Parthenogenetic haploid induction gene DMP and application thereof

Abstract

Provided are a parthenogenetic haploid induction gene DMP and an application thereof. The parthenogenetic haploid induction genes AtDMP8 and AtDMP9 are cloned from Arabidopsis thaliana. Experiments have shown that mutations of AtDMP8 and AtDMP9 can produce parthenogenetic haploid inducibility, to enable dicotyledonous crops to be induced to produce haploids via parthenogenetic means. The present invention was further verified in tomatoes, and it was also found in tomatoes that the mutation of SlDMP can produce parthenogenetic haploid inducibility. The invention lays an important foundation for broadening the application of haploid breeding technology on dicotyledonous plants and revealing the biological mechanism of parthenogenetic haploid production. Given the universality of the utilization of haploid breeding technology in the current breeding industry, the invention has very wide application space and market prospects. Figure 2

Description

A parthenogenetic haploid inducing gene DMP and its application Technical Field

[0001] This invention relates to the fields of agricultural biotechnology and crop genetics and breeding, primarily based on genome editing technology. Specifically, it relates to a method for preparing a plant maternal haploid inducing line and its application, particularly to the application of a DMP mutant of the parthenogenetic haploid inducing gene obtained using gene editing technology as a plant haploid inducing plant to produce maternal haploids. Background Technology

[0002] The selection of superior inbred lines is fundamental and crucial for utilizing heterosis and breeding superior hybrids in crops. However, traditional breeding methods require 7-8 generations to obtain relatively stable inbred lines, while haploid breeding technology only requires 2 generations (Weber DF, 2014), significantly shortening the breeding cycle. Currently, the generation of haploids in dicotyledonous crops mainly relies on anther culture, which is inefficient and highly dependent on the genotype of the material, making large-scale application difficult. Although introducing genetically modified centromere-specific histone 3 variants into Arabidopsis thaliana cenh3 mutants can induce haploid generation, this method produces a large number of euploids during the induction process (Ravi, M, et al, 2010).

[0003] Currently, gene editing technology is a mature and stable system, but its maximum potential cannot be fully realized due to the dependence of genetic transformation on materials and genotypes. While gene editing can be achieved by introducing gene editing vectors into easily transformable recipient materials and then hybridizing them with the target material (Li C et al., 2017), backcrossing is required for a long time to restore the background and cannot achieve 100% restoration. Combining haploid induction with gene editing technology has enabled the editing of haploid genes in target materials to obtain homozygous edited lines, greatly shortening and broadening the application scope of haploid and gene editing technologies (Kelliher, T et al., 2019; Wang, B et al., 2019; Hu, N et al., 2019). However, in dicotyledonous plants, the lack of bio-induced haploid production methods prevents its integration with gene editing technology.

[0004] Invention disclosure

[0005] The purpose of this invention is to provide a method for preparing plant haploid inducible lines.

[0006] The method for preparing plant haploid induction lines provided by this invention is as follows: A1) or A2):

[0007] A1) Silencing or inhibiting the expression and / or activity of the DMP gene in the plant genome or knocking out the DMP gene to obtain a plant haploid inducible line;

[0008] A2) Inhibit the activity of DMP protein in plants to obtain haploid inducible lines of plants;

[0009] The plant in question is a dicotyledonous plant;

[0010] The DMP protein is the protein shown in B1), B2), B3), or B4) below:

[0011] B1) The amino acid sequence of the protein is as shown in sequence 2, sequence 4, or sequence 6;

[0012] B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 2, 4 or 6;

[0013] B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6.

[0014] B4) Proteins that share 75% or more homology with the amino acid sequences shown in Sequence 2, Sequence 4, or Sequence 6 and have the same function;

[0015] The DMP protein has the following function: when the activity of the DMP protein in a dicotyledonous plant is inhibited, the dicotyledonous plant becomes a haploid inducible line. The inhibition of DMP protein activity is defined as either non-expression of the DMP protein or the absence of DMP protein activity.

[0016] In B2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0017] In B3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is the substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0018] In B4 above, the 75% or more homology can be 80%, 85%, 90% or 95% or more homology.

[0019] In the above method for preparing plant haploid inducible lines, the DMP gene is the gene shown in C1), C2), C3), or C4) below:

[0020] C1) cDNA or genomic DNA molecules as shown in sequence 1, 3, or 5;

[0021] cDNA or genomic DNA molecules that have 75% or more identity with the nucleotide sequence defined by C2) and C1);

[0022] C3) is a cDNA or genomic DNA molecule derived from dicotyledonous plants and having 75% or more identity with the nucleotide sequence defined by C1;

[0023] C4) cDNA or genomic DNA molecules that hybridize under strict conditions with nucleotide sequences defined by C1), C2), or C3);

[0024] The DMP gene has the following function: when the DMP gene in a dicotyledonous plant is silenced, suppressed, or knocked out, the dicotyledonous plant becomes a plant haploid induction line.

[0025] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of a protein constituting the amino acid sequence shown in Sequence 2, Sequence 4, or Sequence 6 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0026] In the above-mentioned method for preparing plant haploid inducible lines, the method of silencing or inhibiting the expression and / or activity of the DMP gene in the plant genome or knocking out the DMP gene is to reduce the expression level of the DMP gene in the plant genome or to cause deletion mutations, insertion mutations or base substitutions in the DMP gene in the plant genome.

[0027] Furthermore, when the dicotyledonous plant is Arabidopsis thaliana, the DMP gene is the AtDMP8 gene and / or the AtDMP9 gene; the DMP protein is the AtDMP8 protein and / or the AtDMP9 protein.

[0028] The method involves silencing or inhibiting the expression and / or activity of the AtDMP8 and / or AtDMP9 genes in the Arabidopsis genome, or knocking out the AtDMP8 and / or AtDMP9 genes, or inhibiting the AtDMP8 protein and / or the activity of the AtDMP8 protein, to obtain an Arabidopsis haploid inducible line.

[0029] When the dicotyledonous plant is tomato, the DMP gene is the SlDMP gene; the DMP protein is the SlDMP protein; the method is to silence or inhibit the SlDMP gene in the tomato genome, or knock out the SlDMP gene, or inhibit the activity of the SlDMP protein, to obtain a tomato haploid inducible line.

[0030] Furthermore, the silencing or inhibition of the expression and / or activity of the AtDMP8 and / or AtDMP9 genes in the Arabidopsis genome, or the knockout of the AtDMP8 and / or AtDMP9 genes, refers to reducing the expression level of the AtDMP8 and / or AtDMP9 genes in the Arabidopsis genome, or causing deletion mutations, insertion mutations, or base substitutions in the AtDMP8 and / or AtDMP9 genes in the Arabidopsis genome.

[0031] The silencing or inhibition of the expression and / or activity of the SlDMP gene in the tomato genome, or the knockout of the SlDMP gene, means reducing the expression level of the SlDMP gene in the tomato genome or causing deletion mutations, insertion mutations, or base substitutions in the SlDMP gene in the tomato genome.

[0032] The method for reducing the expression level of the DMP gene in the plant genome can be RNAi interference. The RNAi interference can be single-stranded RNA interference, such as miRNA, or double-stranded RNA interference, such as siRNA, dsRNA, shRNA, etc.

[0033] The methods used to induce deletion mutations, insertion mutations, or base substitutions in the DMP gene of the plant genome can be CRISPR / Cas9, TELLEN, T-DNA insertion, or EMS mutagenesis.

[0034] Furthermore, the method for inducing deletion mutations, insertion mutations, or base substitutions in the DMP gene of the plant genome is CRISPR / Cas9. The method for inducing deletion mutations, insertion mutations, or base substitutions in the DMP gene of the plant genome includes the following steps: introducing a CRISPR / Cas9 vector containing the target sequence into a plant to obtain a plant haploid inducible line.

[0035] In a specific embodiment of the present invention, when the dicotyledonous plant is Arabidopsis thaliana, the target sequence of the CRISPR / Cas9 is positions 98-117 of sequence 1, positions 290-309 of sequence 3, positions 368-387 of sequence 3, and positions 509-528 of sequence 1. The CRISPR / Cas9 vector containing the target sequence is a recombinant vector obtained by ligating the DNA molecule shown in sequence 7 (sgRNA expression element), the DNA molecule shown in sequence 9 (Cas9 expression element), and the DNA molecule shown in sequence 10 (fluorescent protein expression element) into the pICSL4723 vector using the golden gate method.

[0036] In a specific embodiment of the present invention, when the dicotyledonous plant is tomato, the target sequence of the CRISPR / Cas9 is positions 76-95 and 247-266 of sequence 5. The CRISPR / Cas9 vector containing the target sequence is a recombinant vector obtained by ligating the DNA molecule shown in sequence 8 (sgRNA expression element), the DNA molecule shown in sequence 11 (Cas9 expression element), the DNA molecule shown in sequence 10 (fluorescent protein expression element), and the DNA molecule shown in sequence 12 (NptII expression element) into the pICSL4723 vector using the golden gate method.

[0037] Another object of the present invention is to provide a method for preparing a plant haploid inducing line, which includes the step of self-pollinating the above-mentioned plant haploid inducing line.

[0038] The number of self-crosses is at least once, specifically once.

[0039] The method for preparing any of the above-mentioned plant haploid induction lines further includes a step of screening for DMP gene mutants. The DMP gene mutant is a plant in which the DMP gene has been mutated, and the DMP gene mutant is either a DMP gene heterozygous mutant or a DMP gene homozygous mutant.

[0040] In any of the above-mentioned methods for preparing plant haploid induction lines, the plant haploid induction line is specifically Arabidopsis thaliana mutant line T1-34, Arabidopsis thaliana mutant line T1-6, Arabidopsis thaliana mutant line T1-11, Arabidopsis thaliana mutant line T1-19, Arabidopsis thaliana mutant line T1-24, Arabidopsis thaliana mutant line T1-25, Arabidopsis thaliana mutant line T1-28, Arabidopsis thaliana mutant line T1-32, Arabidopsis thaliana mutant line T2-33, Arabidopsis thaliana mutant line T2-38, tomato mutant line sldmp-1, or tomato mutant line sldmp-2;

[0041] The only difference between the Arabidopsis mutant line T1-34 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion segment located at positions 115-512 of sequence 1, and the other chromosome has an insertion of a T base located between positions 114-115 of sequence 1.

[0042] The only difference between the Arabidopsis mutant line T1-6 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a segment is deleted on one chromosome, located at positions 115-512 of sequence 1, and a segment is deleted on the other chromosome, located at positions 113-114 of sequence 1. In addition, in the gene encoding the AtDMP9 protein, a segment is inserted on both chromosomes. The nucleotide sequence of the inserted segment is shown in sequence 13, and the insertion position is between positions 160-161 of sequence 3.

[0043] The only difference between the Arabidopsis mutant line T1-11 and the wild-type Arabidopsis Col-0 is that a single T base insertion occurred in the gene encoding the AtDMP8 protein, located between positions 114 and 115 of sequence 1. In the gene encoding the AtDMP9 protein, a T base insertion occurred on one chromosome, located between positions 160 and 161 of sequence 3, and a fragment insertion occurred on the other chromosome. The nucleotide sequence of the inserted fragment is shown in sequence 13, located between positions 160 and 161 of sequence 3.

[0044] The only genomic differences between the Arabidopsis mutant line T1-19 and the wild-type Arabidopsis Col-0 are as follows: in the gene encoding the AtDMP8 protein, one chromosome has a deletion of a single T base located at position 114 of sequence 1, and the other chromosome has a deletion segment located at positions 115-511 of sequence 1; and in the gene encoding the AtDMP9 protein, one chromosome has a deletion segment located at positions 161-560 of sequence 3, and the other chromosome has a deletion segment located at positions 161-564 of sequence 3.

[0045] The only difference between the Arabidopsis mutant line T1-24 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion segment located at positions 115-512 of sequence 1, and the other chromosome has an insertion of a T base located between positions 114-115 of sequence 1. In the gene encoding the AtDMP9 protein, one chromosome has a deletion segment located at positions 161-560 of sequence 3, and the other chromosome has a deletion segment located at positions 159-160 of sequence 3.

[0046] The only difference between the Arabidopsis mutant line T1-25 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion of a T base located at position 114 of sequence 1, and the other chromosome has an insertion of a CGT fragment located between positions 114 and 115 of sequence 1. In the gene encoding the AtDMP9 protein, one chromosome has a deletion of a fragment located between positions 161 and 162 of sequence 3, and the other chromosome has an insertion of an A base located between positions 160 and 161 of sequence 3.

[0047] The only difference between the Arabidopsis mutant line T1-28 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a segment deletion located at positions 115-512 of sequence 1, and the other chromosome has a deletion of a single T base located at position 114 of sequence 1. In the gene encoding the AtDMP9 protein, both chromosomes have an insertion of a single A base located between positions 160-161 of sequence 3.

[0048] The only difference between the Arabidopsis mutant line T1-32 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion segment located at positions 115-511 of sequence 1, and the other chromosome has an insertion of a T base located between positions 114-115 of sequence 1. In addition, in the gene encoding the AtDMP9 protein, both chromosomes have a deletion of a C base located at position 161 of sequence 3.

[0049] The only difference between the Arabidopsis mutant line T2-33 and the wild-type Arabidopsis Col-0 is that a single T base was inserted into both chromosomes in the gene encoding the AtDMP9 protein. The insertion position of the T base is between positions 160 and 161 of sequence 3. In addition, a fragment was inserted into both chromosomes in the gene encoding the AtDMP9 protein. The nucleotide sequence of the inserted fragment is shown in sequence 14. The insertion position of the fragment is between positions 561 and 562 of sequence 3.

[0050] The only difference between the Arabidopsis mutant line T2-38 and the wild-type Arabidopsis Col-0 is that both chromosomes have a deletion in the gene encoding the AtDMP8 protein, located at positions 115-127 of sequence 1, and both chromosomes have an insertion of the base T and the base G in the gene encoding the AtDMP9 protein, located at positions 160-161 and 562-563 of sequence 3, respectively.

[0051] The only difference between the tomato mutant line sldmp-1 and the wild-type tomato AC is that a single C base has been inserted into both chromosomes in the gene encoding the SlDMP protein. The inserted base is located between positions 92 and 93 of sequence 5.

[0052] The only difference between the tomato mutant line sldmp-2 and the wild-type tomato AC is that both chromosomes have a deletion in the gene encoding the SlDMP protein, located at positions 93-249 of sequence 5.

[0053] Another objective of this invention is to provide a method for preparing plant haploids.

[0054] The method for preparing plant haploids provided by the present invention includes the following steps: self-pollinating the plant haploid induction line or its offspring prepared by the above method, or using it as a male parent to hybridize with other plant materials to obtain self-pollinated offspring or hybrid offspring, which are the plant haploids; the plant is a dicotyledonous plant.

[0055] Furthermore, the above-mentioned method for preparing plant haploids also includes the following steps: performing fluorescent labeling and / or haploid trait identification and / or leaf ploidy identification and / or molecular marker identification on the self-pollinated offspring or the hybrid offspring, and selecting offspring plants that are identified as haploid by at least one method as plant haploids.

[0056] Furthermore, the fluorescent labeling identification method can be performed as follows: The aforementioned haploid inducible line carrying a fluorescent protein expression element is used as the male parent and crossed with the female parent to obtain hybrid offspring. The presence or absence of fluorescence in the offspring seeds is used to determine whether the seed to be tested is haploid or diploid: if the seed shows no fluorescence or weak fluorescence, it is haploid or a candidate for haploid; if it shows strong fluorescence, it is diploid or a candidate for diploid. Further, fluorescence is detected using a fluorescent lamp. Moreover, since the male parent carries a TagRFP fluorescent protein expression element driven by the AtOLEO1 promoter, the presence or absence of red fluorescence in the hybrid offspring seeds can be used to determine whether they are haploid or diploid.

[0057] The method for identifying haploid traits can be carried out as follows: if the plant to be tested has characteristics such as short stature, narrow and upward-pointing leaves, compact plant type, and male sterility, then the plant is or is a candidate for haploid; if the plant to be tested has characteristics such as tall stature, wide and spreading leaves, and normal fertility, then the plant is or is a candidate for diploid.

[0058] The leaf ploidy identification method can be performed as follows: Extract the nuclei from the young leaves of the plant to be tested, using diploid plant leaves as a control; then use flow cytometry to detect the signal. First, detect the diploid cell nuclear signal, setting the peak position of the diploid cell nuclear signal to 50 (since the genetic material in diploid cells is twice that in haploid cells, the peak position of the haploid cell nuclear signal appears around 25). If the cell nuclear signal peak of the plant to be tested appears around 25, then the plant is or is a candidate for haploid; if the signal peak of the plant to be tested appears around 50, and its intensity enrichment position is the same as that of the diploid cell nuclear signal, then the plant is or is a candidate for diploid.

[0059] The molecular marker identification can be performed as follows: PCR amplification is performed using polymorphic primers between the paternal parent (maternal haploid inducible line) and the maternal parent. The PCR amplification products are used to determine whether the plant to be tested is haploid or diploid: if the amplification product of the plant to be tested only has the banding pattern of the maternal parent and does not have the banding pattern of the paternal parent, then the plant is or is a candidate for haploid; if the amplification product of the plant to be tested has heterozygous banding patterns of both the paternal and maternal parents, then the plant is or is a candidate for diploid.

[0060] The plant haploid induction lines and plant haploids prepared according to the above method are also within the scope of protection of this invention.

[0061] The plant haploid induction line and the plant haploid not only include cells, tissues, and organs derived from the plant haploid induction line and the plant haploid, such as seeds, leaves, fruits, stems, flowers, and roots, but also include reproductive materials derived from the plant haploid induction line and the plant haploid, such as pollen, ovary, ovule, plumule, endosperm, egg cell, cut, root, root tip, hypocotyl, cotyledon, stem, leaf, flower, anther, seed, meristem, protoplast, and a population composed of cell tissue culture.

[0062] The AtDMP8 gene, or the AtDMP9 gene, or the SlDMP gene in the Arabidopsis mutant line described above, are also within the scope of protection of this invention.

[0063] Any of the following applications (D1)-D5) also fall within the scope of protection of this invention:

[0064] D1) Application of plant haploid induction lines prepared by the above method in the cultivation of plant haploids;

[0065] D2) The application of substances that silence or inhibit the expression and / or activity of AtDMP8 and / or AtDMP9 genes in the plant genome, or substances that knock out AtDMP8 and / or AtDMP9 genes, or substances that inhibit AtDMP8 protein and / or AtDMP8 protein activity in the cultivation of plant haploid induction lines or plant haploids.

[0066] D3) The application of substances that silence or inhibit the expression and / or activity of the SlDMP gene in the plant genome, or knock out the SlDMP gene, or inhibit the activity of the SlDMP protein in the cultivation of haploid induction lines or plant haploids.

[0067] D4) Application of AtDMP8 protein or related biological materials and / or AtDMP9 protein or related biological materials in regulating the induction rate of plant haploid induction lines or increasing the induction rate of plant haploid induction lines or in cultivating plant haploid induction lines or plant haploids.

[0068] Application of D5)SlDMP protein or related biological materials in regulating the induction rate of plant haploid induction lines, increasing the induction rate of plant haploid induction lines, or cultivating plant haploid induction lines or plant haploids.

[0069] In any of the applications or methods described above, the AtDMP8 protein is the protein shown in a1), a2), a3), or a4) below:

[0070] a1) The amino acid sequence is that of the protein shown in sequence 2;

[0071] a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 2;

[0072] a3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2.

[0073] a4) Proteins that have 75% or more homology with the amino acid sequence shown in Sequence 2 and have the same function;

[0074] The AtDMP9 protein is the protein shown in b1), b2), b3), or b4) below:

[0075] b1) The amino acid sequence is that of the protein shown in sequence 4;

[0076] b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 4;

[0077] b3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 4.

[0078] b4) Proteins that have 75% or more homology with the amino acid sequence shown in sequence 4 and have the same function.

[0079] The SlDMP protein is the protein shown as c1), c2), c3), or c4) below:

[0080] c1) The amino acid sequence is the protein shown in sequence 6;

[0081] c2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 6;

[0082] c3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 6.

[0083] c4) is a protein that has 75% or more homology with the amino acid sequence shown in Sequence 6 and has the same function.

[0084] The AtDMP8 protein, AtDMP9 protein, or SlDMP protein-related biological material is any one of the following d1) to d12):

[0085] d1) A nucleic acid molecule encoding the AtDMP8 protein, the AtDMP9 protein, or the SlDMP protein;

[0086] d2) An expression cassette containing the nucleic acid molecule described in d1);

[0087] d3) A recombinant vector containing the nucleic acid molecules described in d1);

[0088] d4) A recombinant vector containing the expression cassette described in d2);

[0089] d5) Recombinant microorganisms containing the nucleic acid molecules described in d1);

[0090] d6) Recombinant microorganisms containing the expression cassette described in d2);

[0091] d7) Recombinant microorganisms containing the recombinant vector described in d3);

[0092] d8) Recombinant microorganisms containing the recombinant vector described in d4);

[0093] d9) Transgenic plant cell lines containing the nucleic acid molecules described in d1);

[0094] d10) Transgenic plant cell lines containing the expression cassette described in d2);

[0095] d11) Transgenic plant cell lines containing the recombinant vector described in d3);

[0096] d12) Transgenic plant cell lines containing the recombinant vector described in d4).

[0097] Furthermore, the nucleic acid molecule described in d1) is a gene as shown in 1), 2), 3), or 4) below:

[0098] 1) Its coding sequence is the cDNA molecule or genomic DNA molecule shown in sequence 1, sequence 3 or sequence 5;

[0099] 2) A cDNA molecule or genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the AtDMP8 protein, AtDMP9 protein or SlDMP protein.

[0100] 3) cDNA or genomic DNA molecules derived from dicotyledonous plants and having 75% or more identity with the nucleotide sequence defined in 1), and encoding the AtDMP8, AtDMP9, or SlDMP protein.

[0101] 4) A cDNA molecule or genomic DNA molecule that hybridizes to the nucleotide sequence defined in 1) or 2) or 3) under stringent conditions and encodes the AtDMP8 protein or AtDMP9 protein or SlDMP protein.

[0102] Sequence 1 is a nucleic acid molecule encoding the AtDMP8 protein, sequence 3 is a nucleic acid molecule encoding the AtDMP9 protein, and sequence 5 is a nucleic acid molecule encoding the SlDMP protein.

[0103] Furthermore, the substance that knocks out the AtDMP8 gene and / or the AtDMP9 gene, or the substance that knocks out the SlDMP gene, is the CRISPR / Cas9 vector containing the target sequence described above.

[0104] In any of the above-described applications, methods, or plants, the plant is a dicotyledonous plant; the dicotyledonous plant may specifically be Arabidopsis thaliana or tomato; the Arabidopsis thaliana may specifically be wild-type Arabidopsis thaliana (Col-0) or ms1; the tomato may specifically be wild-type tomato AC or Micro-Tom or F1 generation material obtained by hybridization of tomato AC and Micro-Tom. Attached Figure Description

[0105] Figure 1 shows a comparison of haploid and diploid Arabidopsis thaliana. The plant indicated by the arrow is a haploid.

[0106] Figure 2 shows a comparison of haploid and diploid Arabidopsis thaliana after bolting.

[0107] Figure 3 shows a comparison of flow cytometry results for haploid and diploid Arabidopsis thaliana.

[0108] Figure 4 shows the fluorescence identification of Arabidopsis thaliana haploids. Figure a shows the phenotype of Arabidopsis thaliana seeds under white light, and Figure b shows the phenotype of Arabidopsis thaliana seeds under fluorescence. The seeds indicated by the arrows are haploids.

[0109] Figure 5 shows the molecular marker verification gel images of Arabidopsis haploids and diploids. M represents the 2K molecular marker, I represents the banding pattern of the maternal material, II represents the banding pattern of the paternal material, III represents the banding pattern of the haploid, and IV represents the banding pattern of the diploid.

[0110] Figure 6 shows a comparison of wild-type tomato plants and fruits of the sldmp mutant. Figures a and b show wild-type tomato plants and sldmp mutant plants, respectively, and figures c and d show self-pollinated fruits of wild-type tomato plants and sldmp mutant plants, respectively.

[0111] Figure 7 shows the fluorescence expression of tomato seeds. Figures a and b show the results of non-germinating and germinating tomato seeds under bright field conditions, respectively. Figures c and d show the results of non-germinating and germinating tomato seeds under fluorescence conditions, respectively.

[0112] Figure 8 shows a comparison of flow cytometry results for haploid and diploid tomatoes.

[0113] Figure 9 shows a schematic diagram of the main components in the recombinant vector. Figures a and b are schematic diagrams of the vector structures of Arabidopsis thaliana and tomato, respectively.

[0114] The best way to implement an invention

[0115] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0116] The pICSL4723 vector used in the following examples is described in the literature “Castel, B. and L. Tomlinson, et al. (2019). Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. PloS one, 14(1).”, which is available to the public from China Agricultural University. This experimental material is only used to repeat the relevant experiments of this invention and should not be used for other purposes.

[0117] The wild-type Arabidopsis thaliana Col-0 and ms1 in the following examples are described in the literature "Rosso, MG and Y. Li, et al. (2003). An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53 (1-2): 247-59.", which is available to the public from China Agricultural University. This biological material is only used to repeat the relevant experiments of this invention and should not be used for other purposes.

[0118] The wild-type tomato AC used in the following examples is described in the literature “Yuan, G. and C. Jia, et al. (2010). Effect of brassinosteroids on drought resistance and abscisic acid concentration in tomato under water stress. Scientia Horticulturae 126(2):103-108.” It is available to the public from China Agricultural University. This biological material is only used to repeat the relevant experiments of this invention and should not be used for other purposes.

[0119] The wild-type tomato Micro-Tom described in the following examples is described in the literature “Sun, H. and S. Uchii, et al. (2006). A highly efficient transformation protocol for Micro-Tom, a model cultivar for tomato functional genomics. Plant and Cell Physiology 47(3):426-431.”, which is available to the public from China Agricultural University. This biomaterial is only used to repeat the relevant experiments of this invention and should not be used for other purposes.

[0120] The CDS sequence of the AtDMP8 gene in this invention is shown as positions 95-826 of sequence 1 in the sequence listing, and the amino acid sequence of the protein encoded by the AtDMP8 gene is shown as sequence 2.

[0121] The CDS sequence of the AtDMP9 gene in this invention is shown in positions 141-875 of sequence 3 in the sequence listing, and the amino acid sequence of the protein encoded by the AtDMP9 gene is shown in sequence 4.

[0122] The CDS sequence of the SlDMP gene in this invention is shown as positions 1-678 of sequence 5 in the sequence listing, and the amino acid sequence of the protein encoded by the SlDMP gene is shown as sequence 6.

[0123] Example 1: Preparation and application of Arabidopsis mutants with AtDMP8 and / or AtDMP9 gene knockout.

[0124] I. Knocking out the AtDMP8 and / or AtDMP9 genes using the CRISPR / Cas9 system

[0125] The AtDMP8 and / or AtDMP9 genes in Arabidopsis thaliana were knocked out using the CRISPR / Cas9 system to obtain AtDMP8 and / or AtDMP9 gene knockout mutants. The specific steps are as follows:

[0126] 1. Selection of sgRNA sequence

[0127] Target site sequences with a length of 20 bp were designed on the AtDMP8 and AtDMP9 genes, respectively.

[0128] Target site 1 is located at positions 98-117 of sequence 1 and positions 144-163 of sequence 3. The sequence of sgRNA target site 1 is GAGAAAACAGAGGAAAGCGT.

[0129] Target site 2 is located at positions 290-309 of sequence 3, and the sequence of sgRNA target site 2 is AAGAGGTCGAAAACGTCGCA.

[0130] Target site 3 is located at positions 368-387 of sequence 3, and the sequence of sgRNA target site 3 is TCAAGAGTGTTCCTGTCGGA.

[0131] Target site 4 is located at positions 509-528 of sequence 1 and positions 558-577 of sequence 3. The sequence of sgRNA target site 4 is ATGAACACCGCGAGTCCACG.

[0132] 2. Construction of CRISPR / Cas9 vectors

[0133] The CRISPR / Cas9 vector is a recombinant vector obtained by ligating the DNA molecules shown in Sequence 7 (sgRNA expression element), Sequence 9 (Cas9 expression element), and Sequence 10 (fluorescent protein expression element) into the pICSL4723 vector using the golden gate method (vector structure diagram is shown in Figure 9a). The DNA molecule shown in Sequence 7 sequentially includes the coding sequences of sgRNA targeting target site 1, sgRNA targeting target site 2, sgRNA targeting target site 2, and sgRNA targeting target site 4. Each sgRNA coding sequence is preceded by an AtU6-26 promoter for initiating the expression of the sgRNA coding sequence.

[0134] 3. Obtaining transgenic plants

[0135] The CRISPR / Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cells GV3101 (Agrobacterium GV3101 competent cells were purchased from Beijing Aosendin Biotechnology Co., Ltd., and are available to the public through purchase) via heat shock transformation to obtain recombinant bacteria GV3101 / CRISPR / Cas9.

[0136] The recombinant bacteria GV3101 / CRISPR / Cas9 was then used to infect the inflorescences of wild-type Arabidopsis thaliana Col-0 using the Agrobacterium tumefaciens transformation method (the recombinant Agrobacterium tumefaciens was propagated at 28°C, and the propagated bacterial solution was used to infect the inflorescences of Arabidopsis thaliana). After screening with red fluorescence, T1 generation transgenic Arabidopsis thaliana plants were obtained.

[0137] 4. Identification of transgenic plants with mutations in the AtDMP8 and / or AtDMP9 genes

[0138] Leaves of T1 generation transgenic Arabidopsis plants obtained in step 3 were collected, and genomic DNA was extracted as a template. The following two pairs of primers were used for PCR amplification to obtain PCR amplification products of different strains.

[0139] The sequences of the primers for AtDMP8 mutant sequence detection are as follows:

[0140] DMP8F1:TGCGAAATGAGATTGGTTTTGGG;

[0141] DMP8R1:AAACACCCTGTGACTCTCCG.

[0142] The sequences of the primers for AtDMP9 mutant sequence detection are as follows:

[0143] DMP9F1:ATAACCGTCAATAACCGCCG;

[0144] DMP9R2: CCAGTCATGCAACCAACACC.

[0145] PCR amplification products from different strains were subjected to Sanger sequencing, and the sequencing results were compared with those of wild-type Arabidopsis thaliana Col-0 (AtDMP8 and AtDMP9). The genotypes of AtDMP8 and AtDMP9 were identified according to the following principles.

[0146] If a sequence has a bimodal characteristic starting from the target site sequence, then the genotype of the strain is heterozygous (the AtDMP8 and / or AtDMP9 genes on one of the two homologous chromosomes are mutated, while the AtDMP8 and / or AtDMP9 genes on the other chromosome are not mutated), and the strain is a T1 generation transgenic Arabidopsis heterozygous mutant strain.

[0147] If a sequence with a specific single-peak characteristic starting from the target site sequence is identical to the AtDMP8 and AtDMP9 gene sequences of wild-type Arabidopsis thaliana Col-0, then the genotype of the strain is wild-type, meaning that the AtDMP8 and AtDMP9 gene sequences have not been mutated; if it is different from the AtDMP8 and / or AtDMP9 gene sequences of wild-type Arabidopsis thaliana Col-0, then the genotype of the strain is homozygous (mutations have occurred in the AtDMP8 and / or AtDMP9 genes on both homologous chromosomes), and the strain is a T1 generation transgenic Arabidopsis thaliana homozygous mutant strain.

[0148] The identification results are shown in Tables 1 and 2 (Tables 1 and 2 show the AtDMP8 and AtDMP9 gene mutations in the T1 generation transgenic Arabidopsis thaliana, respectively): Of the 41 T1 generation transgenic Arabidopsis thaliana plants, 33 had mutations in the AtDMP8 gene, including 2 homozygous mutations and 17 biallelic mutations. Of the 28 T1 generation transgenic plants, 5 had homozygous mutations and 7 biallelic mutations. Twelve plants had both homozygous and biallelic mutations in AtDMP8 and AtDMP9. Further phenotypic identification was performed on single plants with frameshift mutations (deletions not multiples of 3) from among the homozygous and biallelic mutation plants. There are three types: AtDMP8 homozygous mutation / bicelestem mutation, AtDMP9 homozygous mutation / bicelestem mutation, and both AtDMP8 and AtDMP9 homozygous mutation / bicelestem mutation.

[0149] Table 1. Mutation types of the AtDMP8 gene in T1 generation transgenic Arabidopsis thaliana

[0150] Number AtDMP8allele1allele2T1-1 Biallelic mutation GAAAG-------------------GGGGCGTCGGAATCA..GACTCCACGTT1-2 Heterozygous mutation-----------------CTCGCWTT1-3 Biallelic mutation GAAAGACGTCGGAATCA..GACTCCACGTGGGTCGTCGGAATCA..GACTCCACGTT1-4 Wild-type WTWTT1-5 Wild-type WTWTT1-6 Biallelic mutation GAAAG-------------------GGAA--CGTCGGAATCA..GACTCCACGTT1-7 Heterozygous mutation Heterozygous mutations: GAAAGACGTCGGAATCA..GACTCCACGTWTT1-8; Bicele mutations: GAAAGGCGTCGGAATCA..GACTCCACGTWTT1-9; Bicele mutations: GAAAGTCGTCGGAATCA..GACTCCACGTGGGTCG--GGAATCA..GACTCCACGTT1-10; Bicele mutations: GAAAG---------------------------GGGGCGTCGGAATCA..GACTCCACGTT1-11; Homozygous mutations: GAAAGGCGTCGGAATCA..GACTCCACGTGGGGCGTCGGAATCA..GACTCCACGT

[0151] T1-12 Biallelic mutation GAAAGGCGTCGGAATCA..GACTCCACGTGGG-GTCGGAATCA..GACTCCACGTT1-13 Wild-type WTWTT1-14 Heterozygous mutation GAAAGGCGTCGGAATCA..GACTCCACGTWTT1-15 Biallelic mutation GAAAG------------GGGGCGTCGGAATCA..GACTCCACGTT1-16 Heterozygous mutation GAA-------(+49bp)---TTCATGAAWTT1-17 Wild-type WTWTT1-18 Heterozygous mutation GAAA-CGTCGGAATCA. .GACTCCACGTWTT1-19 Biallelic mutation GAAA-CGTCGGAATCA..CTCCACGTG-ACTCGGG---------------------------T1-20 Heterozygous mutation GAAAG--TCGGAATCA..GACTCCACGTWTT1-21 Heterozygous mutation GAAAG-----------------GACTCGCWTT1-22 Wild-type WTWTT1-23 Biallelic mutation GAAAG------------GGGTCGTCGGAATCAT1-24 Biallelic mutation GAAAG--------------G ACTCGCGGGTCGTCGGAATCAT1-25 Biallelic Mutation GAAA-CGTCGGAATCA..GACTCCACGTGGG(+3bp)CGTCGGAATCAT1-26 Wild-type WTWTT1-27 Biallelic Mutation GAAAG------------GG-CGTCGGAATCAT1-28 Biallelic Mutation GAAAG----------------GACTCGCGG-CGTCGGAATCAT1-29 Wild-type WTWTT1-30 Biallelic Mutation GAAAGGCGTCGGAATCA..GACTCCACGTGGG---------- -----ACTCGCT1-31 Heterozygous mutation GAAAGACGTCGGAATCA..GACTCCACGTWTT1-32 Biallelic mutation GAAAG-----------------GGGTCGTCGGAATCAT1-33 Heterozygous mutation GAAAG------------(+202bp)----WTT1-34 Biallelic mutation GAAAG------------------GACTCGCGGGTCGTCGGAATCAT1-35 Biallelic mutation GAAAGACGTCGGAATCA..GACTCCACGTGGGGCGTCGGAATCA..GACTCCACGTT1-36 Heterozygous mutation GAAAG-----------------GACTCGCWTT1-37 Heterozygous mutation GAAAGTCGTCGGAATCA--GACTCCACGTWTT1-38 Homozygous mutation GAAAG--------GTTTACA--CCACGTGGACTGGG--------GTTTACA..CCACGTGGT1-39 Wild-type WTWTT1-40 Heterozygous mutation GAAAG----------------------WTT1-41 Heterozygous mutation GAAAGGCGTCGGAATCA..GACTCCACGTWT.

[0152] Note: "—" indicates the presence of a missing base, and "." indicates an omitted base.

[0153] Table 2. Mutation types of the AtDMP9 gene in T1 generation transgenic Arabidopsis thaliana

[0154] Number AtDMP9allele1allele2T1-1 Biallelic Mutation GGAAAGACGTCGG..GACGCCAGGAAAG-GTCGG..GACGCCAT1-2 Wild-type WTWTT1-3 Homozygous Mutation GGAAA-CGTCGG..GACGCCAGGAAA-CGTCGG..GACGCCAT1-4 Heterozygous Mutation GGAA-GCGTCGG..GACGCCAWTT1-5 Wild-type WTWTT1-6 Homozygous Mutation GGAAAG(+16bp)CGTCGGA..GACGCCAGGAAAG(+16bp)CGTCGG..GACGCCAT 1-7 Heterozygous mutation GGAAAGACGTCGG..GACGCCAWTT 1-8 Wild-type WTWTT 1-9 Wild-type WTWTT 1-10 Biallelic mutation GGAAAGCG------CAATGTC..GCCAGGAAAGACGTCGG..GACGCCAT 1-11 Biallelic mutation GGAAAGGCGTCGG..GACGCCAGGAAAG(+16bp)CGTCGG..GACGCCAT 1-12 Heterozygous mutation GGAAAGGCGTCGG..GACGCCAWTT 1-13 Wild-type WTWTT 1-14 Heterozygous mutation GGAAAGACGTCGG..GAC GCCAWTT1-15 Heterozygous mutation GGAAAGGCGTCGG..GACGCCAWTT1-16 Heterozygous mutation GGAAAG-GTCGG..GACGCCAWTT1-17 Wild-type WTWTT1-18 Wild-type WTWTT1-19 Biale mutation GGAAAG----------GGAGGAAAG---------TCGCGGTGTTCT1-20 Heterozygous mutation GGA---CGTCGG..GACGCCAWTT1-21 Heterozygous mutation GGAAAGACGTCGG..GACGCCAWTT1-22 Heterozygous mutation GGAAAG--------GGAWT T1-23 Heterozygous mutation GGAAAGACGTCGG..GACGCCAWTT T1-24 Biallelic mutation GGAAAG--------GGAGGAA--CGTCGG..GACGCCAT T1-25 Biallelic mutation GGAAAG--TCGG..GACGCCAGGAAAGACGTCGG..GACGCCAT T1-26 Heterozygous mutation GGAAAG-GTCGG..GACGCCAWTT T1-27 Heterozygous mutation GG----CGTCGG..GACGCCAWTT T1-28 Homozygous mutation GGAAAGACGTCGG..GACGCCAGGAAAGACGTCGG..GACGCCAT1-29 Wild-type WTWTT1-30 Bicele mutation GGAAAG--------GGAGGAAA-CGTCGG..GACGCCAT1-31 Heterozygous mutation GGAAA-CGTCGG..GACGCCAWTT1-32 Homozygous mutation GGAAAG-GTCGG..GACGCCAGGAAAG-GTCGG..GACGCCA.

[0155] T1-33 Heterozygous mutation GGAAAGACG..CCACGTG(+401bp)GAWTT 1-34 Wild type WTWTT 1-35 Heterozygous mutation GGAA--CGTCGG..GACGCCAWTT 1-36 Heterozygous mutation GGAAAGCGTCGG..GACGCCAAWTT 1-37 Wild type WTWTT 1-38 Homozygous mutation GGAAAGTCGTCGG..GACGCCACGTGGGAGGAAAGTCGTCGG..GACGCCACGTGGGAT 1-39 Wild type WTWTT 1-40 Wild type WTWTT 1-41 Wild type WTWT

[0156] Note: "—" indicates the presence of a missing base, and "." indicates an omitted base.

[0157] The obtained T1 generation transgenic Arabidopsis thaliana AtDMP8 gene mutant line is T1-34, with the specific mutations as follows:

[0158] Sequencing analysis revealed that, compared with the genomic DNA of wild-type Arabidopsis thaliana Col-0, the T1 generation transgenic Arabidopsis thaliana AtDMP8 gene mutant line T1-34 differed only in that, in the gene encoding the AtDMP8 protein, one chromosome had a segment deletion located at positions 115-512 of sequence 1, and the other chromosome had a T base insertion located between positions 114-115 of sequence 1.

[0159] The obtained T1 generation transgenic Arabidopsis thaliana double mutant lines of AtDMP8 and AtDMP9 genes are T1-6, T1-11, T1-19, T1-24, T1-25, T1-28, and T1-32, with specific mutations as follows:

[0160] Sequencing analysis revealed that, compared with the wild-type Arabidopsis thaliana Col-0 genomic DNA, the T1 generation transgenic Arabidopsis thaliana AtDMP8 and AtDMP9 double mutant line T1-6 differed only in that, in the gene encoding the AtDMP8 protein, a segment was deleted on one chromosome, located at positions 115-512 of sequence 1, and a segment was deleted on the other chromosome, located at positions 113-114 of sequence 1. In addition, a segment was inserted into the gene encoding the AtDMP9 protein, with the nucleotide sequence: GTTACACGGCGACTC (sequence 13), and the insertion position was located between positions 160-161 of sequence 3.

[0161] Sequencing analysis revealed that, compared with the wild-type Arabidopsis thaliana Col-0 genomic DNA, the T1 generation transgenic Arabidopsis thaliana AtDMP8 and AtDMP9 double mutant line T1-11 differed only in that a single T base was inserted into the gene encoding the AtDMP8 protein, located between positions 114 and 115 of sequence 1. In the gene encoding the AtDMP9 protein, a T base was inserted into one chromosome, located between positions 160 and 161 of sequence 3, while a fragment was inserted into the other chromosome. The nucleotide sequence of this inserted fragment is: GTTACACGGCGACTC (Sequence 13), located between positions 160 and 161 of sequence 3.

[0162] Sequencing analysis revealed that, compared with the wild-type Arabidopsis thaliana Col-0 genomic DNA, the T1 generation transgenic Arabidopsis thaliana AtDMP8 and AtDMP9 double mutant line T1-19 differed only in the following ways: In the gene encoding the AtDMP8 protein, one chromosome had a deletion of a single T base located at position 114 of sequence 1, and the other chromosome had a deletion of a segment located at positions 115-511 of sequence 1. In the gene encoding the AtDMP9 protein, one chromosome had a deletion of a segment located at positions 161-560 of sequence 3, and the other chromosome had a deletion of a segment located at positions 161-564 of sequence 3.

[0163] Sequencing analysis revealed that, compared with the genomic DNA of wild-type Arabidopsis thaliana Col-0, the T1 generation transgenic Arabidopsis thaliana double mutant line T1-24 differed only in the following ways: in the gene encoding the AtDMP8 protein, one chromosome had a deletion segment located at positions 115-512 of sequence 1, and the other chromosome had an insertion of a T base located between positions 114-115 of sequence 1; and in the gene encoding the AtDMP9 protein, one chromosome had a deletion segment located at positions 161-560 of sequence 3, and the other chromosome had a deletion segment located at positions 159-160 of sequence 3.

[0164] Sequencing analysis revealed that, compared with the wild-type Arabidopsis thaliana Col-0 genomic DNA, the T1 generation transgenic Arabidopsis thaliana AtDMP8 and AtDMP9 double mutant line T1-25 differed only in the genes encoding the AtDMP8 protein. One chromosome had a deletion of a single T base located at position 114 of sequence 1, while the other chromosome had an insertion of a CGT fragment located between positions 114 and 115 of sequence 1. Furthermore, in the genes encoding the AtDMP9 protein, one chromosome had a deletion of a single fragment located between positions 161 and 162 of sequence 3, while the other chromosome had an insertion of a single A base located between positions 160 and 161 of sequence 3.

[0165] Sequencing analysis revealed that, compared with the wild-type Arabidopsis thaliana Col-0 genomic DNA, the T1 generation transgenic Arabidopsis thaliana AtDMP8 and AtDMP9 double mutant line T1-28 differed only in the following ways: in the gene encoding the AtDMP8 protein, a segment deletion occurred on one chromosome, located at positions 115-512 of sequence 1, and a single T base deletion occurred on the other chromosome, located at position 114 of sequence 1; and in the gene encoding the AtDMP9 protein, a single A base insertion occurred, located between positions 160-161 of sequence 3.

[0166] Sequencing analysis revealed that, compared with the genomic DNA of wild-type Arabidopsis thaliana Col-0, the T1 generation transgenic Arabidopsis thaliana double mutant line T1-32 differed only in the following ways: in the gene encoding the AtDMP8 protein, a segment deletion occurred on one chromosome, located at positions 115-511 of sequence 1; and a T base insertion occurred on the other chromosome, located between positions 114-115 of sequence 1. Furthermore, a C base deletion occurred in the gene encoding the AtDMP9 protein, located at position 161 of sequence 3.

[0167] 5. Genotyping of T2 generation transgenic Arabidopsis thaliana

[0168] The T1 generation transgenic Arabidopsis thaliana AtDMP8 and / or AtDMP9 gene mutant lines T1-19, T1-33, and T1-38 obtained in step 4 were self-pollinated, and the seeds were harvested and then sown to obtain the T2 generation transgenic Arabidopsis thaliana. The genotypes of the AtDMP8 and AtDMP9 genes in the T2 generation transgenic Arabidopsis thaliana were identified using the following method: using the genomic DNA of the T2 generation transgenic Arabidopsis thaliana as a template, the genotypes of the AtDMP8 and AtDMP9 genes in the T2 generation transgenic Arabidopsis thaliana were identified using the mutation sequence detection primers for AtDMP8 (DMP8F1 and DMP8R1) and AtDMP9 (DMP9F1 and DMP9R2) respectively, following the method described in step 4.

[0169] The obtained T2 generation transgenic Arabidopsis thaliana AtDMP8 gene mutation homozygous lines are T2-33-1, T2-33-2, and T2-33-3. These three lines have the same mutation sequence, and the specific mutations are as follows:

[0170] Sequencing analysis revealed that, compared to the wild-type Arabidopsis thaliana Col-0 genomic DNA, the T2 generation transgenic Arabidopsis thaliana AtDMP8 gene mutation homozygous lines T2-33-1, T2-33-2, and T2-33-3 differed only in that a segment substitution occurred in the gene encoding the AtDMP8 protein. This substitution involved replacing the segment shown in sequence 1 (positions 115-511) with a 202 bp fragment. The nucleotide sequence of the 202 bp fragment is as follows: GAAATTGACGAGCATTGATGTCTTCGAAACCGTTTTTTGAACTCCTTTCGCCACCATGCGACGTTTTCTACCTTTTCCTCCTCCCGCGGCGGCTCCTGCCGGAAGCATAGGCAGTGAAGAGAGAGGGACAGGTTTGGGCGACCGAGACGATGTTGGTGACGGATTTTGCGTCGTTGTCGTCGTGTAAACTCTGATTCCGACG.

[0171] The obtained T2 generation transgenic Arabidopsis thaliana AtDMP9 gene mutation homozygous lines are T2-33-4, T2-33-5, and T2-33-6. These three lines have the same mutation sequence, and the specific mutations are as follows:

[0172] Sequencing analysis revealed that, compared to the wild-type Arabidopsis thaliana Col-0, the T2 generation transgenic Arabidopsis thaliana AtDMP9 gene mutation homozygous lines T2-33-4, T2-33-5, and T2-33-6 differed only in the insertion of a single T base in the gene encoding the AtDMP9 protein. This T base insertion was located between positions 160 and 161 of sequence 3, and a fragment insertion occurred within the AtDMP9 protein gene. The nucleotide sequence of this inserted fragment is as follows: CGTCGGAATCAGAGTTTACACGGCGACTCCGCCGCAAAAACCATCACCATCACCACCTTCTCGTTCACCAAAACCCGTCTTAATCTCTTCATTGCCTTCCCTCCCGTCAGGAGCCGCCGCTGGAGGAG The insertion position of this segment is between positions 561 and 562 of sequence 3.

[0173] The obtained T2 generation transgenic Arabidopsis thaliana AtDMP8 and AtDMP9 gene mutation homozygous lines are T2-19, T2-38-1, and T2-38-2, and the mutation types of each line are as follows:

[0174] Sequencing analysis revealed that, compared with the wild-type Arabidopsis thaliana Col-0 genomic DNA, the T2 generation transgenic Arabidopsis thaliana AtDMP8 and AtDMP9 gene mutation homozygous line T2-19 differed only in that a segment deletion occurred in the gene encoding the AtDMP8 protein, located at positions 115-511 of sequence 1, and a segment deletion occurred in the gene encoding the AtDMP9 protein, located at positions 161-564 of sequence 3.

[0175] Sequencing analysis revealed that, compared with the wild-type Arabidopsis thaliana Col-0 genomic DNA, the T2 generation transgenic Arabidopsis thaliana AtDMP8 and AtDMP9 gene mutation homozygous lines T2-38-1 and T2-38-2 differed only in that a segment deletion occurred in the gene encoding the AtDMP8 protein, located at positions 115-127 of sequence 1. Furthermore, two insertions of the bases T and G occurred in the gene encoding the AtDMP9 protein, located at positions 160-161 and 562-563 of sequence 3, respectively.

[0176] The T1 and T2 generation transgenic Arabidopsis mutant lines were selected for the following haploid induction ability analysis experiment.

[0177] II. Application of Arabidopsis mutants with AtDMP8 and / or AtDMP9 gene knockout in the induction of haploid production

[0178] (I) Identification of the haploid self-crossing induction ability of Arabidopsis mutants with AtDMP8 and AtDMP9 gene knockout

[0179] Three types of mutants obtained from the AtDMP8 and AtDMP9 genes were self-crossed to obtain self-crossed progeny. Haploidity was identified in the self-crossed progeny using the following method (since wild Arabidopsis thaliana Col is a homozygous inbred line, the self-crossed progeny of mutants obtained by knocking out the AtDMP8 and AtDMP9 genes cannot be identified by molecular markers):

[0180] 1. Plant phenotypic identification

[0181] After planting the self-pollinated seeds, the phenotype of individual plants was observed. Haploid plants were characterized by short stature, narrow and upward-pointing leaves, compact plant type, and male sterility, while diploid plants were characterized by tall stature, wide and spreading leaves, and normal fertility (Figure 1, Figure 2).

[0182] 2. Leaf identification by flow cytometry

[0183] The haploid plants obtained in step 1 were subjected to flow cytometry analysis. The specific method is as follows: Nuclei were extracted from young leaves of the plants to be tested, with diploid Arabidopsis leaves used as a control. The flow cytometry instrument was then used to detect the signal. First, the diploid cell nuclear signal was detected, and the peak position of the diploid cell nuclear signal was set to 50 (since the genetic material in diploid cells is twice that in haploid cells, the peak position of the haploid cell nuclear signal appears around 25). If the signal peak of the tested plant's cell nuclear signal appears around 25, the plant is considered haploid. If the signal peak of the tested plant appears around 50, it is considered to have the same intensity enrichment position as the diploid cell nuclear signal, and the plant is considered diploid (Figure 3).

[0184] The above identification results were statistically analyzed, and the induction rate was calculated using the following formula: Induction rate (%) = (Number of haploid plants / Total number of plants) × 100. It can be seen that simultaneous mutation of the AtDMP8 and AtDMP9 genes can produce haploid offspring in self-crossing.

[0185] Table 3. Statistics on haploid induction rate in self-crossed progeny of dmp mutants

[0186] Genotype Plant ID Total Number of Plants Number of Haploids Haploid Induction Rate (%) WTCol-05 2300 dmp8 T2-33-1 27000 dmp9 T2-33-4 18300 dmp8 dmp9 T2-38-1 16563.64

[0187] (II) Identification of the haploid hybridization induction ability of Arabidopsis mutants with AtDMP8 and AtDMP9 gene knockout

[0188] Three types of mutants obtained from the AtDMP8 and AtDMP9 genes were crossed with Arabidopsis thaliana ms1 material to obtain hybrid offspring. Haploids in the hybrid offspring were identified using the following method:

[0189] 1. Identification by fluorescent labeling

[0190] The CRISPR / Cas9 vector carries the AtOLEO1 promoter, which drives the expression of TagRFP (Entacmaea quadricolor). Since the AtOLEO1 promoter is specifically expressed in mature seed embryos, the fluorescence signal of TagRFP can be observed using a fluorescent lamp. Therefore, when a mutant carrying this expression element is used as the male parent and crossed with other maternal materials that do not carry fluorescence, the embryos of diploid seeds exhibit strong red fluorescence due to the paternal genome, while the embryos of haploid seeds, derived from the maternal parent, show no fluorescence or weak fluorescence (Figure 4).

[0191] 2. Molecular marker identification

[0192] The seeds identified in step 1 above that exhibited no fluorescence or weak fluorescence were further planted, and their genomic DNA was extracted. PCR amplification was performed using primers 092B02-F (092B02-F: CAGCTGAGATGAACGAGTTGTCTT), 092B02-R (092B02-R: TCTTTTGAGTCACTCCGTATGTCC), and LB-o8474 (LB-o8474: ATAATACGCTGCGGACATCTACATTTT) to detect the amplification products using agarose gels. If the amplification product of the tested plant was 500 bp in size and showed a single band, the plant was considered to have the Arabidopsis ms1 band pattern. If the band pattern of the paternal material was not present, the plant was considered a maternal haploid. If the amplification products of the tested single plant are 500bp and 1094bp in size, showing two bands, it is considered that the bands of the single plant are heterozygous bands of Arabidopsis ms1 and transgenic Arabidopsis mutant lines. In this case, the single plant is a offspring of normal hybridization and is diploid (Figure 5).

[0193] 3. Phenotypic identification of mature plants

[0194] Further observation of the phenotypes of the plants identified in steps 1 and 2 above revealed that haploid plants are characterized by short stature, narrow and upward-pointing leaves, compact plant type, and male sterility, while diploid plants are characterized by tall stature, wide and spreading leaves, and normal fertility.

[0195] 4. Leaf identification by flow cytometry

[0196] The haploid plants obtained in step 3 above were subjected to flow cytometry analysis. The specific method is as follows: Nuclei were extracted from the young leaves of the plants to be tested, with diploid Arabidopsis leaves used as a control. The flow cytometry instrument was then used to detect the signal. First, the diploid cell nuclear signal was detected, and the peak position of the diploid cell nuclear signal was set to 50 (since the genetic material in diploid cells is twice that in haploid cells, the peak position of the haploid cell nuclear signal appears around 25). If the signal peak of the tested plant's cell nuclear signal appears around 25, the plant is considered haploid. If the signal peak of the tested plant appears around 50, it is considered to have the same intensity enrichment position as the diploid cell nuclear signal, and the plant is considered diploid.

[0197] The above identification results were statistically analyzed, and the induction rate was calculated using the following formula: Induction rate (%) = (Number of maternal haploid plants / Total number of plants) × 100. It can be seen that maternal haploids can be obtained in the offspring of crosses between AtDMP8 gene mutation, AtDMP9 gene mutation, and simultaneous mutation of AtDMP8 and AtDMP9 genes with other materials.

[0198] Table 4. Statistics on haploid induction rate in the hybrid offspring of dmp mutants

[0199]

[0200]

[0201] Example 2: Preparation and application of SlDMP gene knockout tomato mutants

[0202] I. Knocking out the SlDMP gene using the CRISPR / Cas9 system

[0203] The SlDMP gene in tomato was knocked out using the CRISPR / Cas9 system to obtain an SlDMP gene knockout tomato mutant. The specific steps are as follows:

[0204] 1. Selection of sgRNA sequence

[0205] A target site sequence with a length of 20 bp was designed on the SlDMP gene.

[0206] Target site 1 is located at positions 76-95 of sequence 5, and the sequence of sgRNA target site 1 is TATCCTACTAATTTACCACA.

[0207] Target site 2 is located at positions 247-266 of sequence 5, and the sequence of sgRNA target site 2 is TCTCCTTTACCAAATACTGA.

[0208] 2. Construction of CRISPR / Cas9 vectors

[0209] The CRISPR / Cas9 vector is a recombinant vector obtained by ligating the DNA molecules shown in sequence 8 (sgRNA expression element), sequence 11 (Cas9 expression element), sequence 10 (fluorescent protein expression element), and sequence 12 (NptII expression element) into the pICSL4723 vector using the golden gate method (vector structure diagram is shown in Figure 9b). The DNA molecule shown in sequence 8 includes the coding sequences of sgRNA targeting target site 1 and sgRNA targeting target site 2, respectively. Each sgRNA coding sequence is preceded by an AtU6-26 promoter for initiating the expression of the sgRNA coding sequence.

[0210] 3. Obtaining transgenic plants

[0211] The CRISPR / Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cells GV3101 (Agrobacterium GV3101 competent cells were purchased from Beijing Aosendin Biotechnology Co., Ltd., and are available to the public through purchase) via heat shock transformation to obtain recombinant bacteria GV3101 / CRISPR / Cas9.

[0212] The recombinant bacteria GV3101 / CRISPR / Cas9 was then used to infect the cotyledon explants of wild-type tomato AC using Agrobacterium tumefaciens (the recombinant Agrobacterium tumefaciens was propagated at 28°C, and the propagated bacterial solution was used for the tomato cotyledon explants). After kanamycin resistance screening, T0 generation transgenic tomato plants were obtained.

[0213] 4. Identification of transgenic plants with mutations in the SlDMP gene

[0214] Leaves of T0 generation transgenic tomato plants obtained in step 3 were collected, and genomic DNA was extracted as a template. PCR amplification was performed using the following primers to obtain PCR amplification products of different strains.

[0215] The sequences of the primers for detecting SlDMP gene mutations are as follows:

[0216] SlDMPF2: ACTGCTTAGGATATTAACTGACCC;

[0217] SlDMPR1:TTTTGGCACATCGACACCAAG.

[0218] PCR amplification products from different strains were subjected to Sanger sequencing, and the sequencing results were compared with the SlDMP gene of wild-type tomato AC. The genotype of SlDMP was identified according to the following principles.

[0219] If a sequence has a bimodal characteristic starting from the target site sequence, then the genotype of the strain is heterozygous (the SlDMP gene on one of the two homologous chromosomes is mutated, while the SlDMP gene on the other chromosome is not mutated), and the strain is a T0 generation transgenic tomato heterozygous mutant strain.

[0220] If a sequence with a specific single-peak characteristic starting from the target site sequence is identical to the SlDMP gene sequence of wild-type tomato AC, then the genotype of the strain is wild-type, meaning that the SlDMP gene sequence has not mutated; if it is different from the SlDMP gene sequence of wild-type tomato AC, then the genotype of the strain is homozygous (the SlDMP gene on two homologous chromosomes has mutated), and the strain is a T0 generation transgenic tomato homozygous mutant strain.

[0221] Table 5. Mutation types of the SlDMP gene in T0 generation transgenic tomatoes

[0222]

[0223]

[0224] Note: "-" indicates a missing base.

[0225] 5. Genotyping of T1 generation transgenic tomatoes

[0226] The T0 generation transgenic tomato SlDMP gene mutant lines T0-12 and T0-34 obtained in step 4 were self-crossed, and the seeds were harvested and then sown to obtain the T1 generation transgenic tomatoes. The genotype of the SlDMP gene in the T1 generation transgenic tomatoes was identified using the following method: using the genomic DNA of the T1 generation transgenic tomatoes as a template, the genotype of the SlDMP gene in the T1 generation transgenic tomatoes was identified using the mutation sequence detection primers for SlDMP (SlDMPF2 and SlDMPR1) according to the method in step 4.

[0227] The final T1 generation transgenic tomato lines with SlDMP gene mutation homozygous strains were sldmp-1 and sldmp-2. The mutation types of each line are as follows:

[0228] Sequencing analysis revealed that, compared with the genomic DNA of wild-type tomato AC, the T1 generation transgenic tomato SlDMP gene mutation homozygous line sldmp-1 differed only in that a single C base was inserted into the gene encoding the SlDMP protein, located between positions 92 and 93 of sequence 5.

[0229] Sequencing analysis revealed that, compared with the genomic DNA of wild-type tomato AC, the T1 generation transgenic tomato SlDMP gene mutation homozygous line sldmp-2 differed only in that a segment deletion occurred in the gene encoding the SlDMP protein, located at positions 93-249 of sequence 5.

[0230] II. Application of SlDMP gene knockout tomato mutants in inducing haploid production

[0231] (I) Analysis of plant phenotypes and fruit set rate of SlDMP gene knockout tomato mutants

[0232] Comparing the performance of wild-type tomato plants with AC and tomato mutants with the SlDMP gene knocked out under AC backgrounds, it was found that SlDMP gene knockout did not affect plant growth (Figure 6). The number of seeds per self-pollinated tomato fruit was statistically analyzed. Wild-type plants produced an average of approximately 79.5 seeds per self-pollinated fruit, while the sldmp mutant produced only 17 seeds, significantly lower than the wild type (Table 6). This indicates that the SlDMP gene mutation led to a decrease in fruit set, suggesting that the sldmp mutant has the ability to induce haploidy.

[0233] Table 6. Statistics on the number of seeds produced by self-crossing of sldmp mutants

[0234] Material statistics: Average number of ears and seeds (WT) 1279.5±24.1 sldmp-11419.7±7.1 sldmp-22315.3±6.6

[0235] Note: WT stands for wild-type tomato AC.

[0236] (II) Identification of the haploid hybridization induction ability of SlDMP gene knockout tomato mutants

[0237] The sldmp mutant was crossed with tomato AC and Micro-Tom to obtain F1 generation materials, and the haploids in the hybrid offspring were identified by the following method:

[0238] 1. Identification by fluorescent labeling

[0239] The CRISPR / Cas9 vector carries the AtOLEO1 promoter, which drives the expression of TagRFP (Entacmaea quadricolor). Since the AtOLEO1 promoter is specifically expressed in mature seed embryos, the fluorescence signal of TagRFP can be observed using a fluorescent lamp. Therefore, when a mutant carrying this expression element is used as the male parent and crossed with other maternal materials that do not carry fluorescence, the embryos of diploid seeds exhibit red fluorescence due to the paternal genome, while the embryos of haploid seeds, derived from the maternal parent, exhibit no fluorescence or weak fluorescence (Figure 7).

[0240] 2. Molecular marker identification

[0241] The non-fluorescent seeds identified in step 1 were further planted, and their genomic DNA was extracted. PCR amplification was performed using the primers SlDMPF2+SlDMPR1, which are polymorphic primers used between the F1 generation obtained from the cross between tomato AC and Micro-Tom and the SlDMP gene knockout tomato mutant. The amplified products were then subjected to agarose gel spectroscopy or sequencing. If the amplified product of the tested plant showed one band or the sequencing result showed a single peak, the band was considered to be maternal banding, and no paternal banding was observed, indicating that the plant was maternal haploid. If the amplified product of the tested plant showed two bands or the sequencing result showed a heterozygous peak, the band was considered to be heterozygous banding between the F1 generation obtained from the cross between tomato AC and Micro-Tom and the SlDMP gene knockout tomato mutant, indicating that the plant was a normal hybrid offspring and was diploid.

[0242] 3. Phenotypic identification of mature plants

[0243] Further observation of the phenotypes of the plants identified in steps 1 and 2 above revealed that haploid plants are characterized by short stature, narrow and upward-pointing leaves, compact plant type, and male sterility, while diploid plants are characterized by tall stature, wide and spreading leaves, and normal fertility.

[0244] 4. Leaf identification by flow cytometry

[0245] The haploid plants obtained in step 3 above were subjected to flow cytometry analysis. The specific method is as follows: Nuclei were extracted from the young leaves of the plants to be tested, with diploid tomato leaves used as a control. The flow cytometer was then used to detect the signal. First, the diploid cell nucleus signal was detected, and the peak position of the diploid cell nucleus signal was set to 100 (since the genetic material in diploid cells is twice that in haploid cells, the peak position of the haploid cell nucleus signal appears around 50). If the signal peak of the plant to be tested appears around 50, the plant is considered haploid. If the signal peak of the plant to be tested appears around 100, it is considered to have the same intensity enrichment position as the diploid cell nucleus signal, and the plant is considered diploid (Figure 8).

[0246] The above identification results were statistically analyzed, and the induction rate was calculated using the following formula: Induction rate (%) = (Number of maternal haploid plants / Total number of plants) × 100. After the SlDMP gene mutation is performed, hybridization with other materials yields maternal haploids in the hybrid offspring.

[0247] Table 7. Statistics on haploid induction rate in the hybrid offspring of sldmp mutants

[0248] Total number of hybrid plants | Number of haploids | Haploid induction rate (%) F1×WT 9540 0.00 F1×sldmp-13232 0.62 F1×sldmp-26293 0.99

[0249] Note: F1 is the offspring of a cross between tomato AC and Micro-Tom, and WT is wild-type tomato AC.

[0250] Industrial applications

[0251] This invention cloned the parthenogenetic haploid inducing genes AtDMP8 and AtDMP9 from Arabidopsis thaliana. Experiments demonstrated that mutations in AtDMP8 and AtDMP9 can induce parthenogenetic haploids, extending the application of parthenogenetic haploid induction to dicotyledonous crops. This invention further validated the technology in tomato, where mutations in AtDMP8 also showed parthenogenetic haploid induction. This invention lays an important foundation for broadening the application of haploid breeding technology in dicotyledonous plants and elucidating the biological mechanisms of parthenogenetic haploid formation. Given the widespread use of haploid breeding technology in the current breeding industry, this invention has a very broad application scope and market prospect.

Claims

1. A method for preparing a plant haploid inducible line, comprising the following A1) or A2): A1) Silencing or inhibiting the expression and / or activity of the DMP gene in the plant genome or knocking out the DMP gene to obtain a plant haploid inducible line; A2) Inhibit the activity of DMP protein in plants to obtain haploid inducible lines of plants; The plant in question is a dicotyledonous plant; The DMP protein is the protein shown in B1), B2), B3), or B4) below: B1) The amino acid sequence of the protein is as shown in sequence 2, sequence 4, or sequence 6; B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 2, 4 or 6; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6. B4) Proteins that share 75% or more homology with the amino acid sequences shown in Sequence 2, Sequence 4, or Sequence 6 and have the same function.

2. The method according to claim 1, characterized in that: When the dicotyledonous plant is Arabidopsis thaliana, the DMP gene is the AtDMP8 gene and / or the AtDMP9 gene; the DMP protein is the AtDMP8 protein and / or the AtDMP9 protein.

3. The method according to claim 1, characterized in that: When the dicotyledonous plant is tomato, the DMP gene is the SlDMP gene; the DMP protein is the SlDMP protein.

4. The method according to any one of claims 1-3, characterized in that: The DMP gene is the gene shown in C1), C2), C3), or C4) below: C1) cDNA or genomic DNA molecules as shown in sequence 1, 3, or 5; cDNA or genomic DNA molecules that have 75% or more identity with the nucleotide sequence defined by C2) and C1); C3) is a cDNA or genomic DNA molecule derived from dicotyledonous plants and having 75% or more identity with the nucleotide sequence defined by C1; C4) cDNA or genomic DNA molecules that hybridize under strict conditions to nucleotide sequences defined by C1), C2), or C3); The DMP gene has the following function: when the DMP gene in a dicotyledonous plant is silenced, suppressed, or knocked out, the dicotyledonous plant becomes a plant haploid induction line.

5. The method according to any one of claims 1-4, characterized in that: The knockout of the AtDMP8 gene and / or the AtDMP9 gene, or the knockout of the SlDMP gene, is performed using CRISPR / Cas9.

6. The method according to any one of claims 1-5, characterized in that: When the dicotyledonous plant is Arabidopsis thaliana, the target sequences of CRISPR / Cas9 are positions 98-117 of sequence 1, positions 290-309 of sequence 3, positions 368-387 of sequence 3, and positions 509-528 of sequence 1.

7. The method according to any one of claims 1-6, characterized in that: When the dicotyledonous plant is tomato, the target sequence of CRISPR / Cas9 is positions 76-95 and 247-266 of sequence 5.

8. The method according to any one of claims 1-7, characterized in that: The method also includes a step of screening for DMP gene mutants.

9. The method according to any one of claims 1-8, characterized in that: The plant haploid induction lines are Arabidopsis mutant lines T1-34, T1-6, T1-11, T1-19, T1-24, T1-25, T1-28, or T1-32; The only difference between the Arabidopsis mutant line T1-34 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion segment located at positions 115-512 of sequence 1, and the other chromosome has an insertion of a T base located between positions 114-115 of sequence 1. The only difference between the Arabidopsis mutant line T1-6 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a segment is deleted on one chromosome, located at positions 115-512 of sequence 1, and a segment is deleted on the other chromosome, located at positions 113-114 of sequence 1. In addition, in the gene encoding the AtDMP9 protein, a segment is inserted on both chromosomes. The nucleotide sequence of the inserted segment is shown in sequence 13, and the insertion position is between positions 160-161 of sequence 3. The only difference between the Arabidopsis mutant line T1-11 and the wild-type Arabidopsis Col-0 is that a single T base insertion occurred in the gene encoding the AtDMP8 protein, located between positions 114 and 115 of sequence 1. In the gene encoding the AtDMP9 protein, a T base insertion occurred on one chromosome, located between positions 160 and 161 of sequence 3, and a fragment insertion occurred on the other chromosome. The nucleotide sequence of the inserted fragment is shown in sequence 13, located between positions 160 and 161 of sequence 3. The only genomic differences between the Arabidopsis mutant line T1-19 and the wild-type Arabidopsis Col-0 are as follows: in the gene encoding the AtDMP8 protein, one chromosome has a deletion of a single T base located at position 114 of sequence 1, and the other chromosome has a deletion segment located at positions 115-511 of sequence 1; and in the gene encoding the AtDMP9 protein, one chromosome has a deletion segment located at positions 161-560 of sequence 3, and the other chromosome has a deletion segment located at positions 161-564 of sequence 3. The only difference between the Arabidopsis mutant line T1-24 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion segment located at positions 115-512 of sequence 1, and the other chromosome has an insertion of a T base located between positions 114-115 of sequence 1. In the gene encoding the AtDMP9 protein, one chromosome has a deletion segment located at positions 161-560 of sequence 3, and the other chromosome has a deletion segment located at positions 159-160 of sequence 3. The only difference between the Arabidopsis mutant line T1-25 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion of a T base located at position 114 of sequence 1, and the other chromosome has an insertion of a CGT fragment located between positions 114 and 115 of sequence 1. In the gene encoding the AtDMP9 protein, one chromosome has a deletion of a fragment located between positions 161 and 162 of sequence 3, and the other chromosome has an insertion of an A base located between positions 160 and 161 of sequence 3. The only difference between the Arabidopsis mutant line T1-28 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a segment deletion located at positions 115-512 of sequence 1, and the other chromosome has a deletion of a single T base located at position 114 of sequence 1. In the gene encoding the AtDMP9 protein, both chromosomes have an insertion of a single A base located between positions 160-161 of sequence 3. The only difference between the Arabidopsis mutant line T1-32 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion segment located at positions 115-511 of sequence 1, and the other chromosome has an insertion of a T base located between positions 114-115 of sequence 1. In addition, in the gene encoding the AtDMP9 protein, both chromosomes have a deletion of a C base located at position 161 of sequence 3.

10. A method for preparing a plant haploid inducing line, comprising the step of self-pollinating the plant haploid inducing line according to any one of claims 1-9.

11. The method according to claim 10, characterized in that: The method also includes a step of screening for DMP gene mutants.

12. The method according to claim 10 or 11, characterized in that: The plant haploid induction lines are Arabidopsis mutant line T2-33, Arabidopsis mutant line T2-38, tomato mutant line sldmp-1, or the tomato mutant line sldmp-2. The only difference between the Arabidopsis mutant line T2-33 and the wild-type Arabidopsis Col-0 is that a single T base was inserted into both chromosomes in the gene encoding the AtDMP9 protein. The insertion position of the T base is between positions 160 and 161 of sequence 3. In addition, a fragment was inserted into both chromosomes in the gene encoding the AtDMP9 protein. The nucleotide sequence of the inserted fragment is shown in sequence 14. The insertion position of the fragment is between positions 561 and 562 of sequence 3. The only difference between the Arabidopsis mutant line T2-38 and the wild-type Arabidopsis Col-0 is that both chromosomes have a deletion in the gene encoding the AtDMP8 protein, located at positions 115-127 of sequence 1, and both chromosomes have an insertion of the base T and the base G in the gene encoding the AtDMP9 protein, located at positions 160-161 and 562-563 of sequence 3, respectively. The only difference between the tomato mutant line sldmp-1 and the wild-type tomato AC is that a single C base has been inserted into both chromosomes in the gene encoding the SlDMP protein. The inserted base is located between positions 92 and 93 of sequence 5. The only difference between the tomato mutant line sldmp-2 and the wild-type tomato AC is that both chromosomes have a deletion in the gene encoding the SlDMP protein, located at positions 93-249 of sequence 5.

13. A method for preparing plant haploids, comprising the following steps: self-pollinating a plant haploid inducing line or its offspring prepared by the method according to any one of claims 1-12, or hybridizing it with other plant materials as a male parent to obtain self-pollinated offspring or hybrid offspring, which are the plant haploids; wherein the plant is a dicotyledonous plant.

14. The method according to claim 13, characterized in that: The method further includes the following steps: performing fluorescent marker identification and / or haploid trait identification and / or leaf ploidy identification and / or molecular marker identification on the self-pollinated offspring or the hybrid offspring, and selecting offspring plants that are identified as haploid by at least one method as plant haploids.

15. A plant haploid induction line prepared according to any one of claims 1-12.

16. The plant haploid induction line according to claim 15, characterized in that: The plant haploid induction line includes cells, tissues, and organs derived from the plant haploid induction line; the organs include seeds, leaves, fruits, flowers, stems, and roots.

17. The plant haploid induction line according to claim 15 or 16, characterized in that: The plant haploid induction line includes propagation material derived from the plant haploid induction line; the propagation material includes a population composed of pollen, ovary, ovule, plumule, endosperm, egg cell, root, root tip, hypocotyl, cotyledon, stem, leaf, flower, anther, seed, meristematic cells, protoplast, and cell tissue culture.

18. Plant haploids prepared according to the method of claim 13 or 14.

19. The plant haploid according to claim 18, characterized in that: The plant haploid includes cells, tissues, and organs derived from the plant haploid; the organs include seeds, leaves, fruits, flowers, stems, and roots.

20. The plant haploid according to claim 18 or 19, characterized in that: The plant haploid includes propagation material derived from the plant haploid; the propagation material includes pollen, ovary, ovule, plumule, endosperm, egg cell, root, root tip, hypocotyl, cotyledon, stem, leaf, flower, anther, seed, meristematic cells, protoplast and a population composed of cell tissue culture.

21. The AtDMP8 gene in the Arabidopsis mutant lines of claims 1-12, or the AtDMP9 gene in the Arabidopsis mutant lines of claims 1-12, or the SlDMP gene in the tomato mutant lines of claims 1-12.

22. Any one of the following applications (D1)-D5): D1) Application of the plant haploid induction line prepared according to any one of claims 1-12 in the cultivation of plant haploids; D2) The application of substances that silence or inhibit the expression and / or activity of AtDMP8 and / or AtDMP9 genes in the plant genome, or substances that knock out AtDMP8 and / or AtDMP9 genes, or substances that inhibit AtDMP8 protein and / or AtDMP8 protein activity in the cultivation of plant haploid induction lines or plant haploids. D3) The application of substances that silence or inhibit the expression and / or activity of the SlDMP gene in the plant genome, or knock out the SlDMP gene, or inhibit the activity of the SlDMP protein in the cultivation of haploid induction lines or plant haploids. D4) Application of AtDMP8 protein or related biological materials and / or AtDMP9 protein or related biological materials in regulating the induction rate of plant haploid induction lines or increasing the induction rate of plant haploid induction lines or in cultivating plant haploid induction lines or plant haploids. Application of D5)SlDMP protein or related biomaterials in regulating the induction rate of plant haploid induction lines, increasing the induction rate of plant haploid induction lines, or cultivating plant haploid induction lines or plant haploids. The AtDMP8 protein is the protein shown in a1), a2), a3), or a4) below: a1) The amino acid sequence is that of the protein shown in sequence 2; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 2; a3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 2. a4) Proteins that have 75% or more homology with the amino acid sequence shown in Sequence 2 and have the same function; The AtDMP9 protein is the protein shown in b1), b2), b3), or b4) below: b1) The amino acid sequence is that of the protein shown in sequence 4; b2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in sequence 4; b3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 4. b4) Proteins that have 75% or more homology with the amino acid sequence shown in sequence 4 and have the same function; The SlDMP protein is the protein shown as c1), c2), c3), or c4) below: c1) The amino acid sequence is the protein shown in sequence 6; c2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in Sequence 6; c3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in Sequence 6. c4) is a protein that has 75% or more homology with the amino acid sequence shown in Sequence 6 and has the same function.

23. The application according to claim 22, characterized in that: The AtDMP8 protein, AtDMP9 protein, or SlDMP protein-related biological material is any one of the following d1) to d12): d1) The nucleic acid molecule encoding the AtDMP8 protein, AtDMP9 protein, or SlDMP protein; d2) An expression cassette containing the nucleic acid molecule described in d1); d3) A recombinant vector containing the nucleic acid molecules described in d1); d4) A recombinant vector containing the expression cassette described in d2); d5) Recombinant microorganisms containing the nucleic acid molecules described in d1); d6) Recombinant microorganisms containing the expression cassette described in d2); d7) Recombinant microorganisms containing the recombinant vector described in d3); d8) Recombinant microorganisms containing the recombinant vector described in d4); d9) Transgenic plant cell lines containing the nucleic acid molecules described in d1); d10) Transgenic plant cell lines containing the expression cassette described in d2); d11) Transgenic plant cell lines containing the recombinant vector described in d3); d12) Transgenic plant cell lines containing the recombinant vector described in d4).

24. The application according to claim 23, characterized in that: d1) The nucleic acid molecule is a gene as shown in 1), 2), 3), or 4) below: 1) Its coding sequence is the cDNA molecule shown in sequence 1, sequence 3, or sequence 5; 2) A cDNA molecule or genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) and encodes the AtDMP8 protein, AtDMP9 protein or SlDMP protein. 3) cDNA or genomic DNA molecules derived from dicotyledonous plants and having 75% or more identity with the nucleotide sequence defined in 1), and encoding the AtDMP8, AtDMP9, or SlDMP proteins. 4) A cDNA molecule or genomic DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined in 1) or 2) or 3) and encodes the AtDMP8 protein or AtDMP9 protein or SlDMP protein.