefore, we finally compared all the expressed genes represented in the cDNA libraries used from each banana species with all the genes from all other banana species, both wild and cultivated, with the aim of finding all the genes that show evidence of positive selection. The tagged gene pairs that emerged were then individually and carefully resequenced in the laboratory to check the accuracy of the original high-throughput reads to eliminate false positives. Each remaining candidate gene pair with a high Ka / Ks score was then examined to determine whether the comparison was truly orthologous or simply an artificial false positive caused by a paralogous comparison. Using the methodology described above, banana gene sequences available in GenBank were analyzed to identify a positively selected gene that has not been linked to the FW resistance trait in banana species in the art. The inventor identified and selected this gene that was expected to produce resistance to FW and then named it Fusarium Resistance 1 (FusR1). Surprisingly, the inventor found an unusually high Ka / Ks ratio of 3.6 between the FusR1 ortholog from the highly resistant wild relative M. itinerans and the FusR1 from the FW-susceptible Cavendish (M. acuminata). The inventor obtained accessions of several types of bananas, including banana cultivars and landraces, as well as wild (non-domesticated) banana species of the genera Musa, Musella MA / a / ¿U¿¿ / UUU1 Ό2 and Ensete. These three genera comprise the banana family Musaceae. The inventor made substantial efforts to obtain multiple samples of accessions of Musa acuminata (genome A”) and M. balbisiana (genome “B”), to adequately sample the taxonomic and geographic diversity of bananas. The inventor obtained accessions of most of the acuminata subspecies. Additionally, for outgroup analysis, the inventor obtained plant accessions from plant families known to be closely related to Musaceae. It is well known that some group B banana species / varieties are highly susceptible to Foc -TR4 (Chen et al., 2019), although they sometimes display desirable agronomic traits such as drought tolerance. Genome A bananas show a range of resistance, tolerance and sensitivity to Fusarium, depending on the particular species or cultivated variety. As a consequence, many wild banana species and cultivated banana varieties have been carefully and rigorously characterized for their resistance, tolerance, or sensitivity to TR4 (Li et al., 2012, Ssali et al., 2013, Li et al., 2015, Wu et al., 2015). others, 2016, Ribeiro et al., 2018, Niu et al., 2018 and Zuo et al., 2018). Wherever possible, the inventor chose to prepare both RNA (for conversion to cDNA) and genomic DNA (gDNA). Most accessions were obtained as fresh, frozen, or freeze-dried samples, and this usually allowed successful RNA extraction. For some samples, particularly when they are older or partially degraded, only gDNA could be isolated. The mRNA sequences and / or coding sequence only), the intron sequence and some sequences (see Sequence Listing) for various species of Musa, Musella, Ensete, and other groups are provided here as described in Table 1 and in sequence listings. Detailed descriptions of the methods are given in the Methods and Materials section of Example 1. Cultivated bananas are the product of hybridization events between B-genome bananas (the Musa balbisiana group) and A-genome bananas (the M. acuminata group). It is well known that some group B banana species / varieties are susceptible to Foc-TR4 (Chen et al., 2019), although they sometimes possess desirable agronomic traits such as drought tolerance (REF). In contrast, genome A bananas show a range of resistance, tolerance and sensitivity to Fusarium, depending on the particular species or cultivated variety. Some A-genome group species, such as Musa itinerans and M. basjoo, have been shown to be extremely resistant to FocTR4 (Li et al., 2015; Wu et al., 2016), while some A-genome cultivars such as Cavendish are exquisitely resistant to FocTR4. sensitive to Fusarium. The analysis of these sequences revealed an important result; which is that all “A” genome banana species (or cultivated banana varieties) that have been characterized as resistant to Fusarium share FusR1 sequences that belong to a common group, while banana species / varieties sensitive to Fusarium belong to a different group. Surprisingly, every B genome accession that the inventor examined is sensitive to FW, and all FusR1 sequences from the B genome accessions are disrupted and / or damaged in some way with some combination of base pair deletions of coding sequences. Often the deletion is of a long size, such as 82 or 85 bp, however, the inventor also found a consistent single base deletion. These deletions alter the inferred protein sequence by destroying the reading frame, typically resulting in a truncated protein. Furthermore, all FusR1 coding sequences in the B genome contain an 84-bp unspliced ​​intron, which often appears together with the 85-bp deletion. Regarding A-genome bananas, the inventor found that all A-genome accessions known to be resistant to Foc-TR4 share a common FusR1 sequence cluster, while A-genome accessions sensitive to Foc-TR4 share a different FusR1 sequence group. This is strong evidence that FusR1 is responsible for the disease resistance patterns observed between Fusarium-resistant versus Fusarium-susceptible species. The analyzes in this example suggest that the difference in resistance to susceptibility to Fusarium race 4 is strongly related to FusR1 sequence differences. Additional support for this comes from our examination of the few banana species that have been characterized as 'Fusarium wilt tolerant'. All of these species have FusR1 sequences that fall into a third group of sequences, all of which are intermediates between the Fusarium-resistant and Fusarium-susceptible sequence groups. The banana industry was forced in the 1950s to switch from its main cultivar, Gros Michel, to the Cavendish cultivar when Fusarium race 1 (Panama Disease) posed a critical threat to Gros Michel. Cavendish, which is a half-sibling to Gros Michel (both are A genome species), was found to be resistant to race 1. Therefore, the closely related Cavendish and Gros Michel cultivars show different resistance profiles to the various Fusarium races. . (Both are sensitive to Foc-TR4, the current threat to the banana industry). The inventor sequenced FusR1 from several accessions of Musa acuminata. In each case, the inventor cloned, as described in Example 1, the FusR1 gene and then sequenced multiple clones of the FusR1 gene. Some of these M. acuminata accessions have been well characterized for their resistance / sensitivity to Fusarium wilt. The inventor found three alleles for FusR1 from M. acuminata. The critical observation is that all Fusarium wilt-resistant accessions share similar FusR1 sequences. The two alleles of FusR1 from FW-resistant M. acuminata accessions are the FusR1 allele resistant to Fusarium wilt or simply, the resistant alleles (SEQ ID NO: 8 and SEQ ID NO: 10). In contrast, all FW-sensitive M. acuminata accessions share a different allele, called the Fusarium wilt-sensitive FusR1 allele (SEQ ID NO: 13). The FW-resistant FusR1 alleles differ in only a few critical nucleotide substitutions from the FW-susceptible allele. (See Figure 1). This strongly suggests that resistance / sensitivity to Fusarium wilt is controlled by the particular FusR1 allele carried by a banana plant. Example 3: Improvement of banana resistance Tetraploid versions of FW-susceptible Cavendish cultivars (M. acuminata; AAAA) are available or can be developed through large pollination / breeding programs focused on creating, identifying and isolating the relatively low percentage of tetraploid progeny that are produced (e.g. , Aguilar Morán, J.F., 2013, Improvement of Cavendish Banana cultivars through conventional breeding, Acta MA / a / ZUZZ / UUUI oz Hortic. 986: 205-208; Jenny et al., In Jacome et al., Editors, Mycosphaerella leaf spot diseases of banana: present status and outlook, Proceedings of the 2ndInternational Workshop on Mycosphaerella leaf spot diseases held in San José, Costa Rica, May 20-23, 2002, Session 4, pages 199-208) or by subjecting diploid AA genotypes to in vitro polyploidization (Amah et al., November 2019, Frontiers in Plant Science, Vol. 10, Article 1450, 12 pages). The FW-resistant diploid versions of FusR1 (AA) from M. acuminata ssp. Banksia can be identified or developed using methods known to those skilled in the art (e.g., Bakry et al., Chapter 1, Genetic Improvement in Banana, 50 pages, In Breeding Plantation Tree Crops: Tropical Species, 2009). The resulting diploids are screened for the presence of SEQ ID NO: 8 and / or SEQ ID NO: 10 (mRNA sequences). A Cavendish tetraploid plant sensitive to FW, such as a tetraploid of the variety 'Naine' or 'Williams', can be used as the male parent in crosses with a diploid plant of M. acuminata ssp. FW-resistant banksia,1 such as a diploid 'ITC0896', used as the female parent. A large number of the resulting progeny are screened for triploid (AAA) plants comprising SEQ ID NO: 8 and / or SEQ ID NO: 10 (mRNA sequences) and subsequently evaluated for agronomic traits. All resulting banana plants with TR4 resistance can be maintained through asexual reproduction and used for production or in subsequent breeding programs. Example 4: Materials and methods for plant transformation Banana transformation systems will use sterile material from selected banana strains. A variety of tissue culture and transformation methodologies will be used to increase the likelihood of success. See, for example, the transformation protocols described in Ploetz (2015, Phytopathology 105:1512-1521), US Patent No. 7,534,930; United States Patent No. 6,133,035; Sagi et al., Bio / Technology 13,481-485,1995; May et al., Bio / Technology 13, 485-492,1995; Vishnevetsky et al., Transgenic Res. 20(1):61-71,2011; Paul et al. (2011); Zhong et al., Plant Physiol. 110, 1097-1107, 1996; Dugdale et al., Journal of General Virology 79: 2301-2311, 1998; Mohán and Swennen (eds.), 2004, Banana improvement: cellular, molecular biology, and induced mutations, Science Publishers, Inc.; and, Remy et al., 2013, Genetically modified bananas: Past, present and future, Acta Hortícolae 974:71-80, each of which is incorporated herein by reference in its entirety. These methodologies will focus on tissue culture conditions, identifying different types of tissues for regeneration / shooting, media formulations, agrobacteria strains, selection cassettes, construction of control and delivery vectors, gene delivery, selectable markers and target tissue / cell substrates for DNA delivery and transformation. Initial experiments will deploy control vectors using visual markers and selection cassettes to rapidly optimize experimental direction and detect potential transgenic events. Parallel experiments will be aimed at optimizing transformation efficiency and using genes of interest (GOI). Modifications will be made to media formulations, vectors and transformation processes to improve process and transformation efficiency. Transformation vectors containing key genes of interest will continue to transform to produce additional overexpression or knockdown events. Vectors to be used as needed include, but are not limited to, multi-gene stacked vectors, polycistronic gene vectors, and multi-gRNA CRISPR editing vectors to test efficacy in banana. Testing will be performed at T0 events to show the presence and copy number of the selectable or GOL marker gene. Additionally, mRNA expression analysis will be used as needed for any key GOIs. The supposedly transformed plant material will be used for further testing or analysis. CRISPR technologies are described in detail elsewhere in the present description, including references to compositions and methods for using CRISPR to edit plant genomes, such as the banana genome. Detailed compositions and procedures for using CRISPR to delete a gene in plants that gives rise to a phenotype of interest (e.g., resistance to fungal pathogens such as Fusarium) are provided in WO 2019 / 118342 (PCT / US2018 / 064735), WO 2018 / 220581 (PCT / IB2018 / 053903) and US 2019 / 0032070 (US 16 / 072,706), each of which is specifically and completely incorporated by reference herein. Once the target sites for inactivating a candidate gene (e.g., endogenous FW-responsive FusR1 gene(s)) are screened in silico and selected, CRISPR / Cas9 vectors will be constructed for the target mutations in the candidate gene found in the plants of interest for the transformation of the vectors into the plant of interest (i.e., FW-susceptible banana varieties, such as the widely cultivated, triploid, sterile Cavendish variety and its progeny). The CRISPR / Cas9 vectors will be transformed into plants of interest such as banana varieties, especially FW-susceptible bananas using agrobacteria-mediated protocols known in the art (see, for example, Ma et al., 2015) and / or or developed or refined by the inventor. Consequently, tissue culture and regeneration of transformed plants will be carried out. Plants transformed with the CRISPR / Cas9 vectors will be regenerated and tested to verify the introduction of the CRISPR / Cas9 vectors into the plant cells of interest. As a control for indel induction, a construct expressing wild-type Cas9 will also be used in this experiment. Inactivation of the candidate gene(s) will be examined in all transformed plants. Inactivation will be studied by (1) quantitative PCR to verify the deletion and / or silencing of the candidate gene or (2) PCR amplification and subsequent Sanger sequencing and / or high-throughput deep sequencing. Additionally, the amino acid substitution(s) caused by the frameshift introduced to the target genome region will be analyzed by protein sequencing with mass spectrometry. The transformed plants obtained will be grown in the controlled greenhouse and / or in field conditions. It will be observed in transformed plants, verified with the insertion, deletion or substitution of MA / a / 4U44 / UUU1 04 amino acids of interest, improved resistance to FW, Panama disease or Fusarium oxysporum f infection. sp. cover tropical breed 4. Example 5: Banana transformation Banana plants susceptible to Fusarium oxysporum race 4 (also known as tropical race 4 or TR4) can be transformed into TR4-resistant plants by transforming them with a nucleotide sequence encoding resistance using the banana transformation technologies provided in Example 4 and the FusR1 nucleotide sequences encoding TR4 resistance as provided herein. For example, a TR4-susceptible Cavendish banana cultivar can be transformed with one of the FusR1 alleles encoding TR4 resistance as provided herein. As a further example, a TR4-susceptible Cavendish banana cultivar can be transformed with one or more of the following nucleotide coding sequences encoding TR4 resistance: SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9 SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 21 and / or SEQ ID NO: 24. For example, the Cavendish banana cultivar 'Grand Nain' (AAA) can be transformed with SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9 and / or SEQ ID NO: 11 by using the protocols transformation set forth in United States Patent No. 7,534,930 ('Transgenic Disease Resistant Banana'), which is incorporated herein in its entirety for all that it describes. In summary, the immature male flowers of a Cavendish banana cultivar, such as 'Grand Nain' or 'Williams', are used to produce embryogenic callus. A nucleic acid construct is constructed comprising SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 21 and / or SEQ ID NO: 24, operably linked to a 35S promoter sequence. Or, alternatively, the promoter sequence of the FW resistance allele 1 of FusR1 from M. acuminata (SEQ ID NO: 31) could be used to drive expression of the resistance alleles. This construct is introduced into embryogenic calli through the use of microprojectile bombardment. The bombarded seedlings are regenerated from the embryogenic callus and the seedlings are subjected to PCR analysis to determine which seedlings were transformed with the TR4 resistance gene(s). Tissue culture extracts from the resulting plants that positively express the TR4 resistance gene(s) are tested for their ability to suppress TR4 growth. Additionally, the putative transformed plants are tested for resistance to TR4. TR4-resistant plants are isolated and cloned. TR4 resistant plants can be used in breeding programs to transfer the resistant genes as set out in Example 3. When a transformed plant expresses SEQ ID NO: 2 or SEQ ID NO: 5; and also expresses SEQ ID NO: 9 or SEQ ID NO: 11, that transformed plant would have stacked TR4 resistance genes since it comprises two different nucleic acids that encode TR4 resistance. As discussed above and presented in Table 1, SEQ ID NO: 2 and SEQ ID NO: 5 are sequences coding for allele 1 and allele 2 of FusR1, respectively, which encode the resistance obtained from M. itinerans. On the contrary, SEQ ID NO: 9 and SEQ ID NO: 11 are sequences coding for allele 1 and allele 2 of FusR1, respectively, which encode the resistance obtained from M. acuminata ssp. banksia. Therefore, MA / a...

Claims

1. An isolated nucleic acid molecule comprising the nucleic acid sequence SEQ ID NO: 14 encoding susceptibility to Fusarium oxysporum race 4 when expressed in a plant, wherein SEQ ID NO: 14 is modified by one, two, three, or four nucleic acid substitutions such that the resulting nucleic acid sequence encodes resistance to Fusarium oxysporum race 4 when expressed in a plant.

2. The isolated nucleic acid molecule according to claim 1, wherein the nucleic acid substitutions comprise replacing a T corresponding to position 148 of SEQ ID NO: 14 with a G (148T>G).

3. The isolated nucleic acid molecule according to claim 1, wherein the nucleic acid substitutions comprise replacing a T corresponding to position 323 of SEQ ID NO: 14 with an A (323T>A).

4. The isolated nucleic acid molecule according to claim 1, wherein the nucleic acid substitutions comprise replacing a G corresponding to position 344 of SEQ ID NO: 14 with a C (344G>C).

5. The isolated nucleic acid molecule according to claim 1, wherein the nucleic acid substitutions comprise replacing an A corresponding to position 347 of SEQ ID NO: 14 with a T (347A>T).

6. The isolated nucleic acid molecule according to claim 1, wherein the nucleic acid substitutions comprise replacing a T corresponding to position 323 with an A (323T>A), replacing a G corresponding to position 344 with a C (344G>C), and replacing an A corresponding to position 347 with a T (347A>T), and wherein all positions are based on SEQ ID NO:

14.

7. The isolated nucleic acid molecule according to claim 1, wherein SEQ ID NO: 14 encodes an amino acid sequence of SEQ ID NO: 15 and wherein the nucleic acid substitutions result in the replacement of a leucine corresponding to position 50 of SEQ ID NO: 15 by a valine (50L>V).

8. The isolated nucleic acid molecule according to claim 1, wherein SEQ ID NO: 14 encodes an amino acid sequence of SEQ ID NO: 15 and wherein the nucleic acid substitutions result in the replacement of a valine corresponding to position 108 of SEQ ID NO: 15 by a glutamic acid (108V>E).

9. The isolated nucleic acid molecule according to claim 1, wherein SEQ ID NO: 14 encodes an amino acid sequence of SEQ ID NO: 15 and wherein the nucleic acid substitutions result in the replacement of an arginine corresponding to position 115 of SEQ ID NO: 15 by a proline (115R>P).

10. The nucleic acid molecule isolated according to claim 1, wherein SEQ ID NO: 14 encodes an amino acid sequence of SEQ ID NO: 15 and wherein the nucleic acid substitutions result in the replacement of an aspartic acid corresponding to position 116 of SEQ ID NO: 15 by a valine (116D>V).

11. The isolated nucleic acid molecule according to claim 1, wherein SEQ ID NO: 14 encodes an amino acid sequence of SEQ ID NO: 15 and wherein the nucleic acid substitutions result in the replacement of a valine corresponding to position 108 of SEQ ID NO: 15 by a glutamic acid (108V>E), an arginine corresponding to position 115 of SEQ ID NO: 15 by a proline (115R>P) and an aspartic acid corresponding to position 116 of SEQ ID NO: 15 by a valine (116D>V).

12. The isolated nucleic acid molecule according to claims 1-11, wherein expression occurs in a plant cell, plant tissue, plant cell culture, plant tissue culture or whole plant.

13. The nucleic acid molecule isolated according to claim 12, wherein expression occurs in a cell, tissue, cell culture, tissue culture or whole Musa plant.

14. The nucleic acid molecule isolated according to claim 13, wherein the expression occurs in a cell, tissue, cell culture, tissue culture or whole plant of Musa acuminata.

15. A nucleic acid construct comprising the isolated nucleic acid molecule according to claims 1-11, wherein the nucleic acid sequence is operatively linked to a promoter capable of directing the expression of the nucleic acid sequence.

16. The nucleic acid construct according to claim 15, wherein the promoter is a plant promoter.

17. The nucleic acid construct according to claim 15, wherein the promoter is a 35S promoter.

18. The nucleic acid construct according to claim 15, wherein the promoter is encoded by SEQ ID NO:

31.

19. A transformation vector comprising the nucleic acid construct according to claims 15-18.

20. A method for transforming a plant cell comprising introducing the transformation vector according to claim 19 into a plant cell, whereby the transformed plant cell expresses the nucleic acid sequence encoding resistance to Fusarium oxysporum race 4.

21. The method according to claim 20, wherein the plant cell is a Musa plant cell.

22. The method according to claim 20, wherein the plant cell is a Musa acuminata plant cell.

23. The method according to claims 20-22, further comprising producing transformed plant tissue from the transformed plant cell. 111 24. The method according to claim 23, further comprising producing a transformed seedling from the transformed plant tissue.

25. The method according to claim 24, further comprising producing a clone of the transformed seedling.

26. The method according to claim 24 or 25, further comprising growing the transformed seedling or clone of the transformed seedling into a mature transformed plant.

27. The method according to claim 26, wherein the mature transformed plant is a Musa plant and the mature transformed Musa plant is capable of producing fruit.

28. The method according to claim 27, further comprising producing clones of the mature transformed Musa plant.

29. The method according to claim 27 or 28, further comprising the use of the mature transformed Musa plant or the clone of the mature transformed Musa plant in an improvement method.

30. An isolated amino acid molecule comprising an amino acid sequence of SEQ ID NO: 15 encoding a protein that, when produced in a plant, results in susceptibility to Fusarium oxysporum race 4, wherein SEQ ID NO: 15 is modified by one, two, three, or four amino acid substitutions so that it encodes a protein that, when produced in a plant, results in resistance to Fusarium oxysporum race 4.

31. The isolated amino acid molecule according to claim 30, wherein the amino acid substitutions comprise replacing a leucine corresponding to position 50 of SEQ ID NO: 15 with a valine (50L>V).

32. The isolated amino acid molecule according to claim 30, wherein the amino acid substitutions comprise replacing a valine corresponding to position 108 of SEQ ID NO: 15 with a glutamic acid (108V>E).

33. The isolated amino acid molecule according to claim 30, wherein the amino acid substitutions comprise replacing an arginine corresponding to position 115 of SEQ ID NO: 15 with a proline (115R>P).

34. The isolated amino acid molecule according to claim 30, wherein the amino acid substitutions comprise replacing an aspartic acid corresponding to position 116 of SEQ ID NO: 15 with a valine (116D>V).

35. The isolated amino acid molecule according to claim 30, wherein the amino acid substitutions comprise replacing a valine corresponding to position 108 of SEQ ID NO: 15 with a glutamic acid (108V>E), an arginine corresponding to position 115 of SEQ ID NO: 15 with a proline (115R>P), and an aspartic acid corresponding to position 116 of SEQ ID NO: 15 with a valine (116D>V).

36. The isolated amino acid molecule segment according to claims 30-35, wherein production occurs in a plant cell, plant tissue, plant cell culture, plant tissue culture, or whole plant. MA / a / ZUZZ / UUUI oz 112 37. The isolated amino acid molecule segment according to claim 36, wherein production occurs in a cell, tissue, cell culture, tissue culture or whole Musa plant.

38. The isolated amino acid molecule segment according to claim 36, wherein production occurs in a cell, tissue, cell culture, tissue culture or whole plant of Musa acuminata.

39. A nucleic acid construct comprising a nucleic acid sequence encoding resistance to Fusarium oxysporum race 4 when expressed in a plant, wherein said nucleic acid sequence is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 21 and SEQ ID NO: 24, and wherein the nucleic acid sequence is operatively linked to a promoter capable of directing the expression of the nucleic acid sequence.

40. The nucleic acid construct according to claim 39, wherein the promoter is a plant promoter.

41. The nucleic acid construct according to claim 39, wherein the promoter is a 35S promoter.

42. The nucleic acid construct according to claim 39, wherein the promoter is encoded by SEQ ID NO:

31.

43. A transformation vector comprising the nucleic acid construct according to claims 39-42.

44. A method for transforming a plant cell comprising introducing the transformation vector according to claim 43 into a plant cell, whereby the transformed plant cell expresses the nucleic acid sequence encoding resistance to Fusarium oxysporum race 4.

45. The method according to claim 44, wherein the plant cell is a Musa plant cell.

46. ​​The method according to claim 44, wherein the plant cell is a plant cell of Musa acuminala.

47. The method according to claims 44-46, further comprising producing transformed plant tissue from the transformed plant cell.

48. The method according to claim 47, further comprising producing a transformed seedling from the transformed plant tissue.

49. The method according to claim 48, further comprising producing a clone of the transformed seedling.

50. The method according to claim 48 or 49, further comprising growing the transformed seedling or clone of the transformed seedling into a mature transformed plant.

51. The method according to claim 50, wherein the mature transformed plant is a Musa plant and the mature transformed Musa plant is capable of producing fruit. 113 52. The method according to claim 51, further comprising producing clones of the mature transformed Musa plant.

53. The method according to claim 51 or 52, further comprising the use of the mature transformed Musa plant or the clone of the mature transformed Musa plant in an improvement method.

54. A banana breeding method comprising crossing a first Musa plant comprising a nucleic acid sequence encoding resistance to Fusarium oxysporum race 4 with a second Musa plant that is susceptible to Fusarium oxysporum race 4 and selecting the progeny resulting from the cross based on their resistance to Fusarium oxysporum race 4, wherein said nucleic acid sequence encoding resistance to Fusarium oxysporum race 4 is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 18, SEQ ID NO: 21 and SEQ ID NO:

24.

55. The banana improvement method according to claim 54, further comprising producing clones of the progeny resulting from the cross wherein the clones are selected based on their resistance to Fusarium oxysporum race 4.

56. The banana improvement method according to claim 54, wherein the second Musa plant is a Musa acuminata plant.

57. The banana improvement method according to claim 54, wherein the progeny of the cross exhibiting resistance to Fusarium oxysporum race 4 is selected by using molecular markers that are designed based on the nucleic acid sequence encoding resistance to Fusarium oxysporum race 4 that is present in the first Musa plant used in the cross.

58. A method for obtaining a Musa acuminata plant cell with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4, wherein the method comprises introducing a double-strand break at at least one site in an exogenous gene encoded by SEQ ID NO: 14 to produce a Musa acuminata plant cell with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4.

59. The method according to claim 58, further comprising generating a Musa acuminata plant from a Musa acuminata plant cell with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4 to produce a Musa acuminata plant with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4.

60. The method according to claim 59, further comprising the use of the Musa acuminata plant with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4 in a banana breeding program.

61. The method according to claim 20 or 44, wherein the plant cell is the Musa acuminata plant cell according to claim 59 with a silenced endogenous gene encoding susceptibility to Fusarium oxysporum race 4. 114 62. The method according to claim 58, wherein the double-strand break is induced by a nuclease selected from the group consisting of a TALEN, a meganuclease, a zinc-finger nuclease, and a CRISPR-associated nuclease.

63. The method according to claim 62, wherein the double-strand break is induced by a CRISPR-associated nuclease and wherein a guide RNA is provided.

64. A method for producing a plant cell resistant to Fusarium oxysporum race 4 comprising introducing at least one genetic modification into one or more endogenous nucleic acid sequences encoding susceptibility to Fusarium oxysporum race 4, wherein the genetic modification confers resistance to Fusarium oxysporum race 4 to the plant cell.

65. The method according to claim 64, wherein the at least one genetic modification is introduced by means of a TALEN, a meganuclease, a zinc-finger nuclease, or a CRISPR-associated nuclease.

66. The method of claim 64, wherein the at least one genetic modification is introduced by means of a CRISPR-associated nuclease and an associated guide RNA.

67. The method according to claim 64, wherein the at least one genetic modification is selected from the list consisting of replacing a T corresponding to position 148 of SEQ ID NO: 14 by a G (148T>G), replacing a T corresponding to position 323 of SEQ ID NO: 14 by an A (323T>A), replacing a G corresponding to position 344 of SEQ ID NO: 14 by a C (344G>C), and replacing an A corresponding to position 347 of SEQ ID NO: 14 by a T (347A>T).

68. The method according to claim 64, wherein the at least one genetic modification results in a change in an amino acid selected from the group consisting of replacing a leucine corresponding to position 50 of SEQ ID NO: 15 with a valine (50L>V), replacing a valine corresponding to position 108 of SEQ ID NO: 15 with a glutamic acid (108V>E), replacing an arginine corresponding to position 115 of SEQ ID NO: 15 with a proline (115R>P), and replacing an aspartic acid corresponding to position 116 of SEQ ID NO: 15 with a valine (116D>V).

69. The method according to claims 64-68, wherein the plant cell is a Musa plant cell.

70. The method according to claims 64-68, wherein the plant cell is a Musa acuminata plant cell.

71. The method according to claims 64-70, further comprising producing transformed plant tissue from the transformed plant cell.

72. The method according to claim 71, further comprising producing a transformed seedling from the transformed plant tissue.

73. The method according to claim 72, further comprising producing a clone of the transformed seedling. 115 74. The method according to claim 71 or 72, further comprising growing the transformed seedling or clone of the transformed seedling into a mature transformed plant.

75. The method according to claim 74, wherein the mature transformed plant is a Musa plant and the mature transformed Musa plant is capable of producing fruit. 5 76. The method according to claim 75, further comprising producing clones of the mature transformed Musa plant.

77. The method according to claim 75 or 76, further comprising the use of the mature transformed Musa plant or the clone of the mature transformed Musa plant in an improvement method.