Microorganism with reduced mucilage production ability and fermented soy product obtained using same

Abstract

The present invention relates to microorganisms with reduced mucilage production ability, a method for producing fermented soy product using same, fermented soy product produced thereby, and uses thereof.

Description

Microorganisms with reduced mucilage production capacity and soybean fermentation products using the same

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority from Republic of Korea Patent Application No. 10-2020-0142298, dated October 29, 2020, the entire contents of which are incorporated herein by reference.

[0003] The present invention relates to a microorganism having reduced mucilage production ability, a method for producing a soybean fermentation product using the same, and a soybean fermentation product produced in this manner and its use.

[0004]

[0005] As diseases such as mad cow disease, which are fatal to humans, are determined to be caused by animal protein added to feed, there is a continuous movement around the world to replace animal protein added to feed with plant-based protein.

[0006] Among the plant-based protein sources used as a substitute for animal proteins such as fishmeal, meat and bone meal, and plasma in the feed market, defatted soybean meal (hereinafter referred to as "soybean meal") accounts for the largest proportion. Soybean meal, also known as soybean cake, is the residue left after soybean oil is extracted. On a dry basis, soybean meal contains 55-56% protein by weight, 13-14% soluble carbohydrates, and 21-22% insoluble carbohydrates.

[0007] Conventional soybean fermentations have a problem: during the fermentation process, enzymes produced polymerize levan-type fructans and polyglutamates derived from the carbohydrates and proteins of the raw soybeans, creating a sticky, mucilaginous substance. This mucilage causes the soybean fermentation to clump together, making stirring difficult, and making it difficult to control dissolved oxygen and temperature within the fermentation product and to transport it, creating numerous problems in mass production processes.

[0008] Therefore, the development of a technology to reduce mucilage production in soybean fermentation products is required.

[0009]

[0010] Prior art literature

[0011] Patent documents

[0012] (Patent Document 1) International Patent Publication No. WO2011-031020 (March 17, 2011)

[0013]

[0014] One object of the present application is to provide a polypeptide in which the 83rd amino acid from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0015] One object of the present application is to provide a polynucleotide encoding the polypeptide.

[0016] One object of the present application is to provide a recombinant vector comprising the polynucleotide.

[0017] Another object of the present application is to provide a microorganism comprising the polypeptide, a polynucleotide encoding the polypeptide, or a recombinant vector comprising the polynucleotide. Another object of the present application is to provide a composition for producing a soybean fermentation product or a composition for fermenting a soybean product comprising the microorganism.

[0018] Another object of the present application is to provide a soybean fermented product obtained by fermenting a soybean product with the above microorganism.

[0019] Another object of the present application is to provide a method for producing a soybean fermented product, comprising the steps of inoculating the microorganism into a soybean product; and the steps of culturing the microorganism.

[0020] Another object of the present application is to provide a method for reducing mucus production during soybean fermentation, comprising the steps of inoculating the microorganism into a soybean product; and culturing the microorganism.

[0021] Another object of the present application is to provide a feed composition comprising the above soybean fermentation product.

[0022] Another object of the present application is to provide a use of the microorganism for producing soybean fermentation products and / or fermenting soybean products and / or reducing mucilage production during soybean fermentation.

[0023] Another object of the present application is to provide a use of the microorganism for producing a composition for producing a soybean fermentation product and / or a composition for fermenting a soy product.

[0024]

[0025] The present disclosure provides a fermentation strain having improved characteristics useful for solid-state fermentation of soybean products such as soybean meal, and uses thereof. In one embodiment, a Bacillus subtilis strain is provided in which, by introducing a genetic modification into a specific region of a wild-type strain, the mucilage production ability is reduced during the fermentation process compared to the wild-type strain, thereby reducing the content of sticky mucilage in the fermented product and almost eliminating the phenomenon of clumping, thereby increasing the aeration amount and / or productivity of the fermented product, as well as having excellent protease activity and protein increase. It is proposed that, when a soybean product such as soybean meal is solid-state fermented using the strain, a high-quality soybean fermentation product can be produced with improved digestibility and feed efficiency due to the hydrolysis of soybean proteins to lower molecular weights and increase in crude protein content, and the reduction in the content of anti-nutritional factors such as indigestible polysaccharides within a shorter fermentation time than before.

[0026]

[0027] In this specification, “soybean product” refers to a general term for by-products obtained during processing of soybeans (e.g., milking, etc.), and may be, for example, soybean meal, soybean protein concentrate, or a combination thereof.

[0028] In this specification, “soybean fermentation” means a product obtained by inoculating a fermentation strain into a soybean product (soybean protein concentrate and / or soybean meal) and fermenting it, and may mean, for example, fermented soybean meal, fermented soybean protein concentrate, or a combination thereof.

[0029] In this specification, "soybean meal", also called soybean cake or oil cake, is a product obtained after milking soybeans and is the most widely used vegetable protein feed ingredient.

[0030] As used herein, "Soy Protein Concentrate (SPC)" refers to a concentrate of soybean-derived protein content obtained by removing soluble non-protein substances from defatted soybeans. Soy protein concentrate may refer to a high-protein feed ingredient with increased protein content using soybean meal, a by-product of making cooking oil from soybeans. It is classified as a representative vegetable high-protein ingredient along with fermented soybean meal, and can also be used as a substitute for fish meal, which has been used as a major protein source. For example, soy protein concentrate may be manufactured by eluting defatted soybeans with water close to their isoelectric point (pH 4 to 5) or 20 to 80% ethanol, removing non-protein substances such as water-soluble substances and carbohydrates, and concentrating mainly globulin-type proteins. The soy protein concentrate may be a soybean protein-containing substance containing 50 to 90 wt% protein based on the dry matter from which moisture has been removed.

[0031] In this specification, “microorganism” encompasses unicellular bacteria and may be used interchangeably with “cell”, “strain”, etc.

[0032] In this specification, the phrase "a polynucleotide (which may be used interchangeably with a "gene") or a polypeptide (which may be used interchangeably with a "protein") "contains or consists of or is expressed by a specific nucleic acid sequence or amino acid sequence" may mean that the polynucleotide or polypeptide essentially includes the specific nucleic acid sequence or amino acid sequence, and may be interpreted as including (or not excluding) a "substantially equivalent sequence" in which a non-significant mutation (deletion, substitution, modification, and / or addition) is added to the specific nucleic acid sequence or amino acid sequence to the extent that the original function and / or the desired function of the polynucleotide or polypeptide is maintained.

[0033]

[0034] Hereinafter, the present invention will be described in more detail.

[0035]

[0036] An example of the present application provides a polypeptide variant having a mutation introduced into the amino acid sequence of SEQ ID NO: 1. The polypeptide variant may be a polypeptide in which the 83rd amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1 is replaced with a different amino acid. In the present specification, unless otherwise stated, a "polypeptide variant" or "polypeptide" having a mutation introduced into the amino acid sequence of SEQ ID NO: 1 may refer to a polypeptide variant having a mutation introduced into the amino acid sequence of SEQ ID NO: 1 as described herein.

[0037] More specifically, the polypeptide may be a polypeptide in which the 83rd amino acid (aspartic acid; D) from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with valine (V), asparagine (N), glutamic acid (E), glycine (G), alanine (A), serine (S), threonine (T), cysteine ​​(C), leucine (L), isoleucine (I), methionine (M), proline (P), phenylalanine (F), tyrosine (Y), tryptophan (W), glutamine (Q), histidine (H), lysine (K), or arginine (R), for example, valine. Alternatively, the polypeptide may be a polypeptide having valine (V), asparagine (N), glutamic acid (E), glycine (G), alanine (A), serine (S), threonine (T), cysteine ​​(C), leucine (L), isoleucine (I), methionine (M), proline (P), phenylalanine (F), tyrosine (Y), tryptophan (W), glutamine (Q), histidine (H), lysine (K), or arginine (R), for example, valine, at position 83 from the N-terminus in the amino acid sequence of SEQ ID NO: 1. In one specific example, the polypeptide may include the amino acid sequence of SEQ ID NO: 3.

[0038] The variant of the present application may have or comprise the amino acid sequence set forth in SEQ ID NO: 3, or may consist essentially of said amino acid sequence.

[0039]

[0040] In addition, the variant of the present application comprises an amino acid sequence having an amino acid corresponding to position 83 based on the amino acid sequence of SEQ ID NO: 1 is valine, and has an amino acid sequence having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.2% or more, 98.4% or more, 98.6% or more, 98.9% or more, 99.1% or more, 99.3% or more, 99.6% or more, 99.8% or more, or 99.9% or more homology or identity with the amino acid sequence described in SEQ ID NO: 3, or has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, It may consist of or consist essentially of an amino acid sequence having 98% or more, 98.2% or more, 98.4% or more, 98.6% or more, 98.9% or more, 99.1% or more, 99.3% or more, 99.6% or more, 99.8% or more, or 99.9% or more of the amino acid sequence, but is not limited thereto. In addition, it is obvious that a variant having an amino acid sequence in which some of the sequences are deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the variant of the present application.

[0041] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the variant of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.

[0042] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid with similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0043]

[0044] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The above term “variant” may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto as long as the term is used in the meaning of mutation. For the purpose of the present application, the variant may be a polypeptide including the amino acid sequence described in SEQ ID NO: 3, in which aspartic acid, which is an amino acid corresponding to position 83 of the amino acid sequence of SEQ ID NO: 1, is substituted with valine.

[0045] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0046]

[0047] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0048] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0049] Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0050] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0051] As an example of the present application, the variant of the present application may have GTPase ObgE (NCBI Reference Sequence: WP_003229675.1) activity. In addition, the variant of the present application may have a characteristic of reduced mucus production compared to a wild-type polypeptide having GTPase ObgE activity. The sequence of the GTPase ObgE in the present application can be obtained from the NCBI GenBank, a known database. Specifically, it may be a polypeptide having GTPase ObgE activity encoded by ObgE, but is not limited thereto.

[0052]

[0053] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may determine a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0054] For example, any amino acid sequence can be aligned with SEQ ID NO: 3, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 3. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0055] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0056]

[0057] Another example provides a polynucleotide encoding the polypeptide. In one specific embodiment, the polynucleotide may comprise the nucleic acid sequence of SEQ ID NO: 4.

[0058] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.

[0059] The polynucleotide encoding the variant of the present application may comprise a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 3. As an example of the present application, the polynucleotide of the present application may have or comprise the sequence of SEQ ID NO: 4. Furthermore, the polynucleotide of the present application may consist of, or consist essentially of, the sequence of SEQ ID NO: 4.

[0060] The polynucleotide of the present application may have various modifications made to the coding region within a range that does not change the amino acid sequence of the variant of the present application, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present application. Specifically, the polynucleotide of the present application has a base sequence having a homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.68% or more, 98.76% or more, 98.83% or more, 98.91% or more, 98.99% or more, 99.07% or more, 99.15% or more, 99.22% or more, 99.3% or more, 99.38% or more, 99.46% or more, 99.53% or more, 99.61% or more, 99.69% or more, 99.77% or more, 99.84% or more, or 99.92% or more with the sequence of SEQ ID NO: 4. It may consist of, or consist essentially of, a base sequence having, but is not limited to, a homology or identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 98.68%, at least 98.76%, at least 98.83%, at least 98.91%, at least 98.99%, at least 99.07%, at least 99.15%, at least 99.22%, at least 99.3%, at least 99.38%, at least 99.46%, at least 99.53%, at least 99.61%, at least 99.69%, at least 99.77%, at least 99.84%, or at least 99.92% with the sequence of SEQ ID NO: 4. At this time, in the sequence having the above homology or identity, the codon encoding the amino acid corresponding to the 83rd position of sequence number 3 may be one of the codons encoding valine.

[0061] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term “stringent conditions” refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, polynucleotides having high homology or identity, hybridizing with polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 98.68% or more, 98.76% or more, 98.83% or more, 98.91% or more, 98.99% or more, 99.07% or more, 99.15% or more, 99.22% or more, 99.3% or more, 99.38% or more, 99.46% or more, 99.53% or more, 99.61% or more, 99.69% or more, 99.77% or more, 99.84% or more, or 99.92% or more homology or identity, and Or, conditions under which polynucleotides with low identity do not hybridize with each other, or washing conditions of typical southern hybridization, such as 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.Conditions for washing once, specifically two to three times, can be listed, at a salt concentration and temperature equivalent to 1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS.

[0062] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0063] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0064] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0065]

[0066] Another example provides a recombinant vector comprising the polynucleotide. The recombinant vector may be configured to insert the polynucleotide into the genome of a host cell or to replace a corresponding gene in the genome of a host cell.

[0067] The vector of the present application may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.

[0068] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pTop33ori vectors, etc. can be used.

[0069] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, such as, but not limited to, homologous recombination. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, thereby allowing the selection of transformed cells.

[0070] The term "transformation" in this application refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism, thereby enabling expression of the polypeptide encoded by the polynucleotide in the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0071] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present application.

[0072]

[0073] Another example provides a microorganism comprising the polypeptide, a polynucleotide encoding the polypeptide, or a recombinant vector comprising the polynucleotide. The microorganism may be a fermentation strain capable of producing starch, protein, and cellulolytic enzymes. More specifically, the microorganism may be a fermentation strain for soybean products.

[0074] In one specific example, the microorganism may be a bacterium belonging to the genus Bacillus. The bacterium belonging to the genus Bacillus may be at least one selected from the group consisting of Bacillus subtilis, Bacillus cereus, Bacillus megaterium, and Bacillus clausii, and may be, for example, a Bacillus subtilis strain. For example, the microorganism may be a Bacillus subtilis CR01-0016 strain having the accession number KCCM12814P.

[0075] In this application, the term "strain (or microorganism)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that has a specific mechanism weakened or strengthened due to causes such as insertion of an external gene or enhanced or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product.

[0076] The strain of the present application may be, but is not limited to, a strain comprising at least one of a variant of the present application, a polynucleotide of the present application, and a vector comprising a polynucleotide of the present application; a strain modified to express the variant of the present application or the polynucleotide of the present application; a strain (e.g., a recombinant strain) expressing the variant of the present application or the polynucleotide of the present application; or a strain (e.g., a recombinant strain) having the activity of the variant of the present application.

[0077] In this application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain into which the GTPase ObgE variant described herein is not introduced or before it is introduced. The "unmodified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "unmutated strain", "unmodified microorganism", "unmutated microorganism", or "reference microorganism".

[0078]

[0079] In one example, the microorganism may express the polypeptide in place of the wild-type ObgE protein, and / or comprise the polynucleotide in place of the wild-type ObgE gene. When the microorganism is a microorganism belonging to the genus Bacillus, for example, a Bacillus subtilis strain, the endogenous ObgE gene (e.g., SEQ ID NO: 2) encoding the wild-type ObgE protein (e.g., SEQ ID NO: 1) in the microorganism may be mutated to encode a polypeptide (e.g., SEQ ID NO: 3) in which the 83rd amino acid of SEQ ID NO: 1 is mutated as described above (e.g., to have the nucleic acid sequence of SEQ ID NO: 4).

[0080] The above microorganism may be capable of reducing mucus production or preventing mucus production when used in soybean product fermentation. For example, the microorganism may have a reduced mucus production ability compared to a wild-type strain (e.g., a wild-type Bacillus subtilis strain). More specifically, the microorganism may have a reduced mucus production ability compared to a microorganism expressing a wild-type ObgE protein (e.g., an ObgE protein of a wild-type Bacillus subtilis strain; SEQ ID NO: 1) and / or comprising a wild-type ObgE gene (e.g., an ObgE gene of a wild-type Bacillus subtilis strain; SEQ ID NO: 2).

[0081] Another example provides a composition for producing a soybean fermentation product or a composition for fermenting a soy product comprising the above microorganism.

[0082] Another example provides a soybean fermentation product obtained by fermenting a soybean product with the above microorganism. The soybean fermentation product may have a lower mucilage content compared to a fermentation product obtained by fermenting a soybean product with a microorganism comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 or a polynucleotide encoding the polypeptide.

[0083] In this specification, mucilage refers to a substance that increases the viscosity of a fermented soybean product, and may be produced by polymerization of levan form fructan and polyglutamate derived from soybean carbohydrates, proteins, or a combination thereof, but is not limited thereto.

[0084] The above soybean fermentation product may have a moisture content of, by weight, 30 to 60%, 30 to 55%, 30 to 50%, 30 to 45%, 30 to 40%, 30 to 38%, 32 to 60%, 32 to 55%, 32 to 50%, 32 to 45%, 32 to 40%, 32 to 38%, 35 to 60%, 35 to 55%, 35 to 50%, 35 to 45%, 35 to 40%, or 35 to 38%; The total protein content (by dry matter weight) may be 40% or more, 45% or more, or 50% or more, such as 40 to 70%, 40 to 65%, 40 to 60%, 45 to 70%, 45 to 65%, 45 to 60%, 50 to 70%, 50 to 65%, or 50 to 60%; the pH may be 7 or more, 7.2 or more, 7.5 or more, 7.7 or more, or 8 or more (the upper limit may be pH 9 or 8.5); and the viable cell count may be 1x10 5~12 CFU / g, 1x10 6~12 CFU / g, 1x10 7~12 CFU / g, or 1x10 8~12 It may be, but is not limited to, CFU / g.

[0085] Another example provides a method for producing a soybean fermentation product, comprising the steps of inoculating the microorganism into a soybean product; and culturing the microorganism. The soybean fermentation product produced in this manner may have a reduced mucilage content compared to a fermentation product using a wild-type microorganism.

[0086] Another example provides a method for reducing mucilage production during soybean fermentation (or a method for reducing mucilage content in a soybean fermentation product), comprising the steps of inoculating the microorganism into a soybean product; and culturing the microorganism.

[0087] More specifically, the method may include the following steps: (a) adding moisture to a soybean product and heat-treating it; (b) cooling the heat-treated soybean product and then inoculating it with a fermentation bacteria; (c) solid-culturing the bacteria inoculated into the soybean product to obtain a soybean fermentation product. The fermentation bacteria refer to the microorganisms described above.

[0088] (a) Addition of moisture and heat treatment to soybean products

[0089] A pre-heating process may be necessary for the raw soybean product. To achieve this, the raw soybean product can be directly sprayed or mixed with an appropriate amount of water before solid-state fermentation to adjust the moisture content, and then heat-treated for a specified period of time. The purpose of this heat treatment may be to kill any bacteria present in the raw soybean product and / or to destroy soybean cell walls and denature proteins, thereby providing a chemical composition conducive to the growth of target microorganisms.

[0090] In one specific example, the soybean product to which moisture has been added in step (a) may have a moisture content of 30 to 80% (v / w), 30 to 70% (v / w), or 40 to 60% (v / w). This moisture content range is desirable in terms of preventing delays in fermentation speed due to low moisture, improving the problem of high costs in the transport and post-fermentation drying processes of the soybean product, and in terms of thermal efficiency.

[0091] The soybean product to which moisture has been added may be heat-treated. This heat-treatment process may utilize various methods known in the art, including, but not limited to, steam or superheated steam.

[0092] The heat treatment in the above step (a) may be steaming with steam at a temperature of 70 to 130°C for 10 to 60 minutes or short-term heat treatment with superheated steam at 200 to 300°C for several seconds to several minutes, for example, steaming with steam at a temperature of 70 to 130°C for 10 to 30 minutes or steaming with steam at a temperature of 80 to 121.1°C for 10 to 30 minutes.

[0093] Through the above heat treatment process, not only is there the effect of almost killing contaminants present in soybean products and creating a chemical environment in which the next process, solid-state fermentation, proceeds smoothly, but there is also the effect of reducing TI, which inhibits digestibility.

[0094] In one example, a step of pre-cultivating a fermentation medium using a conventional method may be additionally included before or after the step (a) (before the step (b)). The fermentation medium may be the microorganism described above. For example, the final viable cell count of the thus obtained starter culture may be (1 to 5) x 10 9 It can be in the cfu / mL range, but is not limited to this.

[0095] (b) Cooling and inoculation of the heat-treated soybean product with fermentation bacteria

[0096] In the above step (a), the heat-treated soybean product is cooled to a temperature at which solid fermentation is possible, and then inoculated with fermentation bacteria.

[0097] The above cooling can proceed naturally after steaming is completed, or can proceed through a conveyor-type cooling process to increase the cooling speed, prevent overheating, and ensure uniform cooling, but is not limited thereto.

[0098] The temperature of the cooled soybean product at this stage may be 30 to 50°C, 35 to 45°C, or 37°C.

[0099] The above fermentation bacteria can be inoculated as uniformly as possible by cultivating the pre-culture solution of the fermentation bacteria in the prepared soybean product medium as is or by appropriately diluting it with sterilized water.

[0100] The amount of the above-mentioned inoculated fermentation bacteria can be an important factor influencing the solid-state fermentation of soybean products. In one example, the inoculation amount of the above-mentioned fermentation bacteria is such that the number of bacteria immediately after inoculation is 10 5 10 inland 9　 It can be an amount that makes CFU / g.

[0101] (c) Culturing the fermentation bacteria inoculated into the above soybean product and obtaining the fermented soybean product.

[0102] The cultivation at this stage may be solid culture. The term "solid fermentation (cultivation)" as used herein refers to culturing microorganisms using defatted soybean meal and / or soybean protein concentrate remaining after separating fat (soybean oil) from soybeans, and may be a method distinct from "liquid culture or liquid fermentation" that utilizes extracts of soybean meal.

[0103] The above fermentation can be carried out by conventional methods, for example, in a packed-bed fermentor, but is not limited thereto. Packed-bed fermentors come in various forms, including batch-type aeration culture devices, closed-type culture devices, and continuous aeration culture devices, and an appropriate device can be selected and used without limitation depending on the production scale.

[0104] The above fermentation can be carried out at a temperature of 20 to 50°C for 12 to 72 hours, at a temperature of 30 to 45°C for 12 to 48 hours, or at a temperature of 35 to 40°C for 12 to 24 hours.

[0105] (d) Drying and grinding of the fermented soybean meal obtained above

[0106] In one example, after step (c), the step (d) of low-temperature, low-humidity drying and / or grinding the soybean fermentation product may be additionally included.

[0107] During the fermentation process, some moisture in the soybean product evaporates, but the residual moisture content immediately after fermentation is considerably high, ranging from 20 to 50% (v / w). If the final moisture content of the fermented soybean product must be controlled to 10 to 12% (v / w), a drying process is necessary.

[0108] Additionally, since partially weakly coagulated lumps may be formed during soybean product fermentation, in this case, the soybean fermentation product can be ground into a uniform particle size after drying.

[0109] The drying and grinding can be performed using various methods known in the art. For example, drying can be performed at a low temperature that does not kill live bacteria, or using hot air at low temperature and low humidity. The grinding process can be performed to grind the fermented soybean product into various sizes depending on the intended use. A hammer mill can be used as the grinding method, but is not limited thereto.

[0110] By fermenting soybean products according to the above method, various anti-nutritional factors contained in the soybean products are reduced, the digestibility and absorption rate are improved through protein hydrolysis, and the absolute value as feed is improved by increasing the protein content, so a useful soybean fermented product as a high-quality protein feed raw material that can replace animal protein can be obtained. In addition, the soybean fermented product has the advantage of having the function of helping the intestinal function of animals that have consumed the feed because it contains Bacillus bacteria that have strong survival power even during distribution.

[0111] Another example provides a feed composition comprising the above soybean fermentation product.

[0112] The above feed composition is used to encompass all feed, feed raw materials for use in feed manufacturing, and feed additives.

[0113] The feed may be for mammals, poultry, fish, and / or crustaceans. The mammals may include pigs, cattle, horses, deer, goats, dogs, cats, and / or rabbits, the poultry may include chickens, ducks, geese, and / or turkeys, and the fish and crustaceans may include trout, salmon, and / or shrimp.

[0114] The above feed composition may further include, in addition to the soybean fermentation product, at least one selected from the group consisting of organic acids such as citric acid, fumaric acid, adipic acid, and lactic acid; phosphates such as potassium phosphate, sodium phosphate, and polymeric phosphate; vitamins; minerals; and natural antioxidants such as polyphenols, catechins, tocopherols, vitamin C, green tea extracts, chitosan, and tannic acid. If necessary, the feed composition may further include other conventional additives such as anti-influenza agents, buffers, and / or bacteriostatic agents. In addition, a diluent, a dispersant, a surfactant, a binder, and / or a lubricant may be additionally added to formulate the feed composition into an appropriate form such as an aqueous solution, a suspension, an emulsion, an injectable formulation, a capsule, a granule, or a tablet.

[0115] The above feed composition may include the soybean fermentation product in an amount of about 10 to 500 g, or 10 to 100 g per 1 kg based on dry weight, but is not limited thereto.

[0116]

[0117] The Bacillus subtilis C27 strain (KCCM12814P) according to the present application exhibits reduced mucilage production ability during the fermentation process and has excellent protein and cellulose decomposition enzyme activities. Therefore, when soybean meal is solid-state fermented using it as a starter, high-quality fermented soybean meal can be produced with increased digestibility and feed efficiency due to the hydrolysis of soybean protein, which results in a decrease in molecular weight and an increase in crude protein content, and a decrease in the content of anti-nutritional factors such as indigestible polysaccharides.

[0118]

[0119] Figure 1 is a graph showing the viscosity of fermented soybean meal obtained using the C27 strain according to one embodiment compared to the viscosity of fermented soybean meal obtained using the parent strain (CJ2042 strain).

[0120] Figure 2 is a photograph of fermented soybean meal obtained using the C27 strain according to one embodiment and fermented soybean meal obtained using the parent strain (CJ2042 strain).

[0121] FIG. 3 is a graph showing the viscosity of fermented soybean meal obtained using the BS_obgE strain according to one embodiment compared to the viscosity of fermented soybean meal obtained using the parent strain (BS3135 strain).

[0122] FIG. 4 is a photograph of fermented soybean meal obtained using the BS_obgE strain according to one embodiment and fermented soybean meal obtained using the parent strain (BS3135 strain).

[0123]

[0124] Hereinafter, the present invention will be described in more detail through examples. However, these examples are intended to exemplify the present invention, and the scope of the present invention is not limited to these reference examples and examples.

[0125]

[0126] Example 1. Selection of strains with high activity in starch, protein, and cellulose decomposition enzymes.

[0127] In this example, in order to isolate strains with excellent starch, protein, and cellulose decomposition enzyme production capabilities, about 3,000 types of microorganisms were isolated from various traditional fermented foods (kimchi, soy sauce, traditional folk liquor, salted seafood, etc.), and among these, about 450 food-compatible Bacillus subtilis strains were identified, and strains with high expression of starch, protein, and cellulose decomposition enzymes were selected.

[0128] Specifically, the selection of strains with high activity of starch, protein, and cellulose decomposition enzymes was performed by comparing the size of the transparent zone formed by substrate decomposition when strains were cultured on YM agar medium (yeast extract 3.0 g, malt extract 3.0 g, peptone 10.0 g, agar 20.0 g) containing 1% (w / v) soluble starch (Difco, USA), 2% (w / v) skim milk (Difco, USA), or 1% (w / v) CMC (carboxymethyl cellulose), respectively.

[0129] The strains producing high amounts of starch, protein, and cellulose-degrading enzymes thus selected were inoculated onto TSB medium (enzymatic digest of casein 17.0 g, enzymatic digest of soybean meal 3.0 g, NaCl 5.0 g, dipotassium phosphate 2.5 g, dextrose 2.5 g, final pH: 7.3 ± 0.2 at 25°C), and then cultured for 12 hours at 37°C and 200 rpm. 1.0 μl of the culture was spotted onto soluble starch, skim milk, or CMC-containing YM agar medium. After culturing the agar medium at 37°C for 16 hours, the diameter of the transparent ring formed on the medium was measured, and the results are shown in Table 1.

[0130] Strain nameStrain number2%(w / v) skim milk medium1%(w / v) soluble starch medium1%(w / v) CMC mediumTransparent ring diameter (mm)Transparent ring diameter (mm)Transparent ring diameter (mm)Bacillus subtilisCJ204211.88.810.2CJ204710.05.87.4CJ20669.42.48.0CJ21272.45.77.4CJ22336.06.09.0CJ22827.62.44.4CJ22929.86.46.0CJ23159.04.85.6

[0131] The eight strains shown in Table 1 above were selected as high-producing strains of starch, protein, and cellulose-decomposing enzymes, and among them, the CJ2042 strain, which had excellent starch, protein, and cellulose-decomposing enzyme activities, was finally selected.

[0132]

[0133] Example 2: Selection of mutant strains

[0134] The CJ2042 strain selected in Example 1 above exhibits high activity in starch, protein, and cellulose-decomposing enzymes, but contains mucilage due to the nature of the CJ2042 strain. The production of this mucilage makes it difficult to stir during subsequent solid culture, which causes problems in controlling dissolved oxygen, temperature, etc. in the fermented product, and makes transport difficult.

[0135] Accordingly, in this example, in order to develop a mutant strain with reduced mucus production ability while maintaining or improving the enzymatic / physiological characteristics of the CJ2042 strain (having the wild-type ObgE gene), mutations were induced by irradiating the CJ2042 strain with UV as follows.

[0136] First, the CJ2042 strain was spread on TSB agar medium (enzymatic digest of casein 17.0 g, enzymatic digest of soybean meal 3.0 g, NaCl 5.0 g, dipotassium phosphate 2.5 g, dextrose 2.5 g, agar 15.0 g, final pH: 7.3 ± 0.2 at 25°C) and cultured at 37°C for 12 hours to activate the strain.

[0137] The main culture was performed by inoculating 1% of the inoculum suspension into previously prepared TSB medium (enzymatic digest of casein 17.0 g, enzymatic digest of soybean meal 3.0 g, NaCl 5.0 g, dipotassium phosphate 2.5 g, dextrose 2.5 g, final pH: 7.3 ± 0.2 at 25℃) and culturing with shaking at 180 rpm at 37℃. After culturing, the culture solution was centrifuged at 8000 rpm at 25℃ for 10 minutes to separate the cells and supernatant, and only the cells were collected and washed with 0.8% NaCl sterilizing solution. After washing, the recovered cells were irradiated with ultraviolet rays at a wavelength of 254 nm using a UV lamp (VIBER LOURMAT, 115 V, 60 Hz) to induce mutations.

[0138] Next, 0.1 mL of the UV-irradiated mixture was cultured on TSA plate medium (tryptic soy agar, enzymatic digest of casein 15 g, enzymatic digest of soybean meal 5 g, NaCl 5 g, agar 15 g, final pH 7.3±0.2 at 25°C) at 37°C for 12 hours, and compared to the parent strain CJ2042, UV-irradiated mutant strains that formed colonies that did not contain mucus when visually observed were isolated.

[0139]

[0140] Example 3: Measurement of starch, protein, and cellulose decomposition enzyme capacity of mutant strains

[0141] The enzyme capacity of each mutant strain isolated from Example 2 was confirmed. As a control group, the Bacillus subtilis CJ2042 strain selected in Example 1 was used.

[0142] In order to select highly active strains of starch, protein, and cellulose decomposition enzymes among the above mutant strains, the strains were selected by comparing the size of the transparent ring formed by substrate decomposition during strain cultivation on YM agar medium (yeast extract 3.0 g, malt extract 3.0 g, peptone 10.0 g, agar 20.0 g) containing 1% (w / v) soluble starch (Difco, USA), 2% (w / v) skim milk (Difco, USA), or 1% (w / v) CMC (carboxymethyl cellulose), respectively.

[0143] More specifically, each mutant strain was cultured in TSB medium (medium composition: enzymatic digest of casein 17.0 g, enzymatic digest of soybean meal 3.0 g, NaCl 5.0 g, dipotassium phosphate 2.5 g, dextrose 2.5 g, final pH 7.3±0.2 at 25°C) at 37°C and 200 rpm for 12 hours. 1.0 μl of the culture solution of each mutant strain was spotted onto soluble starch, skim milk, or CMC-containing YM agar medium. After culturing the agar medium at 37°C for 16 hours, the diameter of the transparent ring formed on the medium was measured, and the results are shown in Table 2.

[0144] Strain nameStrain number2%(w / v) skim milk medium1%(w / v) soluble starch medium1%(w / v) CMC mediumTransparent ring diameter (mm)Transparent ring diameter (mm)Transparent ring diameter (mm)Bacillus spp.CJ2042 (control)12.39.510.1C313.19.112.5C1511.07.513.1C2512.85.514.1C2714.610.115.5C318.111.18.7C3413.810.59.7

[0145] Among the six mutant strains in Table 2 above, C27 was found to have the best protein and cellulose decomposition activity.

[0146] Subsequently, the selected mutant strain Bacillus subtilis C27 strain was compared with the parent strains Bacillus subtilis CJ2042 strain and Bacillus subtilis TP6 strain (KCCM11438P) for their starch, protein, and cellulose-degrading enzyme activities. The measurement method was the same as above. The obtained results (diameter of the transparent ring) are shown in Table 3.

[0147] Strain name Strain number 2% (w / v) skim milk medium 1% (w / v) soluble starch medium 1% (w / v) CMC medium Transparent ring diameter (mm) Transparent ring diameter (mm) Transparent ring diameter (mm) Bacillus spp. TP67.36.56.1 CJ204212.59.210.2 C2715.19.515.1

[0148] As shown in Table 3 above, the mutant strain C27 was found to have superior starch, protein, and cellulose decomposition enzyme capabilities compared to the parent strains Bacillus subtilis CJ2042 and Bacillus subtilis TP6.

[0149]

[0150] Example 4: Confirmation of fermentation ability of mutant strains in soybean meal

[0151] The soybean meal fermentation ability of the mutant strain C27 selected in Example 3 was confirmed. For comparison, the parent strain CJ2042 mentioned in Example 2 and the control Bacillus subtilis TP6 (KCCM11438P) were used.

[0152] The above C27 strain was pre-cultured in GYP medium (glucose 10 g / L, yeast extract 8 g / L, soy pepton 2 g / L), and the culture obtained through pre-culture was inoculated again into GYP medium at 1% and cultured until A660nm 6 or higher.

[0153] Soybean meal was prepared, the moisture content was adjusted to approximately 43%, heat-treated at 100°C for 30 minutes, and then cooled. The culture solution of the C27 strain was inoculated into the pretreated soybean meal in an amount of 10% by weight based on the weight of the soybean meal, and the moisture content was adjusted to approximately 46%. The soybean meal inoculated with the C27 strain was fermented for 16 hours in a constant temperature and humidity chamber maintained at 37°C and 95% humidity. Before fermentation, the pH of the soybean meal was approximately 6.6, and each strain was inoculated in an amount of approximately 10^7 CFU / g.

[0154] After fermentation was completed, the moisture content, viable cell count, and pH of the fermented product were measured again, and the protein content of the fermented product was analyzed using a dried sample (dry matter), and the results are shown in Table 4.

[0155] Incubation time (hr)Moisture (%)Viable cell count (CFU / g)pHProtein content (%, dry matter basis)Protein increase (%, dry matter basis)TP6046.07.E+076.651.6844.75.E+097.155.23.71242.42.E+107.455.94.31638.41.E+108.056.65.1CJ2042046.47.E+076.651.6843.28.E+097.255.5 3.91240.01.E+107.557.15.51635.31.E+108.057.96.3C27046.28.E+076.651 .6843.65.E+097.255.43.81239.24.E+097.657.35.71635.15.E+098.058.26.7

[0156] As shown in Table 4, after 16 hours of fermentation, the fermented product of each strain contained a moisture content of approximately 35% to 38%, a pH of 8 or higher, and a viable cell count of approximately 10^9 CFU / g or higher. The protein content increased by approximately 4 to 6% compared to the protein content of the raw material.

[0157]

[0158] Example 5: Confirmation of the amount of viscous substance produced by the mutant strain

[0159] The viscosity of the fermented product obtained in Example 4 was measured (6 kPa) using an Anton Paar RheoCompass, and the results are shown in Figs. 1 and 2. As shown in Figs. 1 and 2, the solid-state fermentation results showed that the maximum viscosity measurement value for the C27 strain was 8.8387 kPa, and that the viscosity of the fermented product was lower than that of the parent strain, CJ2042 strain (10.238 kPa).

[0160]

[0161] Example 6: 16S rRNA gene nucleic acid sequence and phylogenetic tree analysis of mutant strains

[0162] In order to identify the mutated C27 strain in Example 5 above, the 16S rRNA gene nucleic acid sequence of the strain was analyzed.

[0163] For strain identification by nucleic acid sequence of 16S rRNA gene, universal primers 27F (5'-AGA GTT TGA TCM TGG CTC AG-3'; SEQ ID NO: 8) and 1492R (5'-TAC GGY TAC CTT GTT ACG ACT T-3'; SEQ ID NO: 9) were used to amplify and purify the PCR product. For nucleic acid sequence determination, 785F (5'-GGA TTA GAT ACC CTG GTA-3'; SEQ ID NO: 10) and 907R (5'-CCG TCA ATT CMT TTR AGT TT-3'; SEQ ID NO: 11) were used to analyze the nucleic acid sequence of 1,491 bp, which is shown in SEQ ID NO: 7.

[0164] The nucleic acid sequences were confirmed by sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems Inc., USA) and analyzed using an ABI 3730XL DNA Analyzer (Applied Biosystems, 3.850 Lincoln Centre Drive, Foster City, CA 94404 USA). The analyzed nucleic acid sequences were compared with the nucleic acid sequences registered in the EzTaxon server (http: / / eztaxon-e.ezbiocloud.net / ) and GenBank / EMBL / DDBJ to confirm the similarity with the nucleic acid sequences of other genes. After performing multiple sequence alignment for the nucleic acid sequences, a phylogenic tree was created using the MEGA 6 program and the taxonomic position was analyzed.

[0165] The above mutant strain C27 was named Bacillus subtilis CR01-0016 and was deposited with the Korean Culture of Microorganisms (KCCM) under the Budapest Treaty on October 26, 2020, under the accession number KCCM12814P.

[0166]

[0167] Example 7: Complete genome analysis of a mutant strain with reduced mucus production capacity

[0168] To identify the mutant gene sequence of Bacillus subtilis strain C27, we commissioned DNA Link to perform a complete genome analysis. Using Novaseq6000 (or Hiseq2500), we secured over 1 Gbase of data per 1G mate (based on filtered total bases), and as a result, a mutation in the ObgE gene was discovered (A248T; causing D83V in the coding amino acid sequence).

[0169]

[0170] Example 8: Introduction of mutations to reduce viscous production and confirmation of the amount of viscous production of strains with introduced mutations.

[0171] Example 8-1. Production of vectors with introduced mutations

[0172] In order to confirm the effect of reducing the mucus production ability when a mutation such as the ObgE gene mutation of C27 occurs in a Bacillus subtilis strain, a strain with a mutated ObgE gene was constructed from a wild-type Bacillus subtilis strain. Specifically, the basic plasmid vector for gene replacement was pTop33ori constructed from the pTOP Blunt V2 plasmid vector (Enzynomics), and inserted into the BamHI restriction enzyme site of the plasmid. First, a replacement vector was constructed to substitute the 248th nucleotide of the ObgE polynucleotide sequence of SEQ ID NO: 2 with thymidine in order to substitute the 83rd amino acid of the ObgE amino acid sequence represented by SEQ ID NO: 1 with valine.

[0173] The gene fragment for constructing the replacement vector was obtained through PCR using the genomic DNA of C27 with mutated ObgE as a template.

[0174] The PCR conditions for constructing the ObgE gene replacement vector were as follows: denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 50°C for 15 seconds, and polymerization at 68°C for 1 minute, followed by polymerization at 68°C for 5 minutes. The primer sequence information used to construct the above vector is shown in Table 5 below.

[0175] Sequence number Primer name Nucleic acid sequence (5'→ 3') 5obgE_FCCATGATTACGCCAAGCTGGATATGTTCCCCAAGC 6obgE_RGGCCGTTACTAGTGGATCTAACCGCTCAAGGCTG

[0176] The approximately 2 kb PCR product amplified in this manner was mixed with pTop33ori treated with BamHI restriction enzyme, and the pTOP33ori_obgE substitution vector was constructed using an infusion enzyme.

[0177]

[0178] Example 8-2. Production of a BS_obgE strain with a mutation and confirmation of reduced viscous production.

[0179] pTOP33ori_obgE, an obgE gene replacement vector produced through the above Example 8-1, was transfected into Bacillus subtilis KCTC 3135 T A mutant strain BS_obgE was created by introducing a mutation into the strain KCTC 3135. T The strain was used after receiving it from KCTC (Korea Research Institute of Bioscience and Biotechnology).

[0180] Specifically, natural competence was induced, the substitution vector pTOP33ori_obgE was mixed, and the strain in which the vector was inserted into the chromosome by recombination of homologous sequences was selected on an agar nutrient medium containing 7.5 mg / L of chloramphenicol. The selected primary strain was then cultured with shaking for 16 hours in an LB medium without chloramphenicol antibiotic, diluted and spread on an LB agar plate, and the grown colonies were each selected for strains susceptible to chloramphenicol antibiotics, and the base sequence was confirmed to obtain mutant strains. The presence of mutations in the final transformed strain was confirmed by sequencing after performing PCR using the primer pair of SEQ ID NOs: 5 and 6.

[0181] In order to confirm the soybean meal fermentation ability of the mutant strain thus obtained, the mutant strain (BS_obgE strain) colony was subcultured in a nutrient medium, then pre-cultured in GYP medium (glucose 10 g / L, yeast extract 8 g / L, soy pepton 2 g / L), and the culture solution obtained through the pre-culture was inoculated again in a 1% amount into GYP medium and cultured until A660nm 6 or higher was obtained, thereby preparing the culture of the BS_obgE strain.

[0182] Soybean meal was prepared, the moisture content was adjusted to approximately 43%, heat-treated at 100°C for 30 minutes, and then cooled. The culture medium of the prepared BS_obgE strain was inoculated into the pretreated soybean meal in an amount of 10 wt% based on the weight of the soybean meal, and the moisture content was adjusted to approximately 46%. The soybean meal inoculated with the BS_obgE strain was fermented for 12 hours in a constant temperature and humidity chamber maintained at 37°C and 95% humidity. The obtained fermented product was measured for viscosity using an Anton Paar Rheo Compass. The measurement was performed at 6 kPa. As a result, it was confirmed that the viscosity was lower when fermented with the BS_obgE strain (8.8779 kPa) than when fermented with the BS3135 strain (9.9514 kPa). These results are shown in Figs. 3 and 4. From the obtained results, it was confirmed that the viscosity of the fermented product obtained by solid-state fermentation of the Bacillus subtilis strain (BS_obgE) into which the mutation was introduced was lower than that of the wild-type Bacillus strain (BS3135 strain), which is the parent strain (Fig. 3, Fig. 4).

[0183]

[0184] [Accession number]

[0185] Name of depositor: Korea Microbiological Conservation Center

[0186] Accession number: KCCM12814P

[0187] Date of acceptance: 20201026

[0188]

[0189]

[0190]

Claims

1. A polypeptide in which the 83rd amino acid from the N-terminus in the amino acid sequence of sequence number 1 is replaced with a different amino acid.

2. A polypeptide in claim 1, wherein the 83rd amino acid is substituted with valine (V), asparagine (N), glutamic acid (E), glycine (G), alanine (A), serine (S), threonine (T), cysteine ​​(C), leucine (L), isoleucine (I), methionine (M), proline (P), phenylalanine (F), tyrosine (Y), tryptophan (W), glutamine (Q), histidine (H), lysine (K), or arginine (R).

3. A polypeptide represented by the amino acid sequence of sequence number 3 in the first paragraph.

4. A polynucleotide encoding a polypeptide according to any one of claims 1 to 3.

5. A recombinant vector comprising the polynucleotide of clause 4.

6. A polypeptide according to claim 1, a polynucleotide encoding the polypeptide, or a recombinant vector comprising the polynucleotide, A microorganism having the ability to produce starch, protein, and cellulose-decomposing enzymes.

7. In paragraph 6, the microorganism is Bacillus subtilis.

8. A microorganism, a Bacillus subtilis strain having the accession number KCCM12814P with reduced mucus production ability.

9. A microorganism having a reduced mucus-producing ability compared to a microorganism comprising a polypeptide consisting of an amino acid sequence of sequence number 1 or a polynucleotide encoding the polypeptide according to any one of claims 6 to 8.

10. A microorganism according to claim 9, wherein the mucilage is produced by polymerization of levan form fructan and polyglutamate derived from soybean carbohydrate, protein, or a combination thereof.

11. A composition for producing a soybean fermentation product, comprising a microorganism according to any one of claims 6 to 8.

12. A fermented soybean product fermented by a microorganism according to any one of claims 6 to 8.

13. In paragraph 12, the soybean product is a fermented soybean product, which is soybean meal, soybean protein concentrate, or a combination thereof.

14. A soybean fermented product having a lower mucilage content compared to a fermented product obtained by fermenting a soybean product with a microorganism comprising a polypeptide consisting of an amino acid sequence of sequence number 1 or a polynucleotide encoding the polypeptide in paragraph 12.

15. A soybean fermented product in claim 14, wherein the mucilage is produced by polymerization of levan form fructan and polyglutamate derived from soybean carbohydrate, protein, or a combination thereof.

16. A method for producing a soybean fermented product, comprising the step of inoculating a soybean product with a microorganism according to any one of claims 6 to 8; and the step of culturing the microorganism.

17. A method for producing a fermented soybean product in claim 16, wherein the soybean product is soybean meal or soybean protein concentrate.

18. A feed composition comprising the fermented soybean product of clause 12.

19. A feed composition in claim 18, wherein the feed composition is a feed or a feed additive.