Novel mdth variant and method for producing o-phosphoserine, cysteine, and derivate of cysteine using same
Patent Information
- Application Number
- MYPI2023007493
- Authority / Receiving Office
- MY · MY
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-06-11
- Filing Date
- 2021-09-06
- Publication Date
- 2026-08-10
- Estimated Expiration
- 2041-09-06
AI Technical Summary
Current methods for producing L-cysteine, particularly through the conversion of O-phosphoserine, require excessive precursor production and are not efficient in achieving high yields.
Development of novel MdtH variants with specific amino acid substitutions, such as replacing valine at the 125th position with isoleucine, to enhance O-phosphoserine production and excretion in microorganisms like E. coli, allowing for increased yields of cysteine and its derivatives.
The novel MdtH variants significantly improve O-phosphoserine production and excretion, leading to higher yields of cysteine and its derivatives compared to existing methods, optimizing the production process.
Abstract
Description
Novel MDTH variants and methods for producing O-phosphoserine, cysteine and derivatives thereof using the same
[0001] The present application relates to a MdtH mutant and a method for producing O-phosphoserine, cysteine and cysteine derivatives using the same.
[0002]
[0003] L-cysteine is an important amino acid in sulfur metabolism in all living organisms, and is used in the synthesis of proteins in the body, such as keratin in hair, glutathione, biotin, methionine, and other sulfur-containing metabolites, as well as a precursor for coenzyme A biosynthesis.
[0004] Methods for producing L-cysteine using microorganisms are known, including 1) a method for biologically converting D,L-ATC (D,L-2-aminothiazoline-4-carboxylic acid) using microorganisms, 2) a direct fermentation method for producing L-cysteine using Escherichia coli (European Patent No. EP0885962B; Wada M and Takagi H, Appl. Microbiol. Biochem., 73:48-54, 2006), and 3) a method for fermenting O-phosphoserine (hereinafter "OPS") using microorganisms and then reacting it with sulfide under the catalytic action of O-phosphoserine sulfhydrylase (hereinafter "OPSS") to convert it into L-cysteine (European Patent Publication No. EP 2444481).
[0005] However, due to the increasing demand for L-cysteine, research on effective L-amino acid production methods is still necessary. In particular, in order to produce high yields of cysteine using the above method 3), there was a need to produce an excessive amount of the precursor OPS.
[0006]
[0007] The present inventors have made efforts to produce OPS, a precursor of cysteine, in large quantities in order to produce cysteine at high yields, and have completed the present application by confirming that a novel MdtH variant improves OPS production capacity.
[0008]
[0009] One object of the present application is to provide an MdtH mutant in which the amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.
[0010] Another object of the present application is to provide a polynucleotide encoding a variant of the present application.
[0011] Another object of the present application is to provide a vector comprising the polynucleotide of the present application.
[0012] Another object of the present application is to provide a recombinant Escherichia genus microorganism comprising an MdtH mutant in which the amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, or a polynucleotide encoding the mutant.
[0013] Another object of the present application is to provide a method for producing O-phosphoserine, comprising the step of culturing a microorganism including an MdtH variant in which the amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid or a polynucleotide encoding the variant in a medium.
[0014] Another object of the present application is to provide a method for producing cysteine or a derivative thereof, comprising the steps of: a) culturing a microorganism including an MdtH mutant in which the amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid or a polynucleotide encoding the mutant in a medium to produce O-phosphoserine or a medium containing the same; and b) reacting O-phosphoserine sulfliydrylase (OPSS) or a microorganism expressing the same and the O-phosphoserine produced in step a) or a medium containing the same with sulfide.
[0015]
[0016] When a microorganism having OPS production ability is cultured using a mutant polypeptide having novel OPS release activity of the present application, high yield OPS production is possible compared to when using an existing unmodified or mutant protein.
[0017]
[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.
[0019]
[0020] One embodiment of the present application is an MdtH mutant in which the amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.
[0021] In one embodiment, the other amino acid may be isoleucine.
[0022]
[0023] The variant of the present application may be a variant in which valine, an amino acid corresponding to the 125th position of the amino acid sequence described in SEQ ID NO: 1, which is the parent sequence, is substituted with isoleucine, and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or less than 100% homology or identity with the amino acid sequence described in SEQ ID NO: 1. For example, the variant of the present application may have or include an amino acid sequence in which the amino acid corresponding to the 125th position based on the amino acid sequence of SEQ ID NO: 1 in the amino acid sequence described in SEQ ID NO: 1 is isoleucine, and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or less than 100% homology or identity with the amino acid sequence described in SEQ ID NO: 1, or may consist of or consist essentially of the amino acid sequence described above. In addition, it is obvious that a variant having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the variant of the present application.
[0024] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the variant of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.
[0025]
[0026] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.
[0027]
[0028] As used herein, the term "variant" refers to a protein in which one or more amino acids in the parent sequence of a specific protein are conservatively substituted and / or modified, resulting in a sequence different from the parent sequence but retaining the functions or properties of the specific protein. A variant differs from the identified sequence by several amino acid substitutions, deletions, or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the specific protein and evaluating the properties of the modified protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the native protein. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The term "variant" above may be used with terms such as variant, modification, mutated protein, mutated polypeptide, mutation, etc. (in English, it may be expressed as modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.), and is not limited thereto as long as it is a term used in the meaning of mutation. For the purpose of the present application, the variant may be a mutated protein with increased activity compared to the natural wild-type or unmodified protein, but is not limited thereto.
[0029] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.
[0030]
[0031] In the present application, the term "parent sequence" refers to a reference sequence into which a modification is introduced to become a mutant polypeptide. That is, the parent sequence may be a starting sequence and may be a target for introducing mutations such as substitutions, insertions, and / or deletions. The parent sequence may be a naturally occurring or wild type, or a variant in which one or more substitutions, insertions, or deletions have occurred in the natural or wild type, or may be an artificially synthesized sequence.
[0032]
[0033] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.
[0034] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.
[0035] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.
[0036] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0037]
[0038] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.
[0039] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).
[0040] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.
[0041] In the present application, the term "MdtH" refers to a type of Major facilitator superfamily (MFS) transporter, a superfamily of membrane transport proteins that facilitate the movement of small solutes across the cell membrane in response to a chemical requirement gradient, and is known as a protein that exhibits OPS export activity from Escherichia coli in which growth inhibition is lifted under conditions in which an excess of OPS is present. In the present application, the MdtH may refer to a membrane protein having the activity of exporting O-phosphoserine (OPS) out of the cell. The sequence of the MdtH can be obtained from the NCBI GenBank, a known database. For example, the MdtH may be a polypeptide having OPS export activity encoded by the mdtH gene, but is not limited thereto.
[0042] The variant of the present invention may have an activity that increases OPS excretion capacity compared to the wild type polypeptide.
[0043]
[0044] The term "O-phosphoserine (hereinafter referred to as "OPS")" in this application is a phosphoric acid ester of serine, which is a component of various proteins. OPS is a precursor of L-cysteine, and can be converted into cysteine by reacting with sulfide under the catalytic action of OPS sulfhydrylase (OPSS), but is not limited thereto (US Patent Publication No. US 2012-0190081).
[0045]
[0046] The variant of the present application may further have one or more amino acids among the amino acids corresponding to positions 60, 180, and 398 in the amino acid sequence of SEQ ID NO: 1 substituted with another amino acid. For example, the variant of the present application may have one in which the amino acid corresponding to position 125 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, and additionally, one or more, two or more, or three amino acids among the amino acids corresponding to positions 60, 180, and 398 are substituted with another amino acid, but is not limited thereto.
[0047] Specifically, the variant of the present application may be a variant polypeptide exhibiting OPS excretion activity, wherein i) valine, which is an amino acid residue corresponding to position 125 from the N-terminus of the amino acid sequence of SEQ ID NO: 1, is substituted with an amino acid residue other than valine, or additionally ii) glutamine, which is an amino acid residue corresponding to position 60, iii) phenylalanine, which is an amino acid residue corresponding to position 180, and / or iv) leucine, which is an amino acid residue corresponding to position 398, are each substituted with a different amino acid residue.
[0048] From the N-terminus of the amino acid sequence of the above sequence number 1, i) amino acids other than valine, which is an amino acid residue corresponding to the 125th position, include glycine, alanine, leucine, isoleucine, serine, proline, phenylalanine, tryptophan, methionine, arginine, threonine, cysteine, tyrosine, asparagine, glutamine, lysine, histidine, aspartic acid and glutamic acid, ii) amino acids other than glutamine, which is an amino acid residue corresponding to the 60th position, include glycine, alanine, leucine, isoleucine, serine, proline, phenylalanine, tryptophan, methionine, arginine, threonine, cysteine, tyrosine, asparagine, valine, lysine, histidine, aspartic acid and glutamic acid, iii) amino acids other than phenylalanine, which is an amino acid residue corresponding to the 180th position, include glycine, alanine, leucine, isoleucine, serine, proline, valine, tryptophan, methionine, arginine, threonine, cysteine, tyrosine, asparagine, glutamine, lysine, histidine, aspartic acid and glutamic acid, and / or iv) amino acids other than leucine, which are amino acid residues corresponding to position 398, may include, but are not limited to, glycine, alanine, isoleucine, serine, proline, phenylalanine, valine, tryptophan, methionine, arginine, threonine, cysteine, tyrosine, asparagine, glutamine, lysine, histidine, aspartic acid and glutamic acid.
[0049] More specifically, the variant of the present application may be such that i) the amino acid residue corresponding to position 125, which is valine, is substituted with isoleucine from the N-terminus of the amino acid sequence of SEQ ID NO: 1, or additionally ii) the amino acid residue corresponding to position 60 is glutamine or arginine, iii) the amino acid residue corresponding to position 180 is phenylalanine or leucine, and iv) the amino acid residue corresponding to position 398 is leucine or proline.
[0050] More specifically, the variant of the present application may be one in which, from the N-terminus of the amino acid sequence of SEQ ID NO: 1, i) valine, which is an amino acid residue corresponding to position 125, is substituted with isoleucine, or, additionally, ii) glutamine, which is an amino acid corresponding to position 60, is substituted with arginine, iii) phenylalanine, which is an amino acid corresponding to position 180, is substituted with leucine, and / or iv) leucine, which is an amino acid corresponding to position 398, is substituted with proline.
[0051] In one embodiment, the variant of the present application may be a variant consisting of an amino acid sequence having at least 99% sequence identity with any one or more amino acid sequences selected from SEQ ID NO: 2 or SEQ ID NO: 3.
[0052] In addition, the variant of the present application may have, include, consist of, or consist essentially of one or more amino acid sequences selected from SEQ ID NO: 2 or SEQ ID NO: 3, but is not limited thereto.
[0053]
[0054] Another aspect of the present application is a polynucleotide encoding a variant of the present application.
[0055] The above mutant is as described above.
[0056]
[0057] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.
[0058] The polynucleotide encoding the variant of the present application may comprise a base sequence encoding an amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 3. As an example of the present application, the polynucleotide of the present application may have or comprise a nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5. In addition, the polynucleotide of the present application may consist of, or consist essentially of, a nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5.
[0059] The polynucleotide of the present application may have various modifications made to the coding region within a range that does not change the amino acid sequence of the variant of the present application, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present application. Specifically, the polynucleotide of the present application may have or include a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and less than 100% homology or identity with the nucleic acid base sequence of SEQ ID NO: 4 or SEQ ID NO: 5, or may consist of or consist essentially of a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, and less than 100% homology or identity with the nucleic acid base sequence of SEQ ID NO: 4 or SEQ ID NO: 5, but is not limited thereto. At this time, in the sequence having the above homology or identity, the codon encoding the amino acid corresponding to the 125th position of sequence number 1 may be one of the codons encoding isoleucine.
[0060] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1YSSC, 0.1% SDS, specifically 60°C, 0.1YSSC, 0.1% SDS, and more specifically 68°C, 0.1YSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, are performed.
[0061] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.
[0062] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.
[0063] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).
[0064]
[0065] Another aspect of the present application is a vector comprising the polynucleotide of the present application. The vector may be an expression vector for expressing the polynucleotide in a host cell, but is not limited thereto.
[0066] The above polynucleotide is as described above.
[0067]
[0068] The vector of the present application may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.
[0069] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, pSK series, pSKH series, and pET series can be used as plasmid vectors. Specifically, pCL, pDC, pDCM2, pSK, pSKH130, pDZ, pACYC177, pACYC184, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.
[0070] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.
[0071] The term "transformation" in this application refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.
[0072] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present application.
[0073]
[0074] Another aspect of the present application is a microorganism of the genus Escherichia, comprising an MdtH variant in which the amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, or a polynucleotide encoding the variant.
[0075] The strain of the present application may comprise a variant polypeptide of the present application, a polynucleotide encoding the polypeptide, and / or a vector comprising the polynucleotide of the present application.
[0076] The above mutants, polynucleotides and vectors are as described above.
[0077] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that has a specific mechanism weakened or strengthened due to causes such as insertion of an external gene or enhanced or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product.
[0078] The strain of the present application may be, but is not limited to, a strain comprising at least one of the variant of the present application, the polynucleotide of the present application, and a vector comprising the polynucleotide of the present application; a strain modified to express the variant of the present application or the polynucleotide of the present application; a strain (e.g., a recombinant strain) expressing the variant of the present application or the polynucleotide of the present application; or a strain (e.g., a recombinant strain) having the activity of the variant of the present application.
[0079] The strain of the present application may be a strain having OPS excretion ability.
[0080] The strain of the present application may be a microorganism that naturally has the ability to excrete MdtH or OPS, or a parent strain that does not have the ability to excrete MdtH or OPS, into which the variant of the present application or a polynucleotide encoding the same (or a vector including the polynucleotide) is introduced and / or OPS excretion ability is conferred, but is not limited thereto.
[0081] For example, the strain of the present application is a cell or microorganism that is transformed with a vector including a polynucleotide encoding the polynucleotide of the present application or a variant of the present application, and expresses the variant of the present application. For the purpose of the present application, the strain of the present application may include all microorganisms capable of excreting OPS, including the variant of the present application. For example, the strain of the present application may be a recombinant strain in which a polynucleotide encoding the variant of the present application is introduced into a natural wild-type microorganism or a microorganism that excretes OPS, thereby expressing an MdtH variant and thus having an increased OPS excretion ability. The recombinant strain in which the OPS excretion ability is increased may be a microorganism in which the OPS excretion ability is increased compared to a natural wild-type microorganism or an MdtH-unmodified microorganism (i.e., a microorganism expressing wild-type MdtH (SEQ ID NO: 1) or a microorganism that does not express a variant (SEQ ID NO: 2 or SEQ ID NO: 3) protein), but is not limited thereto. For example, the MdtH non-modified microorganism, which is the target strain for comparing whether the OPS excretion ability increases, may be CA07-0012 (KCCM 11121P, European Patent Publication No. EP 2444481 or US Publication No. 2012-0190081), a strain with weakened activity of endogenous phosphoserine phosphatase (serB), but is not limited thereto.
[0082] For example, a recombinant strain having increased OPS production ability due to the increase in OPS excretion ability has an OPS production ability of about 1% or more, specifically, about 1% or more, about 2.5% or more, about 5% or more, about 7.5% or more, about 10% or more, about 12.5% or more, about 15% or more, about 17.5% or more, about 20% or more, about 22.5% or more, about 25% or more, about 27.5% or more, about 30% or more, about 32.5% or more, about 35% or more, about 37.5% or more, about 40% or more, about 42.5% or more, about 45% or more, about 47.5% or more, about 50% or more, about 52.5% or more, about 55% or more, about 57.5% or more, about 60% or more, About 62.5% or more, about 65% or more, about 67.5% or more, about 70% or more, about 72.5% or more, about 75% or more, about 77.5% or more, about 80% or more, about 82.5% or more, about 90% or more, about 92.5% or more, about 95% or more, about 97.5% or more, about 100% or more, about 102.5% or more, about 105% or more, about 107.5% or more, about 110% or more, about 112.5% or more, about 115% or more, about 117.5% or more, about 120% or more, about 122.5% or more, about 125% or more, about 127.5% or more, about 130% or more, about 132.5% or more, about 135% or more, or about 137% The OPS production capacity may be increased by more than about 300% (the upper limit is not particularly limited, for example, about 300% or less, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, or about 30% or less), but is not limited thereto, as long as it has a positive increase compared to the production capacity of the parent strain or the unmodified microorganism before mutation. In another example, the recombinant strain having increased OPS production capacity due to the increase in OPS excretion capacity has an OPS production capacity of about 1.01 times or more, about 1.025 times or more, or about 1.0.5 times or more, about 1.075 times or more, about 1.10 times or more, about 1.125 times or more, about 1.15 times or more, about 1.175 times or more, about 1.20 times or more, about 1.225 times or more, about 1.25 times or more, about 1.275 times or more, about 1.30 times or more, about 1.325 times or more, about 1.35 times or more, about 1.375 times or more, about 1.50 times or more, about 1.525 times or more, about 1.55 times or more, about 1.60 times or more, about 1.625 times or more, about 1.65 times or more, about 1.675 times or more, about 1.70 times or more, about 1.725 times or more, about 1.75 times or more, about 1.775 times or more, about 1.8 times or more, about 1.825 times or more, about 1.85 times or more, about 1.875 times or more, about 1.90 times or more, about 1.925 times or more, about, 1.95 times or more, about 1.975 times or more, about 2.0 times or more, about 2.025 times or more, about 2.05 times or more, about 2.075 times or more, about 2.10 times or more, about 2.125 times or more, about 2.15 times or more, about 2.175 times or more, about 2.20 times or more, about 2.225 times or more, about 2.25 times or more, about 2.275 times or more, about 2.30 times or more, about 2.325 times or more, about 2.35 times or more, or about 2.37 times or more (the upper limit is not particularly limited, for example, about 10 times or less, about 5 times or less, about 3 times The term "about" includes, but is not limited to, a range including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes, but is not limited to, a range of values equal to or similar to the value following the term "about."
[0083] In this application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. For example, the unmodified microorganism may refer to a strain that has not been introduced or before the MdtH variant described herein is introduced. The "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."
[0084] As another example of the present application, the microorganism of the present application is not particularly limited in type as long as it can produce OPS, and can be either a prokaryotic cell or a eukaryotic cell, but specifically can be a prokaryotic cell. The prokaryotic cell may include, for example, a microbial strain belonging to the genus Escherichia, the genus Erwinia, the genus Seratia, the genus Providencia, the genus Corynebacterium, and the genus Brevibacterium, and specifically can be a microorganism of the genus Escherichia, more specifically, Escherichia coli, but is not limited thereto.
[0085]
[0086] In particular, in the case of the Escherichia genus microorganism of the present application, OPS and L-serine can be produced through SerA, SerC, and SerB, which are enzymes of the L-serine biosynthetic pathway (Ahmed Zahoor, Computational and structural biotechnology journal, vol 3, 2012 October; Wendisch VF et al., Curr Opin Microbiol. 2006 Jun;9(3):268-74; Peters-Wendisch P et al., Appl Environ Microbiol. 2005 Nov;7 1( ll):7 139-44.). Since SerB, a phosphoserine phosphatase, has the activity of converting OPS into L-serine, a microorganism mutated to have weakened SerB activity has the characteristic of accumulating OPS and can be usefully used for the production of OPS. For example, the microorganism of the present application may be a recombinant microorganism in which, in addition to introducing the mutant of the present application, the activity of SerB is further weakened compared to the intrinsic activity.
[0087] The SerB of the present application may be, but is not limited to, a protein having or including an amino acid sequence described in NCBI Accession No. AAC77341.1, or a protein consisting of or consisting essentially of an amino acid sequence described in AAC77341.1. In addition, the SerB of the present application may have or include an amino acid sequence that is at least 70%, 80%, 90%, 95%, or 99% homologous or identical to the amino acid sequence described in AAC77341.1, as long as it exhibits the activity of converting OPS into L-serine. In addition, the SerB of the present application may be, but is not limited to, consisting of or consisting essentially of an amino acid sequence that is at least 70%, 80%, 90%, 95%, or 99% homologous or identical to the amino acid sequence described in AAC77341.1.
[0088] In addition, the polynucleotide encoding SerB of the present application may have or include a base sequence described in NCBI NP_415583.4. The polynucleotide encoding SerB of the present application may have or include a base sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the base sequence of NP_415583.4, but less than 100%. In addition, the polynucleotide encoding SerB of the present application may be composed of or consist essentially of a base sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the base sequence of NP_415583.4, but is not limited thereto.
[0089]
[0090] In this application, the term "enhancement" of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The "intrinsic activity" refers to the activity of a specific polypeptide that was originally present in a parent strain or unmodified microorganism before the trait change, when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "pre-modification activity." "Enhanced," "upregulated," "overexpressed," or "increased" the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.
[0091] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.
[0092] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0093] Specifically, the enhancement of the polypeptide activity of the present application is
[0094] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;
[0095] 2) Modification of the gene expression control region on the chromosome encoding the polypeptide;
[0096] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0097] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;
[0098] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);
[0099] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;
[0100] 7) Codon optimization of a polynucleotide encoding a polypeptide;
[0101] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or
[0102] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.
[0103] More specifically,
[0104] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.
[0105] The above 2) modification of the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, replacement with a sequence having stronger activity, or insertion thereof. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.
[0106] Examples of known strong promoters include, but are not limited to, the cj1 to cj7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.
[0107] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0108] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not the chromosome has been inserted. The selection marker is as described above.
[0109] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.
[0110] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.
[0111] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.
[0112] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.
[0113]
[0114] In this application, the term "attenuation" of polypeptide activity encompasses both a decrease in activity or the absence of activity compared to the intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
[0115] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification." The term "inactivation, deficiency, reduction, downregulation, deterioration, attenuation" of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had prior to the transformation.
[0116] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
[0117]
[0118] Specifically, the weakening of the polypeptide activity of the present application is
[0119] 1) Deletion of all or part of a gene encoding a polypeptide;
[0120] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;
[0121] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;
[0122] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);
[0123] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0124] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;
[0125] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;
[0126] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or
[0127] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.
[0128] for example,
[0129] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.
[0130] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0131] In addition, the above 5) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0132] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 3) and 4) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of a gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.
[0133] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
[0134] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.
[0135] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.
[0136]
[0137] In the microorganism of the present application, modification of part or all of the polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.
[0138]
[0139] Additionally, the above microorganism may be a microorganism that further reduces the ability of OPS to enter and decompose cells.
[0140] In addition to the above-described contents regarding the OPS producing microorganism, contents disclosed in European Patent Publication No. EP 2444481 or U.S. Publication No. 2012-0190081 may be used as reference material for this application, but are not limited thereto.
[0141] In the microorganism of the present application, the mutant, polynucleotide, OPS, etc. are as described in the other aspects above.
[0142]
[0143] Another aspect of the present application is a method for producing O-phosphoserine, comprising the step of culturing a microorganism including an MdtH variant in which the amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid or a polynucleotide encoding the variant in a medium.
[0144] The OPS production method of the present application may include a step of culturing a microorganism including a variant of the present application, a polynucleotide of the present application, or a vector of the present application in a medium.
[0145] The term "cultivation" in this application refers to growing the microorganisms of this application under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0146] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the microorganism of this application, and supplies nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.
[0147] Carbon sources included in the above medium may include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid, and these substances may be used individually or as a mixture, but are not limited thereto.
[0148] The nitrogen sources included in the above medium may include organic nitrogen sources such as peptone, yeast extract, meat juice, malt extract, corn steep liquor, and soybean meal, and inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, and these nitrogen sources may be used alone or in combination, but are not limited thereto.
[0149] The above-mentioned agents may include, but are not limited to, potassium dihydrogen phosphate, potassium dihydrogen phosphate and corresponding sodium-containing salts.
[0150] Additionally, the medium may contain metal salts such as magnesium sulfate or iron sulfate, and may also contain amino acids, vitamins, and appropriate precursors. These media or precursors may be added to the culture in batch or continuous manner, but are not limited thereto.
[0151] During cultivation, chemicals such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be added to the culture in an appropriate manner to adjust the pH of the culture. Furthermore, foaming can be suppressed during cultivation using an antifoaming agent such as fatty acid polyglycol ester. Furthermore, to maintain aerobic conditions in the medium, oxygen or oxygen-containing gas can be injected into the medium, or to maintain anaerobic and microaerobic conditions, no gas can be injected, or nitrogen, hydrogen, or carbon dioxide can be injected, but is not limited thereto.
[0152] In the cultivation of the present application, the cultivation temperature may be maintained at 25°C to 40°C, specifically 30°C to 35°C, and the cultivation period may continue until the desired amount of useful material is produced, but may be specifically 10 to 100 hours. However, the present invention is not limited to these examples.
[0153] The OPS produced by the culture of the present application can be secreted into the medium.
[0154]
[0155] The OPS production method of the present application may additionally include a step of preparing the microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, before the culturing step.
[0156] The OPS production method of the present application may additionally include a step of recovering OPS from the culture medium (medium in which culture is performed) or the microorganism of the present application. The recovering step may be additionally included after the culturing step.
[0157] The method for recovering the above OPS may be to collect the target OPS using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target OPS may be recovered from the medium or microorganism using a suitable method known in the art.
[0158] Additionally, the OPS production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the OPS production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.
[0159] In the method of the present application, the variant, polynucleotide, vector, strain, etc. are as described in the other aspects above.
[0160]
[0161] Another aspect of the present application is a method for producing cysteine or a derivative thereof.
[0162] Specifically, the method may include a) culturing a microorganism including an MdtH variant in which an amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid or a polynucleotide encoding the variant in a medium to produce O-phosphoserine or a medium containing the same; and b) reacting O-phosphoserine sulfliydrylase (OPSS) or a microorganism expressing the same and the O-phosphoserine produced in step a) or a medium containing the same with sulfide.
[0163]
[0164] In this application, the term "derivative" means a similar compound obtained by chemically changing a part of a compound, usually a compound in which a hydrogen atom or a specific atomic group in the compound is replaced by another atom or atomic group.
[0165]
[0166] In this application, the term “cysteine derivative” means a compound in which a hydrogen atom or a specific atomic group of cysteine is replaced by another atom or atomic group. For example, it may be in the form of another atom or atomic group being attached to the nitrogen atom of the amine group (-NH 2) of cysteine or the sulfur atom of the thiol group (-SH), and examples thereof include, but are not limited to, NAC (N-acetylcysteine), SCMC (S-Carboxymetylcysteine), BOC-CYS(ME)-OH, (R)-S-(2-Amino-2-carboxyethyl)-L-homocysteine, (R)-2-Amino-3-sulfopropionic acid, D-2-Amino-4-(ethylthio)butyric acid, 3-sulfino-L-alanine, Fmoc-Cys(Boc-methyl)-OH, Seleno-L-cystine, S-(2-Thiazolyl)-L-cysteine, S-(2-Thienyl)-L-cysteine, S-(4-Tolyl)-L-cysteine, etc.
[0167] If cysteine is produced according to the method of the present application, conversion into cysteine derivatives can be easily achieved by methods widely known in the art.
[0168] Specifically, the method for producing the cysteine derivative may further include a step of converting the cysteine produced in step b) into a cysteine derivative. For example, N-acetylcysteine (NAC) may be synthesized by reacting cysteine with an acetylation agent, or S-Carboxymetylcysteine (SCMC) may be synthesized by reacting cysteine with a haloacetic acid under basic conditions, but is not limited thereto.
[0169] The above cysteine derivatives can be used primarily as pharmaceutical raw materials, as antitussives, cough relievers, and as treatments for bronchitis, bronchial asthma, and pharyngitis, but are not limited thereto.
[0170]
[0171] In this application, the term "O-phosphoserine sulfhydrylase (OPSS)" refers to an enzyme that catalyzes a reaction that converts OPS into cysteine by providing a thiol group (SH group) to the OPS. The enzyme may have been first discovered in Aeropymm pernix, Mycobacterium tuberculosis, Mycobacterium megmatics, and Trichomonas vaginalis (Mino K and Ishikawa K, FEBSletters, 551:133-138, 2003; Bums KE et al. J. Am. Chem. Soc, 127: 11602-11603, 2005). In addition, the OPSS includes not only the wild-type OPSS protein, but also a mutant protein having a sequence in which a part of the polynucleotide sequence encoding the OPSS is deleted, substituted, or added, and exhibits an activity equivalent to or greater than the biological activity of the wild-type OPSS protein, and may also include all of the OPSS proteins disclosed in European Patent Publication No. EP 2444481 and U.S. Patent No. US 9127324 and their mutant proteins.
[0172] The above sulfide is provided in the form of a liquid or gas due to differences in pH, pressure, and solubility, as well as in the solid form commonly used in the relevant technical field, and is sulfide (S 2- ), thiosulfate (S203) 2-) etc., any sulfide that can be converted into a thiol group (SH group) can be used without limitation. Specifically, Na2S, NaSH, H2S, (NH4)2S, NaSH and Na2S2O3 that provide a thiol group to OPS can be used, but are not limited thereto. The above reaction is a reaction that provides one thiol group to one OPS reactor to produce one cysteine or cysteine derivative, and the amount of sulfide added during the reaction may be 0.1 to 3 times the molar concentration of OPS, specifically, 1 to 2 times, but is not limited thereto.
[0173] Additionally, the present application may further include a step of recovering cysteine produced through the above reaction step. At this time, the desired cysteine may be separated, purified, and collected from the reaction solution using a suitable reaction known in the art.
[0174]
[0175] Another aspect of the present application is a composition for producing OPS, comprising a microorganism comprising an MdtH variant in which the amino acid corresponding to position 125 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, or a polynucleotide encoding the variant; a medium for culturing the same; or a combination of two or more thereof.
[0176] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing OPS, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.
[0177] In the composition of the present application, the variant, polynucleotide, vector, strain, medium, OPS, etc. are as described in the other aspects above.
[0178]
[0179] Another aspect of the present application is the use of the mutant polypeptide of the present application for producing OPS, cysteine or derivatives of cysteine, which exhibit OPS efflux activity.
[0180] Another aspect of the present application is the use of a polypeptide having a mutant polypeptide exhibiting OPS excretion activity of the present application for excreting OPS from a microorganism.
[0181] In the purposes of the present application, the variants, polynucleotides, vectors, strains, media, OPS, etc. are as described in the other aspects above.
[0182]
[0183] The present application is described in more detail below through examples. However, these examples are intended to exemplify the present application and are not intended to limit the scope of the present application to these examples.
[0184]
[0185] Example 1: Construction and screening of mdtH library
[0186] To select MdtH mutants with increased OPS excretion activity, a library of mdtH gene mutant plasmids was constructed. The specific process is as follows.
[0187] Random mutagenesis PCR was performed using the genomic DNA of E. coli K12 W3110 (Genbank: NC_007779.1) as a template and primer pairs (primer 3 and 8) of sequence numbers 9 and 10 (Takara Diversify PCR random mutagenesis kit, Cat no. 630703).
[0188] PCR was performed by denaturing at 94°C for 5 minutes, repeating 20 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, and then polymerization at 72°C for 5 minutes.
[0189] To insert the mutant gene fragments produced through this process into the pCL1920 vector (GenBank No. AB236930) containing the trc promoter, pCL_Ptrc was first produced. To secure the trc promoter fragment, PCR was performed using the primer pair (primer 1 and 2) of SEQ ID NO: 7 and 8. The PCR was performed by denaturing at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes.
[0190] The primer sequences used here are as shown in Table 1 below.
[0191]
[0192] SEQ ID NO: SEQ ID NO: Sequence 7primer 1CACAGGAAAGATAtcatgTCCCGCGTGTCGCAGGC8primer 2TTGCATGCCTGCAtcaGGCGTCGCGTTC9primer 3CACAGGAAAGATAtcatgTCCCGCGTGTCGCAGGC10primer 8CTTGCATGCCTGCAGGGCAGTAAGGGCAGTGATC
[0193] The trc promoter fragment was cloned into the pCL1920 vector digested with EcoRI and SalI using an infusion cloning kit (Clontech Laboratories, Inc.), and pCL_Ptrc was obtained. The obtained pCL_Ptrc vector was digested with PstI and EcoRV, and the mutant gene fragments obtained through the PCR were cloned using the infusion cloning kit. Cloning was performed by reacting at 50°C for 60 minutes, and through this, the pCL_Ptrc-mdtH gene mutant plasmid library was constructed.
[0194] The constructed pCL_Ptrc-mdtH gene mutant plasmid library was transformed into CA07-0012 (KCCM 11121P, European Patent Publication No. EP 2444481 or US Publication No. 2012-0190081) by electroporation. Two strains containing mutants were selected, and plasmids were obtained from these, and the base sequences were analyzed using sequencing techniques.
[0195] As a result of base sequence analysis, it was confirmed that the two selected mutants were a mutant in which valine at the 125th amino acid residue was substituted with isoleucine in the amino acid sequence of wild-type MdtH [mdtH(V125I)], and a mutant in which glutamine at the 60th amino acid residue was substituted with arginine, valine at the 125th amino acid residue was substituted with isoleucine, phenylalanine at the 180th amino acid residue was substituted with leucine, and leucine at the 398th amino acid residue was substituted with proline [mdtH(Q60R, V125I, F180L, L398P)]. The strain CA07-0012 / pCL_Ptrc-mdtH(V125I) transformed with the above mutant mdtH(V125I) was named E. coliCA07-0379, and the strain CA07-0012 / pCL_Ptrc-mdtH(Q60R, V125I, F180L, L398P) transformed with the above mutant mdtH(Q60R, V125I, F180L, L398P) was named E. coliCA07-0380.
[0196]
[0197] Example 2: Evaluation of OPS production capacity of strains introducing MdtH mutants
[0198] The OPS production ability of the strain into which the MdtH mutant was introduced was evaluated using the following medium (Table 2).
[0199]
[0200] Medium ingredients preparation amount Glucose 40g KH2PO4(KP1) 6g (NH4)2SO4 17g MgSO4.7H2O 1g MnSO4.4H2O 5mg FeSO4.7H2O 10mg L-glycine 2.5g / L Homo extract 3g / LCaCO 330g / L pH 6.8
[0201] Specifically, each strain was plated onto LB solid medium and cultured overnight in an incubator at 33°C. The strains cultured overnight on LB solid medium were inoculated into 25 mL of the titer medium in Table 2, which was then cultured in an incubator at 33°C and 200 rpm for 48 hours, and the OPS production ability was evaluated, and the results are shown in Table 3 below.
[0202]
[0203] Strain OPS concentration (g / L) CA07-0012 / pCL_Ptrc-mdtH 1.9 CA07-0012 / pCL_Ptrc-mdtH (V125I) 3.4 CA07-0012 / pCL_Ptrc-mdtH (Q60R, V125I, F180L, L398P) 4.5
[0204] As a result, strain CA07-0012 / pCL_Ptrc-mdtH(V125I) into which mdtH(V125I) was introduced showed about 180% of the productivity compared to strain CA07-0012 / pCL_Ptrc-mdtH into which wild-type mdtH was introduced. In addition, strain CA07-0012 / pCL_Ptrc-mdtH(Q60R, V125I, F180L, L398P) into which mdtH(Q60R, V125I, F180L, L398P) was introduced showed about 237% of the productivity compared to strain CA07-0012 / pCL_Ptrc-mdtH.
[0205] The above CA07-0012 / pCL_Ptrc-mdtH(V125I) was named CA07-0379, and CA07-0012 / pCL_Ptrc-mdtH(Q60R, V125I, F180L, L398P) was named CA07-0380.
[0206]
[0207] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.
Claims
1. An MdtH mutant in which the amino acid corresponding to position 125 of the amino acid sequence of sequence number 1 is replaced with a different amino acid.
2. An MdtH mutant in claim 1, wherein the other amino acid is isoleucine.
3. An MdtH mutant in the second paragraph, wherein the amino acid corresponding to the 125th position is valine.
4. In the first paragraph, the MdtH mutant has O-phosphoserine excretion activity.
5. In the first paragraph, the MdtH variant is an amino acid corresponding to the 60th position in the amino acid sequence of the sequence number 1, which is glutamine or arginine.
6. In the first paragraph, the MdtH mutant is an amino acid corresponding to the 180th position in the amino acid sequence of sequence number 1, which is phenylalanine or leucine.
7. In the first paragraph, the MdtH mutant is an amino acid corresponding to position 398 in the amino acid sequence of sequence number 1, which is leucine or proline.
8. An MdtH variant in the first paragraph, wherein the variant has a sequence identity of 80% or more and less than 100% with the amino acid sequence described in SEQ ID NO:
1.
9. In the first paragraph, the MdtH variant is composed of a polypeptide having an amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO:
3.
10. A polynucleotide encoding the variant of paragraph 1.
11. A recombinant Escherichia genus microorganism comprising an MdtH variant in which the amino acid corresponding to position 125 of the amino acid sequence of sequence number 1 is replaced with another amino acid, or a polynucleotide encoding the variant.
12. In the 11th paragraph, the recombinant microorganism is a microorganism in which the activity of phosphoserine phosphatase (SerB) is further weakened compared to the endogenous activity.
13. A method for producing O-phosphoserine, comprising the step of culturing a microorganism containing an MdtH variant in which the amino acid corresponding to the 125th position of the amino acid sequence of sequence number 1 is substituted with another amino acid or a polynucleotide encoding the variant in a medium. 14.a) A step of culturing a microorganism containing an MdtH variant in which the amino acid corresponding to the 125th position of the amino acid sequence of sequence number 1 is substituted with another amino acid or a polynucleotide encoding the variant in a medium to produce O-phosphoserine or a medium containing the same; and b) A method for producing cysteine or a derivative thereof, comprising a step of reacting O-phosphoserine sulfliydrylase (OPSS) or a microorganism expressing the same and a medium containing the O-phosphoserine produced in step a) with sulfide.
15. Use for producing OPS, cysteine or derivatives of cysteine of an MdtH variant in which the amino acid corresponding to the 125th position of the amino acid sequence of sequence number 1 is replaced with another amino acid.
16. Use of an MdtH mutant in which the amino acid corresponding to position 125 of the amino acid sequence of sequence number 1 is replaced with another amino acid, for excreting OPS from a microorganism.