Mutant l-threonine-releasing protein and method for producing l-threonine using same

Abstract

The present disclosure relates to an L-threonine efflux protein variant and a method for producing L-threonine using the same.

Description

Mutant L-threonine excretory protein and method for producing L-threonine using the same

[0001] The present application relates to a mutant L-threonine excretion protein and a method for producing L-threonine using the same.

[0002] Microorganisms of the genus Corynebacterium are Gram-positive microorganisms widely used for the production of L-amino acids. L-amino acids, particularly L-threonine, are essential amino acids used in animal feed, human medicine, and cosmetics industries. They are produced by fermentation using Corynebacterium strains.

[0003] Many attempts have been made to improve the production of L-amino acids using Corynebacterium strains. Among these, research has attempted to improve Corynebacterium strains that produce L-amino acids by disrupting or attenuating specific genes using recombinant DNA technology. Furthermore, numerous studies have attempted to improve L-amino acid-producing Corynebacterium strains by amplifying genes involved in individual L-amino acid biosynthesis and studying their effects on L-amino acid production. Furthermore, there have been cases of introducing exogenous genes from other bacteria. However, even with the aforementioned conventional methods, strains with improved L-threonine production remain in demand.

[0004] Meanwhile, expression of specific amino acid export genes has been shown to increase the productivity of the corresponding amino acid in microorganisms. Intensifying the expression of the L-lysine export gene (lysE) of a Corynebacterium microorganism improved the productivity of lysine (WO1997-023597). In addition, a patent (EP1016710B1) discloses that by strengthening the yeaS gene, yahN gene, yfiK gene, and yggA gene, which are genes whose functions have not been elucidated in Escherichia coli, the productivity of L-lysine, L-alanine, L-glutamic acid, L-threonine, L-histidine, L-valine, L-arginine, L-proline, and L-isoleucine was improved.

[0005] The present inventors completed the present application by identifying a mutant of an L-threonine efflux protein and confirming that when a microorganism expressing the mutant of the L-threonine efflux protein is cultured, a higher yield of L-threonine is produced compared to a microorganism having an existing wild-type efflux protein.

[0006] The present application provides a mutant L-threonine efflux protein in which the amino acid corresponding to position 133 in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0007] The present application provides a polynucleotide encoding a mutant L-threonine efflux protein of the present application.

[0008] The present application provides a microorganism comprising a mutant L-threonine efflux protein of the present application; or a polynucleotide encoding the same.

[0009] The present application provides a method for producing L-threonine, comprising the step of culturing a microorganism comprising a mutant L-threonine efflux protein of the present application; or a polynucleotide encoding the same; in a medium.

[0010] The present application provides a composition for producing L-threonine, comprising: a mutant L-threonine efflux protein of the present application; a polynucleotide encoding the same; a vector comprising the polynucleotide; a microorganism comprising the mutant L-threonine efflux protein or a polynucleotide encoding the same; a medium in which the microorganism is cultured; or a combination of two or more thereof.

[0011] The present application provides a use of a mutant L-threonine efflux protein of the present application; a polynucleotide encoding the same; a vector comprising the polynucleotide; or a microorganism comprising the mutant L-threonine efflux protein or a polynucleotide encoding the same for producing L-threonine.

[0012] When a microorganism producing L-threonine is cultured using a mutant of the L-threonine efflux protein of the present application, high yield L-threonine production is possible compared to a microorganism having an existing wild-type efflux protein.

[0013] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.

[0014]

[0015] One aspect of the present application provides a mutant L-threonine efflux protein, wherein the amino acid corresponding to position 133 in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid.

[0016]

[0017] The mutant L-threonine efflux protein of the present application may be one in which the amino acid at the position corresponding to position 133 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid different from the amino acid before substitution. Alternatively, the mutant L-threonine efflux protein may be a mutant L-threonine efflux protein in which an amino acid having an uncharged side chain is substituted with an amino acid different from the amino acid before substitution, which is a polar or hydrophilic amino acid, but is not limited thereto.

[0018] Specifically, the mutant L-threonine excretion protein may be one in which the amino acid corresponding to position 133 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid selected from the group consisting of arginine, lysine, histidine, aspartic acid, asparagine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, glutamic acid, and glutamine, but is not limited thereto.

[0019] More specifically, the mutant L-threonine efflux protein may be one in which the amino acid corresponding to position 133 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid selected from the group consisting of serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and may be substituted with serine, for example, but is not limited thereto.

[0020] More specifically, the variant L-threonine efflux protein of the present application may have, comprise, consist of, or consist essentially of the amino acid sequence set forth in SEQ ID NO: 3.

[0021] The protein to be subjected to mutation in the present application may be a protein having L-threonine excretion activity. Specifically, the protein may comprise the amino acid sequence of SEQ ID NO: 1 and may have threonine excretion activity, but is not limited thereto. This does not exclude meaningless sequence additions before and after the amino acid sequence of SEQ ID NO: 1, mutations that may occur naturally, or silent mutations thereof, and if it has the same or corresponding activity as the protein comprising the amino acid sequence of SEQ ID NO: 1, it may correspond to the protein to be subjected to mutation in the present application. For example, the protein to be subjected to mutation in the present application may be a protein composed of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity therewith. In addition, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added is also included within the scope of the protein that is the subject of mutation in the present application, provided that the amino acid sequence has such homology or identity and exhibits an effect corresponding to the protein.

[0022]

[0023] The mutant L-threonine efflux protein of the present application may include an amino acid sequence in which the amino acid corresponding to position 133 of the amino acid sequence of SEQ ID NO: 1 is an amino acid other than glycine, for example, serine, and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5%, but less than 100%, homology or identity with the amino acid sequence described in SEQ ID NO: 1. In addition, it is obvious that a mutant L-threonine efflux protein having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the mutant L-threonine efflux protein of the present application.

[0024] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the mutant L-threonine efflux protein of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.

[0025]

[0026] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0027] For example, among amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; and amino acids having uncharged side chains include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.

[0028]

[0029] As used herein, the term "variant protein" or "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The term "variant protein" may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto as long as the term is used in the meaning of mutation. For the purpose of the present application, the variant may be a polypeptide in which the amino acid corresponding to position 133 of the amino acid sequence of SEQ ID NO: 1 is substituted with serine. Specifically, the variant may be a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3, but is not limited thereto.

[0030] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0031]

[0032] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0033] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0034] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al.](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information database.

[0035] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for the GAP program are (1) a unitary matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a matrix of 1s for identity and 0s for non-identity, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al. (1986) Nucl. Acids Res. 48:443. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0036] As an example of the present application, the mutant L-threonine efflux protein of the present application may have an activity that increases L-threonine production ability compared to a wild-type polypeptide having L-threonine efflux protein activity.

[0037] In this application, the term "L-threonine efflux protein" refers to a membrane protein having L-threonine efflux activity, and may be used interchangeably with RhtC. The amino acid sequence of RhtC can be obtained from a known database such as NCBI's Genebank.

[0038] For example, RhtC of the present application may be of microbial origin, specifically, may be of prokaryotic microbial origin, and more specifically, may be of Escherichia coli or the like, but may be a protein having L-threonine excretion activity of various origins. In the amino acid sequence before modification of RhtC to be mutated in the present application, the amino acid before modification corresponding to position 133 of SEQ ID NO: 1 may be glycine (G).

[0039]

[0040] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0041] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0042] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0043]

[0044] Another aspect of the present application provides a polynucleotide encoding a mutant L-threonine efflux protein of the present application.

[0045] The rhtC gene of the present application may include any gene known to encode a protein having RhtC activity.

[0046] Specifically, the rhtC gene of the present application may be a rhtC gene derived from Escherichia coli. For example, the rhtC gene of the present application may be a polynucleotide encoding WP_000928824.1 derived from Escherichia coli.

[0047] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the mutant L-threonine efflux protein.

[0048] The polynucleotide encoding the mutant L-threonine efflux protein of the present application may include a base sequence encoding a mutant L-threonine efflux protein in which the amino acid corresponding to position 133 in the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid, or may include a base sequence in which the codon corresponding to positions 397 to 399 in the nucleotide sequence of SEQ ID NO: 2 is substituted with a codon encoding a different amino acid. Specifically, the polynucleotide of the present application may include a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 3. As a more specific example of the present application, the polynucleotide of the present application may have or include the sequence of SEQ ID NO: 4 or SEQ ID NO: 5. In addition, the polynucleotide of the present application may consist of, or consist essentially of, the sequence of SEQ ID NO: 4 or SEQ ID NO: 5.

[0049] The polynucleotide of the present application can have various modifications made to the coding region within a range that does not change the amino acid sequence of the mutant L-threonine efflux protein of the present application, taking into account the degeneracy of the codon or the codon preferred in the organism that is to express the mutant L-threonine efflux protein of the present application. Specifically, the polynucleotide of the present application has or includes a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 2, or may consist of or consist essentially of a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 2, but is not limited thereto. At this time, in the sequence having the homology or identity, the codon encoding the amino acid corresponding to the 133rd position of SEQ ID NO: 1 may be one of the codons encoding an amino acid other than glycine, for example, serine.

[0050] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, are performed.

[0051] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0052] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0053] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0054]

[0055] Another aspect of the present application provides a vector comprising the polynucleotide of the present application. The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a host cell.

[0056] The vector of the present application may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.

[0057] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0058] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0059] The term "transformation" in this application refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0060] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target mutant L-threonine efflux protein of the present application.

[0061]

[0062] Another aspect of the present application provides a microorganism comprising a mutant L-threonine efflux protein of the present application or a polynucleotide of the present application.

[0063] The strain of the present application may comprise a mutant L-threonine efflux protein of the present application, a polynucleotide encoding the polypeptide, or a vector comprising the polynucleotide of the present application.

[0064] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that has a specific mechanism weakened or strengthened due to causes such as insertion of an external gene or enhanced or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product.

[0065] The strain of the present application may be a strain that naturally has L-threonine production ability, or a microorganism in which L-threonine production ability is conferred on a strain that does not have L-threonine production ability. For example, it may be a microorganism in which the mutant L-threonine excretion protein of the present application or a polynucleotide encoding the same is introduced, thereby enhancing L-threonine excretion ability, but is not limited thereto.

[0066] The strain of the present application may be a microorganism having increased L-threonine production capacity compared to a parent strain or a wild-type Corynebacterium strain that does not include the variant of the present application. The microorganism may have an increased L-threonine production capacity due to an increased L-threonine excretion capacity caused by the introduction of the variant of the present application.

[0067] For example, the target strain for comparing the increase in L-threonine production ability, the L-threonine excretion protein-unmodified microorganism, may be, but is not limited to, the L-threonine producing strain Corynebacterium glutamicum CA09-0903 strain (Accession No. KCCM12502P, Republic of Korea Patent No. 10-2126951) or Corynebacterium glutamicum KFCC10881-THR (Accession No. KCCM11222P, US 10590446 B2).

[0068] For example, the recombinant strain with increased productivity may have an L-threonine productivity of about 1% or more, specifically, about 1% or more, about 2.5% or more, about 5% or more, about 7.5% or more, about 10% or more, about 12.5% ​​or more, about 15% or more, about 17.5% or more, about 20% or more, about 22.5% or more, about 25% or more, about 27.5% or more, about 30% or more, about 32.5% or more, or about 33% or more (the upper limit is not particularly limited and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 15% or less) increased compared to the L-threonine productivity of the parent strain before mutation or the non-mutated microorganism, It is not limited thereto, as long as it has a positive increase in the production capacity compared to the unmodified microorganism or the unmodified microorganism of L-threonine efflux protein. In another example, the recombinant strain with increased L-threonine production ability may have an L-threonine production ability increased by about 1.01 times or more, about 1.025 times or more, about 1.05 times or more, about 1.075 times or more, about 1.10 times or more, about 1.125 times or more, about 1.15 times or more, about 1.175 times or more, about 1.20 times or more, about 1.225 times or more, about 1.25 times or more, about 1.275 times or more, about 1.30 times or more, about 1.325 times or more, or about 1.33 times or more (the upper limit is not particularly limited and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less) compared to the parent strain before mutation, the unmodified microorganism, or the unmodified microorganism having the L-threonine excretion protein, but Not limited.

[0069] In the present application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation due to natural or artificial factors. In addition, the term "unmodified L-threonine efflux protein microorganism" in the present application may refer to a strain that is not introduced or before the L-threonine efflux protein variant described herein is introduced. The unmodified L-threonine efflux protein microorganism in the present application does not exclude a strain that contains a modification of a protein or another gene other than a modification of the L-threonine efflux protein or a polynucleotide encoding the same.

[0070] In this application, the term “unmodified microorganism” may be used interchangeably with “pre-modified strain”, “pre-modified microorganism”, “unmodified strain”, “unmodified microorganism”, or “reference microorganism”.

[0071] The microorganism of the present application may be, but is not limited to, a microorganism comprising a mutant L-threonine efflux protein or a polynucleotide encoding the same; or a microorganism genetically modified to include a mutant L-threonine efflux protein or a polynucleotide encoding the same (e.g., a recombinant microorganism). The term "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by a parent strain, wild type, or unmodified microorganism before a change in phenotype, when the phenotype is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification."

[0072] In another example of the present application, the microorganism of the present application is Corynebacterium stationis, Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens.

[0073]

[0074] As another example, the recombinant microorganism of the present application may be a microorganism with enhanced L-threonine production ability by further enhancing the activity of a portion of a protein in the L-threonine biosynthesis pathway or by further weakening the activity of a portion of a protein in the L-threonine degradation pathway.

[0075] Specifically, in order to enhance the biosynthetic pathway of the L-threonine, the expression of, for example, the thrC gene encoding threonine synthetase, the ppc gene encoding phosphoenolpyruvate carboxylase, the galP gene involved in glucose uptake, the lysC gene encoding lysine-sensitive aspartokinase 3, the hom gene encoding homoserine dehydrogenase, or the pyc gene inducing an increase in the oxaloacetate pool can be enhanced or increased in the microorganism.

[0076] To relieve the feedback inhibition of L-threonine, a genetic mutation can be introduced, for example, into the lysC gene, the hom gene, or the thrA gene, which has the dual function of aspartokinase and homoserine dehydrogenase 1.

[0077] In order to inactivate genes that weaken the biosynthetic pathway of L-threonine, for example, the expression of the pckA gene involved in converting oxaloacetate (OAA), an intermediate of L-threonine biosynthesis, into phosphoenolpyruvate (PEP), the tyrR gene that represses the lysC gene, the galR gene that represses the expression of the galP gene involved in glucose uptake, or the mcbR gene, a DNA-binding transcriptional dual regulator, can be weakened or inactivated in the microorganism.

[0078] In order to increase the activity of the above L-threon, a plasmid containing a threonine operon (Japanese Patent Publication No. 2005-227977) composed of genes encoding aspartokinase, homoserine dehydrogenase, homoserine kinase, and threonine synthase, or a threonine operon derived from Escherichia coli, etc., can be introduced into a microorganism (TURBA E, et al, Agric. Biol. Chem. 53:2269~2271, 1989), thereby increasing the expression of the threonine operon in the microorganism.

[0079] Additionally, it may confer resistance to L-threonine analogs such as α-amino-β-hydroxyvaleric acid or D,L-threonine hydroxamate.

[0080] In addition, it can weaken the genes dapA (dihydrodipicolinate synthase), lysA (diaminopimelate decarboxylase), and ddh (diaminopimelate dehydrogenase), which are genes that act on the biosynthetic pathway of L-lysine, which has a common precursor with L-threonine.

[0081] However, without limitation thereto, L-threonine production can be enhanced by any gene expression control method known in the art.

[0082]

[0083] In this application, the term "attenuation" of the activity of a polypeptide (including, for example, proteins specified by the name of each enzyme) includes both a decrease in activity or absence of activity compared to the intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0084] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The fact that the activity of the polypeptide is “inactivated, deficient, reduced, downregulated, reduced, attenuated” compared to the intrinsic activity means that the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the transformation is lowered.

[0085] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0086]

[0087] Specifically, the weakening of the activity of the polypeptide of the present application is

[0088] 1) Deletion of all or part of a gene encoding a polypeptide;

[0089] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;

[0090] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;

[0091] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);

[0092] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0093] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;

[0094] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;

[0095] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or

[0096] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.

[0097] for example,

[0098] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.

[0099] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0100] The modification of the amino acid sequence or polynucleotide sequence of the above 3) and 4) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of the gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.

[0101] The above 5) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0102] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0103] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.

[0104] In addition, the addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0105]

[0106] In this application, the term "enhancement" of the activity of a polypeptide means that the activity of the polypeptide is increased compared to the intrinsic activity. The term "enhancement" may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or the activity before modification. "Enhancement," "up-regulation," "overexpression," or "increase" of the activity of a polypeptide compared to the intrinsic activity means that the activity and / or concentration (expression amount) of a specific polypeptide is enhanced compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had before the transformation.

[0107] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0108] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0109] Specifically, the enhancement of the activity of the polypeptide of the present application is

[0110] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0111] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;

[0112] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0113] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0114] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0115] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0116] 7) Codon optimization of a polynucleotide encoding a polypeptide;

[0117] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0118] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.

[0119] More specifically,

[0120] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0121] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0122] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0123] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0124] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred.

[0125] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0126] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0127] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0128] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity, concentration, or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild-type or unmodified microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0129]

[0130] In the microorganism of the present application, modification of part or all of the polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0131]

[0132] In the microorganism of the present application, the mutant L-threonine excretion protein, polynucleotide, and L-threonine, etc. are as described in the other aspects above.

[0133]

[0134] Another aspect of the present application provides a method for producing L-threonine, comprising the step of culturing a microorganism comprising a mutant L-threonine efflux protein of the present application or a polynucleotide of the present application in a medium.

[0135] The method for producing L-threonine of the present application may include a step of culturing a microorganism comprising the mutant L-threonine excretion protein of the present application or the polynucleotide of the present application or the vector of the present application in a medium.

[0136] In this application, the term "cultivation" refers to growing the microorganism of this application under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected microorganism. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0137] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the microorganism of this application, and supplies nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0138] Specifically, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0139] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0140] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0141] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0142] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0143] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0144] L-threonine produced by the culture of the present invention may be secreted into the medium or remain within the cells.

[0145]

[0146] The method for producing L-threonine of the present application may additionally include a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, before the culturing step.

[0147] The method for producing L-threonine of the present application may further include a step of recovering L-threonine from the culture medium (medium in which culture is performed) or the Corynebacterium glutamicum strain according to the above-described cultivation. The recovering step may be additionally included after the culturing step.

[0148] The above recovery may be performed by collecting the target L-threonine using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target L-threonine may be recovered from the medium or microorganism using a suitable method known in the art.

[0149] Additionally, the L-threonine production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the L-threonine production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0150] In the method of the present application, the mutant L-threonine efflux protein, polynucleotide, vector, strain, etc. are as described in the other embodiments above.

[0151]

[0152] Another aspect of the present application provides a composition for producing L-threonine, comprising: a mutant L-threonine efflux protein of the present application; a polynucleotide encoding the same; a vector comprising the polynucleotide; a microorganism comprising the mutant L-threonine efflux protein or the polynucleotide encoding the same; a medium in which the microorganism is cultured; or a combination of two or more thereof.

[0153] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing L-amino acids, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0154]

[0155] Another aspect of the present application provides a use for producing L-threonine, comprising: a variant L-threonine efflux protein of the present application; a polynucleotide encoding the same; a vector comprising the polynucleotide; or a microorganism comprising the variant L-threonine efflux protein or a polynucleotide encoding the same.

[0156] The above L-threonine efflux protein, mutant L-threonine efflux protein, polynucleotide, vector, strain, medium, and L-threonine, etc. are as described in the other embodiments above.

[0157]

[0158] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0159]

[0160] Example 1: Construction of a mutant library and plasmid of L-threonine efflux protein.

[0161] To prepare a template for error-prone PCR, a PrhtC base sequence fragment (SEQ ID NO: 6) was first obtained by performing PCR using the primer pair of SEQ ID NO: 7 and SEQ ID NO: 8 from the genomic DNA of Escherichia coli strain W3110.

[0162] The primers used here are as shown in Table 1 below.

[0163] Sequence number Sequence name Sequence (5' -> 3') 7PrhtC FTCGAGCTCGGTACCCGGGGAGCCATGAACATTGGGTGAGC 8PrhtC RGTCGACTCTAGAGGAggatccACATTTGACTCGCGGGGGA

[0164] Then, the pCC1BAC (EPICENTRE) digested with SmaI restriction enzyme and the DNA fragment obtained above were cloned using the Gibson assembly method to obtain the recombinant plasmid pCC1BAC-PrhtC. Cloning was performed by mixing the Gibson assembly reagent and each gene fragment in the calculated molar number and then storing it at 50°C for 1 hour.

[0165] Random mutagenesis was performed using a diversify PCR random mutagenesis kit (Takara) to induce error-prone PCR in wild-type rhtC (rhtCWT) (SEQ ID NO: 2) encoding L-threonine efflux protein. Error-prone PCR was performed under two conditions depending on the MnSO4 concentration to select the mutation rate condition as follows. Genomic DNA of Escherichia coli strain W3110 was used as the DNA template to introduce mutations. The composition of the reaction mixture for error-prone PCR was as shown in Table 2 below. The PCR conditions were denaturation at 95°C for 30 s, followed by 25 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and polymerization at 68°C for 30 s, and then polymerization at 68°C for 60 s. When performing PCR, a primer pair of sequence numbers 9 and 10 was used as primers.

[0166] The primers used here are as shown in Table 3 below.

[0167] case #1 (μl)2 (μl)10X Titanium taq Buffer55MnSO4(8mM)12dGTP (2mM)1150

[0168] Sequence number Sequence name Sequence (5' -> 3') 9rhtC FTCCCCCGCGAGTCAAATGTgATGTTGATGTTATTTCTCACCGTC 10rhtC RGTCGACTCTAGAGGAggatcTCACCGCGAAATAATCAAATGAATG

[0169]

[0170] The product obtained by performing error-inducing PCR under the conditions of Table 2 above was treated with DpnI and cloned into pCC1BAC-PrhtC digested with BamHI restriction enzyme using the Gibson assembly method to obtain a library of recombinant mutant plasmids pCC1BAC-PrhtC_rhtC(mt). The mutant library obtained by the above method was transformed into E. coli K12 strain and plated on LB plate medium containing 50 μg / L spectinomycin.

[0171] Fifty colonies were selected from the transformed E. coli K12 (K12 / pCC1BAC-PrhtC-rhtC(mt)) strain library using the above mutant library, and sequenced to determine the mutation rate and the presence or absence of mutations at various locations. The sequencing results showed that the mutation rate under case #1 was one per 1.2 kb, and under case #2, one per 2.0 kb. Since both cases #1 and #2 were determined to have mutation rates suitable for securing mutant libraries, a valid mutation screening process was performed using the libraries constructed under the above conditions.

[0172] In addition, to construct the pCC1BAC-PrhtC-rhtC(WT) vector as a control, a base sequence fragment (SEQ ID NO: 2) encoding RhtC WT was obtained by performing PCR using the primer pair of SEQ ID NO: 9 and SEQ ID NO: 10 from the genomic DNA of E. coli W3110 strain using a conventional method. The PCR conditions were denaturation at 95°C for 30 seconds, followed by 25 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 68°C for 30 seconds, and then polymerization at 68°C for 60 seconds. The obtained product was treated with DpnI and cloned into pCC1BAC-PrhtC digested with BamHI restriction enzyme by the Gibson assembly method to construct the recombinant mutant plasmid pCC1BAC-PrhtC_rhtC(WT) vector.

[0173]

[0174] Example 2: Identification of mutations in L-threonine efflux protein through library screening.

[0175] 300 μl of M9 minimal media containing 60 g / L of L-threonine was dispensed into 96 deep-well plates, and colonies of K12 / pCC1BAC-PrhtC-rhtC(mt) transformed with the mutant library constructed in Example 1 and K12 / pCC1BAC and K12 / pCC1BAC-PrhtC-rhtC(WT) as controls were inoculated. After culturing at 1200 rpm / 15 hr / 37°C, OD was measured at a wavelength of 600 nm to select strains that did not show growth inhibition, unlike the wild-type E. coli K12 strain, in M9 minimal media containing 60 g / L of L-threonine.

[0176] As a result, most mutant strains showed little growth in deep-well plates, similar to the control strains (K12 / pCC1BAC, K12 / pCC1BAC-PrhtC_rhtC(WT)). Approximately 4,000 strains were initially screened based on the measured OD. Among them, the top 5% (150) were subjected to secondary screening, and colonies with high average values ​​were selected through triplicate. After excluding colonies with severe deviation, six strains were finally selected for growth in contrast to the control strain and named K12 pCC1BAC-PrhtC_rhtC (m1 to m6). The OD was recorded and shown in Table 4 below.

[0177] Strain nameODK12 / pCC1BAC0.14K12 / pCC1BAC-PrhtC_rhtC(WT)0.17K12 / pCC1BAC-PrhtC_rhtC(m1)1.21K12 / pCC1BAC-PrhtC_rhtC(m2)1.16K12 / pCC1BAC-PrhtC_rhtC(m3)1.25K12 / pCC1BAC-PrhtC_rhtC(m4)1.26K12 / pCC1BAC-PrhtC_rhtC(m5)1.49K12 / pCC1BAC-PrhtC_rhtC(m6)1.31

[0178] In order to confirm the base sequence of the rhtC gene included in the six selected strains K12 / pCC1BAC-PrhtC_rhtC (m1 to m6), a DNA fragment including the rhtC gene was amplified by PCR under the same conditions as in Example 1 using the primer pair of SEQ ID NO: 9 and SEQ ID NO: 10.

[0179] Analysis of the base sequence of the amplified gene confirmed that the K12 / pCC1BAC-PrhtC-rhtC (m1 to m6) strains commonly had 1 to 2 mutations introduced into the base sequence located between 397 and 399 bp downstream from the rhtC gene ORF start codon. That is, the K12 / pCC1BAC-PrhtC_rhtC (m1 to m6) strain was confirmed to contain a sequence encoding a mutant RhtC (G133S) protein in which the 397th to 399th base sequence based on SEQ ID NO: 2 had a mutation from the existing GGC to AGC or AGT, and the 133rd amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1, glycine (G), was substituted with serine (S).

[0180]

[0181] Example 3: Construction of a plasmid for expression of a mutant L-threonine efflux protein.

[0182] In order to introduce a mutant gene for expressing the mutant L-threonine excretion protein identified in Example 2 onto the chromosome of a Corynebacterium strain, a recombinant vector was constructed using the following method.

[0183] First, to construct the Ncgl1762 deletion vector, the genomic DNA of Corynebacterium glutamicum ATCC13032 strain was used as a template, and the Ncgl1762 upper and lower homologous region fragments were amplified by PCR under the same conditions as in Example 1 using the primer pairs of SEQ ID NOs: 11 and 12 and the primer pairs of SEQ ID NOs: 13 and 14, respectively. After the amplified product was treated with the restriction enzyme SmaI, it was ligated to the pDCM2 vector (Korean Patent No. 2278000) heat-treated at 65°C for 20 minutes using an Infusion Cloning Kit, and then transformed into E. coli DH5α. The transformed strain was spread on LB solid medium containing kanamycin (25 mg / l), and the selected colonies were cultured to obtain a plasmid, which was named pDCM2-△Ncgl1762.

[0184] The primers used here are as shown in Table 5 below.

[0185] Sequence number Sequence name Sequence (5' -> 3') 111762A FTGAATTCGAGCTCGGTACCCGTGGCCAGTATTAATGGGCT 121762A RGTCTCAAGCAGAGActcgagCACCCTCAATGGGTCAGGCC 131762B FACCCATTGAGGGTGctcgagTCTCTGCTTGAGACTTAAGC 141762B RGTCGACTCTAGAGGATCCCCAGGCTCTCTATGGGCACCTC

[0186] Next, vectors were constructed to insert the wild-type rhtC and mutant rhtC genes into the Ncgl1762 locus, respectively. Using the primer pairs of SEQ ID NOs: 15 and 16, PCR was performed under the same conditions as in Example 1 from the genomic DNA of the E. coli W3110 strain to obtain a rhtC (WT) fragment. In addition, using the fragment of rhtC containing the sequence encoding the mutant protein in which the 133rd glycine is substituted with serine identified in Example 2 as a template, the primer pairs of SEQ ID NOs: 15 and 16 were used to amplify and obtain a mutant rhtC (G133S) fragment. Thereafter, each fragment and the pDCM2-△Ncgl1762 vector were treated with the restriction enzyme XhoI, heat-treated at 65°C for 20 minutes, and then ligated using an Infusion Cloning Kit to transform the E. coli DH5α strain. The above strains were spread on LB solid medium containing kanamycin (25 mg / l), and the selected colonies were cultured to obtain plasmids, which were named pDCM2-△Ncgl1762::PrhtC-rhtC(WT) and pDCM2-△Ncgl1762::PrhtC-rhtC(G133S), respectively.

[0187] The primers used here are as shown in Table 6 below.

[0188]

[0189] SEQ ID NO Sequence Name Sequence (5' -> 3') 15rhtC(m) FGCCTGACCCATTGAGGGTGcGCCATGAACATTGGGTGAGC16rhtC(m) RATAACGCTTAAGTCTCAAGCAGAGActcgaTCACCGCGAAATAATCAAAT

[0190] Example 4: Production of Corynebacterium glutamicum KCCM12502P strain containing mutant L-threonine efflux protein and analysis of L-threonine production ability

[0191] The pDCM2-△Ncgl1762, pDCM2-△Ncgl1762::PrhtC_rhtC(WT), and pDCM2-△Ncgl1762::PrhtC_rhtC(G133S) vectors prepared in Example 3 were each transformed by electroporation into the Corynebacterium glutamicum CA09-0903 strain (Accession No. KCCM12502P, Republic of Korea Patent No. 10-2126951) endowed with L-threonine production ability, and then, through a second crossing process, a strain lacking Ncgl1762 on the chromosome and a strain in which the wild-type rhtC or mutant rhtC gene was inserted at the Ncgl1762 position were obtained. The genetic manipulation was confirmed by PCR using primer pairs of SEQ ID NOs: 17 to 23, which can amplify external regions of the upstream and downstream regions of the homologous recombination region into which the gene was inserted, and genome sequencing.

[0192] The primers used here are as shown in Table 7 below.

[0193] SEQ ID NO: Sequence name Sequence (5' -> 3') 17pDC FCTATTACGCCAGCTGGCGAAAG18pDC RATGTTGCTGTGGAATTGTGAG19seq 1TTCTCTTGTTCCTTTCTGAG20seq 2TTCTGAGTAGCTGAGCTTCG21seq 3CCAGATGCTACGTGGGTGCAC22seq 4TGGTCTGCTCGCTTCTCGAT23seq 5TATCTTCGTAGAGCACTGCT

[0194] The obtained Ncgl1762 deletion strains and strains in which the wild-type rhtC or mutant rhtC gene was inserted at the Ncgl1762 position were named 12502P-del, 12502P-WT, and 12502P-G133S, respectively.

[0195] To analyze the L-threonine production ability of the three mutant strains, flask culture was performed using the following medium. The parent strain, Corynebacterium glutamicum KCCM12502P, was used as a control, and L-threonine production was measured by culturing using the following method.

[0196] First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 32°C for 72 hours with shaking at 200 rpm. The compositions of the seed medium and production medium are as follows, and the L-threonine production concentration according to the culture is shown in Table 8.

[0197]

[0198] <Seed medium (pH 7.0)>

[0199] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO 4· 7H2O 0.5 g, biotin 0.1 mg, thiamine HCl 1 mg, calcium pantothenic acid 22 mg, nicotinamide 2 mg (per 1 liter of distilled water)

[0200]

[0201] <Production medium (pH 7.0)>

[0202] Glucose 63 g, (NH4)2SO4 28 g, soy protein 20 g, molasses 14 g, KH2PO4 1.1 g, MgSO 4· 7H2O 1.2 g, biotin 1.8 mg, thiamine hydrochloride 9 mg, calcium pantothenic acid 9 mg, MnSO4 180 mg, FeSO4 200 mg, ZnSO4 1 mg, CuSO4 1 mg, CaCO3 30 g (based on 1 liter of distilled water)

[0203]

[0204] Strain name L-threonine (g / L) Batch 1 Batch 2 Batch 3 Average KCCM12502P 3.3 13.27 3.213.26 KCCM12502P-del 3.26 3.34 3.22 3.27 KCCM12502P-WT 3.4 13.45 3.39 3.42 KCCM12502P-G13 3S 4.3 24.36 4.414.36

[0205]

[0206] As a result, as shown in Table 8 above, the control group KCCM12502P produced 3.26 g / L of L-threonine, and KCCM12502P-del produced 3.27 g / L of L-threonine. In addition, KCCM12502P-G133S, into which the mutant rhtC (G133S) was introduced, produced 4.36 g / L of L-threonine.

[0207] In terms of L-threonine fermentation yield, KCCM12502P-WT showed a 5% increase compared to KCCM12502P, while the KCCM12502P-G133S strain with the mutant rhtC (G133S) introduced showed a 33% increase.

[0208]

[0209] Example 5: Production of Corynebacterium glutamicum KCCM11222P strain containing mutant L-threonine efflux protein and analysis of L-threonine production ability

[0210] To confirm whether L-threonine production is increased by introduction of mutant RhtC in other Corynebacterium glutamicum strains that produce L-threonine, the vectors pDCM2-△Ncgl1762, pDCM2-△Ncgl1762::PrhtC_rhtC(WT), and pDCM2-△Ncgl1762::PrhtC_rhtC(G133S) constructed in Example 3 were transformed into Corynebacterium glutamicum KFCC10881-THR (Accession No. KCCM11222P, US 10590446 B2), an L-threonine-producing strain, using the same method as in Example 4, and then named 11222P-del, 11222P-WT, and 111222P-G133S, respectively.

[0211] To analyze the L-threonine production ability of the three mutant strains, flask culture was performed using the following medium. The parent strain, Corynebacterium glutamicum KCCM11222P, was used as a control, and L-threonine production was measured by culturing using the following method.

[0212] First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium and cultured at 30°C for 20 hours with shaking at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of production medium and cultured at 32°C for 72 hours with shaking at 200 rpm. The compositions of the seed medium and production medium are as follows, respectively, and the L-threonine production concentration according to the culture is shown in Table 9.

[0213]

[0214] <Seed medium (pH 7.0)>

[0215] Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO 4·7H2O 0.5 g, biotin 0.1 mg, thiamine HCl 1 mg, calcium pantothenic acid 22 mg, nicotinamide 2 mg (per 1 liter of distilled water)

[0216]

[0217] <Production medium (pH 7.0)>

[0218] Glucose 63 g, (NH4)2SO4 28 g, soy protein 20 g, molasses 14 g, KH2PO4 1.1 g, MgSO 4· 7H2O 1.2 g, biotin 1.8 mg, thiamine hydrochloride 9 mg, calcium pantothenic acid 9 mg, MnSO4 180 mg, FeSO4 200 mg, ZnSO4 1 mg, CuSO4 1 mg, CaCO3 30 g (based on 1 liter of distilled water)

[0219]

[0220] Strain name L-threonine (g / L) Batch 1 Batch 2 Batch 3 Average KCCM11222P 7.117.147.117.12 KCCM11222P-del 7.217.187.167.18 KCCM11222P-WT 7.347.387.427.38 KCCM11222P-G133S 8.948.899.018.95

[0221] As a result, as shown in Table 9 above, when the mutant rhtC (G133S) was introduced into Corynebacterium glutamicum KCCM11222P, an L-threonine producing strain, it was confirmed that the L-threonine production ability increased by an average of 25%.

[0222]

[0223] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A mutant L-threonine efflux protein in which the amino acid corresponding to position 133 in the amino acid sequence of sequence number 1 is replaced with another amino acid.

2. A mutant L-threonine excretion protein according to claim 1, wherein the other amino acid is an amino acid selected from the group consisting of serine, threonine, cysteine, tyrosine, asparagine, and glutamine.

3. A mutant L-threonine efflux protein according to claim 2, wherein the other amino acid is serine.

4. In the first paragraph, the mutant L-threonine efflux protein has a sequence identity of 70% or more and less than 100% with the amino acid sequence of sequence number 1.

5. A polynucleotide encoding a mutant L-threonine efflux protein according to any one of claims 1 to 4.

6. A microorganism comprising a mutant L-threonine efflux protein in which the amino acid corresponding to position 133 in the amino acid sequence of sequence number 1 is replaced with another amino acid; or a polynucleotide encoding the same.

7. In the 6th paragraph, the microorganism has increased L-threonine production ability compared to a Corynebacterium microorganism comprising a wild-type L-threonine excretion protein having an amino acid sequence of sequence number 1 or a polynucleotide encoding the same.

8. A microorganism according to claim 6, wherein the microorganism is a microorganism of the genus Corynebacterium.

9. A microorganism according to claim 8, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

10. A method for producing L-threonine, comprising the step of culturing a microorganism including a mutant L-threonine excretory protein in which the amino acid corresponding to position 133 in the amino acid sequence of sequence number 1 is replaced with another amino acid; or a polynucleotide encoding the same; in a medium.

11. A composition for producing L-threonine, comprising a mutant L-threonine efflux protein in which the amino acid corresponding to position 133 in the amino acid sequence of SEQ ID NO: 1 is replaced with another amino acid; a polynucleotide encoding the same; a vector comprising the polynucleotide; a microorganism comprising the mutant L-threonine efflux protein or a polynucleotide encoding the same; a medium in which the microorganism is cultured; or a combination of two or more thereof.

12. A use for producing L-threonine of a mutant L-threonine efflux protein in which the amino acid corresponding to position 133 in the amino acid sequence of SEQ ID NO. 1 is replaced with another amino acid; a polynucleotide encoding the same; a vector comprising the polynucleotide; or a microorganism comprising the mutant L-threonine efflux protein or a polynucleotide encoding the same.