Glutamate-cysteine ligase variant and method for producing glutathione using same

Abstract

Provided are a novel glutamate--cysteine ligase variant and a method of producing glutathione using the same.

Description

Glutamate-cysteine ​​ligase mutant and glutathione production method using the same

[0001] The present application relates to a novel glutamate-cysteine ​​ligase variant and a method for producing glutathione using the same.

[0002]

[0003] Glutathione (GSH) is the most common organic sulfur compound found within cells and is a tripeptide composed of three amino acids: glycine, glutamate, and cysteine.

[0004] Glutathione exists in the body in two forms: reduced glutathione (GSH) and oxidized glutathione (GSSG). Reduced glutathione (GSH), which is present in relatively high concentrations under normal conditions, is primarily distributed in the liver and skin cells. It plays a crucial role in antioxidant activity, decomposing and removing reactive oxygen species; detoxifying exogenous compounds such as toxic substances; and whitening, inhibiting melanin production.

[0005] As aging progresses, the amount of glutathione produced gradually decreases, and the decrease in glutathione production, which plays an important role in antioxidant and detoxification functions, promotes the accumulation of active oxygen, which is the main cause of aging, so glutathione supply from outside is necessary (Sipes IG et al, The role of glutathione in the toxicity of xenobiotic compounds: metabolic activation of 1,2-dibromoethane by glutathione, Adv Exp Med Biol. 1986;197:457-67.).

[0006] Glutathione, with its diverse functions, is attracting attention as a material in various fields such as pharmaceuticals, health functional foods, and cosmetics, and is also used in the production of flavoring ingredients and food and feed additives. Glutathione is known to have a significant effect in enhancing the flavor of raw ingredients and maintaining a rich flavor. It can be used alone or in combination with other substances as a kokumi flavor enhancer. Kokumi ingredients are generally known to have a richer flavor than existing umami ingredients such as nucleic acids and MSG, and are known to be produced through the decomposition and maturation of proteins.

[0007] However, despite the increasing demand for glutathione, which can be used in various fields, the enzymatic synthesis process has not yet been commercialized due to the high production cost, and the industrial production of glutathione requires considerable costs, so the market is not very active.

[0008]

[0009] The present applicants confirmed that a microorganism introducing a newly developed glutamate-cysteine ​​ligase variant can produce glutathione in high yield, and completed the present application.

[0010]

[0011] The present application provides a glutamate-cysteine ​​ligase variant in which the amino acid corresponding to position 653 from the N-terminus of the amino acid sequence of SEQ ID NO: 1 in a protein having glutamate-cysteine ​​ligase activity is substituted with methionine.

[0012] The present application provides a polynucleotide encoding the above mutant and a vector comprising the same.

[0013] The present application provides a microorganism that produces glutathione, comprising at least one of the above mutant; a polynucleotide encoding the mutant; and a vector comprising the above polynucleotide.

[0014] The present application provides a method for producing glutathione, which comprises a step of culturing the above microorganism.

[0015]

[0016] The novel glutamate-cysteine ​​ligase variant of the present application significantly increases glutathione production and can thus be usefully utilized for high-production of glutathione. The yeast, dried product, extract, culture, lysate thereof, and the glutathione produced in this manner have antioxidant effects, detoxification effects, and immune-enhancing effects, and can be usefully used in cosmetic compositions, food compositions, feed compositions, pharmaceutical compositions, and the manufacture thereof.

[0017]

[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0019] Furthermore, those skilled in the art will recognize or be able to ascertain, using only routine experimentation, numerous equivalents to the specific embodiments of the present application described herein. Furthermore, such equivalents are intended to be encompassed by this application.

[0020]

[0021] One aspect of the present application can provide a glutamate-cysteine ​​ligase variant comprising an amino acid substitution in a protein having glutamate-cysteine ​​ligase activity, wherein the substitution comprises a substitution of an amino acid corresponding to position 653 from the N-terminus of SEQ ID NO: 1 with methionine.

[0022] The above variant may be a protein variant in which glycine, an amino acid corresponding to position 653 from the N-terminus in the glutamate-cysteine ​​ligase amino acid sequence of sequence number 1, is substituted with methionine.

[0023] The "glutamate-cysteine ​​ligase (GCL)" of the present application is an enzyme also called "glutamate-cysteine ​​ligase" or "gamma-glutamylcysteine ​​synthetase (GCS)". Glutamate-cysteine ​​ligase is known to catalyze the following reactions:

[0024] L-glutamate + L-cysteine ​​+ ATP ↔ gamma-glutamyl cysteine ​​+ ADP + Pi

[0025] Additionally, the reaction catalyzed by the above glutamate-cysteine ​​ligase is known to be the first step in glutathione synthesis.

[0026] In the present application, the amino acid sequence of glutamate-cysteine ​​ligase is an amino acid sequence encoded by the gsh1 gene, and may be referred to as "GSH1 protein" or "glutamate-cysteine ​​ligase." The amino acid sequence constituting the glutamate-cysteine ​​ligase of the present application can be obtained from the NCBI's GenBank, a known database. The glutamate-cysteine ​​ligase may be a protein comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto. As another example, the glutamate-cysteine ​​ligase may be derived from Saccharomyces cerevisiae, and as another example, the amino acid corresponding to position 653 in the amino acid sequence of Saccharomyces SEQ ID NO: 1 may be glycine. However, this is not limited thereto, and a sequence having the same glutamate-cysteine ​​ligase activity as the above amino acid sequence may be included without limitation.

[0027] For example, the glutamate-cysteine ​​ligase of the present application may be a protein comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto. In addition, it is obvious that a protein having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, or added is also included within the scope of the protein that is the subject of mutation of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the protein.

[0028] In addition, in the present application, an example of glutamate-cysteine ​​ligase is defined as a protein including the amino acid sequence of SEQ ID NO: 1, but this does not exclude meaningless sequences before and after the amino acid sequence of SEQ ID NO: 1, mutations that may occur naturally, or silent mutations thereof, and it is obvious to those skilled in the art that if it has the same or corresponding activity as the protein consisting of the amino acid sequence of SEQ ID NO: 1, it corresponds to the glutamate-cysteine ​​ligase of the present application.

[0029] That is, even if the present application describes a “protein or polypeptide having an amino acid sequence described by a specific sequence number” or a “protein or polypeptide comprising an amino acid sequence described by a specific sequence number,” it is clear that a protein having an amino acid sequence in which some of the sequences are deleted, modified, substituted or added can also be used in the present application if it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding sequence number.

[0030]

[0031] As used herein, the term "variant" or "modified polypeptide" refers to a protein in which one or more amino acids differ from the recited sequence by conservative substitution and / or modification, but the functions or properties of the protein are maintained. For the purposes of the present application, the variant may be a glutamate-cysteine ​​ligase variant or a variant polypeptide having glutamate-cysteine ​​ligase activity, wherein the amino acid corresponding to position 653 from the N-terminus of SEQ ID NO: 1 among the glutamate-cysteine ​​ligases described above is substituted with methionine. The variant of the present application, "glutamate-cysteine ​​ligase variant" may also be described as "(variant) polypeptide having glutamate-cysteine ​​ligase activity", "GSH1 variant".

[0032] The above variants differ from the identified sequence by several amino acid substitutions, deletions, or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the native protein. In addition, some variants may include variant polypeptides in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The terms “variant” or “variant polypeptide” may be used interchangeably with terms such as variant, modification, mutated protein, and variation (in English, modification, modified protein, mutant, mutein, divergent, variant, etc.), and are not limited thereto as long as the terms are used in the meaning of variation.

[0033] For the purposes of this application, the variant may be, but is not limited to, one that increases the activity of the mutated protein compared to the native wild-type or unmodified protein, or increases glutathione production compared to the protein before mutation, the native wild-type polypeptide, or the unmodified polypeptide.

[0034] The term "conservative substitution" in this application refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such variants may, for example, have one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0035] For example, among amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; and amino acids having uncharged side chains include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.

[0036] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of a protein that is involved in co-translational or post-translational protein transfer. Furthermore, the polypeptide may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis of the polypeptide.

[0037]

[0038] In one embodiment, the variant may be a glutamate-cysteine ​​ligase variant in which the amino acid corresponding to position 653 from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is substituted with methionine. In one embodiment, the variant may be, but is not limited to, a variant in which the glycine corresponding to position 653 in the amino acid sequence of SEQ ID NO: 1 is substituted with methionine.

[0039] In this application, "substitution with another amino acid" is not limited to an amino acid different from the amino acid before substitution. Meanwhile, when this application expresses that "a specific amino acid has been substituted," it is self-evident that the amino acid has been substituted with an amino acid different from the amino acid before substitution, even if it is not specifically stated that it has been substituted with another amino acid. The term "corresponding position" in this application refers to an amino acid residue at a position listed in a protein or polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the protein or polypeptide. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related protein or reference protein.

[0040] In the present application, specific numbering may be used for amino acid residue positions within the protein used in the present application. For example, by aligning the polypeptide sequences of the target protein to be compared with the protein of the present application, it is possible to renumber positions corresponding to amino acid residue positions in the protein of the present application.

[0041]

[0042] A glutamate-cysteine ​​ligase variant in which the amino acid corresponding to the 653rd position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 of the present application is substituted with methionine may be a protein in which the amino acid corresponding to the 653rd position of SEQ ID NO: 1 is substituted with methionine among the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto. Such a variant may be a variant having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 1 and less than 100% homology or identity with SEQ ID NO: 1, but is not limited thereto.

[0043] A glutamate-cysteine ​​ligase variant, in which the amino acid corresponding to the 653rd position from the N-terminus of the amino acid sequence of SEQ ID NO: 1 of the present application is substituted with methionine, may comprise the amino acid sequence of SEQ ID NO: 3. Specifically, it may consist essentially of the amino acid sequence of SEQ ID NO: 3, and more specifically, it may consist of any one amino acid sequence of SEQ ID NO: 3, but is not limited thereto.

[0044] In addition, the variant may include an amino acid sequence of SEQ ID NO: 3, or an amino acid sequence in which amino acid position 653 is fixed (i.e., the amino acid corresponding to position 653 of SEQ ID NO: 3 in the amino acid sequence of the variant is identical to the amino acid at position 653 of SEQ ID NO: 3), and may include an amino acid sequence having 80% or more homology or identity therewith, but is not limited thereto.

[0045] Specifically, the variant of the present application may include a polypeptide having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of SEQ ID NO: 3 and SEQ ID NO: 3. In addition, it is obvious that a protein having an amino acid sequence in which part of the sequence is deleted, modified, substituted, or added, other than position 653, is also included in the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the variant.

[0046]

[0047] In this application, the terms "homology" or "identity" refer to the degree to which two given amino acid sequences or base sequences are related, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0048] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions, typically along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its entire length. It should be appreciated that hybridization also encompasses polynucleotides containing common codons or codons that are considered codon degenerate.

[0049]

[0050] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information database.

[0051] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0052] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and appropriate hybridization conditions are within the skill of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0053]

[0054] A glutamate-cysteine ​​ligase variant in which the amino acid corresponding to position 653 from the N-terminus of the amino acid sequence of SEQ ID NO. 1 of the present application is substituted with methionine may additionally include a variant in which the amino acid corresponding to position 86 from the N-terminus of the amino acid sequence of SEQ ID NO. 1 is substituted with another amino acid.

[0055] Specifically, the variant may include a variant in which the cysteine ​​corresponding to position 86 is substituted with another amino acid, for example, a variant in which the cysteine ​​is substituted with arginine.

[0056] For example, the variant may comprise, consist essentially of, or consist of the amino acid sequence of SEQ ID NO: 13, but is not limited thereto.

[0057]

[0058] Another aspect of the present application may provide a polynucleotide encoding the variant.

[0059] In this application, the term "polynucleotide" means a DNA or RNA strand of a certain length or longer, which is a polymer of nucleotides in which nucleotide units (monomers) are linked in a long chain shape by covalent bonds.

[0060] The gene encoding the glutamate-cysteine ​​ligase of the present application may be the gsh1 gene.

[0061] The above gene may be derived from yeast. Specifically, it may be derived from the genus Saccharomyces, more specifically from Saccharomyces cerevisiae. Specifically, it includes, without limitation, a polypeptide encoding a glutamate-cysteine ​​ligase activity derived from Saccharomyces cerevisiae, and in one embodiment, it may be a gene encoding an amino acid sequence of SEQ ID NO: 1, and in one embodiment, it may include, but is not limited to, a base sequence of SEQ ID NO: 2.

[0062] The polynucleotide encoding the protein variant of the present application may include, without limitation, any polynucleotide encoding the glutamate-cysteine ​​ligase variant of the present application and a polypeptide having a corresponding activity.

[0063] The polynucleotide encoding the glutamate-cysteine ​​ligase of the present application and its variants may have various modifications made to the coding region within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of codons preferred in an organism that is intended to express the polypeptide.

[0064] Specifically, the polynucleotide encoding the protein variant of the present application may include, without limitation, a polynucleotide sequence encoding a protein variant in which the amino acid corresponding to position 653 in the amino acid sequence of SEQ ID NO: 1 is substituted with methionine. For example, the polynucleotide encoding the protein variant of the present application may be, but is not limited to, a polynucleotide sequence encoding the protein variant of the present application, specifically, a protein comprising the amino acid sequence of SEQ ID NO: 3, or a polypeptide having homology or identity therewith. The homology or identity is as described above.

[0065] In addition, the polynucleotide encoding the protein variant of the present application may include, without limitation, a probe that can be prepared from a known gene sequence, for example, a sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the base sequence, and encodes a protein variant in which the amino acid corresponding to position 653 in the amino acid sequence of SEQ ID NO: 1 is substituted with methionine.

[0066] The above “stringent conditions” refer to conditions that enable specific hybridization between polynucleotides. These conditions are specifically described in the literature (e.g., J. Sambrook et al., 1989, supra). For example, conditions under which polynucleotides having a high degree of homology or identity hybridize with each other, specifically at least 40%, specifically at least 90%, more specifically at least 95%, at least 96%, at least 97%, at least 98%, and even more specifically at least 99%, and polynucleotides having a lower degree of homology or identity than that hybridize, or conditions under which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, and more specifically 68°C, 0.1×SSC, 0.1% SDS, which are washing conditions of typical southern hybridization, can be listed.

[0067] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0068] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by those skilled in the art depending on the purpose.

[0069] The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (see Sambrook et al., 1989, supra, 9.50-9.51, 11.7-11.8).

[0070]

[0071] Another aspect of the present application may provide a vector comprising a polynucleotide encoding the protein variant.

[0072] The term "vector" as used herein refers to a DNA construct containing a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome, or may be integrated into the genome itself.

[0073] For example, a polynucleotide encoding a target protein within a chromosome can be replaced with a mutated polynucleotide through a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, such as, but not limited to, homologous recombination. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface protein, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells.

[0074] The vector used in the present application is not particularly limited, and any vector known in the art can be used. The yeast expression vector can be both an integrative yeast plasmid (YIp) and an extrachromosomal plasmid vector. The extrachromosomal plasmid vector can include an episomal yeast plasmid (YEp), a replicative yeast plasmid (YRp), and a yeast centromer plasmid (YCp). In addition, artificial yeast chromosomes (YACs) can also be used as the vector in the present application. As specific examples, available vectors include pESCHIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAPα A, pGAPα B, pGAPα C, pPIC3.5K, pPIC6 A, pPIC6 B, pPIC6 C, pPIC6α A, pPIC6α B, pPIC6α C, pPIC9K, pYC2 / CT, pYD1 Yeast Display Vector, pYES2, pYES2 / CT, pYES2 / NT A, pYES2 / NT B, pYES2 / NT C, pYES2 / CT, pYES2.1, pYES-DEST52, pTEF1 / Zeo, pFLD1, PichiaPinkTM, p427-TEF, p417-CYC, pGAL-MF, p427-TEF, p417-CYC, PTEF-MF, pBY011, pSGP47, pSGP46, pSGP36, pSGP40, ZM552, pAG303GAL-ccdB, pAG414GAL-ccdB, pAS404, pBridge, pGAD-GH, pGAD T7, pGBK T7, pHIS-2, pOBD2, pRS408, pRS410, pRS418, pRS420, pRS428, yeast micron A form, pRS403, pRS404, pRS405, pRS406, pYJ403, Including but not limited to pYJ404, pYJ405 and pYJ406.

[0075]

[0076] The term "transformation" in this application refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell or microorganism, thereby enabling expression of the protein encoded by the polynucleotide within the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed within the host cell. Furthermore, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. Additionally, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0077] Additionally, the term "operably linked" as used herein means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the target polypeptide of the present application.

[0078] The method for transforming the vector of the present application includes any method for introducing nucleic acids into cells, and can be performed by selecting an appropriate standard technique known in the art depending on the host cell. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0079]

[0080] The present application can provide a microorganism that produces glutathione, comprising at least one of the mutant; a polynucleotide encoding the mutant; and a vector comprising the polynucleotide.

[0081] The term "microorganism" in this application encompasses both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and encompasses microorganisms whose specific mechanisms are weakened or enhanced due to factors such as the insertion of foreign genes or the enhancement or weakening of endogenous gene activity. In this application, the term "microorganism" may be included without limitation as long as it is a microorganism into which the glutamate-cysteine ​​ligase variant of this application is introduced or included.

[0082] The above microorganism is, for example, a cell or microorganism that is transformed with a gene encoding a target protein or a vector containing the same and expresses the target protein. For the purpose of the present application, the host cell or microorganism may be any microorganism capable of producing glutathione, including the glutamate-cysteine ​​ligase variant.

[0083] "Glutathione" in this application is used interchangeably with "glutathione" and "GSH", and refers to a tripeptide composed of three amino acids: glutamate, cysteine, and glycine. Glutathione can be used as a raw material for pharmaceuticals, health functional foods, flavoring materials, foods, feed additives, cosmetics, etc., but is not limited thereto.

[0084] In this application, the term "microorganism producing glutathione" includes all microorganisms that have undergone genetic modification, either naturally or artificially, and may be microorganisms in which a specific mechanism has been weakened or strengthened due to causes such as the insertion of an external gene or the strengthening or inactivation of an endogenous gene, and may be microorganisms in which genetic mutations for the production of the desired glutathione have occurred or the activity has been strengthened. For the purpose of this application, the microorganism producing glutathione may refer to a microorganism capable of producing an excess of the desired glutathione compared to a wild-type or unmodified microorganism, including glutamate-cysteine ​​ligase. The term "microorganism producing glutathione" may be used interchangeably with terms such as "glutathione-producing microorganism," "microorganism having glutathione-producing ability," "glutathione-producing strain," and "strain having glutathione-producing ability."

[0085] The above glutathione-producing microorganism is not particularly limited in type as long as it is capable of producing glutathione, but may be a microorganism of the genus Saccharomyces, and specifically, may be Saccharomyces cerevisiae, but is not limited thereto.

[0086] The parent strain of the glutathione-producing microorganism including the above mutant is not particularly limited as long as it is capable of producing glutathione. The microorganism may further include mutations such as strengthening the biosynthetic pathway for increasing glutathione production capacity, releasing feedback inhibition, and inactivating genes that weaken the degradation pathway or biosynthetic pathway, and such mutations do not exclude natural ones. In one embodiment, the microorganism may include a mutation in the expression control region of glutamate-cysteine ​​ligase that increases glutathione production capacity. This may be any one or more mutations selected from -250 (C→T), -252 (G→A), -398 (A→T), -399 (A→C), -407 (T→C), and -409 (T→C) at the top of the GSH1 ORF. However, it is not limited thereto.

[0087]

[0088] The microorganism comprising at least one of the variants of the present application; a polynucleotide encoding the variant; and a vector comprising the polynucleotide may be a microorganism expressing a glutamate-cysteine ​​ligase variant in which the amino acid corresponding to position 653 in the amino acid sequence of SEQ ID NO: 1 is substituted with methionine, but is not limited thereto.

[0089] The glutamate-cysteine ​​ligase and its variants are as described above.

[0090]

[0091] In this application, the term "protein to be / is expressed" refers to a state in which a target protein is introduced into a microorganism or modified to be expressed within the microorganism. If the target protein is a protein existing within the microorganism, this refers to a state in which its activity is enhanced compared to its endogenous state or prior to modification.

[0092] The microorganism expressing the protein variant of the present application may be a microorganism modified to express the protein variant of the present application, and therefore another aspect of the present application provides a method for producing a microorganism expressing the protein variant of the present application.

[0093]

[0094] In this application, "introduction of a protein" means that a microorganism exhibits the activity of a specific protein that it did not originally possess, or exhibits enhanced activity compared to the protein's inherent activity or activity prior to modification. For example, a specific protein may be introduced, a polynucleotide encoding a specific protein may be introduced into the chromosome of a microorganism, or a vector containing a polynucleotide encoding a specific protein may be introduced into the microorganism, resulting in the expression of its activity.

[0095] In this application, the term “enhancement” of polypeptide or protein activity means that the activity of the polypeptide or protein is increased compared to the intrinsic activity. The term “enhancement” may be used interchangeably with terms such as up-regulation, overexpression, and increase. Here, the term “increase” may include both exhibiting an activity that was not originally present, or exhibiting an improved activity compared to the intrinsic activity or activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide or protein that was originally present in a parent strain or unmodified microorganism before the transformation, when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” The term “enhancement” or “increase” of the activity of a polypeptide or protein compared to the intrinsic activity means that the activity of a specific polypeptide or protein is improved compared to the activity that the parent strain or unmodified microorganism originally had before the transformation.

[0096] The above “increased activity” may be achieved by introducing an exogenous polypeptide or protein, or by enhancing the activity of an endogenous polypeptide or protein. Specifically, it may be achieved by enhancing the activity of an endogenous polypeptide or protein. Whether the activity of the polypeptide or protein is enhanced can be confirmed by an increase in the level of activity of the polypeptide or protein, the amount of expression, or the amount of a product secreted from the protein.

[0097] Enhancement of the activity of the polypeptide or protein may be achieved by applying various methods well known in the art, and may not be limited as long as the activity of the target polypeptide or protein can be enhanced compared to the microorganism before modification. The method may utilize, but is not limited to, genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art (Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0098] Methods for enhancing polypeptide or protein activity using the above genetic engineering include, for example,

[0099] 1) Increase in the intracellular copy number of a gene or polynucleotide encoding the above polypeptide or protein;

[0100] 2) A method of replacing the gene expression control region on a chromosome encoding the above polypeptide or protein with a highly active sequence;

[0101] 3) A method for modifying the base sequence of the initiation codon or 5'-UTR region of the above polypeptide or protein;

[0102] 4) A method for modifying a polynucleotide sequence on a chromosome so as to increase the activity of the polypeptide or protein;

[0103] 5) Introduction of a foreign polynucleotide exhibiting the activity of the above polypeptide or protein or a codon-optimized variant polynucleotide of the above polynucleotide, or

[0104] 6) It can be performed by a combination of the above methods, but is not limited thereto.

[0105] The method of enhancing polypeptide or protein activity using the above protein engineering can be performed, for example, by analyzing the tertiary structure of a polypeptide or protein, selecting an exposed portion, and modifying or chemically modifying the exposed portion, but is not limited thereto.

[0106] The above 1) increase in the intracellular copy number of a gene or polynucleotide encoding a polypeptide or protein can be performed by any method known in the art, for example, by introducing a vector capable of replicating and functioning independently of a host, to which the gene or polynucleotide encoding the polypeptide or protein is operably linked, into a host cell. Alternatively, the method can be performed by introducing a vector capable of inserting the gene or polynucleotide into a chromosome within the host cell, to which the gene is operably linked, into the host cell, but is not limited thereto. The vector is as described above.

[0107] The method of replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide or protein in the above 2) with a sequence having strong activity can be performed by any method known in the art, for example, by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof of the nucleic acid sequence to further enhance the activity of the expression control region, or by replacing it with a nucleic acid sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence regulating the termination of transcription and translation, etc. The method may specifically be, but is not limited to, linking a strong heterologous promoter instead of the original promoter.

[0108] Examples of known promoters for eukaryotes include promoters for translation elongation factor 1 (TEF1), glycerol-3-phosphate dehydrogenase 1 (GPD1), 3-phosphoglycerate kinase or other glycolytic enzymes such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase, while examples of other yeast promoters that are inducible promoters with the additional advantage of transcription being controlled by growth conditions include promoters for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, and enzymes associated with nitrogen metabolism. There are promoters for the enzymes responsible for the utilization of maltose, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for the utilization of maltose and galactose, and when the host cell is yeast, available promoters may include the TEF1 promoter, the TEF2 promoter, the GAL10 promoter, the GAL1 promoter, the ADH1 promoter, the ADH2 promoter, the PHO5 promoter, the GAL1-10 promoter, the TDH3 promoter (GPD promoter), the TDH2 promoter, the TDH1 promoter, the PGK1 promoter, the PYK2 promoter, the ENO1 promoter, the ENO2 promoter and the TPI1 promoter, and suitable vectors and promoters for use in yeast expression are further described, but are not limited to, in EP 073657. Additionally, yeast enhancers may also be advantageously used in conjunction with yeast promoters, but are not limited thereto.

[0109] The method of modifying the base sequence of the initiation codon or 5'-UTR region of the polypeptide or protein, as described above, may be any method known in the art, for example, replacing the endogenous initiation codon of the polypeptide or protein with another initiation codon having a higher polypeptide or protein expression rate than the endogenous initiation codon, but is not limited thereto.

[0110] The method of modifying a polynucleotide sequence on a chromosome to increase the activity of the polypeptide or protein as described above 4) can be performed by any method known in the art, for example, by inducing a mutation in the expression regulatory sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof of the nucleic acid sequence to further enhance the activity of the polynucleotide sequence, or by replacing it with a polynucleotide sequence that has been improved to have stronger activity. The replacement may specifically be inserting the gene into the chromosome by homologous recombination, but is not limited thereto.

[0111] The vector used at this time may additionally include a selection marker to confirm whether chromosomal insertion has occurred. The selection marker is as described above.

[0112] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide or protein described above 5) can be carried out by any method known in the art, for example, by introducing a foreign polynucleotide encoding a polypeptide or protein exhibiting the same / similar activity as the polypeptide or protein, or a codon-optimized mutant polynucleotide thereof, into a host cell. The foreign polynucleotide can be used without limitation in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide or protein. In addition, the introduced foreign polynucleotide can be introduced into a host cell by optimizing its codons so that optimized transcription and translation can occur within the host cell. The introduction can be carried out by a person skilled in the art appropriately selecting a known transformation method, and the introduced polynucleotide can be expressed within the host cell, thereby producing a polypeptide or protein and increasing its activity.

[0113] Finally, 6) a combination of the above methods can be performed by applying one or more of the above methods 1) to 5) together.

[0114] Such enhancement of polypeptide or protein activity may be, but is not limited to, an increase in the activity or concentration of the corresponding polypeptide or protein relative to the activity or concentration of the polypeptide or protein expressed in the wild-type or pre-modified microbial strain, or an increase in the amount of a product produced from the polypeptide or protein.

[0115]

[0116] In this application, the term "pre-transformation strain" or "pre-transformation microorganism" does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. The "pre-transformation strain" or "pre-transformation microorganism" may be used interchangeably with "non-mutated strain", "non-transformed strain", "non-mutated microorganism", "non-transformed microorganism", or "reference microorganism".

[0117] In the present application, a microorganism comprising a polynucleotide comprising or encoding the glutamate-cysteine ​​ligase variant, or a vector comprising the polynucleotide, may be a recombinant microorganism, and the recombination may be achieved by genetic modification such as transformation.

[0118] For example, it may be a recombinant microorganism produced by transformation with a vector containing the polynucleotide, but is not limited thereto. The recombinant microorganism may be yeast, and for example, it may be a microorganism of the genus Saccharomyces, specifically, Saccharomyces cerevisiae, but is not limited thereto.

[0119] Another aspect of the present application provides a method for producing glutathione, comprising a step of culturing the microorganism. The microorganism and glutathione are as described above.

[0120] The medium and other culture conditions used for culturing the strain of the present application can be any medium used for culturing microorganisms of the genus Saccharomyces without any particular limitation. Specifically, the strain of the present application can be cultured in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin, etc., under aerobic or anaerobic conditions while controlling temperature, pH, etc.

[0121] In the present application, the carbon source may include, but is not limited to, carbohydrates such as glucose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamate, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar), and other appropriate amounts of carbon sources may be used without limitation. These carbon sources may be used alone or in combination of two or more.

[0122] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0123] The above-mentioned personnel may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc.

[0124] In addition, the medium may contain amino acids, vitamins, and / or appropriate precursors. Specifically, L-amino acids may be added to the culture medium of the strain. Specifically, glycine, glutamate, and / or cysteine ​​may be added, and L-amino acids such as lysine may be further added if necessary, but are not necessarily limited thereto.

[0125]

[0126] The above medium or precursor may be added to the culture in batch or continuous manner, but is not limited thereto.

[0127] In the present application, during the cultivation of the strain, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the culture in an appropriate manner to adjust the pH of the culture. In addition, during the cultivation, an antifoaming agent such as fatty acid polyglycol ester can be used to suppress bubble formation. Furthermore, to maintain the aerobic state of the culture, oxygen or an oxygen-containing gas can be injected into the culture, or to maintain anaerobic and microaerobic states, no gas can be injected, or nitrogen, hydrogen, or carbon dioxide gas can be injected.

[0128] The temperature of the culture may be between 25°C and 40°C, more specifically between 28°C and 37°C, but is not limited thereto. The culture period may continue until the desired amount of useful substance is produced, and may be between 1 hour and 100 hours, but is not limited thereto.

[0129]

[0130] The above glutathione manufacturing method may further include an additional process after the culturing step. The additional process may be appropriately selected depending on the glutathione's intended use.

[0131] Specifically, the method for producing glutathione may include a step of recovering glutathione accumulated in the cell by the culturing step, and for example, may include a step of recovering glutathione from one or more materials selected from the strain, its dried product, extract, culture, and lysate after the culturing step.

[0132] The above method may additionally include a step of lysing the strain prior to or concurrently with the recovery step. Lysis of the strain may be performed using methods commonly used in the technical field to which the present application pertains, such as a lysis buffer solution, a sonicator, heat treatment, and a French press. In addition, the lysis step may include, but is not limited to, an enzymatic reaction such as a cell wall-degrading enzyme, a nuclease, a nucleic acid transferase, or a protease.

[0133] For the purpose of the present application, the above glutathione manufacturing method can be used to manufacture dry yeast, yeast extract, yeast extract mix powder, and pure glutathione containing a high content of glutathione, but is not limited thereto, and can be manufactured appropriately depending on the intended product.

[0134] In this application, the term "dry yeast" may be used interchangeably with terms such as "strain dried product." The dry yeast may be produced by drying yeast cells that have accumulated glutathione, and may be specifically included in feed compositions, food compositions, etc., but is not limited thereto.

[0135] In this application, the term "yeast extract" may be used interchangeably with terms such as "strain extract." The strain extract may refer to the remaining material after separating the cell wall from the cells of the strain. Specifically, it may refer to the remaining component obtained by lysing the cells, excluding the cell wall. The strain extract includes glutathione, and other components may include, but are not limited to, one or more of proteins, carbohydrates, nucleic acids, and fibers.

[0136] The above recovery step can recover the target substance, glutathione, using a suitable method known in the art.

[0137] The above recovery step may include a purification process. The purification process may separate and purify only glutathione from the strain. Through the purification process, pure glutathione can be produced.

[0138] If necessary, the glutathione production method may further include a step of mixing a material selected from the strain obtained after the culturing step, its dried product, extract, culture, lysate, and glutathione recovered therefrom with an excipient. Through the mixing step, a yeast extract mix powder may be produced.

[0139] The above excipients can be appropriately selected and used depending on the intended use or form, and for example, can be selected from starch, glucose, cellulose, lactose, glycogen, D-mannitol, sorbitol, lactitol, maltodextrin, calcium carbonate, synthetic aluminum silicate, calcium hydrogen phosphate, calcium sulfate, sodium chloride, sodium bicarbonate, purified lanolin, dextrin, sodium alginate, methylcellulose, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methylcellulose, propylene glycol, casein, calcium lactate, Primogel, and gum Arabic, and specifically, can be one or more ingredients selected from starch, glucose, cellulose, lactose, dextrin, glycogen, D-mannitol, and maltodextrin, but are not limited thereto.

[0140] The above excipients may include, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents, for example.

[0141] Another aspect of the present application provides a use of the variant of the present application for producing glutathione.

[0142] One aspect of the present application provides a use of a microorganism comprising a mutant glutamate-cysteine ​​ligase mutant of the present application for producing glutathione.

[0143] The above mutants, polynucleotides, and microorganisms are as described above.

[0144]

[0145] Hereinafter, this application will be described in more detail through examples and experimental examples. However, these examples and experimental examples are intended to exemplify this application and the scope of this application is not limited to these examples and experimental examples.

[0146]

[0147] Example 1: Selection and improvement of glutathione-producing strains

[0148] Example 1-1: Selection of glutathione-producing strains

[0149] Strains were obtained from yeast containing various strains, improved, and strains with glutathione production ability were selected.

[0150] Specifically, grain samples such as rice, barley, mung beans, and oats were collected from 20 regions including Yongin, Icheon, Pyeongtaek, and Hwaseong in Gyeonggi Province, South Korea, ground, kneaded, wrapped in cloth, pressed firmly to shape, wrapped in straw, fermented for 10 days, and then slowly dried to produce nuruk.

[0151] To isolate various strains from the manufactured nuruk, the following experiment was performed. 45 ml of saline water was added to 5 g of nuruk and ground in a mixer. To isolate the pure yeast strain, serial dilution was performed and spread on YPD agar (yeast extract 10 g / L, bacto peptone 20 g / L, glucose 20 g / L, based on 1 liter of distilled water) and cultured at 30°C for 48 hours. Then, yeast colonies were streaked on YPD agar through colony morphology and microscopic examination. 25 ml of YPD broth was dispensed into a 250 ml Erlenmeyer flask, and the pure isolated strain was inoculated. The strain was screened by shaking (30°C, 200 rpm) for 48 hours to confirm glutathione production.

[0152] To improve the strains initially isolated, random mutations were induced in the isolated strains. Specifically, among the yeast isolated from the above-mentioned nuruk, a strain confirmed to produce glutathione was isolated and named the CJ-37 strain. The CJ-37 strain was cultured on solid media, then inoculated into broth to obtain a culture solution, and the cells were irradiated with UV light using a UV lamp. Afterwards, the UV-irradiated culture solution was spread on a plate medium, and only the mutant strains that formed colonies were isolated and obtained, and their glutathione production was confirmed.

[0153] As a result, the strain showing the best glutathione production among the mutant strains was selected as a glutathione-producing strain and named CJ-5 strain. It was deposited with the Korean Culture Center of Microorganisms (KCCM), an international depository under the Budapest Treaty, on July 31, 2019, and assigned the deposit number KCCM12568P.

[0154] Example 1-2: Additional improvement experiments to increase glutathione production

[0155] To further improve the glutathione production capacity of the CJ-5 strain, mutations were induced as follows.

[0156] The CJ-5 strain was cultured on solid media, inoculated into broth, and the culture solution was irradiated to the cells using a UV lamp. The UV-irradiated culture solution was then spread on a plate medium, and only the mutant strains that formed colonies were isolated and obtained. The strain with the greatest improvement in glutathione production was isolated and named CC02-2490 strain and deposited with the Korean Culture Center of Microorganisms (KCCM), an international depository under the Budapest Treaty, on January 17, 2020, and assigned the accession number KCCM12659P.

[0157] As a result of analyzing the base sequence of the glutathione biosynthesis gene gsh1 in relation to the increase in glutathione production capacity of the above CC02-2490 strain, it was confirmed that cysteine, the 86th amino acid of the GSH1 protein (SEQ ID NO: 1) encoded by the gsh1 gene, was substituted with arginine.

[0158] Example 1-3: Additional improvement experiments to increase glutathione production.

[0159] To further improve the glutathione production capacity of the CC02-2490 strain, mutations were induced as follows.

[0160] The CC02-2490 strain was cultured on solid medium, then inoculated into broth to obtain a culture solution, and the cells were irradiated with UV light using a UV lamp. Afterwards, the UV-irradiated culture solution was spread on a plate medium, and only the mutant strains that formed colonies were isolated and obtained. The strain with the greatest improvement in glutathione production was isolated and named CC02-2544 strain, and deposited with the Korean CultureCenter of Microorganisms (KCCM), an international depository under the Budapest Treaty, on February 20, 2020, and assigned the accession number KCCM12674P.

[0161] As a result of analyzing the base sequence of the glutathione biosynthetic gene gsh1 in relation to the increase in glutathione production ability of the above CC02-2544 strain, it was confirmed that mutations occurred at positions -250 (C→T), -252 (G→A), -398 (A→T), -399 (A→C), -407 (T→C), and -409 (T→C) at the top of the GSH1 ORF (SEQ ID NO: 12).

[0162]

[0163] Example 2: Further improvement experiment of strain CC02-2544 to increase glutathione production.

[0164] To further improve the glutathione production capacity of strain CC02-2544, mutations were induced as follows.

[0165] The CC02-2544 strain was cultured on solid media, inoculated into broth, and the culture solution was irradiated to the cells using a UV lamp. The UV-irradiated culture solution was then spread on a plate medium, and only mutant strains that formed colonies were isolated and obtained, and their base sequences were analyzed.

[0166] Experimental results confirmed that the 653rd amino acid (glycine) of GSH1, a protein encoded by the glutathione biosynthetic gene gsh1, was substituted with methionine in the strain with a 27% enhanced glutathione content. This strain was designated CC02-2816 and deposited with the Korea Microbiological Conservation Center, a depository institution under the Budapest Treaty, on December 8, 2020, and assigned accession number KCCM12891P.

[0167]

[0168] Example 3: GSH1 G653 residue mutation experiment

[0169] From the results of Example 2 above, it was determined that position 653 of the GSH1 protein would be important for glutathione production, and thus mutant strains of Saccharomyces cerevisiae CEN.PK2-1D and CC02-2544 strains were constructed to express mutant proteins in which the 653rd amino acid of the GSH1 protein was substituted with a different amino acid, and the aim was to confirm whether glutathione production increased. Meanwhile, as mentioned above, the CC02-2544 strain is a strain in which the GSH1 C86R mutant has mutations at positions -250 (C→T), -252 (G→A), -398 (A→T), -399 (A→C), -407 (T→C), and -409 (T→C) at the top of the GSH1 ORF, and a mutation at the 653rd amino acid of the GSH1 protein was additionally introduced into the strain.

[0170] To construct a strain in which amino acid 653 of the GSH1 protein of Saccharomyces cerevisiae was substituted with methionine, the pWAL100 and pWBR100 plasmids were used with reference to the paper by Lee TH, et al. (J. Microbiol. Biotechnol. (2006), 16(6), 979-982). Specifically, PCR was performed as follows using the genomic DNA of the CJ-5 strain as a template. By performing PCR using primers of SEQ ID NO: 4 and SEQ ID NO: 5, a partial sequence of the N-terminal GSH1 including the N-terminal BamHI flanking sequence, the start codon of the GSH1 ORF, and the G653M mutant coding sequence was secured, and by using primers of SEQ ID NO: 6 and SEQ ID NO: 7, a partial sequence of the C-terminal GSH1 including the C-terminal XhoI flanking sequence, the GSH1 ORF stop codon, and the G653M mutant coding sequence was secured. Afterwards, using these two sequences as templates and performing overlap PCR using SEQ ID NO: 4 and SEQ ID NO: 7, a GSH1 ORF fragment including the coding sequence of the GSH1 mutant protein in which the 653rd amino acid is substituted with methionine, the N-terminal BamHI, and the C-terminal XhoI restriction enzyme sequences were secured. The above ORF fragment was cloned into the pWAL100 vector treated with the same enzymes after BamHI and XhoI treatment, thereby producing the pWAL100-GSH1 (G653M) vector.

[0171] In addition, PCR was performed using the genomic DNA of the CJ-5 strain as a template using sequence numbers 8 and 9 to obtain a 500-bp fragment after the GSH1 ORF stop codon containing the N-terminal SpeI and C-terminal NcoI restriction enzyme sequences, and the fragment was treated with SpeI and NcoI restriction enzymes. Afterwards, the fragment was cloned into pWBR100 treated with the same restriction enzymes to produce the pWBR100-GSH1 vector.

[0172] Finally, to produce a DNA fragment to be introduced into yeast, a PCR product containing a methionine mutation coding sequence and a part of KlURA3 was obtained using the primers of SEQ ID NO: 4 and SEQ ID NO: 10 using the previously produced pWAL100-GSH1 (G653M) vector as a template, and a PCR product containing a part of KlURA3 and 500 bp after the GSH1 stop codon was obtained using the primers of SEQ ID NO: 11 and SEQ ID NO: 9 using the pWBR100-GSH1 vector as a template. Then, each PCR product was transformed into S. cerevisiae CEN.PK2-1D and S. cerevisiae CC02-2544 at the same molar ratio. PCR was performed at 95°C for 5 minutes of heat denaturation, 53°C for 1 minute of binding, and 72°C for 1 minute per 1 kb of polymerization. Yeast transformation was performed using the lithium acetate method modified from Geitz's paper (Nucleic Acid Research, 20(6), 1425). Specifically, yeast cells with an OD of 0.7 to 1.2 were washed twice with lithium acetate / TE buffer, and the PCR products and single-stranded DNA (Sigma D-7656) were mixed and cultured in lithium acetate / TE / 40% PEG buffer at 30°C for 30 minutes and at 42°C for 15 minutes. After culturing the cells on SC (2% glucose) agar plates without uracil until colonies were visible, a strain into which the GSH1 G653M mutant coding sequence and the KlURA3 gene were introduced was obtained. Afterwards, to remove KlURA3, each strain was cultured overnight in 2 ml of YPD, diluted 1 / 100, and spread on SC (2% glucose) agar plates containing 0.1% 5-FOA to obtain S. cerevisiae CEN.PK2-1D GSH1 G653M mutant strains with the uracil marker removed and S.A GSH1 G653M mutant strain of B. cerevisiae CC02-2544 was constructed. A strain capable of expressing a GSH1 mutant protein substituted with an amino acid other than methionine was constructed in the same manner, except that a primer pair was used in which the methionine coding sequence at position 653 in the primer sequences of SEQ ID NOs. 5 and 6 was substituted with a sequence encoding a different amino acid.

[0173] Primer 5' -> 3' sequence F_BamHI_GSH1 (SEQ ID NO: 4) GGTAGGATCCATGGGACTCTTAGCTTTGGGCACR_GSH1_G653M (SEQ ID NO: 5) GTCAATTCCATTTTTGAATCGTCCAF_GSH1_G653M (SEQ ID NO: 6) ATTCAAAATGGAATTGACATCCTTR_XhoI_GSH1 (SEQ ID NO: 7) ATGACTCGAGTTAACATTTGCTTTCTATTGAAGGCF_SpeI_GSH1_DW (SEQ ID NO: 8) TAGAACTAGTACTCCTTTTATTTCGGTTGTGAAR_NcoI_GSH1_DW (SEQ ID NO: 9) GCTGCCATGGGAATAGTGTGAACCGATAACTGTGTR_AL killer (SEQ ID NO: 10) GAGCAATGAACCCAATAACGAAATCTTF_BR killer (SEQ ID NO: 11)CTTGACGTTCGTTCGACTGATGAG

[0174] The results of measuring the concentration and content of glutathione (GSH) produced by culturing each strain produced above for 26 hours are shown in Tables 2 and 3. As a result of additionally introducing the GSH1 G653M mutation (SEQ ID NO: 13) into the CC02-2544 strain, the GSH concentration increased by 77 mg / L from 471.5 mg / L to 548.5 mg / L, and as a result of introducing the GSH1 G653M mutation (SEQ ID NO: 3) into the CEN.PK-1D strain, the GSH concentration increased by 58 mg / L from 42 mg / L to 100 mg / L.

[0175]

[0176] Example 3-1: Introduction of GSH1 G653 mutation into CC02-2544 strain

[0177] S. cerevisiae CC02-2544 GSH concentration (mg / L)GSH content (%)Ratio to control GSH concentration (fold)Ratio to control GSH content (fold)WT (wild type)471.53.21.001.00GSH1 G653M548.53.81.161.19GSH1 G653N507.03.31.081.03GSH1 G653C440.53.20.931.00GSH1 G653A454.63.20.961.00GSH1 G653L471.53.21.001.00GSH1 G653T445.53.00.940.94GSH1 G653H443.73.00.940.93GSH1 G653P391.32.90.830.90GSH1 G653V346.52.40.730.75

[0178] Example 3-2: Introduction of GSH1 G653 mutation into CEN.PK-1D strain

[0179] S. cerevisiae CEN.PK2-1D GSH concentration (mg / L)GSH content (%)Ratio to control GSH concentration (fold)Ratio to control GSH (fold)WT (wild type)42.00.41.001.00GSH1 G653M100.00.92.382.37GSH1 G653L53.00.51.261.27GSH1 G653A40.00.40.951.02GSH1 G653C42.00.41.001.02GSH1 G653N45.00.41.071.02GSH1 G653H39.00.40.950.96GSH1 G653T37.00.40.890.94GSH1 G653V36.00.30.860.87GSH1 G653P18.00.20.430.51

[0180] It can be seen that the GSH1 variant with glycine at position 653 of the GSH1 protein substituted with methionine significantly increases the glutathione production capacity.

[0181] Through this, it can be confirmed that the novel GSH1 variant developed in this application shows an increase in glutathione production. In addition, yeast that produces high amounts of glutathione, including the GSH1 variant of this application, its dried product, extract, culture, lysate, and produced glutathione, have antioxidant effects, detoxification effects, and immune-enhancing effects, and can be usefully used in cosmetic compositions, food compositions, feed compositions, pharmaceutical compositions, and the manufacture thereof.

[0182]

[0183] Reference example: C86 residue substitution experiment in GSH1 protein

[0184] Mutant strains of Saccharomyces cerevisiae CEN.PK2-1D and Saccharomyces cerevisiae CJ-5 strains were constructed to express mutant proteins in which the 86th cysteine ​​amino acid of the GSH1 protein was substituted with another amino acid, and it was attempted to determine whether glutathione production increased.

[0185] To construct a strain in which cysteine ​​at position 86 of the GSH1 protein of Saccharomyces cerevisiae was substituted with arginine, the pWAL100 and pWBR100 plasmids were used with reference to the paper by Lee TH, et al. (J. Microbiol. Biotechnol. (2006), 16(6), 979-982). Specifically, PCR was performed as follows using the genomic DNA of the CJ-5 strain as a template. By performing PCR using primers of SEQ ID NO: 4 and SEQ ID NO: 14, a partial sequence of the GSH1 N-terminal including the N-terminal BamHI flanking sequence, the start codon of the GSH1 ORF, and the C86R mutant coding sequence was secured, and by using primers of SEQ ID NO: 15 and SEQ ID NO: 7, a partial sequence of the GSH1 C-terminal including the C-terminal XhoI flanking sequence, the GSH1 ORF stop codon, and the C86R mutant coding sequence was secured. Afterwards, using these two sequences as templates and performing overlap PCR using SEQ ID NO: 4 and SEQ ID NO: 7, a GSH1 ORF fragment including the coding sequence of the GSH1 mutant protein in which the 86th cysteine ​​is substituted with arginine, the N-terminal BamHI, and the C-terminal XhoI restriction enzyme sequences were secured. The above ORF fragment was cloned into the pWAL100 vector treated with the same enzymes after BamHI and XhoI treatment, thereby producing the pWAL100-GSH1(C86R) vector.

[0186] In addition, PCR was performed using the genomic DNA of the CJ-5 strain as a template and the primers of SEQ ID NO: 8 and SEQ ID NO: 9 to secure 500 bp after the GSH1 ORF stop codon, including the N-terminal SpeI and C-terminal NcoI restriction enzyme sequences, and treated with SpeI and NcoI restriction enzymes. Afterwards, the vector pWBR100-GSH1 was constructed by cloning it into pWBR100 treated with the same restriction enzymes.

[0187] Finally, to produce a DNA fragment to be introduced into yeast, a PCR product containing the arginine mutation coding sequence and part of KlURA3 was obtained using the primers of SEQ ID NO: 4 and SEQ ID NO: 10 using the previously produced pWAL100-GSH1 (C86R) vector as a template, and a PCR product containing part of KlURA3 and 500 bp after the GSH1 stop codon was obtained using the primers of SEQ ID NO: 11 and SEQ ID NO: 9 using the pWBR100-GSH1 vector as a template. Then, each PCR product was transformed into S. cerevisiae CEN.PK2-1D and S. cerevisiae CJ-5 at the same molar ratio. PCR was performed at 95℃ for 5 minutes of heat denaturation, 53℃ for 1 minute of binding, and 72℃ for 1 minute per 1 kb of polymerization. Yeast transformation was performed using the lithium acetate method modified from Geitz's paper (Nucleic Acid Research, 20(6), 1425). Specifically, yeast cells with an OD of 0.7 to 1.2 were washed twice with lithium acetate / TE buffer, and the PCR products and single-stranded DNA (Sigma D-7656) were mixed and cultured in lithium acetate / TE / 40% PEG buffer at 30℃ for 30 minutes and at 42℃ for 15 minutes. After culturing the cells on SC (2% glucose) agar plates without uracil until colonies were visible, a strain into which the GSH1 C86R mutant coding sequence and the KlURA3 gene were introduced was obtained. Afterwards, to remove KlURA3, each strain was cultured overnight in 2 ml of YPD, diluted 1 / 100, and spread on SC (2% glucose) agar plates containing 0.1% 5-FOA to obtain S. cerevisiae CEN.PK2-1D GSH1 C86R mutant strain with the uracil marker removed and S.A cerevisiae CJ-5 GSH1 C86R mutant strain was constructed. A strain capable of expressing a GSH1 mutant protein substituted with an amino acid other than arginine was constructed in the same manner, except that a primer pair was used in which the arginine coding sequence at position 86 in the primer sequences of SEQ ID NOs. 14 and 15 was substituted with a sequence encoding a different amino acid.

[0188]

[0189] Primer 5'→3' sequence F_BamHI_GSH1 (SEQ ID NO: 4) GGTAGGATCCATGGGACTCTTAGCTTTGGGCACR_GSH1_C86R (SEQ ID NO: 14) TTAGCCTCCCTAAGGGACGAATCCTF_GSH1_C86R (SEQ ID NO: 15) CGTCCCTTAGGGAGGCTAACGATGTR_XhoI_GSH1 (SEQ ID NO: 7) ATGACTCGAGTTAACATTTGCTTTCTATTGAAGGCF_SpeI_GSH1_DW (SEQ ID NO: 8) TAGAACTAGTACTCCTTTTATTTCGGTTGTGAAR_NcoI_GSH1_DW (SEQ ID NO: 9) GCTGCCATGGGAATAGTGTGAACCGATAACTGTGTR_AL killer (SEQ ID NO: 10) GAGCAATGAACCCAATAACGAAATCTTF_BR killer (SEQ ID NO: 11)CTTGACGTTCGTTCGACTGATGAG

[0190] The results of measuring the concentration of glutathione (GSH) produced by culturing each strain produced above for 26 hours are shown in Tables 5 and 6.

[0191]

[0192]

[0193]

[0194]

[0195]

[0196] Experimental results showed that replacing cysteine ​​at position 86 of the GSH1 protein with another amino acid increased glutathione production compared to the case where the wild-type GSH1 protein was included.

[0197] This shows that a GSH1 mutant in which cysteine ​​at position 86 of the GSH1 protein is replaced with another amino acid significantly increases glutathione production capacity.

[0198]

[0199] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

[0200]

[0201]

[0202]

[0203]

Claims

1. A glutamate-cysteine ​​ligase mutant in which the amino acid corresponding to position 653 from the N-terminus of the amino acid sequence of sequence number 1 is substituted with methionine.

2. A glutamate-cysteine ​​ligase variant, wherein the amino acid corresponding to position 653 in paragraph 1 is glycine.

3. A glutamate-cysteine ​​ligase variant according to claim 1, wherein the variant has a sequence homology of 80% or more and less than 100% with the amino acid sequence of sequence number 1.

4. A glutamate-cysteine ​​ligase mutant according to claim 1, wherein the mutant is composed of an amino acid sequence of sequence number 3.

5. In the first paragraph, the mutant is a glutamate-cysteine ​​ligase mutant in which the amino acid corresponding to position 86 is further substituted with a different amino acid.

6. In the fifth paragraph, the mutant is a glutamate-cysteine ​​ligase mutant consisting of an amino acid sequence of sequence number 13.

7. A polynucleotide encoding a glutamate-cysteine ​​ligase variant of any one of claims 1 to 6.

8. A vector comprising the polynucleotide of clause 7.

9. A microorganism producing glutathione, comprising at least one of a glutamate-cysteine ​​ligase variant of any one of claims 1 to 6; a polynucleotide encoding the variant; and a vector comprising the polynucleotide.

10. In paragraph 9, the microorganism is a microorganism of the genus Saccharomyces, a microorganism producing glutathione.

11. In paragraph 9, the microorganism is a microorganism producing glutathione, which is Saccharomyces cerevisiae.

12. A method for producing glutathione, comprising the step of culturing a microorganism comprising at least one of a glutamate-cysteine ​​ligase variant of any one of claims 1 to 6; a polynucleotide encoding the variant; and a vector comprising the polynucleotide in a medium.

13. A method for producing glutathione in claim 12, wherein the method further comprises a step of recovering glutathione from at least one material selected from the cultured microorganism, a dried product of the microorganism, an extract of the microorganism, a culture of the microorganism, and a fragment of the microorganism.