Novel transcriptional regulator variant and method for producing l-valine using same

Abstract

The present application relates to a novel transcriptional regulator variant, a corynebacterium glutamicum strain comprising the variant, and a method for producing L-valine using the strain.

Description

Novel transcription regulator variant and method for producing L-valine using the same

[0001] The present application relates to a novel transcription regulator mutant, a Corynebacterium glutamicum strain comprising the mutant, and a method for producing L-valine using the strain.

[0002]

[0003] To produce L-amino acids and other useful substances, various studies are being conducted to develop high-efficiency production microorganisms and fermentation process technologies. For example, target-substance-specific approaches, such as increasing the expression of genes encoding enzymes involved in L-valine biosynthesis or deleting genes unnecessary for biosynthesis, are primarily being utilized (US 8,465,962 B2).

[0004] As demand for L-valine increases, research is needed to increase the effective production of L-valine.

[0005]

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] US 8465962 B2 (published on June 18, 2013)

[0009] [Non-patent literature]

[0010] JOURNAL OF BACTERIOLOGY, Oct. 2011, p. 5155-5163 (published on July 22, 2011)

[0011]

[0012] One object of the present application is to provide a transcriptional regulator mutant comprising an amino acid sequence represented by SEQ ID NO: 1, in which glutamic acid (Glu, E), an amino acid corresponding to position 247 of the amino acid sequence of SEQ ID NO: 3, is substituted with lysine (Lys, K).

[0013] Another object of the present application is to provide a polynucleotide encoding a variant of the present application.

[0014] Another object of the present application is to provide a Corynebacterium glutamicum strain comprising a variant of the present application or a polynucleotide encoding the variant, and having L-valine production ability.

[0015] Another object of the present application is to provide a method for producing L-valine, comprising the step of culturing a Corynebacterium glutamicum strain having L-valine production ability, comprising a variant or a polynucleotide encoding the variant, in a medium.

[0016]

[0017] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly explain the level of the technical field to which the present invention pertains and the contents of the present invention.

[0018]

[0019] One aspect of the present application provides a transcription regulator variant comprising an amino acid sequence represented by SEQ ID NO: 1, wherein glutamic acid (Glu, E), an amino acid corresponding to position 247 of the amino acid sequence of SEQ ID NO: 3, is substituted with lysine (Lys, K).

[0020] The variant of the present application may have or comprise the amino acid sequence set forth in SEQ ID NO: 1, or may consist essentially of said amino acid sequence.

[0021] In addition, the variant of the present application may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% homology or identity with the amino acid sequence of SEQ ID NO: 1, wherein the amino acid corresponding to position 247 based on the amino acid sequence of SEQ ID NO: 3 in the amino acid sequence described in SEQ ID NO: 1 is lysine. In addition, it is obvious that a variant having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the variant of the present application.

[0022] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the variant of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.

[0023] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0024] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term “variant” may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto as long as the term is used in the meaning of mutation. For the purpose of the present application, the variant may be a polypeptide including the amino acid sequence described in SEQ ID NO: 1, in which glutamic acid (Glu, E), an amino acid corresponding to position 247 of the amino acid sequence of SEQ ID NO: 3, is substituted with lysine (Lys, K).

[0025] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0026]

[0027] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0028] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0029] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0030] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0031] As an example of the present application, the variant of the present application may have transcriptional regulator activity. Furthermore, the variant may have activity that increases L-valine production compared to the wild-type polypeptide.

[0032] In this application, the term "transcriptional regulator iolR" refers to a transcriptional regulator involved in myo-inositol utilization. In this application, the transcriptional regulator may be used interchangeably with iolR, and its sequence can be obtained from the NCBI GenBank database (e.g., WP_003857140.1). Specifically, it may be a polypeptide having transcriptional regulator activity encoded by the iolR gene, but is not limited thereto.

[0033] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0034] For example, any amino acid sequence can be aligned with SEQ ID NO: 3, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 3. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0035] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0036] Another aspect of the present application provides a polynucleotide encoding a variant of the present application.

[0037] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.

[0038] A polynucleotide encoding a variant of the present application may comprise a base sequence encoding an amino acid sequence set forth in SEQ ID NO: 1. As an example of the present application, the polynucleotide of the present application may have or comprise the sequence of SEQ ID NO: 2. Furthermore, the polynucleotide of the present application may consist of, or consist essentially of, the sequence of SEQ ID NO: 2.

[0039] In another example, the polynucleotide of the present application may include a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleic acid sequence of SEQ ID NO: 2, wherein the base corresponding to position 739 based on the nucleic acid sequence of SEQ ID NO: 4 in the nucleic acid sequence described in SEQ ID NO: 2 is A. In addition, it is obvious that a polynucleotide having a nucleic acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application, as long as it is a sequence encoding a polypeptide or protein having such homology or identity and exhibiting an effect corresponding to the variant of the present application.

[0040] The polynucleotide of the present application may have various modifications made to the coding region within a range that does not change the amino acid sequence of the variant of the present application, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present application. Specifically, the polynucleotide of the present application has or includes a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 2, or may consist of or consist essentially of a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 2, but is not limited thereto. At this time, in the sequence having the homology or identity, the codon encoding the amino acid corresponding to the 247th position of SEQ ID NO: 1 may be one of the codons encoding lysine.

[0041] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term “stringent conditions” refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, and more specifically 68°C, 0.1×SSC, 0.1% SDS, which are washing conditions of typical southern hybridization, are performed.

[0042] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0043] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0044] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0045]

[0046] Another aspect of the present application provides a vector comprising the polynucleotide of the present application. The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a host cell.

[0047] The present application vector may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.

[0048] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0049] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0050] The term "transformation" in this application refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0051] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present application.

[0052]

[0053] Another aspect of the present application provides a strain of Corynebacterium glutamicum comprising a variant of the present application or a polynucleotide of the present application.

[0054] The strain of the present application may comprise a variant polypeptide of the present application, a polynucleotide encoding the polypeptide, or a vector comprising the polynucleotide of the present application.

[0055] In this application, the term "strain (or microorganism)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product, as a microorganism whose specific mechanism has been weakened or strengthened due to causes such as the insertion of an external gene or the enhancement or inactivation of the activity of an endogenous gene.

[0056] The strain of the present application may be, but is not limited to, a strain comprising at least one of the variant of the present application, the polynucleotide of the present application, and a vector comprising the polynucleotide of the present application; a strain modified to express the variant of the present application or the polynucleotide of the present application; a strain (e.g., a recombinant strain) expressing the variant of the present application or the polynucleotide of the present application; or a strain (e.g., a recombinant strain) having the activity of the variant of the present application.

[0057] The strain of the present application may be a strain having L-valine production ability.

[0058] The strain of the present application may be, but is not limited to, a microorganism that naturally has transcription regulator activity and / or L-valine production ability, or a parent strain that does not have transcription regulator activity or L-valine production ability, into which a variant of the present application or a polynucleotide encoding the same (or a vector including the polynucleotide) is introduced and / or L-valine production ability is conferred.

[0059] For example, the strain of the present application is a cell or microorganism that is transformed with a vector including a polynucleotide encoding the polynucleotide of the present application or a variant of the present application, and expresses the variant of the present application. For the purpose of the present application, the strain of the present application may include all microorganisms capable of producing L-valine, including the variant of the present application. For example, the strain of the present application may be a recombinant strain in which a polynucleotide encoding the variant of the present application is introduced into a natural wild-type microorganism or a microorganism that produces L-valine, thereby expressing a transcription regulator variant and thereby increasing L-valine production ability. The recombinant strain in which L-amino acid production ability is increased may be a microorganism in which L-valine production ability is increased compared to a natural wild-type microorganism or a microorganism in which the transcription regulator is not modified (i.e., a microorganism expressing a wild-type (SEQ ID NO: 3) protein or a microorganism that does not express a variant (SEQ ID NO: 1) protein), but is not limited thereto. For example, the target strain for comparing the increase in L-valine production ability, a transcription regulator-free microorganism, may be, but is not limited to, ATCC14067 strain and / or Corynebacterium glutamicum CA08-0072 strain (KCCM11201P).

[0060] For example, the recombinant strain with increased productivity has an L-valine productivity of about 1% or more, about 2.5% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 10.5% or more, about 11% or more, about 11.5% or more, about 12% or more, about 12.5% ​​or more, about 13% or more, about 13.5% or more, about 14% or more, about 14.5% or more, about 15% or more, about 15.5% or more, about 16% or more, about 16.5% or more, about 17% or more, about 17.5% or more, about 18% or more, about 18.5% or more, about 19% or more, about 19.5% or more, or about 20%, compared to the parent strain before mutation or the unmodified microorganism. The production capacity may be increased by about 20.5% or more, about 21% or more, about 21.5% or more, about 22% or more, about 22.1% or more, or about 22.2% or more (the upper limit is not particularly limited, and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, or about 33% or less), but is not limited thereto, as long as it has a positive increase compared to the production capacity of the parent strain before mutation or the unmodified microorganism. In another example, the recombinant strain with increased productivity may have an L-valine productivity increased by about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, about 1.15 times or more, about 1.16 times or more, about 1.17 times or more, about 1.18 times or more, about 1.19 times or more, about 1.2 times or more, about 1.21 times or more, or about 1.22 times or more (the upper limit is not particularly limited and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less) compared to the parent strain before mutation or the unmodified microorganism.

[0061] More specifically, the recombinant strain with increased productivity may have an L-valine productivity increased by about 22.2% (or about 1.22 times) compared to the parent strain or the unmodified microorganism before mutation, but is not limited thereto. The term “about” includes, but is not limited to, a range including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all values ​​in a range equal to or similar to the value following the term “about.”

[0062] In this application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain that has not been introduced or before the protein variant described herein is introduced. The "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0063] In another example of the present application, the microorganism of the present application is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens.

[0064]

[0065] In this application, the term "attenuation" of a polypeptide encompasses both a decrease in activity or the absence of activity compared to the intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0066] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” The term “inactivation, deficiency, reduction, downregulation, deterioration, attenuation” of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had before the transformation.

[0067] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0068]

[0069] Specifically, the weakening of the polypeptide of the present application is

[0070] 1) Deletion of all or part of a gene encoding a polypeptide;

[0071] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;

[0072] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;

[0073] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);

[0074] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0075] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;

[0076] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;

[0077] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or

[0078] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.

[0079] for example,

[0080] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.

[0081] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0082] In addition, the above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0083] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of a gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.

[0084] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0085] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.

[0086] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0087] In this application, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0088] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0089] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0090] Specifically, the enhancement of the polypeptide of the present application is

[0091] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0092] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;

[0093] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0094] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0095] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0096] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0097] 7) Codon optimization of a polynucleotide encoding a polypeptide;

[0098] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0099] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.

[0100] More specifically,

[0101] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0102] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0103] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0104] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0105] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not the chromosome has been inserted. The selection marker is as described above.

[0106] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0107] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0108] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0109] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0110]

[0111] In the microorganism of the present application, modification of part or all of the polynucleotide (e.g., modification to encode the protein variant described above) may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosomal integration into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector including a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0112]

[0113] In the microorganism of the present application, the mutant, polynucleotide, L-valine, etc. are as described in the other aspects above.

[0114]

[0115] Another aspect of the present application provides a method for producing L-amino acids, comprising the step of culturing a Corynebacterium glutamicum strain comprising a variant of the present application or a polynucleotide of the present application in a medium.

[0116] The method for producing L-amino acid of the present application may include a step of culturing a Corynebacterium glutamicum strain comprising a variant of the present application, a polynucleotide of the present application, or a vector of the present application in a medium.

[0117] Additionally, the L-amino acid of the present application may be L-valine.

[0118] In this application, the term "cultivation" refers to growing the Corynebacterium glutamicum strain of this application under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. Such culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0119] In this application, the term "medium" means a material containing nutrients as a main component necessary for culturing the Corynebacterium glutamicum strain of this application, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the Corynebacterium glutamicum strain of this application may be any medium used for culturing general microorganisms without particular limitation, but the Corynebacterium glutamicum strain of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0120] Specifically, culture media for strains of the genus Corynebacterium can be found in the "Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981).

[0121] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0122] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0123] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0124] In addition, during the cultivation of the Corynebacterium glutamicum strain of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0125] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0126] L-amino acids produced by the culture of the present invention may be secreted into the medium or remain within the cells.

[0127]

[0128] The method for producing L-amino acid of the present application may additionally include a step of preparing a Corynebacterium glutamicum strain of the present application, a step of preparing a medium for culturing the strain, or a combination thereof (in any order), for example, prior to the culturing step.

[0129] The L-amino acid production method of the present application may further include a step of recovering L-amino acid from the culture medium (medium in which culture is performed) or the Corynebacterium glutamicum strain of the present application. The recovering step may be additionally included after the culturing step.

[0130] The above recovery may be performed by collecting the target L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target L-amino acid may be recovered from the medium or microorganism using a suitable method known in the art.

[0131] Additionally, the L-amino acid production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the L-amino acid production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0132] In the method of the present application, the variant, polynucleotide, vector, strain, etc. are as described in the other aspects above.

[0133]

[0134] Another aspect of the present application provides a composition for producing L-amino acids, comprising a variant of the present application, a polynucleotide encoding the variant, a vector comprising the polynucleotide, or a Corynebacterium glutamicum strain comprising the polynucleotide of the present application; a medium for culturing the same; or a combination of two or more thereof.

[0135] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing amino acids, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0136] In the composition of the present application, the variant, polynucleotide, vector, strain, medium, and L-amino acid, etc. are as described in the other aspects above.

[0137]

[0138] When culturing a Corynebacterium glutamicum strain containing the novel transcription regulator variant of the present application, high yield L-valine production is possible compared to microorganisms having conventional unmodified polypeptides.

[0139]

[0140] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0141]

[0142] Example 1: Construction of a vector for expression of transcription regulator variants in microorganisms.

[0143] To determine the effect of a mutant (E247K; SEQ ID NO: 1) in which glutamic acid (Glu, E) at position 247 of a protein consisting of an amino acid sequence of SEQ ID NO: 3 is substituted with lysine (Lys, K) on L-valine production, a vector for constructing an expression strain was constructed as follows using plasmid pDCM2 (Korean Publication No. 10-2020-0136813) for insertion and replacement of genes in the Corynebacterium chromosome.

[0144] Using the gDNA (genomic DNA) of wild-type Corynebacterium glutamicum ATCC14067 as a template, PCR was performed using primer pairs of sequences SEQ ID NOs: 5 and 6 and primer pairs of sequences SEQ ID NOs: 7 and 8, respectively. Overlapping PCR was performed again using a mixture of the two fragments obtained above as a template and primer pairs of sequences SEQ ID NOs: 5 and 8 to obtain fragments. PCR was performed at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute and 30 seconds, and then 72°C for 5 minutes. The pDCM2 vector was treated with smaI, and the PCR products obtained above were fusion cloned. Fusion cloning was performed using the In-Fusion® HD cloning kit (Clontech). The resulting plasmid was named pDCM2-iolR (E247K). The sequences of the primers used in this example are listed in Table 1 below.

[0145] Name Sequence (5'->3') Sequence number iolR_1FTGAATTCGAGCTCGGTACCCCCAAGAAGTCGTAGACAAAGSequence number 5iolR_2RGCCACCAGAGTGGTTTtAAAGTTGTACATATCTSequence number 6iolR_3FAGATATGTACAACTTTaAAACCACTCTGGTGGCSequence number 7iolR_4RGTCGACTCTAGAGGATCCCCTTGAGCTAAGTATCCTATGASequence number 8

[0146]

[0147] Example 2: Evaluation of L-valine production ability of microorganisms expressing transcription regulator variants

[0148] 2-1. Production of a strain expressing a transcription regulator mutant

[0149] The vector prepared in Example 1 above was transformed into Corynebacterium glutamicum CA08-0072 (KCCM11201P) (see US 8,465,962).

[0150] In the transformed strains, a strain in which homologous recombination occurred was selected using a primer pair of sequences 9 and 10, and was named CA08-0072_iolR_E247K. The sequences of the primers used in this example are listed in Table 2 below.

[0151] Name sequence (5'->3') Sequence number iolR_5FCCAAGAAGTCGTAGACAAAG Sequence number 9 iolR_6RTTGAGCTAAGTATCCTATGA Sequence number 10

[0152]

[0153] 2-2. Comparison of L-valine production capacity of transcription regulator mutant expression strains

[0154] The L-valine production ability was analyzed through flask fermentation titer evaluation of each strain produced in Example 2-1 and the control parent strain.

[0155] First, each colony was subcultured on nutrient medium, and then each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of production medium, and cultured at 30°C for 72 hours with shaking at 200 rpm. Thereafter, the concentration of L-valine was analyzed using HPLC, and the analyzed concentrations of L-valine are shown in Table 3 below.

[0156] Nutrient medium (pH 7.2)

[0157] 10 g glucose, 5 g meat juice, 10 g polypeptone, 2.5 g sodium chloride, 5 g yeast extract, 20 g agar, 2 g urea (per 1 liter of distilled water)

[0158]

[0159] <Production medium (pH 7.0)>

[0160] Glucose 100 g, ammonium sulfate 40 g, soy protein 2.5 g, corn steep solids 5 g, urea 3 g, potassium phosphate dibasic 1 g, magnesium sulfate heptahydrate 0.5 g, biotin 100 μg, thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (per 1 liter of distilled water).

[0161]

[0162] The above experiment was repeated three times, and the average value of the analysis results is shown in Table 3 below.

[0163] Strain L-valine concentration (g / L) Increase rate of L-valine concentration (%) CA08-00721.8-CA08-0072_iolR_E247K2.222.2

[0164] As shown in Table 3, the CA08-0072_iolR_E247K strain showed increased L-valine production compared to the control group.

[0165]

[0166] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A transcription regulator mutant consisting of an amino acid sequence described in SEQ ID NO: 1, in which glutamic acid, an amino acid corresponding to position 247 of SEQ ID NO: 3, is substituted with lysine.

2. A polynucleotide encoding the variant of paragraph 1.

3. A Corynebacterium glutamicum strain comprising a variant of paragraph 1 or a polynucleotide encoding the variant.

4. In the third paragraph, the strain has increased L-valine production ability compared to Corynebacterium glutamicum comprising the polypeptide of sequence number 3 or a polynucleotide encoding the same.

5. A method for producing L-valine, comprising the step of culturing a Corynebacterium glutamicum strain comprising the variant of paragraph 1 or a polynucleotide encoding the variant in a medium.