Microalgae strain having effect of promoting plant growth and use thereof

Abstract

The present application relates to a novel microalgae strain with the efficacy of promoting plant growth and a use thereof. When cultured in the presence of fermentation exhaust gas, a novel Chlorella vulgaris CD02-3002 strain according to an aspect grows fast with a high efficiency of photosynthesis and thus can effectively reduce the exhaust gas generated by microbial fermentation. Having the effect of promoting plant growth when applied to plants, a culture of the strain or a supernatant of the culture can be used as a fertilizer for plants and thus can be advantageously applied as a novel carbon reduction technique.

Description

Microalgae strains having plant growth promoting effects and their uses

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority to Korean Patent Application No. 10-2021-0125207, filed September 17, 2021, the entire contents of which are incorporated herein by reference.

[0003] The present application relates to a novel microalgae strain having plant growth promoting efficacy and its use.

[0004] As the bio industry expands, microbial fermentation technology has become the foundation for the creation of diverse products. In particular, the microbial fermentation industry has experienced significant growth, driven by the recent growth of the white bio sector. However, fermentation inherently emits carbon dioxide, and the development of this industry has also brought with it a significant increase in greenhouse gas emissions. Furthermore, with climate change emerging as a global issue, efforts are being made to reduce greenhouse gases, a key driver of climate change. Therefore, reducing greenhouse gases generated by microbial fermentation has become a key challenge.

[0005] To date, technologies that can contribute to carbon reduction by primarily suppressing greenhouse gas emissions themselves have been commercialized. However, reducing carbon dioxide emissions during microbial fermentation processes remains a significant challenge. Furthermore, the development of technologies capable of directly capturing and reducing greenhouse gases remains minimal. Carbon dioxide, in particular, exists in very low concentrations in the atmosphere and is a stable substance with very low reactivity, making it difficult to develop technologies to reduce carbon dioxide that has already been emitted. While utilizing photosynthetic organisms as a biological carbon reduction technology could be considered, the lack of a clear profit structure beyond the carbon reduction goal makes it difficult to apply in actual industrial settings. Therefore, there is a pressing need to develop carbon reduction technologies that can reduce carbon dioxide generated by microbial fermentation in an environmentally friendly manner while also being industrially applicable.

[0006] The purpose of this application is to provide a Chlorella vulgaris CD02-3002 strain, deposited under accession number KCTC14659BP, having plant growth promoting efficacy.

[0007] Another object of the present application is to provide a composition for promoting plant growth, comprising at least one selected from the group consisting of the strain Chlorella vulgaris CD02-3002, deposited under accession number KCTC14659BP and having plant growth promoting efficacy; a culture or culture supernatant of the strain; a concentrate of the culture or culture supernatant; a dried product of the culture, culture supernatant or concentrate; and a crushed product of the dried product.

[0008] Another object of the present application is to provide a plant fertilizer comprising the above plant growth promoting composition.

[0009] Another object of the present application is to provide a method for culturing a Chlorella vulgaris CD02-3002 strain, which is deposited under the accession number KCTC14659BP and has a plant growth promoting effect, comprising a step of culturing the Chlorella vulgaris CD02-3002 strain in the presence of fermentation exhaust gas.

[0010] Another object of the present application is to provide a method for promoting plant growth, comprising the steps of preparing a plant growth promoting composition comprising at least one selected from the group consisting of Chlorella vulgaris CD02-3002 strain, deposited under accession number KCTC14659BP and having plant growth promoting efficacy; a culture or culture supernatant of the strain; a concentrate of the culture or culture supernatant; a dried product of the culture, culture supernatant or concentrate; and a crushed product of the dried product; and a step of bringing the plant growth promoting composition into contact with the plant.

[0011] Another purpose of the present application is to provide a use for manufacturing a plant fertilizer using the Chlorella vulgaris CD02-3002 strain, deposited under accession number KCTC14659BP and having plant growth promoting efficacy, or a use for promoting plant growth.

[0012] Another object of the present application is to provide a use for producing a plant fertilizer for promoting plant growth, or a use for promoting plant growth, of a composition comprising at least one selected from the group consisting of the strain Chlorella vulgaris CD02-3002, deposited under the accession number KCTC14659BP and having plant growth promoting efficacy; a culture or culture supernatant of the strain; a concentrate of the culture or culture supernatant; a dried product of the culture, culture supernatant or concentrate; and a crushed product of the dried product.

[0013]

[0014] Each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions set forth below. Furthermore, those skilled in the art will recognize or be able to ascertain, through routine experimentation alone, numerous equivalents to the specific embodiments of this application described in this application. Furthermore, such equivalents are intended to be encompassed by this application.

[0015]

[0016] The present invention provides a strain of Chlorella vulgaris CD02-3002, deposited under accession number KCTC14659BP, having plant growth promoting efficacy.

[0017] The plant may be a plant of the genus Arabidopsis. For example, the plant of the genus Arabidopsis may be, but is not limited to, Arabidopsis thaliana.

[0018] As used herein, the term “plant growth” means the process by which a plant seed germinates and produces roots, stems, leaves, or thereafter gradually increases in size and weight, and the term “promoting plant growth” means promoting the germination of a plant seed or an increase in the size and / or weight of a germinated plant.

[0019] The above Chlorella vulgaris CD02-3002 strain may have an 18S rRNA base sequence of SEQ ID NO: 1, but is not limited thereto. For example, the above Chlorella vulgaris CD02-3002 strain may have an 18S rRNA composed of a base sequence exhibiting a sequence identity of 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, or 99% or more with the base sequence of SEQ ID NO: 1, but is not limited thereto.

[0020]

[0021] Another aspect provides a composition for promoting plant growth, comprising at least one selected from the group consisting of a strain of Chlorella vulgaris CD02-3002, deposited under accession number KCTC14659BP and having plant growth promoting efficacy; a culture or culture supernatant of the strain; a concentrate of the culture or culture supernatant; a dried product of the culture, culture supernatant or concentrate; and a crushed product of the dried product.

[0022] The above Chlorella vulgaris CD02-3002 strain is as described above.

[0023] The “culture” of the above strain refers to a product produced by culturing the strain, and may specifically be a culture solution containing the strain, and the “culture supernatant” may be a culture filtrate from which the strain has been removed from the culture solution of the strain or the culture solution. The “concentrate” may mean a concentrated version of the culture or culture supernatant. The “dry product” refers to a culture, culture supernatant or concentrate thereof of the strain from which moisture has been removed, and may be, for example, in the form of dried cells of the strain, but is not limited thereto. In addition, the “crushed product” of the dried product refers to a general term for the result of crushing the dried product from which moisture has been removed, and may be, for example, in the form of dried cells powder of the strain, but is not limited thereto. The culture of the strain may be prepared by inoculating the strain into a culture medium and by a culture method known in the art, or may be prepared by a method including a step of culturing the strain in the presence of fermentation exhaust gas. The above concentrate, its dried product or its crushed product can be prepared according to a method for treating or drying microalgae or its culture known in the art.

[0024] The plant may be a plant of the genus Arabidopsis. For example, the plant of the genus Arabidopsis may be, but is not limited to, Arabidopsis thaliana.

[0025] The above plant growth promoting composition may contain a preservative, stabilizer, wetting agent or emulsifier, cryoprotectant, or excipient.

[0026] The above preservative, stabilizer, or excipient may be included in the composition in an effective amount sufficient to reduce deterioration of the composition.

[0027] As used herein, the term “quality deterioration” may include a decrease in the number, a decrease in the activity, or a combination thereof of the Chlorella vulgaris CD02-3002 strain included in the composition, etc.

[0028] For example, the composition may include an effective amount of a preservative, stabilizer, or excipient sufficient to reduce deterioration of the quality of the composition, thereby allowing the Chlorella vulgaris CD02-3002 strain to survive or remain active for a longer period of time within the composition than the Chlorella vulgaris CD02-3002 strain that exists in nature.

[0029] The above preservatives, stabilizers, or excipients may be used without limitation as long as they can reduce the deterioration of the quality of the composition, as are commonly used in the art. For example, the stabilizer may be at least one selected from the group consisting of alginate, sodium alginate, casein, sodium caseinate, cellulose, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, pectin, gelatin, gum arabic, xanthan gum, dextran, cyclodextrin, and starch.

[0030] The cryoprotectant may be included in the composition in an effective amount sufficient to reduce quality deterioration of the composition when the composition is in a lyophilized state. For example, unlike the Chlorella vulgaris CD02-3002 strain existing in a natural state, the composition may include an effective amount of the cryoprotectant sufficient to reduce quality deterioration of the composition in a lyophilized state, thereby allowing the Chlorella vulgaris CD02-3002 strain to survive or remain active for a longer period of time within the lyophilized composition.

[0031] As the cryoprotectant, any agent commonly used in the art may be used without limitation, as long as it is intended to reduce quality deterioration of the composition in a lyophilized state. For example, the cryoprotectant may be at least one selected from the group consisting of glycerol, ethylene glycol, propylene glycol, dimethyl sulfoxide (DMSO), glucose, trehalose, maltodextrin, dextrin, skim milk, and starch.

[0032] The above composition can be added to plant fertilizer by immersion, spraying or mixing.

[0033]

[0034] Another aspect provides a plant fertilizer comprising the above plant growth promoting composition.

[0035] The composition for promoting plant growth is as described above.

[0036] The plant may be a plant of the genus Arabidopsis. For example, the plant of the genus Arabidopsis may be, but is not limited to, Arabidopsis thaliana.

[0037] The above plant fertilizer can be manufactured using a manufacturing method commonly used in the art. For example, the plant fertilizer can further include excipients or carriers commonly used in the art, and can be manufactured using a formulation of a conventional plant fertilizer known in the art.

[0038] The above plant fertilizer may be an eco-friendly fertilizer that can replace chemical fertilizer.

[0039] The above plant fertilizer can be used to promote plant growth.

[0040]

[0041] Another aspect provides a method for culturing a Chlorella vulgaris CD02-3002 strain, deposited under accession number KCTC14659BP, which comprises culturing the Chlorella vulgaris CD02-3002 strain having plant growth promoting efficacy in the presence of fermentation exhaust gas.

[0042] The above Chlorella vulgaris CD02-3002 strain is as described above.

[0043] The above fermentation exhaust gas may contain 0.5 to 20% (v / v) of carbon dioxide. For example, the above fermentation exhaust gas may contain 0.5 to 18% (v / v), 0.5 to 16% (v / v), 0.5 to 14% (v / v), 0.5 to 12% (v / v), 0.8 to 18% (v / v), 0.8 to 16% (v / v), 0.8 to 14% (v / v), or 0.8 to 12% (v / v) of carbon dioxide.

[0044] The above-mentioned fermentation exhaust gas may be generated by microbial fermentation. For example, the above-mentioned fermentation exhaust gas may contain carbon dioxide generated by microbial fermentation. The microorganism may include, without limitation, any microorganism that generates carbon dioxide during the fermentation or cultivation process.

[0045] The above culturing step may be performed while supplying the fermentation exhaust gas to the fermentation tank. For example, the fermentation exhaust gas may be a gas generated by microbial fermentation that has been filtered and supplied to the fermentation tank. The fermentation exhaust gas may be supplied to the fermentation tank at a rate of 0.001 to 1 vvm. For example, the fermentation exhaust gas may be supplied to the fermentation tank at a rate of 0.001 to 1 vvm, 0.001 to 0.7 vvm, 0.001 to 0.5 vvm, 0.001 to 0.3 vvm, 0.001 to 0.2 vvm, 0.005 to 1 vvm, 0.005 to 0.7 vvm, 0.005 to 0.5 vvm, 0.005 to 0.3 vvm, 0.005 to 0.2 vvm, 0.01 to 1 vvm, 0.01 to 0.7 vvm, 0.01 to 0.5 vvm, 0.01 to 0.3 vvm, or 0.01 to 0.2 vvm.

[0046] The above culturing step may be performed at 20 to 40°C. For example, the above culturing step may be performed at 20 to 30°C.

[0047] The above culturing step may be performed in the presence of light. For example, the above culturing step may be performed while irradiating a light source sufficient for the growth of the Chlorella vulgaris CD02-3002 strain. The light source may be, for example, an LED light source, but is not limited thereto.

[0048] The above culturing step may be performed for 30 days or less. For example, the above culturing step may be performed for 3 to 30 days, 3 to 20 days, 3 to 15 days, 3 to 12 days, or 3 to 10 days.

[0049] The above culturing step is not particularly limited thereto, but may be performed by a known batch culture method, continuous culture method, fed-batch culture method, etc. The medium and other culture conditions used for culturing the Chlorella vulgaris CD02-3002 strain of the present application may be any medium used for culturing a conventional Chlorella vulgaris strain without particular limitation, and for example, BG-11 medium may be used. Specifically, the Chlorella vulgaris CD02-3002 strain of the present application may be cultured in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin, while controlling temperature, pH, etc. Specifically, the appropriate pH may be adjusted using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid), but is not limited thereto.

[0050]

[0051] Another aspect provides a method for promoting plant growth, comprising the steps of preparing a plant growth promoting composition comprising at least one selected from the group consisting of: a strain of Chlorella vulgaris CD02-3002, deposited under accession number KCTC14659BP and having plant growth promoting efficacy; a culture or culture supernatant of the strain; a concentrate of the culture or culture supernatant; a dried product of the culture, culture supernatant or concentrate; and a crushed product of the dried product; and a step of bringing the plant growth promoting composition into contact with the plant.

[0052] The above Chlorella vulgaris CD02-3002 strain and the plant growth promoting composition are as described above.

[0053] The culture or culture supernatant of the above Chlorella vulgaris CD02-3002 strain may be recovered using a suitable method known in the art. Furthermore, the step of preparing the plant growth promoting composition may utilize a suitable method known in the art. For example, centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC may be used, and a purification process may further be included. Methods known in the art may include concentration, drying, etc. of microalgae or their cultures.

[0054] The contacting step may be performed by a method of treating soil, a plant, or a plant seed with the plant growth promoting composition. For example, the contacting step may be performed by spraying the plant growth promoting composition onto the leaves of a plant, but is not limited thereto.

[0055]

[0056] Another aspect provides the use of the strain Chlorella vulgaris CD02-3002, deposited under accession number KCTC14659BP, having plant growth promoting efficacy, for the manufacture of a plant fertilizer, or for the use of the strain for promoting plant growth.

[0057] Another aspect provides a use for producing a plant fertilizer for promoting plant growth, or a use for promoting plant growth, of a composition comprising at least one selected from the group consisting of a strain of Chlorella vulgaris CD02-3002, deposited under the accession number KCTC14659BP and having plant growth promoting efficacy; a culture or culture supernatant of the strain; a concentrate of the culture or culture supernatant; a dried product of the culture, culture supernatant or concentrate; and a crushed product of the dried product.

[0058]

[0059] The novel Chlorella vulgaris CD02-3002 strain according to the present invention has a fast growth rate and high photosynthetic efficiency when cultured in the presence of fermentation exhaust gas, and can effectively reduce exhaust gas caused by microbial fermentation. In addition, when the culture or culture supernatant of the strain is treated to plants, it has the effect of promoting plant growth and can be used as a plant fertilizer. Therefore, it can be usefully utilized as a new carbon reduction technology that is environmentally friendly and has high industrial applicability.

[0060]

[0061] Figure 1 is a graph showing the results of measuring dry cell weight (DCW) after culturing each of the four Chlorella vulgaris strains.

[0062] Figure 2 is a graph showing the results of measuring the weight of the aerial parts of Arabidopsis thaliana after treatment with diluted culture supernatants of each of four strains of Chlorella vulgaris: DW, BG-11 liquid medium, Acadian 29, or Chlorella vulgaris.

[0063]

[0064] The present invention will be described in more detail below through examples. However, these examples are intended to exemplify one or more specific examples, and the scope of the present invention is not limited to these examples.

[0065]

[0066] Example 1. Isolation of a novel wild-type green algae

[0067] Samples were collected from five river areas in Suwon, Gyeonggi-do, South Korea, and microalgae belonging to green algae were isolated using the direct plating technique.

[0068] Specifically, microalgae were isolated from the samples within 2 to 3 days after collection, and the samples were observed under a microscope to be green and contain a spherical morphology. The samples were incubated on BG-11 solid medium for microbial isolation (1.5 g / L NaNO3, 40 mg / L K2HPO4, 75 mg / L MgSO4·7H2O, 36 mg / L CaCl2·2H2O, 6 mg / L citric acid·H2O, 6 mg / L ferric ammonium citrate, 1 mg / L Na2EDTA·2H2O, 20 mg / L Na2CO3, 2.86 mg / L H3BO3, 1.81 mg / L MnCl2·4H2O, 0.22 mg / L ZnSO4·7H2O, 0.39 mg / L Na2MoO4·2H2O, 0.079 mg / L The cultures were plated on 15 g / L agar (CuSO4·5H2O, 0.049 mg / L Co(NO3)2·6H2O, 15 g / L agar). The obtained colonies were purified through subculture on BG-11 solid medium containing adjusted concentrations of antibiotic cocktail mix solution (0–500 mg / L Streptomycin sulfate, 0–500 mg / L Ampicillin, 0–500 mg / L Kanamycin sulfate).

[0069]

[0070] Example 2. Identification of DNA sequences of isolated microalgae

[0071] For molecular biological identification of the microalgae isolated in Example 1 above, the 18s rRNA sequence was analyzed.

[0072] Specifically, DNA was extracted from purely isolated colonies, and PCR was performed using primers for gene amplification of the 18s rRNA region (Table 1).

[0073] Sequence number primer sequence (5' -> 3') 218s-FCGACTTCTGGAAGGGACGTA 318s-RCTAGGTGGGAGGGTTTAATG

[0074] The PCR reaction was performed by denaturing at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by a final polymerization reaction at 72°C for 5 minutes. The base sequence was analyzed using the amplified reaction solution, and a base sequence of approximately 1,565 bp in size was obtained (SEQ ID NO: 1). As a result of BLAST search at NCBI (https: / / www.ncbi.nlm.nih.gov / ), it was confirmed that it had 99.68% homology with Chlorella vulgaris KMMCC FC-42 strain, and the isolated strain was named Chlorella vulgaris CD02-3002, and was deposited with the Korean Collection for Type Cultures (KCTC), an international depository institution under the Budapest Treaty, on August 23, 2021, and was assigned the accession number KCTC14659BP.

[0075]

[0076] Example 3. Confirmation of growth ability of Chlorella vulgaris CD02-3002 strain under photo-culture conditions based on fermentation exhaust gas.

[0077] To determine whether the isolated novel strain Chlorella vulgaris CD02-3002 is a strain capable of growing under photo-cultivation conditions based on fermentation exhaust gas, its growth ability was compared and evaluated with that of several Chlorella vulgaris strains.

[0078] As a control strain, Chlorella vulgaris UTEX265 strain, obtained from the UTEX Culture Collection of Algae at UT-Austin, was used, and as a comparison group, Chlorella vulgaris CD11-2001 and CD11-2003 strains, isolated using the same method as described in Example 1, were used. Each strain was inoculated into 100 mL of sterilized BG-11 liquid medium (1.5 g / L NaNO3, 40 mg / L K2HPO4, 75 mg / L MgSO4·7H2O, 36 mg / L CaCl2·2H2O, 6 mg / L citric acid·H2O, 6 mg / L ferric ammonium citrate, 1 mg / L Na2EDTA·2H2O, 20 mg / L Na2CO3, 2.86 mg / L H3BO3, 1.81 mg / L MnCl2·4H2O, 0.22 mg / L ZnSO4·7H2O, 0.39 mg / L Na2MoO4·2H2O, 0.079 mg / L CuSO4·5H2O, 0.049 mg / L Co(NO3)2·6H2O) using an LED light source. The culture was cultured for 4 to 7 days under continuous light irradiation and CO2 concentration of 1 to 10% (v / v) supplied at 0.01 to 0.1 vvm. Afterwards, the culture was inoculated into 900 mL of new sterilized BG-11 liquid medium and cultured for 3 to 5 days under continuous light irradiation with an LED light source. During the culture period, the fermentation exhaust gas was directly supplied to the culture at 0.01 to 0.5 vvm through an air filter. The fermentation exhaust gas was the gas generated during fed-batch cultivation of Escherichia coli CJ181 (KFCC 10902) strain (US Patent Publication No. US 2008 / 0299644 A1) in a 5 L fermenter at a culture temperature of 30°C, a culture pH of 6.9 to 7.1 (pH adjusted with ammonia water), an aeration rate of 0.5 to 1.0 vvm, and a stirring speed of 500 to 700 rpm.

[0079] After the culture was completed, 10 mL of each strain culture was filtered through a 0.45 μm filter and dried in an oven at 60°C for 24 hours. The difference between the weight of the filter before filtration and the weight of the filter including the dried cells after filtration and drying was calculated to obtain the dry cell weight (DCW) value.

[0080] As a result, as shown in Fig. 1, it was confirmed that the Chlorella vulgaris CD02-3002 strain had a significantly higher dry cell weight than the received Chlorella vulgaris strain (UTEX265) or other newly isolated Chlorella vulgaris strains (CD11-2001 and CD11-2003). Through this, it was found that the Chlorella vulgaris CD02-3002 strain was the strain with the best growth rate under photo-cultivation conditions based on fermentation exhaust gas compared to other Chlorella vulgaris strains.

[0081]

[0082] Example 4. Confirmation of the plant growth promotion effect of the culture supernatant of Chlorella vulgaris CD02-3002 strain.

[0083] To confirm the plant growth promotion efficacy of the culture supernatant of Chlorella vulgaris CD02-3002 strain, growth promotion was evaluated using Arabidopsis thaliana.

[0084] Specifically, wild-type Arabidopsis thaliana seeds were surface-sterilized in 70% ethanol for 1 minute and 1% NaOCl solution for 3 minutes, and then washed with sterilized distilled water. After refrigerated storage (4°C) for 2 days, Arabidopsis thaliana seeds were planted in soil (Dongbu Farm Hannong Co., Ltd.) and then cultured in an incubator at 21°C for approximately 1 week, with 12 hours of light and 12 hours of darkness.

[0085] Four strains of Chlorella vulgaris UTEX265, CD11-2001, CD02-3002, and CD11-2003 were inoculated into 200 mL of sterilized BG-11 liquid medium, and cultured at 25°C for 5 to 7 days under LED light and continuous supply of 1 to 10% (v / v) CO2 at 0.1 vvm. The cultured seed culture was inoculated into 1.8 L of sterilized BG-11 liquid medium and cultured under the same conditions for up to 10 days. After completion of culture, the culture was centrifuged to obtain the culture supernatant of each strain.

[0086] To evaluate the plant growth promotion efficacy, cultivated Arabidopsis thaliana was treated with 10- to 1000-fold dilutions of the culture supernatant of each strain at 1 mL / plant, and foliar application was performed three times at 4-day intervals. The control group was set as a group treated with distilled water (DW) in the same manner, and the comparison group was added to the group treated with the medium used for photoculture of microalgae (BG-11 liquid medium) or a commercially available liquid fertilizer containing seaweed extract (Acadian 29). The above-ground fresh weight (weight of the above-ground part) was measured as an indicator of Arabidopsis thaliana growth. The experiment was repeated with 8 Arabidopsis plants for each test group, and the average value and standard deviation of the above-ground fresh weight were calculated and presented.

[0087] As a result, as shown in Fig. 2, other Chlorella vulgaris strains showed little or no growth promotion efficacy compared to the control group, whereas Chlorella vulgaris CD02-3002 strain showed significantly superior growth promotion efficacy, which was found to be significantly superior to that of Acadian 29, a commercial fertilizer.

[0088]

[0089] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering the technical concept or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

[0090]

[0091] [Accession number]

[0092] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0093] Accession number: KCTC14659BP

[0094] Date of acceptance: 20210823

[0095]

[0096]

Claims

1. A strain of Chlorella vulgaris CD02 - 3002 deposited under accession number KCTC14659BP and having a plant growth promoting effect.

2. A strain of Chlorella vulgaris CD02 - 3002 deposited under accession number KCTC14659BP and having a plant growth promoting effect; a culture or culture supernatant of the strain; a concentrate of the culture or culture supernatant; a dried product of the culture, culture supernatant or concentrate; and a composition for promoting plant growth comprising any one or more selected from the group consisting of a crushed product of the dried product.

3. A plant fertilizer comprising the composition for promoting plant growth according to claim 2.

4. A method for culturing Chlorella vulgaris CD02 - 3002 strain, comprising the step of culturing the Chlorella vulgaris CD02 - 3002 strain deposited under accession number KCTC14659BP and having a plant growth promoting effect in the presence of a fermentation exhaust gas.

5. The method for culturing Chlorella vulgaris CD02 - 3002 strain according to claim 4, wherein the fermentation exhaust gas contains 0.5 to 20% (v / v) of carbon dioxide.

6. The method for culturing Chlorella vulgaris CD02 - 3002 strain according to claim 4, wherein the fermentation exhaust gas is generated by microbial fermentation.

7. The method for culturing Chlorella vulgaris CD02 - 3002 strain according to claim 4, wherein the culturing step is carried out at 20 to 40 °C.

8. The method for culturing Chlorella vulgaris CD02 - 3002 strain according to claim 4, wherein the culturing step is carried out for 30 days or less.

9. A Chlorella vulgaris CD02-3002 strain deposited under accession number KCTC14659BP and having a plant growth promoting effect; a culture or culture supernatant of the strain; a concentrate of the culture or culture supernatant; a dried product of the culture, culture supernatant or concentrate; and a crushed product of the dried product, and preparing a composition for promoting plant growth comprising any one or more selected from the group consisting of; and A method for promoting plant growth, comprising contacting the plant growth promoting composition with a plant.

10. The method for promoting plant growth according to claim 9, wherein the contacting step is carried out by a method of treating the plant growth promoting composition on soil, a plant, or a seed of a plant.