Anti-IGF-i receptor antibody
Patent Information
- Application Number
- NZ757410
- Authority / Receiving Office
- NZ · NZ
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2017-05-30
- Filing Date
- 2018-05-29
- Publication Date
- 2026-07-31
AI Technical Summary
Current treatments for muscle wasting and growth disorders, such as short stature and muscle atrophy, face challenges with the short blood half-life of IGF-I requiring frequent administration and side effects like hypoglycemia, and lack of compliance due to frequent injection regimens, as well as limited options for improving muscle mass and growth without adverse metabolic effects.
Development of an anti-IGF-I receptor antibody that specifically binds to the vertebrate IGF-I receptor, inducing muscle mass and growth plate cartilage thickness without lowering blood sugar levels, with a prolonged effect and less frequent administration, potentially administered once a week.
The anti-IGF-I receptor antibody achieves muscle mass increase and growth promotion with sustained efficacy, maintaining proliferation-inducing activity longer than natural IGF-I and avoiding hypoglycemic effects, even at higher doses, and does not induce glucose uptake in differentiated muscle cells, allowing for effective treatment of muscle wasting and growth disorders with improved compliance.
Smart Images

Figure 00000078_0000 
Figure 00000078_0001 
Figure 00000079_0000
Abstract
Description
Anti-IGF-I receptor antibody
[0001] The present invention relates to anti-IGF-I receptor antibodies, particularly to anti-IGF-I receptor antibodies that specifically bind to the IGF-I receptor of vertebrates.
[0002] 1. IGF-I IGF-I is an insulin-like growth factor secreted primarily by the liver. It exerts various physiological functions in various organs by acting on IGF-I receptors. This suggests that IGF-I is expected to be useful in treating a variety of diseases. Because IGF-I shares a high degree of homology (approximately 40%) with the amino acid sequence of proinsulin, it may also bind to insulin receptors and exert insulin-like effects (Non-Patent Document 1). Furthermore, because the IGF-I receptor shares a high degree of homology (approximately 60%) with the amino acid sequence of the insulin receptor, the two receptors may form heterodimers (Non-Patent Document 1). Furthermore, insulin exerts a potent blood glucose-lowering effect by acting on the insulin receptor, and is therefore used therapeutically as a hypoglycemic drug.
[0003] 2. IGF-I Receptor The IGF-I receptor is a transmembrane protein composed of an α chain and a β chain, and includes six extracellular domains, L1, CR, L2, Fn1, Fn2, and Fn3, a transmembrane domain, and an intracellular domain (Non-Patent Document 2). The intracellular domain of the IGF-I receptor contains a tyrosine kinase. The cysteine-rich domain (CR), which is an extracellular domain, is involved in the activation of intracellular tyrosine kinase associated with the conformational change of the IGF-I receptor upon binding of IGF-I to the IGF-I receptor. The IGF-I receptor forms a homodimeric complex (homozyme), and upon binding of IGF-I, activates the receptor kinase, thereby transmitting a signal. It also forms a heterodimeric complex (heterozyme) with the insulin receptor, and upon binding of insulin or IGF-I, activates the receptor kinase, thereby transmitting a signal (Non-Patent Documents 3 and 4).
[0004] 3. Physiological Effects of IGF-I IGF-I has been shown to have growth-promoting effects such as height and weight gain, as well as insulin-like metabolic effects such as promoting glucose metabolism and hypoglycemic effects. Mecasermin, a human recombinant IGF-I, has been shown to improve symptoms of insulin receptor abnormalities, such as hyperglycemia, hyperinsulinemia, acanthosis nigricans, and hirsutism. It has also been shown to improve growth disorders associated with growth hormone-resistant dwarfism (Non-Patent Document 5). As a growth-promoting effect of IGF-I, IGF-I is known to enhance the DNA synthesis ability of human chondrocytes. Furthermore, administration of IGF-I increases the body weight and femoral length in hypophysectomized rats (Non-Patent Document 5).
[0005] 4. IGF-I's Muscle Mass-Increasing Effect Enhancement of IGF-I-mediated cell proliferation activity requires sustained activation of the IGF-I receptor (Non-Patent Document 6). Animals overexpressing the IGF-I receptor exhibit increased muscle mass (Non-Patent Document 7). Furthermore, sustained administration of IGF-I / IGFBP3 enhances grip strength and improves the ability to rise from a sitting position without assistance in patients with proximal femoral fractures (Non-Patent Document 8). Although IGF-I concentrations in muscle are known to be lower in elderly humans and mice compared with younger mice (Non-Patent Documents 9 and 10), muscle mass was improved in elderly mice with muscle-specific forced expression of IGF-I compared with wild-type mice (Non-Patent Document 11).
[0006] 5. Muscle Mass-Increasing Precursor: Anamorelin, a ghrelin receptor agonist, increased lean body mass in clinical trials of cachexia, a disuse muscular atrophy. However, side effects include nausea and elevated blood glucose levels (Non-Patent Document 12). Myostatin is a negative regulator of skeletal muscle formation that acts on activin receptor II (ActRII) and inhibits Akt / mTOR (Non-Patent Documents 13-15). The anti-myostatin antibody LY2495655 increases muscle mass in patients undergoing total hip arthroplasty and in elderly patients (Non-Patent Documents 16 and 17). Furthermore, the anti-ActRII antibody bimagrumab increases muscle mass in patients with neuromuscular diseases (Non-Patent Document 18). However, there are currently no drugs that promote skeletal muscle formation and can be used for treatment.
[0007] 6. Growth-promoting prior products: Human recombinant GH preparations (growth hormone preparations) activate GH receptors, secrete IGF-I, and demonstrate growth-promoting effects. However, because they are administered as subcutaneous injections once daily, reduced growth effects have been observed due to medication compliance (e.g., missed doses) (Non-Patent Document 19). Long-acting GH preparations that improve GH kinetics and are administered once a week or once every two weeks are under development. However, no therapeutic drugs that improve medication compliance and have growth-promoting effects currently exist. Furthermore, reduced growth effects have been observed in patients with reduced sensitivity to GH receptor activation, GH receptor abnormalities, or resistance to GH treatment (Non-Patent Document 20). Because IGF-I acts downstream of the GH receptor, it is the only therapeutic agent that has growth-promoting effects even in patients with reduced sensitivity to GH receptor activation. However, IGF-I preparations are administered as injections twice a day, which not only leads to poor medication compliance but also has been associated with hypoglycemia as a side effect (Non-Patent Document 21). There are currently no drugs that can be used to improve compliance with IGF-I medication and to treat hypoglycemia.
[0008] 7. Blood Glucose-Hypothetical Effect of IGF-I IGF-I is known to have an insulin-like effect, known as a blood glucose-lowering effect. IGF-I enhances glucose uptake in rat muscle-derived cells (Non-Patent Document 5). Furthermore, administration of IGF-I reduces blood glucose levels in rats (Non-Patent Document 5). The blood glucose-lowering effect of IGF-I has been reported to induce hypoglycemia as a clinical side effect (Non-Patent Document 21). Furthermore, since IGF-I can cause hypoglycemia when administered to humans, treatment should be initiated with a low dose followed by an appropriate dose, and various clinical findings, including post-administration blood glucose levels, should be monitored (Non-Patent Document 5). IGF-I exerts its blood glucose-lowering effect via increased phosphorylation of Akt, a downstream signaling pathway of the IGF-I receptor. An active Akt mutant enhances glucose uptake in 3T3-L1 cells (Non-Patent Document 22). Meanwhile, mice lacking Akt2 exhibit elevated blood glucose levels (Non-Patent Document 23). Furthermore, Akt inhibitors inhibit insulin-stimulated glucose uptake in rat muscle-derived cells (Non-Patent Document 24). Furthermore, IGF-I is known to activate the insulin receptor, which is involved in its hypoglycemic effect. Based on these findings, it is believed that the hypoglycemic effect of IGF-I is related to excessive activation of Akt and activation of the insulin receptor.
[0009] 8. Short Serum Half-Life of IGF-I The short serum half-life of IGF-I necessitates frequent administration. In fact, mecasermin, a human recombinant IGF-I, has a serum half-life of approximately 11 to 16 hours, requiring once-to-twice-daily administration for the treatment of dwarfism (Non-Patent Document 5). Approximately 70 to 80% of IGF-I in the blood is bound to IGFBP3. The free form of IGF-I is physiologically active. Binding to IGFBP3 maintains the serum half-life of IGF-I at approximately 10 to 16 hours (Non-Patent Document 1). IPLEX, a combination of IGF-I and IGFBP3, has a serum half-life of approximately 21 to 26 hours, longer than IGF-I, allowing for once-daily administration (Non-Patent Document 23). However, IPLEX has been withdrawn from the market. Attempts have been made to develop PEGylated IGF-I that improves the kinetics of IGF-I, but no drug has been used for treatment (Patent Document 1).
[0010] 9. Therapeutic Effects Expected from the Action of IGF-I IGF-I is known to act on various organs and has a wide range of physiological functions (Non-Patent Document 21). It has been reported that IGF-I protects mitochondria and exerts neuroprotective effects through antioxidant activity in the central nervous system via activation of the IGF-I receptor (Non-Patent Documents 26, 27). IGF-I promotes neurite formation after injury (Non-Patent Document 28). IGF-I is a major growth-promoting factor (Non-Patent Documents 29, 30). In fact, mecasermin, a human recombinant IGF-I, is used clinically as a treatment for dwarfism. IGF-I is thought to be useful in the treatment of liver cirrhosis. Liver cirrhosis is a condition that progresses from liver injury or chronic liver disease and is accompanied by liver fibrosis. In an animal model of liver cirrhosis, administration of IGF-I suppressed liver fibrosis (Non-Patent Document 31). IGF-I is also known to be involved in kidney development and function. IGF-I has a protective effect against oxidative stress and apoptosis caused by glucotoxicity in renal mesangial cells (Non-patent Document 32). IGF-I is expected to be a therapeutic agent for nephropathy.
[0011] Pathologies that are expected to be improved by the administration of IGF-I include dwarfism, Larondosis, liver cirrhosis, liver fibrosis, aging, intrauterine growth retardation (IUGR), neurological disorders, stroke, spinal cord injury, cardiovascular protection, diabetes, insulin resistance, metabolic syndrome, nephropathy, osteoporosis, cystic fibrosis, wound healing, myotonic dystrophy, AIDS-associated myasthenia, HIV-associated fat redistribution syndrome, burns, Crohn's disease, Werner's syndrome, X-linked combined immunodeficiency, hearing loss, anorexia nervosa, and retinopathy of prematurity (Non-Patent Document 21). Due to its diverse physiological effects, IGF-I is expected to be a therapeutic agent for a variety of diseases. However, its side effect of hypoglycemic activity and the short half-life, which requires multiple administrations, pose challenges for its clinical use.
[0012] 10. IGF-I Receptor Agonist Antibody Antibody preparations generally have a long half-life and are effective when administered once or twice a month. IGF-I receptor agonist antibodies have been reported to activate the receptor in vitro, but no antibodies have been reported to have agonist activity against the IGF-I receptor in vivo (Non-Patent Documents 33-37). Antibodies 3B7 and 2D1 enhance cellular DNA synthesis in vitro (Non-Patent Document 34). Antibodies 11A1, 11A4, 11A11, and 24-57 enhance tyrosine phosphorylation of the IGF-I receptor in vitro (Non-Patent Document 35). Antibodies 16-13, 17-69, 24-57, 24-60, 24-31, and 26-3 have been shown to enhance cellular DNA synthesis and glucose uptake in vitro, and these antibodies may have a blood glucose lowering effect (Non-Patent Documents 36 and 37).
[0013] However, there have been no reports of IGF-I receptor agonist antibodies that have demonstrated cell proliferation activity in vitro using primary cultured cells, especially human myoblasts, much less those that have demonstrated muscle mass-increasing activity in vivo.
[0014] 11. IGF-I Receptor Antagonist Antibodies Antibodies that bind to IGF-I receptors have been used to treat malignant tumors and other conditions, taking advantage of their antagonistic effect of inhibiting the binding of IGF-I to the IGF-I receptor. However, existing IGF-I receptor antagonist antibodies not only have many side effects such as hyperglycemia when used alone (Non-Patent Document 38), but also increase the incidence of hyperglycemia when used in combination with other anticancer drugs (Non-Patent Document 39), so their therapeutic applications are thought to be limited.
[0015] "Use of PEGylated IGF-I Variants for the Treatment of Neuromuscular Disorders," JP-A 2011-518778 (WO 2009 / 121759), 2011
[0016] Ohlsson, C., et al., The role of liver-derived insulin-like growth factor-I. Endocr Rev, 2009. 30(5): p. 494-535.Kavran, J.M., et al., How IGF-I activates its receptor. Elife, 2014. 3.Bailyes, E.M., et al., Insulin receptor / IGF-I receptor hybrids are widely distributed in mammalian tissues: quantification of individual receptor species by selective immunoprecipitation and immunoblotting. Biochem J, 1997. 327 ( Pt 1): p. 209-15.Pandini, G., et al., Insulin / insulin-like growth factor I hybrid receptors have different biological characteristics depending on the insulin receptor isoform involved. J Biol Chem, 2002. 277(42): p. 39684-95.オーファンパシフィック, IF. 2015.Fukushima, T., et al., Phosphatidylinositol 3-kinase (PI3K) activity bound to insulin-like growth factor-I (IGF-I) receptor, which is continuously sustained by IGF-I stimulation, is required for IGF-I-induced cell proliferation. J Biol Chem, 2012. 287(35): p. 29713-21.Schiaffino, S. and C.Mammucari, Regulation of skeletal muscle growth by the IGF-I-Akt / PKB pathway: insights from genetic models. Skelet Muscle, 2011. 1(1): p. 4.Boonen, S., et al., Musculoskeletal effects of the recombinant human IGF-I / IGF binding protein-3 complex in osteoporotic patients with proximal femoral fracture: a double-blind, placebo-controlled pilot study. J Clin Endocrinol Metab, 2002. 87(4): p. 1593-9.Barton-Davis, E.R., et al., Viral mediated expression of insulin-like growth factor I blocks the aging-related loss of skeletal muscle function. Proc Natl Acad Sci U S A, 1998. 95(26): p. 15603-7.Lamberts, S.W., A.W. van den Beld, and A.J. van der Lely, The endocrinology of aging. Science, 1997. 278(5337): p. 419-24.Musaro, A., et al., Localized IGF-I transgene expression sustains hypertrophy and regeneration in senescent skeletal muscle. Nat Genet, 2001. 27(2): p. 195-200.Temel, J.S., et al., Anamorelin in patients with non-small-cell lung cancer and cachexia (ROMANA 1 and ROMANA 2): results from two randomized, double-blind, phase 3 trials. Lancet Oncol, 2016. 17(4): p. 519-31.Glass, D.J., Signaling pathways perturbing muscle mass. Curr Opin Clin Nutr Metab Care, 2010. 13(3): p. 225-9.Lee, S.J. and A.C. McPherron, Regulation of myostatin activity and muscle growth. Proc Natl Acad Sci U S A, 2001. 98(16): p. 9306-11.Amirouche, A., et al., Down-regulation of Akt / mammalian target of rapamycin signaling pathway in response to myostatin overexpression in skeletal muscle. Endocrinology, 2009. 150(1): p. 286-94.Woodhouse, L., et al., A Phase 2 Randomized Study Investigating the Efficacy and Safety of Myostatin Antibody LY2495655 versus Placebo in Patients Undergoing Elective Total Hip Arthroplasty. J Frailty Aging, 2016.5(1): p. 62-70.Becker, C., et al., Myostatin antibody (LY2495655) in older weak fallers: a proof-of-concept, randomized, phase 2 trial.Lancet Diabetes Endocrinol, 2015. 3(12): p. 948-57.Amato, A.A., et al., Treatment of sporadic inclusion bodymyositis with bimagrumab. Neurology, 2014. 83(24): p. 2239-46.Cutfield, W. S., et al., Non-compliance with growth hormone treatment in children is common and impairs linear growth. PLos One., 2011.6(1):e16223Bang, P., et al., Identification and management of poor response to growth-promoting therapy in children with short stature. Clin Endocrinol (Oxf)., 2012.77(2):p.169-181.Puche, J.E. and I. Castilla-Cortazar, Human conditions of insulin-like growth factor-I (IGF-I) deficiency. J Transl Med, 2012. 10: p. 224.Kohn, A.D., et al., Expression of a constitutively active Akt Ser / Thr kinase in 3T3-L1 adipocytes stimulates glucose uptake and glucose transporter 4 translocation. J Biol Chem, 1996. 271(49): p. 31372-8.Cho, H., et al., Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKB beta). Science, 2001. 292(5522): p. 1728-31.Green, C.J., et al., Use of Akt inhibitor and a drug-resistant mutant validates a critical role for protein kinase B / Akt in the insulin-dependent regulation of glucose and system A amino acid uptake. J Biol Chem, 2008. 283(41): p. 27653-67. FDA application materials, APPLICATION NUMBER, 21-884 Garcia-Fernandez, M., et al., Low doses of insulin-like growth factor I improve insulin resistance, lipid metabolism, and oxidative damage in aging rats. Endocrinology, 2008. 149(5): p. 2433-42. Puche, J.E., et al., Low doses of insulin-like growth factor-I induce mitochondrial protection in aging rats. Endocrinology, 2008. 149(5): p. 2620-7. Joseph D'Ercole, A. and P. Ye, Expanding the mind: insulin-like growth factor I and brain development. Endocrinology, 2008. 149(12): p. 5958-62. Abuzzahab, M.J., et al., IGF-I receptor mutations resulting in intrauterine and postnatal growth retardation. N Engl J Med, 2003. 349(23): p. 2211-22. Woods, K.A., et al., Intrauterine growth retardation and postnatal growth failure associated with deletion of the insulin-like growth factor I gene. N Engl J Med, 1996. 335(18): p. 1363-7.Perez, R., et al., Mitochondrial protection by low doses of insulin-like growth factor- I in experimental cirrhosis. World J Gastroenterol, 2008. 14(17): p. 2731-9.Kang, B.P., et al., IGF-I inhibits the mitochondrial apoptosis program in mesangial cells exposed to high glucose. Am J Physiol Renal Physiol, 2003. 285(5): p. F1013-24.Bhaskar, V., et al., A fully human, allosteric monoclonal antibody that activates the insulin receptor and improves glycemic control. Diabetes, 2012. 61(5): p. 1263-71.Xiong, L., et al., Growth-stimulatory monoclonal antibodies against human insulin-like growth factor I receptor. Proc Natl Acad Sci U S A, 1992. 89(12): p. 5356-60.Runnels, H.A., et al., Human monoclonal antibodies to the insulin-like growth factor 1 receptor inhibit receptor activation and tumor growth in preclinical studies.Adv Ther, 2010. 27(7): p. 458-75.Soos, M.A., et al., A panel of monoclonal antibodies for the type I insulin-like growth factor receptor. Epitope mapping, effects on ligand binding, and biological activity. J Biol Chem, 1992. 267(18): p. 12955-63.Kato, H., et al., Role of tyrosine kinase activity in signal transduction by the insulin-like growth factor-I (IGF-I) receptor. Characterization of kinase-deficient IGF-I receptors and the action of an IGF-I-mimetic antibody (alpha IR-3). J Biol Chem, 1993. 268(4): p. 2655-61.Atzori,F.,et al., A Phase I Pharmacokinetic and Pharmacodynamic Study of Dalotuzumab (MK-0646), an Anti-Insulin-like Growth Factor-1 Receptor Monoclonal Antibody, in Patients with Advanced Solid Tumors. Clin Cancer Res., 2011.17(19):p.6304-12.de Bono J.S., et al.,Phase II randomized study of figitumumab plus docetaxel and docetaxel alone with crossover for metastaticcastration-resistant prostate cancer. Clin Cancer Res., 2014.20(7):p.1925-34..
[0017] An object of the present invention is to provide an anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, which specifically binds to a vertebrate IGF-I receptor. Another object of the present invention is to provide an antibody that increases muscle mass or growth plate cartilage thickness via the IGF-I receptor without lowering blood glucose levels.
[0018] That is, the present invention relates to the following: [1] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, which specifically binds to a vertebrate IGF-I receptor and has the activity of inducing the proliferation of vertebrate-derived cells. [2] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to [1], which has the activity of inducing the proliferation of vertebrate-derived cells at the same level as or higher than that of natural IGF-I. [3] The activity of inducing the proliferation of vertebrate-derived cells as measured by in vitro EC 50 [4] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to [3], which, when contacted with cultured vertebrate-derived cells, exhibits an improved persistence of proliferation-inducing activity on the cultured cells relative to the contact time with the cultured cells, compared to that of native IGF-I. [5] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [2] to [4], wherein the native IGF-I is human IGF-I having the amino acid sequence set forth in SEQ ID NO: 1. [6] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [2] to [4], wherein the native IGF-I is human IGF-I having the amino acid sequence set forth in SEQ ID NO: 1. [7] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [3] to [4], wherein the native IGF-I is human IGF-I having the amino acid sequence set forth in SEQ ID NO: 1. [8] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [3] to [4], wherein the native IGF-I is human IGF-I having the amino acid sequence set forth in SEQ ID NO: 1. [9] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [3] to [4], wherein the native IGF-I is human IGF-I having the amino acid sequence set forth in SEQ ID NO: 1.
[10] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [3] to [4], wherein the native IGF-I is human IGF-I having the amino acid sequence set forth in SEQ ID NO: 1. 50
[10] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to [5], wherein the value of the antibody or fragment thereof is 0.1 nmol / L or less. [7] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to [6], which has the activity of inducing an increase in muscle mass and / or body length in a vertebrate when parenterally administered to the vertebrate. [8] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to [7], which is administered to a vertebrate once a week or less. [9] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to [8], wherein the vertebrate is a human or a non-human animal including a guinea pig, monkey, rabbit, cow, pig, horse, sheep, dog, or chicken, or a non-human animal expressing a human IGF-I receptor.
[10] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to [9], which does not induce glucose uptake in differentiated muscle cells at a dose that induces proliferation of vertebrate-derived cells.
[11] An EC2 antibody or a fragment thereof that exhibits in vitro proliferation-inducing activity of vertebrate-derived cells. 50
[10] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to
[10] , characterized in that it does not induce glucose uptake in differentiated muscle cells even at a dose 100-fold or more higher than the effective dose.
[12] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to
[10] or
[11] , wherein the vertebrate-derived cells are myoblasts derived from a human or a mammal other than a human.
[13] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [7] to
[12] , characterized in that it does not lower the blood glucose level of a vertebrate when parenterally administered to the vertebrate at a dose that induces an increase in muscle mass and / or body length in the vertebrate.
[14] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to
[13] , characterized in that it does not change the blood glucose level of a vertebrate when parenterally administered to the vertebrate at a dose 10-fold or more higher than the effective dose for inducing an increase in muscle mass and / or body length in the vertebrate.
[15] The anti-IGF-I receptor antibody according to any one of [1] to
[14] , or a fragment thereof, or a derivative thereof, which binds to the CR domain of the IGF-I receptor.
[16] An anti-IGF-I receptor antibody, or a fragment thereof, or a derivative thereof, which binds to the CR domain of the IGF-I receptor and inhibits the binding of IGF-I or IGF-II to the IGF-I receptor.
[17] A CR domain of the IGF-I receptor that has a sequence of ProSerGlyPheIleArgAsnX. 1 X 2 GlnSerMet(X 1 is Gly or Ser, X 2
[18] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to
[17] , characterized in that it binds to an epitope comprising ProSerGlyPheIleArgAsnGlySerGlnSerMet or its vicinity in the sequence of the CR domain of the IGF-I receptor.
[19] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to
[18] , which has cross-reactivity with the IGF-I receptor of humans or non-human animals including guinea pigs, monkeys, rabbits, cows, pigs, horses, sheep, dogs, and chickens.
[20] The antigen-antibody reaction of the anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, has a dissociation equilibrium constant (KD) of 1 x 10 -8The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to
[19] , characterized in having an affinity strength of M or less.
[21] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of
[16] to
[20] , wherein the anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, has at least one of the characteristics 1) to 4). 1) Has activity of inducing proliferation of vertebrate-derived cells. 2) Has activity of inducing an increase in muscle mass and / or body length of a vertebrate when administered parenterally to the vertebrate. 3) Does not induce glucose uptake in differentiated muscle cells at a dose that induces proliferation of vertebrate-derived cells. 4) Does not fluctuate the blood glucose level of a vertebrate when administered parenterally to the vertebrate when administered parenterally to the vertebrate and induces an increase in muscle mass and / or body length of the vertebrate.
[22] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to any one of
[16] to
[21] , wherein the anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, has at least one of the following characteristics 1) to 4): 1) inhibits IGF-I-induced proliferation of vertebrate-derived cells; 2) suppresses cell proliferation in a cell proliferative disorder caused by IGF-I in a vertebrate when administered parenterally to the vertebrate; 3) does not affect glucose uptake in differentiated muscle cells at a dose that inhibits IGF-I-induced proliferation of vertebrate-derived cells; and 4) does not change the blood glucose level of the vertebrate when administered parenterally to the vertebrate when suppressing cell proliferation in a cell proliferative disorder caused by IGF-I in the vertebrate.
[23] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to any one of [1] to
[22] , wherein the anti-IGF-I receptor antibody or fragment thereof, or derivative thereof is a Fab, scFv, diabody, bispecific antibody, or derivative thereof.
[24] A heavy chain variable region CDR-1 (CDR-H1) sequence of SEQ ID NO: 3 or an amino acid sequence in which one amino acid residue of SEQ ID NO: 3 has been substituted, deleted, or inserted; a heavy chain variable region CDR-2 (CDR-H2) sequence of SEQ ID NO: 4 or an amino acid sequence in which one or two amino acid residues of SEQ ID NO: 4 have been substituted, deleted, or inserted; a heavy chain variable region CDR-3 (CDR-H3) sequence of SEQ ID NO: 5 or an amino acid sequence in which one or two amino acid residues of SEQ ID NO: 5 have been substituted, deleted, or inserted; a light chain variable region CDR-1 (CDR-L1) sequence of SEQ ID NO: 6 or an amino acid sequence in which one or two amino acid residues of SEQ ID NO: 6 have been substituted, deleted, or inserted;
[25] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[23] , which consists of an amino acid sequence comprising SEQ ID NO: 7 or an amino acid sequence in which one amino acid residue of SEQ ID NO: 7 has been substituted, deleted, or inserted as the CDR-2 (CDR-L2) sequence of the light chain variable region, and SEQ ID NO: 8 or an amino acid sequence in which one or two amino acid residues of SEQ ID NO: 8 have been substituted, deleted, or inserted as the CDR-3 (CDR-L3) sequence of the light chain variable region.
[25] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[24] , further comprising an immunoglobulin framework sequence.
[26] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to
[25] , wherein the immunoglobulin framework sequence is a framework sequence of each class of immunoglobulin from humans or non-human animals including guinea pigs, monkeys, rabbits, cows, pigs, horses, sheep, dogs, chickens, mice, and rats.
[27] An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[26] , which comprises an amino acid sequence comprising SEQ ID NO: 9 or an amino acid sequence having 90% or more homology to SEQ ID NO: 9 as a heavy chain variable region, and SEQ ID NO: 10 or an amino acid sequence having 90% or more homology to SEQ ID NO: 10 as a light chain variable region.
[28] The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to
[27] , further comprising a constant region of each class of immunoglobulin from a human or a non-human animal, including a guinea pig, monkey, rabbit, cow, pig, horse, sheep, dog, chicken, mouse, or rat.
[29] A nucleic acid molecule consisting of a polynucleotide sequence encoding the anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to
[28] .
[30] A cloning vector or expression vector comprising at least one nucleic acid molecule according to
[29] .
[31] A recombinant cell in which the vector according to
[30] has been introduced into a host cell.
[32] A method for producing the anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, according to any one of [1] to
[28] , comprising the steps of culturing the recombinant cell according to
[31] and purifying the anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, produced from the recombinant cell.
[33] A pharmaceutical composition comprising the anti-IGF-I receptor antibody or a fragment thereof according to any one of [1] to
[28] , or a derivative thereof, the nucleic acid molecule according to
[29] , the vector according to
[30] , or the recombinant cell according to
[31] .
[34] The pharmaceutical composition according to
[33] , further comprising an active ingredient other than the anti-IGF-I receptor antibody or a fragment thereof according to any one of [1] to
[28] , or a derivative thereof, the nucleic acid molecule according to
[29] , the vector according to
[30] , or the recombinant cell according to
[31] .
[35] The pharmaceutical composition according to
[34] , wherein the active ingredient is one or more selected from growth hormone or an analogue thereof, insulin or an analogue thereof, IGF-II or an analogue thereof, an anti-myostatin antibody, a myostatin antagonist, an anti-activin type IIB receptor antibody, an activin IIB receptor antagonist, a soluble activin type IIB receptor or an analogue thereof, ghrelin or an analogue thereof, follistatin or an analogue thereof, a beta-2 agonist, and a selective androgen receptor modulator.
[36] The active ingredient is a corticosteroid, an antiemetic, ondansetron hydrochloride, granisetron hydrochloride, metroclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, tropisetron, a cancer vaccine, a GM-CSF inhibitor, or a GM-CSF DNA vaccines, cell-based vaccines, dendritic cell vaccines, recombinant viral vaccines, heat shock protein (HSP) vaccines, allogeneic tumor vaccines, autologous tumor vaccines, analgesics, ibuprofen, naproxen, choline magnesium trisalicylate, oxycodone hydrochloride, anti-angiogenic drugs, antithrombotic drugs, anti-PD-1 antibodies, nivolumab, pembrolizumab, anti-PD-L1 antibodies, atezolizumab, anti-CTLA4 antibodies, ipilimumab, anti-CD20 antibodies, rituximab, anti-HER2 antibodies, trastuzumab, anti-CCR4 antibodies, mogamulizumab, anti-VEGF antibodies, bevacizumab, anti-VEGF receptor antibodies, soluble VEGF receptor fragments, anti-TWEAK antibodies, anti-TWEAK receptor antibodies, soluble TWEAK receptor fragments, AMG 706, AMG 386, an antiproliferative drug, a farnesyl protein transferase inhibitor, an αvβ3 inhibitor, an αvβ5 inhibitor, a p53 inhibitor, a Kit receptor inhibitor, a ret receptor inhibitor, a PDGFR inhibitor, a growth hormone secretion inhibitor, an angiopoietin inhibitor, a tumor-infiltrating macrophage inhibitor, a c-fms inhibitor, an anti-c-fms antibody, a CSF-1 inhibitor, an anti-CSF-1 antibody, a soluble c-fms fragment, pegvisomant, gemcitabine, panitumumab, irinotecan, and SN-38.
[37] A pharmaceutical composition for use in the treatment or prevention of an IGF-I-associated condition, comprising any one or more of the anti-IGF-I receptor antibody or fragment thereof described in [1] to
[28] , the nucleic acid molecule described in
[29] , the vector described in
[30] , and the recombinant cell described in
[31] .
[38] The medicament according to
[37] , wherein the IGF-I-associated condition is selected from disuse muscle atrophy, short stature, diabetic nephropathy, chronic renal failure, Larondosis, cirrhosis, hepatic fibrosis, aging, intrauterine growth retardation (IUGR), neurological disease, stroke, spinal cord injury, cardiovascular protection, diabetes, insulin resistance, metabolic syndrome, osteoporosis, cystic fibrosis, wound healing, myotonic dystrophy, AIDS myasthenia, HIV-associated fat redistribution syndrome, burns, Crohn's disease, Werner's syndrome, X-linked combined immunodeficiency, hearing loss, anorexia nervosa and retinopathy of prematurity, Turner syndrome, Prader-Willi syndrome, Silver-Russell syndrome, idiopathic short stature, obesity, multiple sclerosis, fibromyalgia, ulcerative colitis, low muscle mass, myocardial ischemia, and low bone mineral density.
[39] The medicament according to
[37] or
[38] , which is administered parenterally.
[40] The medicament according to any one of
[37] to
[39] , which is an veterinary drug administered to a non-human animal.
[41] The medicament according to
[40] , which is administered for the purpose of increasing muscle mass and / or body length, promoting growth, increasing milk production, promoting reproduction, or preventing aging.
[42] The veterinary drug according to
[40] or
[41] , wherein the non-human animal is a guinea pig, monkey, rabbit, cow, pig, horse, sheep, dog, or chicken.
[43] The medicament according to any one of
[37] to
[42] , which is used for the treatment or prevention of a disease caused by the action of IGF-I or IGF-II on the IGF-I receptor.
[44] Diseases caused by the action of IGF-I or IGF-II on the IGF-I receptor include liver cancer, neuroblastoma, rhabdomyosarcoma, osteosarcoma, childhood cancer, acromegaly, ovarian cancer, pancreatic cancer, benign prostatic hyperplasia, breast cancer, prostate cancer, bone cancer, lung cancer, colorectal cancer, cervical cancer, synovial sarcoma, bladder cancer, gastric cancer, Wilms' tumor, diarrhea associated with metastatic carcinoid and vasoactive intestinal peptide-secreting tumors, vipoma, Werner-Morrison syndrome, Beckwith-Wiedemann syndrome, kidney cancer, renal cell carcinoma, transitional cell carcinoma, euthyroidism, and urinary tract cancer. The medicament according to
[43] , wherein the disease is selected from the group consisting of: Ing's sarcoma, leukemia, acute lymphoblastic leukemia, brain tumor, glioblastoma, non-glioblastoma brain tumor, meningioma, pituitary adenoma, vestibular schwannoma, primitive neuroectodermal tumor, medulloblastoma, astrocytoma, oligodendroglioma, ependymoma, choroid plexus papilloma, gigantism, psoriasis, atherosclerosis, vascular smooth muscle restenosis, inappropriate microvascular proliferation, diabetic retinopathy, Graves' disease, multiple sclerosis, systemic lupus erythematosus, chronic thyroiditis, myasthenia gravis, autoimmune thyroiditis, and Behcet's disease.
[45] A method for culturing vertebrate-derived cells in vitro, comprising a step of contacting the vertebrate-derived cells with one or more of the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, according to any one of [1] to
[28] , the nucleic acid molecule according to
[29] , the vector according to
[30] , and the recombinant cell according to
[31] during the culturing process.
[46] The culture method according to
[45] , wherein the contacting step is carried out for the purpose of promoting proliferation or inducing differentiation of vertebrate-derived cells.
[47] The culture method according to
[45] or
[46] , wherein the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof is adsorbed or immobilized to a solid phase.
[48] A genetically modified animal in which a mutation has been introduced into the CR domain of the IGF-I receptor gene, characterized in that the CR domain of the IGF-I receptor has, by genetic recombination, the amino acid sequence of ProSerGlyPheIleArgAsnGlySerGlnSerMet.
[49] A genetically modified animal into which a heterologous IGF-I receptor gene has been introduced, wherein the amino acid sequence encoded by the introduced IGF-I receptor gene in the CR domain is ProSerGlyPheIleArgAsnX, relative to the amino acid sequence of the IGF-I receptor endogenously possessed by the animal. 1 X 2 In the sequence of the GlnSerMet portion, X 1 and / or X 2 A genetically modified animal into which an IGF-I receptor gene has been introduced, the amino acid sequence of which does not match the amino acid sequence of the IGF-I receptor endogenously possessed by said animal.
[0019] The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof of the present invention has the effect of specifically binding to the IGF-I receptor of a vertebrate.
[0020] 1 shows the results of comparing the amino acid sequences of the CR domain of the IGF-I receptor (amino acid sequences are shown in single-letter code) among mice, rats, humans, guinea pigs, and rabbits. This figure shows the results of ELISA using mutants of the IGF11-16 putative epitope. This figure shows the proliferation activity of human myoblasts after drug removal of IGF11-16 and IGF-I. This figure shows the glucose uptake effect when IGF-I and IGF11-16 are added to differentiated human muscle cells. This figure shows the weight of the extensor digitorum longus muscle two weeks after continuous administration of IGF-I using an osmotic pump or a single subcutaneous or intravenous administration of IGF11-16 to guinea pigs. This figure shows the time course of blood glucose levels following a single subcutaneous administration of IGF-I to guinea pigs under fasting conditions. This figure shows the time course of blood glucose levels following a single subcutaneous administration of IGF11-16 to guinea pigs under fasting conditions. 1 is a graph showing the time course of blood glucose levels following a single intravenous administration of IGF11-16 to guinea pigs under fasting conditions. 2 is a graph showing the effect of IGF11-16 on increasing the thickness of growth plate cartilage in hypophysectomized guinea pigs (HPX). 3 is a graph showing the effect of IGF11-16 on increasing tibia length in hypophysectomized guinea pigs (HPX). 4 is a graph showing the time course of blood kinetics following a single subcutaneous administration of IGF-I to guinea pigs under fasting conditions. 5 is a graph showing the time course of blood kinetics following a single subcutaneous administration of IGF11-16 to guinea pigs under fasting conditions.
[0021] The present invention will be described below based on specific embodiments, but the present invention is not limited to these embodiments. All documents cited in this specification, including patent publications, patent application publications, and non-patent publications, are incorporated herein by reference in their entirety for all purposes.
[0022] [IGF] IGF refers to insulin-like growth factor, and includes IGF-I and IGF-II. IGF-I and IGF-II are in vivo ligands that bind to the IGF-I receptor (insulin-like growth factor-I receptor) described below and have agonist activity, transducing signals for cell division and metabolism into cells. IGF-I and IGF-II are known to weakly cross-bind with the insulin receptor (INSR), which is structurally similar to the IGF-I receptor. This specification will mainly focus on IGF-I, whose physiological functions are better known. However, when examining effects or diseases mediated by binding between the IGF-I receptor and its ligand, the effects of both IGF-I and IGF-II may be described.
[0023] IGF-I, also known as somatomedin C, is a hormone that is a single polypeptide consisting of 70 amino acids. The sequence of human IGF-I can be obtained by referring to EMBL-EBI UniProtKB-Accession No. P50919, etc., and the amino acid sequence of mature IGF-I is shown in SEQ ID NO: 1 of the Sequence Listing. This sequence consisting of 70 amino acids is conserved in many species. In the present invention, when "IGF-I" is referred to alone, it means an IGF-I protein that has hormonal activity, unless otherwise specified.
[0024] IGF-I is produced in various cells in the body, including liver cells, and is also present in blood and other body fluids. Therefore, natural IGF-I can be obtained by purifying it from animal body fluids or cultures of primary cultured cells or established cell lines isolated from animals. Furthermore, since IGF-I production in cells is induced by growth hormone, IGF-I can also be purified from body fluids of animals administered with growth hormone or from cultures of primary cultured cells or established cell lines isolated from animals cultured in the presence of growth hormone. Alternatively, IGF-I can be produced using recombinant cells in which a nucleic acid molecule encoding the amino acid sequence of IGF-I is incorporated into an expression vector and introduced into a eukaryotic host cell, such as a prokaryote (e.g., Escherichia coli), yeast, insect cells, or mammalian-derived cultured cells, or using transgenic animals or plants into which the IGF-I gene has been introduced. Furthermore, human IGF-I is also available as a research reagent (Enzo Life Sciences, catalog: ADI-908-059-0100, Abnova, catalog: P3452, etc.) or as a pharmaceutical (Somazon (registered trademark), mecasermin, INCRELEX (registered trademark), etc.). The in vivo and in vitro activities of the IGF-I used can be evaluated by comparing its specific activity, expressed as 1 international unit / microgram, with the activity of an IGF-I standard material (NIBSC code: 91 / 554) from the National Institute for Biological Standards and Control (NIBSC) of the World Health Organization. The IGF-I in the present invention is considered to have a specific activity equivalent to that of the IGF-I of NIBSC code: 91 / 554.
[0025] [IGF-I Receptor] IGF-I receptor refers to insulin-like growth factor-I receptor. Unless otherwise specified, "IGF-I receptor" as used herein refers to an IGF-I receptor protein. The IGF-I receptor is a protein structured by the association of two subunits consisting of an α chain and a β chain. In the amino acid sequence of the human IGF-I receptor shown in SEQ ID NO: 2, the portion consisting of amino acids 31 to 735 of the amino acid sequence corresponds to the α chain, and the β chain corresponds to the sequence from 740 onwards. The α chain of the IGF-I receptor has an IGF-I binding site, and the β chain has a transmembrane structure and functions to transmit signals into cells. The α chain of the IGF-I receptor is divided into L1, CR, L2, FnIII-1, and FnIII-2a / ID / FnIII-2b domains. In the amino acid sequence of the human IGF-I receptor shown in SEQ ID NO: 2, the portion from positions 31 to 179 corresponds to the L1 domain, the portion from positions 180 to 328 corresponds to the CR domain, the portion from positions 329 to 491 corresponds to the L2 domain, the portion from positions 492 to 607 corresponds to the FnIII-1 domain, and the portion from positions 608 to 735 corresponds to the FnIII-2a / ID / FnIII-2b domain. Among these, the CR (cysteine-rich domain) domain is involved in the activation of intracellular tyrosine kinase of the β chain, which is accompanied by a conformational change in the IGF-I receptor upon binding of IGF-I to the IGF-I receptor. The amino acid sequence of the human IGF-I receptor can be referenced from EMBL-EBI UniProtKB-Accession No. P08069, etc., and is also shown in SEQ ID NO: 2 in the Sequence Listing.
[0026] IGF-I receptors are known to be expressed in a wide range of tissues and cells in the body, and are stimulated by IGF-I, such as by the induction of cell proliferation and the activation of intracellular signals. In particular, myoblasts can be used to evaluate the effects of IGF-I via the IGF-I receptor, using cell proliferation activity as an indicator. This makes myoblasts useful for analyzing the effects of antibodies that bind to IGF-I receptors. Furthermore, by incorporating a nucleic acid molecule encoding the amino acid sequence of an IGF-I receptor of a human or other vertebrate into an expression vector and introducing it into a eukaryotic host cell, such as an insect cell or a mammalian cultured cell, the recombinant cell can be transformed to express the IGF-I receptor encoded by the introduced nucleic acid on the cell membrane, thereby artificially producing cells expressing the IGF-I receptor of a human or other vertebrate. These IGF-I receptor-expressing cells can be used to analyze antibody binding and examine intracellular signal transduction, among other things.
[0027] [Anti-IGF-I Receptor Antibodies] Antibodies are glycoproteins comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain comprises a heavy chain variable region (abbreviated as VH) and a heavy chain constant region, with the heavy chain constant region comprising three domains, CH1, CH2, and CH3. Each light chain comprises a light chain variable region (abbreviated as VL) and a light chain constant region. The light chain constant region comprises one domain, CL. There are two types of light chain constant regions, termed λ chains and κ chains. Heavy chain constant regions include γ chains, μ chains, α chains, δ chains, and ε chains, and antibody isotypes, IgG, IgM, IgA, IgD, and IgE, are defined according to the heavy chain. The VH and VL regions are further subdivided into four more conserved regions (FR-1, FR-2, FR-3, FR-4) called framework regions (FR) and three hypervariable regions (CDR-1, CDR-2, CDR-3) called complementarity-determining regions (CDR). VH contains three CDRs and four FRs arranged in the following order from amino terminus to carboxy terminus: FR-1, CDR-1 (CDR-H1), FR-2, CDR-2 (CDR-H2), FR-3, CDR-3 (CDR-H3), FR-4. The VL contains three CDRs and four FRs, arranged from amino terminus to carboxy terminus in the following order: FR-1, CDR-1 (CDR-L1), FR-2, CDR-2 (CDR-L2), FR-3, CDR-3 (CDR-L3), and FR-4. The variable regions of the heavy and light chains contain binding domains that interact with antigens.
[0028] The antibody of the present invention may be an antibody fragment and / or derivative. Examples of antibody fragments include F(ab')2, Fab, and Fv. Examples of antibody derivatives include antibodies with artificial amino acid mutations introduced into the constant region, antibodies with modified constant region domain configurations, antibodies with two or more Fc domains per molecule, antibodies composed of only heavy chains or only light chains, glycosylated antibodies, bispecific antibodies, antibody conjugates bound to antibodies or antibody fragment compounds or proteins other than antibodies, antibody enzymes, nanobodies, tandem scFvs, bispecific tandem scFvs, diabodies, and VHHs. In the present invention, the term "antibody" is intended to include antibody fragments and / or derivatives, unless otherwise specified.
[0029] Furthermore, while a monoclonal antibody classically refers to an antibody molecule obtained from a clone derived from a single antibody-producing cell, it also refers to a single type of antibody molecule comprising a combination of VH and VL consisting of a specific amino acid sequence. Monoclonal antibodies can also be obtained by obtaining nucleic acid molecules having gene sequences encoding the amino acids of the antibody protein, and antibodies can also be produced by genetic engineering using such nucleic acid molecules. Furthermore, techniques well known to those skilled in the art include modifying antibodies to improve their binding and specificity using genetic information such as H chains, L chains, and their variable regions and CDR sequences, as well as producing antibodies with a structure suitable for use as therapeutic agents by modifying antibodies from animals such as mice into human antibodies. Furthermore, human monoclonal antibodies can also be obtained by using non-human transgenic animals into which human antibody genes have been introduced as animals to be sensitized with antigens. Alternatively, as a method that does not require sensitization of animals, a person skilled in the art can appropriately carry out a technique in which a phage library expressing the antigen-binding region of a human antibody or a portion thereof (human antibody phage display) is used to obtain antibodies that specifically bind to a corresponding antigen or phage clones consisting of a specific amino acid sequence, and then human antibodies are produced from the information obtained (see, for example, the review by Taketo Tanaka et al., Keio J. Med., Vol. 60, pp. 37-46). Furthermore, when designing antibodies to be administered to animals other than humans, a person skilled in the art can design them using appropriate amino acid sequence information of the CDRs and variable regions, as in humanization techniques.
[0030] In the present invention, the term "antigen-antibody reaction" refers to an antibody that binds to the IGF-I receptor with an equilibrium dissociation constant (KD) of 1 x 10 -8 The antibody of the present invention binds to the IGF-I receptor with an affinity of typically 1×10 -8 M or less, especially 1 x 10 -9 M or less, and even 1 x 10 -10 It is preferred that the binding occurs with a KD of M or less.
[0031] The specificity of an antibody means that a high antigen-antibody reaction occurs with a certain antigen. In particular, in the present invention, an IGF-I receptor-specific antibody refers to an antibody whose antigen-antibody reactivity with INSR, which has a high similarity to the primary structure (amino acid sequence) and higher-order structure of IGF-I receptor, is 1.5 times or less than its reactivity with mock cells, at a concentration that shows a significant antigen-antibody reaction with cells expressing IGF-I receptor.
[0032] Those skilled in the art can measure antigen-antibody reactions by appropriately selecting binding measurements in a solid-phase or liquid-phase system. Such methods include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), surface plasmon resonance (SPR), fluorescence resonance energy transfer (FRET), and luminescence resonance energy transfer (LRET). Furthermore, when measuring such antigen-antibody binding, it is also possible to label the antibody and / or antigen with an enzyme, fluorescent substance, luminescent substance, radioisotope, etc., and detect the antigen-antibody reaction using a measurement method suitable for the physical and / or chemical properties of the labeled substance.
[0033] The anti-IGF-I receptor antibody of the present invention includes both an agonist antibody and an antagonist antibody. The IGF-I receptor agonist antibody of the present invention has the effect of enhancing the proliferation activity of myoblasts when used alone. The IGF-I receptor antagonist antibody of the present invention has the effect of inhibiting the proliferation activity of myoblasts caused by IGF-I when used simultaneously with IGF-I.
[0034] The IGF-I receptor agonist antibody of the present invention, which binds strongly to a specific domain of the IGF-I receptor, has the effect of enhancing the proliferation activity of myoblasts in vitro.
[0035] Furthermore, the IGF-I receptor agonist antibody of the present invention does not have the effect of enhancing glucose uptake in differentiated muscle cells in vitro at an effective concentration that enhances the proliferation activity of myoblasts, more preferably at a concentration 10 times higher, and even more preferably at a concentration 100 times higher than the effective concentration.
[0036] IGF-I has a significant blood glucose lowering effect at doses that increase muscle mass, but the IGF-I receptor agonist antibody of the present invention does not have a blood glucose lowering effect even at doses that increase muscle mass, more preferably at doses that are 10 times or more higher than those doses.
[0037] Furthermore, a single administration of an IGF-I receptor agonist antibody to guinea pigs has in vivo activity that increases muscle mass to the same extent as the continuous administration of IGF-I. Furthermore, the IGF-I receptor agonist antibody of the present invention has a long half-life in the blood and exhibits a muscle mass-increasing effect upon single administration to animals.
[0038] From the above, the IGF-I receptor agonist antibody of the present invention has the potential to become a therapeutic or preventive agent for various diseases associated with the IGF-I receptor, such as disuse muscular atrophy and dwarfism, which are expected to have the effects of IGF-I, and it is possible to overcome the blood glucose lowering effect, which is a problem associated with IGF-I, and to prolong the half-life in blood.
[0039] The IGF-I receptor antagonist antibody of the present invention inhibits the binding of IGF-I to the IGF-I receptor. In one embodiment of the IGF-I receptor antagonist antibody of the present invention, the antibody activates the IGF-I receptor but inhibits the action of IGF-I on the IGF-I receptor. In this case, the antibody has the effect of negating the additive agonist activity of IGF-I, for example, the proliferation-inducing activity of IGF-I on myoblasts. Another embodiment of the IGF-I receptor antagonist antibody of the present invention is an antibody that binds to the IGF-I receptor but does not activate it. Examples of such antagonist antibodies that do not activate the IGF-I receptor through cross-linking include, but are not limited to, antibodies with monovalent antigen-binding ability such as Fab and scFv, antibodies such as bispecific antibodies that have bivalent binding sites but only one of the binding sites binds to a specific domain of the IGF-I receptor, and antibodies in which the distance between the bivalent binding sites has been changed by a linker or the like. Among the IGF-I receptor antagonist antibodies of the present invention, antibodies that bind to IGF-I receptor but do not have agonist activity can be confirmed to have binding activity to IGF-I receptor by a method measuring the antigen-antibody reaction between the antibody and IGF-I receptor, and to have no cell proliferation-inducing activity by a cell proliferation test using cells such as myoblasts. Furthermore, the IGF-I receptor antagonist antibody does not affect glucose uptake in differentiated muscle cells in vitro or blood glucose levels in vivo. Therefore, the IGF-I receptor antagonist antibody of the present invention, as an anti-IGF-I receptor antibody that does not exhibit side effects such as hyperglycemia, has the potential to be used as a therapeutic or preventive agent for malignant tumors such as breast cancer, colon cancer, sarcoma, lung cancer, prostate cancer, thyroid cancer, and myeloma.
[0040] [Binding of anti-IGF-I receptor antibodies] The anti-IGF-I receptor antibodies of the present invention have the CR domain of the IGF-I receptor as an epitope. On the other hand, IGF-I receptor agonist antibodies do not have binding affinity to INSR, which is highly similar to the primary structure (amino acid sequence) and higher-order structure of the IGF-I receptor. It is thought that the anti-IGF-I receptor antibodies of the present invention, by binding to the CR domain of the IGF-I receptor, activate a homozygous receptor in which the IGF-I receptor forms a dimer, or a heterozygous receptor in which the IGF-I receptor and INSR form a dimer.
[0041] [Sequence of anti-IGF-I receptor antibody] The sequence of the anti-IGF-I receptor antibody of the present invention is not particularly limited, as long as it specifically binds to the IGF-I receptor of a vertebrate and has the activity of inducing cell proliferation. However, it is preferable that each CDR sequence has a specific amino acid sequence. Specifically, this is as follows. In the present invention, "identity" of an amino acid sequence means the proportion of identical amino acid residues, and "similarity" means the proportion of identical or similar amino acid residues. Homology and identity can be determined, for example, by the BLAST method (NCBI PBLAST default conditions).
[0042] Here, "similar amino acid residues" refers to amino acid residues having side chains with similar chemical properties (e.g., charge or hydrophobicity). Examples of similar amino acid residues include the following combinations: 1) amino acid residues having aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine residues; 2) amino acid residues having aliphatic hydroxyl side chains: serine and threonine residues; 3) amino acid residues having an amide-containing side chain: asparagine and glutamine residues; 4) amino acid residues having aromatic side chains: phenylalanine, tyrosine, and tryptophan residues; 5) amino acid residues having a basic side chain: lysine, arginine, and histidine residues; 6) amino acid residues having acidic side chains: aspartic acid and glutamic acid residues; and 7) amino acid residues having sulfur-containing side chains: cysteine and methionine residues.
[0043] In the present invention, the CDR-1 (CDR-H1) sequence of the heavy chain variable region is preferably SEQ ID NO: 3 (SerTyrTrpMetHis) or an amino acid sequence in which one amino acid residue in SEQ ID NO: 3 has been substituted, deleted, or inserted. Furthermore, the CDR-H1 sequence preferably has 80% or more homology with SEQ ID NO: 3. In the present invention, when an amino acid residue (hereinafter referred to as the "first amino acid residue") in a certain amino acid sequence is substituted with another amino acid residue (hereinafter referred to as the "second amino acid residue"), it is more preferable that the first amino acid residue before substitution and the second amino acid residue after substitution are similar in structure and / or properties to each other.
[0044] The CDR-2 (CDR-H2) sequence of the heavy chain variable region is preferably SEQ ID NO: 4 (GluThrAsnProSerAsnSerValThrAsnTyrAsnGluLysPheLysSer) or an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 4 have been substituted, deleted, or inserted. Furthermore, the CDR-H2 sequence preferably has a homology of 82% or more, preferably 88% or more, and more preferably 94% or more with SEQ ID NO: 4.
[0045] The CDR-3 (CDR-H3) sequence of the heavy chain variable region is preferably SEQ ID NO: 5 (GlyArgGlyArgGlyPheAlaTyr) or an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 5 have been substituted, deleted, or inserted. Furthermore, the CDR-H3 sequence preferably has a homology of 75% or more, more preferably 87% or more, with SEQ ID NO: 5.
[0046] The CDR-1 (CDR-L1) sequence of the light chain variable region is preferably SEQ ID NO: 6 (ArgAlaSerGlnAsnIleAsnPheTrpLeuSer) or an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 6 have been substituted, deleted, or inserted. Furthermore, the CDR-L1 sequence preferably has 81% or more homology with SEQ ID NO: 6, and more preferably 90% or more homology.
[0047] The CDR-2 (CDR-L2) sequence of the light chain variable region is preferably SEQ ID NO: 7 (LysAlaSerAsnLeuHisThr) or an amino acid sequence in which one amino acid residue in SEQ ID NO: 7 has been substituted, deleted, or inserted. Furthermore, the CDR-L2 sequence preferably has 85% or more homology with SEQ ID NO: 7.
[0048] The CDR-3 (CDR-L3) sequence of the light chain variable region is preferably SEQ ID NO: 8 (LeuGlnGlyGlnSerTyrProTyrThr) or an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 8 have been substituted, deleted, or inserted. Furthermore, the CDR-L3 sequence preferably has a homology of 77% or more, more preferably 88% or more, with SEQ ID NO: 8.
[0049] In particular, the anti-IGF-I receptor antibody of the present invention preferably has the following combination of CDR sequences: the amino acid sequence of sequence 3 as the CDR-H1 sequence, the amino acid sequence of sequence 4 as the CDR-H2 sequence, the amino acid sequence of sequence 5 as the CDR-H3 sequence, the amino acid sequence of sequence 6 as the CDR-L1 sequence, the amino acid sequence of sequence 7 as the CDR-L2 sequence, and the amino acid sequence of sequence 8 as the CDR-L3 sequence.
[0050] Methods for identifying the sequences of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, or CDR-L3 in an antibody include, for example, the Kabat method (Kabat et al., The Journal of Immunology, 1991, Vol. 147, No. 5, pp. 1709-1719) and the Chothia method (Al-Lazikani et al., Journal of Molecular Biology, 1997, Vol. 273, No. 4, pp. 927-948). These methods are common knowledge to those skilled in the art in this field, and are also well known in the art, for example, as described in Dr. Andrew C. R. An overview can also be found on the Martin's Group's internet homepage (http: / / www.bioinf.org.uk / abs / ).
[0051] The framework sequences of the immunoglobulins that are the antibodies of the present invention are preferably framework sequences of each class of vertebrate immunoglobulins, particularly those of humans or non-human animals, including guinea pigs, monkeys, rabbits, cows, pigs, horses, sheep, dogs, chickens, mice, and rats.
[0052] The anti-IGF-I receptor antibody of the present invention preferably has specific amino acid sequences as the heavy chain variable region and the light chain variable region. Specifically, these are as follows:
[0053] The heavy chain variable region is preferably SEQ ID NO: 9, an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 9 have been substituted, deleted, or inserted, or an amino acid sequence having 90% or more homology to SEQ ID NO: 9. The light chain variable region is preferably SEQ ID NO: 10, an amino acid sequence in which one or two amino acid residues in SEQ ID NO: 10 have been substituted, deleted, or inserted, or an amino acid sequence having 90% or more homology to SEQ ID NO: 10. In particular, the anti-IGF-I receptor antibody of the present invention is preferably IGF11-16. That is, it preferably comprises a combination of a heavy chain variable region with SEQ ID NO: 9 and a light chain variable region with SEQ ID NO: 10.
[0054] Those skilled in the art can design the humanized anti-IGF-I receptor antibody of the present invention by appropriately combining the amino acid sequences of the above-mentioned heavy and light chain CDRs and / or chain variable regions with the amino acid sequences of the heavy and light chain framework regions and / or constant regions of a human antibody. The amino acid sequences of the heavy and light chain framework regions and / or constant regions of the humanized antibody can be selected from, for example, human IgG, IgA, IgM, IgE, and IgD classes or mutants thereof.
[0055] When the anti-IGF-I receptor antibody of the present invention is an IGF-I receptor agonist antibody, the antibody or antigen-binding fragment thereof of the present invention is preferably of the human IgG class or a variant thereof, preferably the human IgG4 subclass or the human IgG1 subclass or a variant thereof. In one example, the stabilized IgG4 constant region contains a proline at position 241 in the hinge region according to the Kabat system. This position corresponds to position 228 in the hinge region according to the EU numbering system (Kabat et al., Sequences of Proteins of Immunological Interest, DIANE Publishing, 1992; Edelman et al., Proc. Natl. Acad. Sci. USA, 63, 78-85, 1969). In human IgG4, this residue is typically serine, and substitution of serine with proline can induce stabilization. In one example, the N297A mutation can be incorporated into the constant region of IgG1 to minimize its ability to bind to Fc receptors and / or fix complement.
[0056] [Competitive Binding] Antibodies that bind competitively to the IGF-I receptor with the anti-IGF-I receptor antibody of the present invention are also included within the scope of the present invention. In the present invention, "competitive binding" refers to the phenomenon in which, when multiple types of monoclonal antibodies coexist with an antigen, the binding of one antibody to the antigen is inhibited by the binding of another antibody to the antigen. In general, this can be measured by adding varying amounts (concentrations) of a monoclonal antibody to a fixed amount (concentration) of another monoclonal antibody and measuring the amount (concentration) added at which the binding amount of the fixed amount of the monoclonal antibody to the antigen decreases. The degree of inhibition is expressed as the IC 50 A monoclonal antibody that competitively binds to the anti-IGF-I receptor antibody of the present invention is one that has an IC value of 10 nM when the anti-IGF-I receptor antibody of the present invention, for example, the IGF11-16 antibody, is used to detect antigen-antibody binding. 50The term "antibody" refers to an antibody having a binding activity of typically 1000 nM or less, particularly 100 nM or less, and further 10 nM or less. When measuring competitive binding, the antibody used can be labeled with an enzyme, fluorescent substance, luminescent substance, radioisotope, or the like, and the measurement can be performed by detecting the antibody using a measurement method suitable for the physical and / or chemical properties of the labeled substance.
[0057] [Cross-reactivity] The anti-IGF-I receptor antibody of the present invention preferably cross-reacts with IGF-I receptors of other vertebrates. Cross-reactivity refers to the ability of an antibody to bind to an antigen of another animal species different from the animal species (e.g., human) of the IGF-I receptor with which the antibody has an antigen-antibody reaction. The antibody preferably cross-reacts with the IGF-I receptor of a non-human animal, including humans, guinea pigs, monkeys, rabbits, cows, pigs, horses, sheep, dogs, or chickens, other than the animal species with which the antibody has an antigen-antibody reaction. In Example 7, the anti-IGF-I receptor antibody IGF11-16 antibody was shown to bind to the sequence ProSerGlyPheIleArgAsnGlySerGlnSerMet in the CR domain of the human IGF-I receptor. The sequence ProSerGlyPheIleArgAsnGlySerGlnSerMet is conserved in the homologous portion of the IGF-I receptors of monkeys (cynomolgus monkeys), rabbits, guinea pigs, cattle, sheep, horses, and dogs, and there is cross-reactivity with the IGF-I receptors of these species. Furthermore, in mice and rats, the amino acid sequence of the homologous portion is ProSerGlyPheIleArgAsnSerThrGlnSerMet, and by obtaining an anti-IGF-I receptor antibody that binds to this portion, it is possible to obtain an antibody that binds to the IGF-I receptor of mice, rats, etc., and has properties and functions similar to those of IGF11-16.
[0058] Furthermore, by using an animal species that does not cross-react with the anti-IGF-I receptor antibody of the present invention and genetically modifying the cells or animals, it is possible to produce cells or animals that express an IGF-I receptor with which the anti-IGF-I receptor antibody of the present invention cross-reacts.
[0059] [Proliferation-inducing activity of vertebrate-derived cells, and activity of inducing increases in muscle mass and / or body length] In one embodiment of the present invention, the anti-IGF-I receptor antibody has proliferation-inducing activity of vertebrate-derived cells. Although the existence of IGF-I receptor agonist antibodies has already been known, there have been no reports of antibodies that have shown proliferation-inducing activity in primary cultured cells, particularly myoblasts. Furthermore, in vitro, the EC of IGF-I has been shown to be a key factor in inducing proliferation of IGF-I. 50 There have been no reports of antibodies that have cell proliferation-inducing activity at doses lower than the above values. The vertebrate-derived cells of the present invention are preferably cells derived from mammals, birds, reptiles, amphibians, or fish, more preferably cells derived from mammals or birds, and even more preferably cells derived from humans, monkeys, rabbits, guinea pigs, cows, pigs, sheep, horses, or dogs. Cell proliferation can be induced by the anti-IGF-I receptor antibodies of the present invention in cells derived from these species that express an IGF-I receptor with which the anti-IGF-I receptor antibodies of the present invention cross-react. Furthermore, cells or animals modified to express a certain type of IGF-I receptor that cross-reacts with the anti-IGF-I receptor antibodies of the present invention, or cells derived from such modified animals, are also included in the vertebrate-derived cells of the present invention.
[0060] Cells used to examine the in vitro proliferation-inducing activity of vertebrate-derived cells can include primary cultured cells, established cell lines, or transformed cells of these cells. Primary cultured cells are cells isolated from the organs or tissues of an organism, and typically can be subcultured for a certain number of passages. Primary cultured cells derived from vertebrates can be obtained from vertebrate organs or tissues by enzyme treatment, physical dispersion, or the explant method. Organs or tissues obtained from vertebrates, or fragments thereof, can also be used. Examples of organs or tissues from which the primary cells are prepared include, preferably, endocrine tissues such as the thyroid gland, parathyroid gland, and adrenal gland; immune tissues such as the appendix, tonsils, lymph nodes, and spleen; respiratory organs such as the trachea and lungs; digestive organs such as the stomach, duodenum, small intestine, and large intestine; urinary organs such as the kidneys and bladder; male reproductive organs such as the vas deferens, testes, and prostate; female reproductive organs such as the breast and fallopian tubes; and muscle tissues such as cardiac muscle and skeletal muscle. The primary cultured cells used to examine the proliferation-inducing activity of anti-IGF-I receptor antibodies in the present invention are cells that express an IGF-I receptor and whose proliferation is induced by IGF-I that binds to the IGF-I receptor. A representative example is skeletal muscle myoblasts, which are primary cultured cells isolated from muscle tissue. Primary cultured cells derived from humans or animals can be obtained and used as distributed or commercially available cells, and human primary cultured cells can be obtained from institutions or companies such as ATCC (registered trademark), ECACC, Lonza, Gibco (registered trademark), Cell Applications, ScienCell research laboratories, and PromoCell.
[0061] A cell line is a cultured cell that is derived from an organism and is immortalized to be able to grow semi-permanently while maintaining certain properties. Cell lines include those derived from non-tumor origin and tumor origin. As a vertebrate-derived cell line for examining the proliferation-inducing activity of the anti-IGF-I receptor antibody of the present invention, cells that express IGF-I receptor and whose growth is induced by IGF-I that binds to the IGF-I receptor are used. Examples of established cell lines that express IGF-I receptors and whose cell proliferation is induced by IGF-I include, but are not limited to, human neuroblastoma SH-SY5Y, human epidermal keratinocyte cell line HaCaT, human alveolar basal epithelial adenocarcinoma cell line A549, human colon adenocarcinoma cell line Caco-2, human liver cancer-derived cell line HepG2, human cervical cancer cell line Hela, human cervical cancer cell line SiHa, human breast cancer cell line MCF7, human pluripotent embryonal carcinoma NTERA-2, and human osteosarcoma cell line U-2-OS.
[0062] Furthermore, cells for which proliferation induction by the anti-IGF-I receptor antibodies of the present invention is examined also include transformed cells of primary cultured cells or established cell lines. Examples of such transformed cells include iPS cells prepared from primary cultured cells and cells or tissues induced to differentiate from such iPS cells. Other transformed cells also include cells in which genes are introduced into primary cultured cells or established cell lines and the genes are expressed transiently or sustainedly. Genes introduced into and expressed in such cells may include genes encoding IGF-I receptors of human or other species.
[0063] Methods for examining cell proliferation induction by the anti-IGF-I receptor antibody of the present invention in vertebrate-derived cells include cell counting, measuring the amount of DNA synthesis, and measuring changes in metabolic enzyme activity. Cell counting methods include methods using a hemocytometer or a cell counting device such as a Coulter counter. Methods for measuring DNA synthesis include methods based on the incorporation of [3H]-thymidine or 5-bromo-2'-deoxyuridine (BrdU). Methods for observing changes in metabolic enzyme activity include the MTT method, XTT method, and WST method. Those skilled in the art can also use other methods as appropriate. Cell proliferation-inducing activity can be determined by determining whether cell proliferation is increased when the cultured cells used in the test are reacted with the anti-IGF-I receptor antibody of the present invention compared to when the antibody is not reacted. In this case, it is convenient to evaluate the activity by reacting IGF-I, the ligand for the original IGF-I receptor, under the same conditions as the control for the inducing activity and then measuring the activity.
[0064] When the cultured cells to be tested are reacted with varying concentrations of the anti-IGF-I receptor antibody of the present invention and IGF-I, the concentration at which 50% of the maximum proliferation activity is exhibited is defined as EC 50 When the proliferation activity is evaluated using human skeletal muscle myoblasts, the cell proliferation-inducing activity of the anti-IGF-I receptor antibody of the present invention is preferably at an EC value equivalent to that of IGF-I. 50 value, and more preferably the EC 50 The EC value of the anti-IGF-I receptor antibody of the present invention is 1 / 10 or less, more preferably 1 / 20 or less, of that of IGF-I. 50 Furthermore, when the proliferation activity was evaluated using human skeletal muscle myoblasts, the EC value of the anti-IGF-I receptor antibody of the present invention was 1 / 50 or less of that of IGF-I. 50 The value is preferably 0.5 nmol / L or less, more preferably 0.3 nmol / L or less, and even more preferably 0.1 nmol / L or less.
[0065] The in vivo proliferation-inducing activity of vertebrate-derived cells can be examined by parenterally administering the anti-IGF-I receptor antibody of the present invention to the vertebrate and measuring changes in the weight, size, cell number, etc. of the entire administered individual or of the organs or tissues in the administered individual, or by using an animal transplanted with the vertebrate cells and measuring changes in the weight, size, cell number, etc. of a graft containing the transplanted vertebrate cells in the transplanted individual. Measurements of the entire individual include measurements of body weight, body length, limb circumference, etc., body composition measurement using impedance analysis, creatinine, height coefficient, etc. Measurements of organs, tissues, or grafts in individuals include directly recovering the target organ, tissue, or graft in non-human animals and calculating the weight, size, and cell number contained therein. Non-invasive methods for measuring organs, tissues, or grafts in individuals include image analysis using X-ray images, CT, or MRI, and contrast methods using isotope or fluorescent tracers. When the target tissue is skeletal muscle, changes in muscle strength or the like serve as an indicator. Alternatively, a person skilled in the art can use other appropriate methods to examine the effect of the anti-IGF-I receptor antibody of the present invention on the in vivo proliferation-inducing activity of vertebrate-derived cells. The in vivo cell proliferation-inducing activity of the anti-IGF-I receptor antibody of the present invention can be examined by comparing the results of measurements, etc., performed by the methods described above, between an individual administered with the anti-IGF-I receptor antibody of the present invention and an individual administered with an antibody other than the anti-IGF-I receptor antibody of the present invention or another control substance.
[0066] The anti-IGF-I receptor antibody of the present invention has the characteristic of improved durability, since its proliferation-inducing effect lasts longer than that of native IGF-I relative to the time of contact with cells. In the in vitro cell proliferation-inducing activity test in Example 12, the cell proliferation-inducing activity of native IGF-I was lost when the cells were contacted with the native IGF-I and then washed with an IGF-I-free medium, whereas the cell proliferation-inducing activity of the IGF11-16 antibody, an anti-IGF-I receptor antibody of the present invention, was sustained even when the cells were contacted with the IGF11-16 antibody and then washed with an IGF11-16 antibody-free medium. Furthermore, in Example 16, the blood kinetics of IGF-I and the IGF11-16 antibody, an anti-IGF-I receptor antibody of the present invention, were compared. Approximately 50% or more of native IGF-I was eliminated from the blood within 24 hours after administration to animals, whereas 60% or more of the IGF11-16 antibody remained in the blood even 48 hours after administration to animals, demonstrating that the IGF11-16 antibody remains in the blood for a long period of time. These findings demonstrate that the anti-IGF-I receptor antibody of the present invention exhibits a long-lasting cell proliferation-inducing effect in vitro and in vivo.
[0067] Furthermore, the in vivo effects of the anti-IGF-I receptor antibody of the present invention include an effect of increasing muscle mass and / or body length. IGF-I acts not only on the proliferation and differentiation of myoblasts in skeletal muscle as described above, but also on thickening muscle fibers, and it is believed that these comprehensive effects have the effect of increasing muscle mass. When administered to an animal, the anti-IGF-I receptor antibody of the present invention also has the effect of increasing the muscle mass of the animal, similar to IGF-I. The anti-IGF-I receptor antibody of the present invention is the first IGF-I receptor agonist antibody to be shown to have a muscle-enhancing effect in vivo.
[0068] Methods for measuring the muscle mass-increasing effect of the anti-IGF-I receptor antibody of the present invention include, for whole-individual measurements, measurements of body weight, body length, limb circumference, etc., body composition measurement by impedance method, creatinine, height index, etc., as well as methods such as image analysis by CT or MRI, and contrast methods using isotope or fluorescent tracers. Changes in muscle strength, etc., can also be used as an indicator. For non-human animals, methods such as directly collecting muscle and measuring its weight and size are also possible. The muscle mass-increasing effect can be evaluated by comparing the increase in muscle mass between individuals administered with the anti-IGF-I receptor antibody of the present invention and individuals not administered the antibody, or by comparing the muscle mass in a single individual before and after administration of the anti-IGF-I receptor antibody of the present invention. The effect of increasing muscle mass can be determined by observing a difference in muscle mass increase following administration of the anti-IGF-I receptor antibody of the present invention. The effect of administering the anti-IGF-I receptor antibody of the present invention can be determined by observing a difference in muscle mass of preferably 103% or more, more preferably 104% or more, between individuals administered and not administered the anti-IGF-I receptor antibody of the present invention, or between individuals before and after administration of the anti-IGF-I receptor antibody of the present invention. IGF-I is also involved in bone growth and increases body length (height in humans). Therefore, the anti-IGF-I receptor antibody of the present invention also has the effect of increasing body length when administered to animals. The effect of increasing body length due to the anti-IGF-I receptor antibody of the present invention can be measured by measuring the individual's weight, body length, limb circumference, etc.
[0069] [Effect on glucose uptake in vertebrate-derived cells and / or blood glucose level in animals] In one embodiment of the present invention, the anti-IGF-I receptor antibody has the characteristic of not affecting the glucose uptake into cells in differentiated muscle cells derived from vertebrates and / or the blood glucose level in vertebrates. IGF-I is known to increase the glucose uptake into cells and lower blood glucose levels as part of its agonistic effect on the IGF-I receptor, but the anti-IGF-I receptor antibody of the present invention, which functions as an IGF-I receptor agonist antibody, does not affect the proliferation-inducing activity in cells in vitro in EC 50The unexpected effect is that the antibody does not induce glucose uptake in differentiated muscle cells even at doses 100 times or more the effective dose for inducing an increase in muscle mass when parenterally administered to animals, and does not fluctuate blood glucose levels even at doses 10 times or more the effective dose for inducing an increase in muscle mass when parenterally administered to animals. Furthermore, as an IGF-I receptor antagonist antibody, the characteristic of not affecting glucose uptake in differentiated muscle cells derived from vertebrate cells and / or blood glucose levels in vertebrates is advantageous in avoiding hyperglycemia and other problems that have been unmet when using conventional IGF-I receptor antagonist antibodies in human therapy. The vertebrate-derived cells of the present invention are preferably cells derived from mammals, birds, reptiles, amphibians, or fish, more preferably cells derived from mammals or birds, and even more preferably cells derived from humans, monkeys, rabbits, guinea pigs, cows, pigs, sheep, horses, or dogs. Furthermore, vertebrate-derived cells of the present invention also include cells or animals that have been modified to express an IGF-I receptor derived from a vertebrate species that is cross-reactive with the anti-IGF-I receptor antibody of the present invention, or an IGF-I receptor into which a mutation has been introduced so as to have binding ability, or cells derived from such modified animals.
[0070] Primary cultured cells, established cell lines, or transformed cells of these cells can be used to examine the characteristic of the anti-IGF-I receptor antibody of the present invention that does not affect the in vitro glucose uptake of vertebrate-derived cells. Primary cultured cells are cells isolated from organs or tissues of an organism, and typically refer to cells that can be subcultured for a certain number of passages. Primary cultured cells derived from vertebrates can be obtained from vertebrate organs or tissues by enzyme treatment, physical dispersion, the explant method, or other techniques. Preferred organs and tissues from which the primary cells are prepared include endocrine tissues such as the thyroid gland, parathyroid gland, and adrenal gland; immune tissues such as the appendix, tonsils, lymph nodes, and spleen; respiratory organs such as the trachea and lungs; digestive organs such as the stomach, duodenum, small intestine, and large intestine; urinary organs such as the kidneys and bladder; male reproductive organs such as the vas deferens, testes, and prostate; female reproductive organs such as the breast and fallopian tubes; and muscle tissues such as cardiac muscle and skeletal muscle, with the liver, kidneys, or digestive organs or muscle tissue being more preferred, and muscle tissue being even more preferred.
[0071] The primary cultured cells used to examine the characteristic of the anti-IGF-I receptor antibody of the present invention that does not affect intracellular glucose uptake are cells that express an IGF-I receptor and in which intracellular glucose uptake is induced by IGF-I that binds to the IGF-I receptor. Representative examples include differentiated muscle cells obtained by differentiating skeletal muscle myoblasts, which are primary cultured cells isolated from muscle tissue.
[0072] The differentiated muscle cells of the present invention refer to differentiated muscle cells, including those that have not yet fully differentiated. For convenience, the term "differentiated muscle cells" used in the present invention refers to cells approximately 6 days after the start of differentiation. Primary cultured cells derived from humans or animals can be purchased and used as separate or commercially available cells. Human primary cultured cells can be obtained from institutions or companies such as ATCC (registered trademark), ECACC, Lonza, Gibco (registered trademark), Cell Applications, ScienCell research laboratories, and PromoCell.
[0073] A cell line refers to a cultured cell that is derived from an organism and is immortalized to allow it to grow semi-permanently while maintaining certain properties. Cell lines include those derived from non-tumor origin and tumor origin. As a vertebrate-derived cell line for investigating the effect of the anti-IGF-I receptor antibody of the present invention on glucose uptake into cells, cells that express an IGF-I receptor and in which glucose uptake into cells is induced by IGF-I that binds to the IGF-I receptor are used. Examples of cells that express an IGF-I receptor and in which glucose uptake into cells is induced by IGF-I include, but are not limited to, skeletal muscle cells, adipocytes, and epidermal keratinocytes.
[0074] Furthermore, cells for which the effect of the anti-IGF-I receptor antibody of the present invention on intracellular glucose uptake can be examined include transformed cells of primary cultured cells or established cell lines. Examples of such transformed cells include iPS cells prepared from primary cultured cells and cells induced to differentiate from such iPS cells. Other transformed cells include cells obtained by introducing a gene into primary cultured cells or established cell lines and expressing the gene transiently or sustainably. The gene introduced and expressed in such cells may include a gene encoding an IGF-I receptor from a human or other species.
[0075] Methods for examining the effect of the anti-IGF-I receptor antibody of the present invention on glucose uptake in vertebrate-derived cells include measuring intracellular glucose concentration, measuring the amount of intracellular uptake of a glucose-related tracer substance, and measuring changes in glucose transporters. Methods for measuring glucose concentration include absorbance measurement methods such as enzymatic methods, methods for measuring the amount of intracellular uptake of a glucose-related tracer substance include measuring the amount of [3H]-2'-deoxyglucose uptake, and methods for observing changes in glucose transporters include cell immunostaining and Western blotting, but those skilled in the art can also use other methods as appropriate. The effect on intracellular glucose uptake can be determined by determining whether the intracellular glucose uptake when the anti-IGF-I receptor antibody of the present invention is reacted with the cultured cells used in the test is the same as that when the antibody is not reacted. In this case, it is convenient to evaluate the activity by reacting IGF-I, the ligand of the original IGF-I receptor, under the same conditions as a control for the inducing activity and measuring it.
[0076] The amount of glucose uptake is shown as the amount of glucose uptake into cells when the cultured cells to be tested are reacted with varying concentrations of the anti-IGF-I receptor antibody of the present invention and IGF-I, respectively, and the amount of glucose uptake into cells in an untreated group is taken as 100%. When glucose uptake is evaluated using human differentiated muscle cells, the amount of glucose uptake of the anti-IGF-I receptor antibody of the present invention is preferably equal to or less than the amount of glucose uptake of IGF-I at the same concentration, more preferably equal to or less than 110% of the untreated group, and even more preferably equal to 100% of the untreated group. Furthermore, when glucose uptake is evaluated using human differentiated muscle cells, the amount of glucose uptake when 100 nmol / L of the anti-IGF-I receptor antibody of the present invention is added is preferably equal to or less than 110%, more preferably equal to or less than 105%, and even more preferably 95 to 100%.
[0077] In vivo glucose uptake in vertebrate-derived cells can be examined by parenterally administering the anti-IGF-I receptor antibody of the present invention to the vertebrate and measuring changes in the glucose content, etc., in the organs or tissues of the administered individual. Measurements of the entire individual can be made by measuring blood glucose levels, etc., or hemoglobin A1C, etc., using glycated proteins as an indicator. In measuring the amount of glucose uptake in individual organs or tissues, in non-human animals, the target organ or tissue is directly collected and the glucose content or tracer is calculated. Non-invasive methods for measuring glucose uptake in individual organs or tissues include image analysis using X-ray images, CT, and MRI, and imaging methods using isotope or fluorescent tracers. When the target tissue is skeletal muscle, glucose clamps and the like can also be used as indicators. Those skilled in the art can also use other appropriate methods to examine the effect of the anti-IGF-I receptor antibody of the present invention on in vivo glucose uptake in vertebrate-derived cells.
[0078] Furthermore, the anti-IGF-I receptor antibodies of the present invention are characterized in that, when parenterally administered to a vertebrate, they do not cause changes in blood glucose levels in the vertebrate, even at the same dose, preferably at a dose 10 times or more higher than the effective dose for inducing an increase in muscle mass in the vertebrate. Animals used to examine changes in blood glucose levels in vertebrates in response to the anti-IGF-I receptor antibodies of the present invention are preferably mammals, birds, reptiles, amphibians, or fish, more preferably mammals or birds, and even more preferably humans, monkeys, rabbits, guinea pigs, cows, pigs, sheep, horses, or dogs. Animals used to examine changes in blood glucose levels in vertebrates in response to the anti-IGF-I receptor antibodies of the present invention also include animals that have been modified to express a certain type of IGF-I receptor that cross-reacts with the anti-IGF-I receptor antibodies of the present invention. Blood glucose levels are measured using invasive methods such as colorimetry and electrode methods, enzymes used for detection include the glucose oxidase (GOD) method and the glucose dehydrogenase (GDH) method, and non-invasive methods such as optical measurement. However, those skilled in the art can also select other methods as appropriate. The normal fasting blood glucose range for humans is 100 mg / dL to 109 mg / dL. Adverse events caused by drug administration on blood glucose levels (Common Terminology Criteria for Adverse Events v4.0) are defined as hypoglycemia when blood glucose levels fall below the range of 77 mg / dL-55 mg / dL, and hyperglycemia when blood glucose levels rise above the range of 109 mg / dL-160 mg / dL. No effect of drug administration on blood glucose levels means that blood glucose levels after drug administration are between 55 mg / dL and 160 mg / dL, more preferably between 77 mg / dL and 109 mg / dL. However, normal blood glucose levels and the range of fluctuations therein vary depending on the animal to which the antibody is administered, and even in humans, blood glucose levels at the time of administration are not necessarily within the normal range. Therefore, in the present invention, not fluctuating the blood glucose levels of a vertebrate means that the blood glucose levels of a vertebrate administered with the anti-IGF-I receptor antibody of the present invention change by preferably within 30%, more preferably within 20%, and even more preferably within 10%.
[0079] [Method for Producing Anti-IGF-I Receptor Antibodies] The antibodies of the present invention can be obtained using techniques well known to those skilled in the art. The antibodies of the present invention can be polyclonal or monoclonal antibodies (Milstein et al., Nature (England), published October 6, 1983, Vol. 305, No. 5934, pp. 537-540). For example, polyclonal antibodies can be recovered from the serum of a mammal sensitized with the IGF-I receptor peptide of SEQ ID NO: 2 as an antigen. When a peptide is used as an antigen, the antigen can be bound to a carrier protein such as BSA or KLH, or to polylysine. A specific example of a peptide used as an antigen is ProSerGlyPheIleArgAsnGlySerGlnSerMet, which is a partial sequence of SEQ ID NO: 2, but is not limited thereto. The monoclonal antibody of the present invention can be recovered from the culture by cloning hybridomas obtained by extracting immune cells from a mammal sensitized with an antigen and fusing them with myeloma cells or the like. A method for obtaining such a monoclonal antibody is described in Example 1, and examples of monoclonal antibodies obtained thereby include, but are not limited to, monoclonal antibodies (IGF11-16) having the VH amino acid sequence of SEQ ID NO: 9 and the VL amino acid sequence of SEQ ID NO: 10.
[0080] It is also possible to obtain a nucleic acid molecule having a gene sequence encoding the amino acid sequence of the antibody protein from the obtained monoclonal antibody, and such a nucleic acid molecule can be used to produce an antibody by genetic engineering. Using the genetic information of the antibody, such as information on the H chain, L chain, and their variable regions and CDR sequences, it is possible to modify the antibody to improve its binding ability or specificity, or to modify an antibody from an animal such as a mouse into a human antibody, thereby producing an antibody with a structure suitable for use as a therapeutic agent. These techniques are well known to those skilled in the art. It is also possible to obtain human monoclonal antibodies by using a non-human transgenic animal into which a human antibody gene has been introduced as an animal to be sensitized with an antigen. Alternatively, as a method that does not require sensitization of animals, a person skilled in the art can appropriately carry out a technique in which a phage library expressing the variable region of a human antibody or a part thereof (human antibody phage display) is used to obtain an antibody that specifically binds to a corresponding antigen or a phage clone consisting of a specific amino acid sequence, and then a human antibody is produced from the information (see, for example, the review by Taketo Tanaka et al., Keio J. Med., Vol. 60, pp. 37-46).
[0081] Furthermore, the above-mentioned monoclonal antibodies can be produced by culturing hybridomas producing the desired antibodies and purifying the antibodies from the resulting culture supernatants by conventional methods. Another production method involves obtaining antibody-encoding genes, more specifically, genes encoding the heavy and / or light chains of immunoglobulins, from hybridomas producing the desired antibodies or phage clones obtained by human antibody phage display, constructing vectors for expressing the genes, and introducing the vectors into host cells (mammalian cells, insect cells, microorganisms, etc.) to produce the antibodies. Those skilled in the art can use known techniques to genetically modify the genes encoding the immunoglobulin heavy and / or light chains to introduce desired traits, and to produce humanized antibodies, antibody chimeric proteins, low-molecular-weight antibodies, and scaffold antibodies using structural information on the variable regions or CDR regions of the immunoglobulin heavy and / or light chains. Furthermore, for the purpose of improving antibody performance or avoiding side effects, modifications can be made to the structure of the antibody constant region or to the sugar chain portion, as appropriate, using techniques well known to those skilled in the art.
[0082] The anti-IGF-I receptor antibody of the present invention can be obtained using techniques well known to those skilled in the art. Specifically, the anti-IGF-I receptor antibody of the present invention is usually a monoclonal antibody (Milstein et al., Nature, 1983, Vol. 305, No. 5934, pp. 537-540), and such a monoclonal antibody can be prepared, for example, by the following method.
[0083] For example, a nucleic acid molecule encoding the amino acid sequence of the immunoglobulin heavy chain and / or light chain of the anti-IGF-I receptor antibody of the present invention is prepared. Then, such a nucleic acid molecule may be introduced into various vectors or plasmids to prepare a vector or plasmid containing the nucleic acid molecule. Next, a host cell is transformed with the nucleic acid molecule, vector, or plasmid. Examples of host cells include eukaryotic cells such as mammalian cells, insect cells, yeast cells, or plant cells, or bacterial cells. Next, the transformed host cell is cultured under appropriate conditions for producing the anti-IGF-I receptor antibody of the present invention. If necessary, the resulting anti-IGF-I receptor antibody of the present invention may be isolated from the host cell. The various techniques used in these procedures are all well known to those skilled in the art.
[0084] Furthermore, in a method using sensitization of animals, non-human transgenic animals into which a human antibody gene has been introduced are used as animals to be sensitized to an antigen, and the animals are sensitized with IGF-I receptor and / or a partial peptide thereof, etc., and immune cells are extracted and fused with myeloma cells, etc. to obtain hybridomas, which are then cloned and the antibodies are purified and recovered from the resulting culture supernatant by standard methods. Such methods for obtaining monoclonal antibodies are described, for example, in WO 2013 / 180238.
[0085] Alternatively, a technique can be used in which a phage library expressing the variable region of a desired humanized antibody or a part thereof (human antibody phage display) is used to obtain an antibody that specifically binds to a corresponding antigen or a phage clone consisting of a specific amino acid sequence, and then a humanized antibody is produced from the information obtained (see, for example, the review by Taketo Tanaka et al., The Keio Journal of Medicine, Vol. 60, pp. 37-46).
[0086] Here, those skilled in the art can use known techniques to produce antibody chimeric proteins, low-molecular-weight antibodies, scaffold antibodies, etc. by genetically modifying genes encoding immunoglobulin heavy and / or light chains to introduce desired traits or by using structural information on the variable regions or CDR regions of the immunoglobulin heavy and / or light chains. Furthermore, for the purpose of improving antibody performance or avoiding side effects, modifications to the structure of the antibody constant region or modifications to the sugar chain portion can also be appropriately performed using techniques well known to those skilled in the art.
[0087] [Drugs containing anti-IGF-I receptor antibodies] The anti-IGF-I receptor antibodies of the present invention can be used as therapeutic or preventive agents for IGF-I-related conditions or diseases caused by the action of IGF-I receptors. Specifically, IGF-I-related conditions or diseases that can be treated or prevented with an IGF-I receptor agonist antibody include disuse muscle atrophy, dwarfism, liver cirrhosis, hepatic fibrosis, diabetic nephropathy, chronic renal failure, Laronism, aging, intrauterine growth restriction (IUGR), cardiovascular protection, diabetes, insulin resistance, metabolic syndrome, osteoporosis, cystic fibrosis, myotonic dystrophy, AIDS-associated myasthenia, and HIV-associated myasthenia. Diseases that can be treated or prevented with IGF-I receptor antagonist antibodies include fat redistribution syndrome, Crohn's disease, Werner's syndrome, X-linked combined immunodeficiency, hearing loss, anorexia nervosa and retinopathy of prematurity, Turner's syndrome, Prader-Willi syndrome, Silver-Russell syndrome, idiopathic short stature, obesity, multiple sclerosis, ulcerative colitis, low muscle mass, myocardial ischemia, low bone mineral density, and diseases that can be treated or prevented with IGF-I receptor antagonist antibodies include neuroblastoma, rhabdomyosarcoma, osteosarcoma, childhood cancer, acromegaly, ovarian cancer, pancreatic cancer, benign prostatic hyperplasia, breast cancer, prostate cancer, bone cancer, lung cancer, colorectal cancer, cervical cancer, synovial sarcoma, bladder cancer, gastric cancer, Wilms' tumor, diarrhea associated with metastatic carcinoid and vasoactive intestinal peptide-secreting tumors, vipoma, Werner-Morrison syndrome, Beckwith-Wiedemann syndrome, kidney cancer, renal cell carcinoma, transitional cell carcinoma, Ewing's sarcoma, leukemia, acute lymphoblastic leukemia, and leukemia. Examples of the anti-IGF-I receptor antibodies of the present invention include leukemia, brain tumor, glioblastoma, non-glioblastoma brain tumor, meningioma, pituitary adenoma, vestibular schwannoma, primitive neuroectodermal tumor, medulloblastoma, astrocytoma, oligodendroglioma, ependymoma, choroid plexus papilloma, gigantism, psoriasis, atherosclerosis, vascular smooth muscle restenosis, inappropriate microvascular proliferation, diabetic retinopathy, Graves' disease, systemic lupus erythematosus, chronic thyroiditis, myasthenia gravis, autoimmune thyroiditis, and Behçet's disease. In particular, the anti-IGF-I receptor antibodies of the present invention are preferably used as therapeutic or preventive agents for disuse muscle atrophy and / or dwarfism. Furthermore, the anti-IGF-I receptor antibodies of the present invention are advantageous in that they do not cause fluctuations in blood glucose levels upon administration.
[0088] Drugs containing the anti-IGF-I receptor antibodies of the present invention may be formulated in the form of pharmaceutical compositions containing, in addition to the anti-IGF-I receptor antibodies of the present invention, pharmaceutically acceptable carriers and / or other additives. Formulations using pharmaceutically acceptable carriers and / or other additives can be carried out, for example, by the methods described in University of the Sciences in Philadelphia, "Remington: The Science and Practice of Pharmacy, 20th Edition," Lippincott Williams & Wilkins, 2000. One form of such therapeutic or prophylactic agents is provided as a liquid preparation or a lyophilized product prepared by dissolving, suspending, or emulsifying the antibody in a sterile aqueous or oily liquid. Examples of such solvents or dissolving solutions as diluents include aqueous liquids such as distilled water for injection and physiological saline, and when an osmolality adjuster (e.g., D-glucose, D-sorbitol, D-mannitol, sodium chloride, etc.) is added, a suitable solubilizing agent such as an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant (e.g., polysorbate 80, polyoxyethylene hydrogenated castor oil 50), etc. may also be used in combination. In addition, an oily liquid may also be used as the solvent or dissolving solution, and examples of such oily liquids include sesame oil and soybean oil, and benzyl benzoate, benzyl alcohol, etc. may also be used in combination as a solubilizing agent.In such formulations, additives such as buffers (e.g., phosphate buffers, acetate buffers), soothing agents (e.g., benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (e.g., human serum albumin, polyethylene glycol, etc.), preservatives (e.g., ascorbic acid, erythorbic acid, and salts thereof, etc.), coloring agents (e.g., copper chlorophyll, β-carotene, Red No. 2, Blue No. 1, etc.), antiseptics (e.g., parahydroxybenzoic acid esters, phenol, benzethonium chloride, benzalkonium chloride, etc.), thickeners (e.g., hydroxypropyl cellulose, carboxymethyl cellulose, and salts thereof, etc.), stabilizers (e.g., human serum albumin, mannitol, sorbitol, etc.), and odorants (e.g., menthol, citrus flavors, etc.) may be used as appropriate. Another example is a therapeutic or preventive agent for application to the mucosa. In these preparations, additives such as adhesives, adhesion enhancers, thickeners, and viscosifiers (e.g., mucin, agar, gelatin, pectin, carrageenan, sodium alginate, locust bean gum, xanthan gum, tragacanth gum, gum arabic, chitosan, pullulan, waxy starch, sucralfate, cellulose, and derivatives thereof (e.g., hydroxypropylmethylcellulose, polyglycerol fatty acid esters, acrylic acid alkyl (meth)acrylate copolymers or salts thereof, polyglycerol fatty acid esters, etc.) may be contained, primarily for the purpose of imparting properties such as adsorption and retention to the mucosa. However, the form, solvent, and additives of the therapeutic or preventive agent administered to a living body are not limited to these and can be appropriately selected by one skilled in the art.
[0089] A drug containing the anti-IGF-I receptor antibody of the present invention may contain, in addition to the anti-IGF-I receptor antibody of the present invention, other existing drugs (active ingredients). Furthermore, a drug containing the anti-IGF-I receptor antibody of the present invention may be combined with other existing drugs to form a kit. Examples of active ingredients to be combined with the IGF-I receptor agonist antibody include growth hormone or analogs thereof, insulin or analogs thereof, IGF-II or analogs thereof, anti-myostatin antibodies, myostatin antagonists, anti-activin type IIB receptor antibodies, activin IIB receptor antagonists, soluble activin type IIB receptor or analogs thereof, ghrelin or analogs thereof, follistatin or analogs thereof, beta-2 agonists, and selective androgen receptor modulators.In addition, examples of active ingredients to be combined with the IGF-I receptor antagonist antibody include corticosteroids, antiemetics, ondansetron hydrochloride, granisetron hydrochloride, metroclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, tropisetron, cancer vaccines, GM-CSF inhibitors, and GM-CSF DNA vaccines, cell-based vaccines, dendritic cell vaccines, recombinant viral vaccines, heat shock protein (HSP) vaccines, allogeneic tumor vaccines, autologous tumor vaccines, analgesics, ibuprofen, naproxen, choline magnesium trisalicylate, oxycodone hydrochloride, anti-angiogenic drugs, antithrombotic drugs, anti-PD-1 antibodies, nivolumab, pembrolizumab, anti-PD-L1 antibodies, atezolizumab, anti-CTLA4 antibodies, ipilimumab, anti-CD20 antibodies, rituximab, anti-HER2 antibodies, trastuzumab, anti-CCR4 antibodies, mogamulizumab, anti-VEGF antibodies, bevacizumab, anti-VEGF receptor antibodies, soluble VEGF receptor fragments, anti-TWEAK antibodies, anti-TWEAK receptor antibodies, soluble TWEAK receptor fragments, AMG 706, AMG 386, antiproliferative drugs, farnesyl protein transferase inhibitors, αvβ3 inhibitors, αvβ5 inhibitors, p53 inhibitors, Kit receptor inhibitors, Ret receptor inhibitors, PDGFR inhibitors, growth hormone secretion inhibitors, angiopoietin inhibitors, tumor-infiltrating macrophage inhibitors, c-fms inhibitors, anti-c-fms antibodies, CSF-1 inhibitors, anti-CSF-1 antibodies, soluble c-fms fragments, pegvisomant, gemcitabine, panitumumab, irinotecan, and SN-38. The doses of drugs other than the anti-IGF-I receptor antibody to be combined can be those used in conventional treatments, but can be increased or decreased depending on the situation.
[0090] The therapeutic or prophylactic agent of the present invention can be administered parenterally for the purpose of alleviating symptoms. In the case of parenteral administration, for example, it can be a nasal preparation, and liquid preparations, suspensions, solid preparations, etc. can be selected. Another form of parenteral administration can be an injection, and examples of the injection include subcutaneous injections, intravenous injections, drip injections, intramuscular injections, intraventricular injections, and intraperitoneal injections. Other examples of preparations used for parenteral administration include suppositories, sublingual preparations, transdermal preparations, and transmucosal preparations other than nasal preparations. Furthermore, it can also be administered locally intravascularly by being contained in or applied to a stent or intravascular embolization agent.
[0091] The dosage of the therapeutic or prophylactic agent of the present invention varies depending on the patient's age, sex, weight, symptoms, therapeutic effect, administration method, treatment time, and the type of active ingredient contained in the pharmaceutical composition. However, the active ingredient is usually administered in a single dose of 0.1 mg to 1 g, preferably 0.5 mg to 300 mg, per adult, once every one to four weeks or once every one to two months. Therefore, it is preferably administered no more than once a week. However, the dosage and frequency of administration vary depending on various conditions, and therefore, a dosage and frequency less than the above-mentioned dosage and frequency may be sufficient, or a dosage and frequency greater than the above-mentioned range may be required.
[0092] [Use in Non-Human Animals] In certain embodiments of the present invention, the anti-IGF-I receptor antibodies of the present invention can be used for livestock or veterinary purposes in non-human animals. Animals in which the anti-IGF-I receptor antibodies of the present invention can be used for livestock or veterinary purposes are preferably non-human mammals, birds, reptiles, amphibians, or fish, more preferably non-human mammals or birds, and even more preferably animals selected from monkeys, rabbits, guinea pigs, cows, pigs, sheep, horses, and dogs. Currently, bovine growth hormone and porcine growth hormone are used to increase milk production in cows and promote the growth of piglets, and these effects are thought to be due to the action of IGF-I, the expression of which is induced by growth hormone (H. Jiang and X. Ge, Journal of Animal Science, Vol. 92, pp. 21-29, 2014). Therefore, by utilizing its agonistic activity, the anti-IGF-I receptor antibody of the present invention can similarly be used to enhance milk production in animals, promote the growth of fetuses and postnatal animals, and the like. Other examples of uses for which the anti-IGF-I receptor antibody of the present invention can be used include, but are not limited to, increasing muscle mass or the muscle to fat weight ratio in animals, efficiently converting ingested feed into body tissue, increasing reproductive efficiency and enhancing reproductive capacity for species preservation, and treating wasting symptoms in animals due to trauma or wasting diseases. Furthermore, by utilizing its antagonistic activity, which is another aspect, the anti-IGF-I receptor antibody of the present invention can also be used for treating malignant tumors in animals, controlling reproductive frequency, controlling individual growth, and other uses. When using the anti-IGF-I receptor antibody of the present invention, those skilled in the art can appropriately modify its structure before use, for example, by modifying the amino acid sequence of the antibody framework or constant region to suit the animal to be administered, thereby reducing immunogenicity.
[0093] [Cell Culture Method Using Anti-IGF-I Receptor Antibody] IGF-I or its derivatives are widely used in cell culture techniques for maintaining, growing, and / or differentiating vertebrate-derived cells in vitro, and are commercially available as cell culture reagents. Due to stability issues and other factors, the effectiveness of IGF-I may weaken over time during long-term culture, necessitating appropriate concentration adjustments and other measures to achieve stable cell culture. Furthermore, since IGF-I induces glucose uptake into cells, an increase in intracellular glucose concentration may induce changes in the metabolism or characteristics of cells, or a decrease in the glucose concentration in the medium may alter the culture environment. The anti-IGF-I receptor antibody of the present invention is characterized by its higher stability compared to IGF-I, its ability to induce cell proliferation over a longer period after contact with cells, its cell proliferation-inducing activity at lower concentrations than IGF-I, and its lack of induction of glucose uptake into cells. The anti-IGF-I receptor antibodies of the present invention can be used by adding an appropriate amount to the medium for cell culture, or by adsorbing or immobilizing them on a solid phase in a culture vessel, thereby reducing the amount used and effectively inducing cell proliferation of cells attached to the solid phase. The vertebrate-derived cells of the present invention are preferably cells derived from mammals, birds, reptiles, amphibians, or fish, more preferably cells derived from mammals or birds, and even more preferably cells derived from humans, monkeys, rabbits, guinea pigs, cattle, pigs, sheep, horses, or dogs. Primary cultured cells, established cell lines, or transformed cells of these cells, cells derived from genetically modified animals, and the like can also be used as the cells. Furthermore, organs and tissues derived from vertebrates or genetically modified animals thereof can also be cultured using the anti-IGF-I receptor antibodies of the present invention. The anti-IGF-I receptor antibodies of the present invention can be used in cell culture for substance production using cells, or in the culture process of cell therapy or regenerative medicine using the cells themselves.
[0094] Example 1: Preparation of Mouse Monoclonal Antibodies Mouse monoclonal antibodies can be prepared by the hybridoma method of Kohler et al. (Nature 256:495-497, 1975). IGF-I receptor agonist antibodies were prepared by immunizing mice with cells expressing the human IGF-I receptor and using standard hybridoma techniques. All animal experiments were performed in accordance with the institution's regulations. Standard methods were used to fuse spleen-derived cells harvested from mice with a mouse myeloma cell line (P3U1). Hybridomas were selected using a medium containing hypoxanthine, aminopterin, and thymidine. Using the hybridoma culture medium, binding was assessed by Cell ELISA using cells expressing the IGF-I receptor, and activation of the intracellular tyrosine kinase of the IGF-I receptor was assessed using PathHunter®, and wells containing positive hybridomas were selected. The hybridomas contained in these wells were single cloned by limiting dilution. These single cloned positive hybridomas were cultured in serum-free medium, and monoclonal antibodies were purified from the culture medium using a protein A column (Ab-Capcher, Proteinova). Using this monoclonal antibody, IGF11-16, an IGF-I receptor agonist antibody, was identified by assessing its activity in inhibiting human myoblast proliferation.
[0095] Example 2: Determination of antibody isotype To determine the antibody isotype of an IGF-I receptor agonist antibody, ELISA was performed using an antibody specific to the antibody isotype. Anti-mouse IgG antibody (TAGO, 6150) diluted 2000-fold with PBS was added to a 96-well plate (Nunc, MaxiSorp) at 50 μL / well and allowed to stand overnight at 4°C. The 96-well plate was replaced with 3% BSA / PBS for the ELISA. The IGF-I receptor agonist antibody was added to the 96-well plate on which the anti-mouse IgG antibody had been immobilized at 30 μL / well and allowed to react for 1.5 hours at room temperature. After washing with washing solution, antibodies specifically reacting with various mouse IgG isotypes, such as anti-mouse IgG1 antibody-ALP conjugate (SBA, 1070-04), anti-mouse IgG2a antibody-ALP conjugate (SBA, 1080-04), anti-mouse IgG2b antibody-ALP conjugate (SBA, 1090-04), and anti-mouse IgG3 antibody-ALP conjugate (SBA, 1100-04), were added at 30 μL / well and allowed to react at room temperature for 1 hour. Substrate (PNPP) was added at 100 μL / well, and the reaction was allowed to continue at room temperature for 45 minutes, after which the absorbance at 405-550 nm was calculated. The absorbance at 405-550 nm was evaluated as binding activity. Since IGF11-16 exhibits reactivity with anti-mouse IgG1 antibody, the isotype of the antibody was determined to be IgG1.
[0096] Example 3: Determination of antibody sequence SMARTer® RACE was performed to determine the gene sequences of the light and heavy chains of an IGF-I receptor agonist antibody. Fragments of the antibody heavy and light chain genes, including initiation and termination codons, were obtained from RNA derived from a hybridoma producing the antibody by SMARTer® RACE, and their nucleotide sequences were determined. First-strand cDNA was synthesized using the SMARTer® RACE 5' / 3' Kit (634859, Clontech) with the hybridoma-derived total RNA as a template, and the cDNA was then amplified by PCR. Using the cDNA as a template, PCR was performed using a primer for the universal sequence provided with the kit and primers specific to the heavy and light chains of the antibody, respectively. Primers for the mouse antibody light chain (kappa) were designed with reference to Accession No. BC080787, and for the mouse antibody IgG1, primers were designed with reference to Accession No. LT160966. The primer sequence for the mouse antibody light chain was ggtgaagttgatgtcttgtgagtgg, and the primer sequence for the mouse antibody heavy chain was gctcttctcagtatggtggttgtgtgc, and both were used in the experiment. The resulting PCR products were used for TA cloning as 5' RACE PCR products.
[0097] For TA cloning, 5' RACE PCR products were electrophoresed, and cDNA containing the desired molecular weight was purified using a QIAEX II Gel Extraction Kit (20021, Qiagen). The purified cDNA was reacted with TaKaRa-Taq (R001A, Takara) at 72°C for 5 minutes to add adenines to the 5' and 3' ends. The cDNA was then cloned into a Topoisomerase I-activated pCR II-TOPO vector (hereafter referred to as the TOPO vector) using a TOPO TA Cloning Kit (450641, Thermo Fisher Scientific) according to the attached protocol. The TOPO vector into which the cDNA of interest had been cloned was transformed into Escherichia coli TOP10, which was then cultured on an agar medium containing 50 μg / mL kanamycin. Insertion of the cDNA of interest into the TOPO vector was confirmed by colony PCR. The nucleotide sequence of the cloned cDNA was identified. Similarly, the nucleotide sequence of the 3' RACE PCR product was identified, and the full-length sequence of the antibody gene was determined. The full-length gene sequence of the light chain of IGF11-16 is shown in SEQ ID NO:27, the full-length amino acid sequence in SEQ ID NO:28, the full-length gene sequence of the heavy chain of IGF11-16 in SEQ ID NO:29, and the full-length amino acid sequence in SEQ ID NO:30. In addition, CDR-H1 of IGF11-16 is shown in SEQ ID NO: 3, CDR-H2 is shown in SEQ ID NO: 4, CDR-H3 is shown in SEQ ID NO: 5, CDR-L1 is shown in SEQ ID NO: 6, CDR-L2 is shown in SEQ ID NO: 7, CDR-L3 is shown in SEQ ID NO: 8, the heavy chain variable region is shown in SEQ ID NO: 9, and the light chain variable region is shown in SEQ ID NO: 10.
[0098] Example 4 Binding Activity to IGF-I Receptor (ELISA) To examine the binding activity of IGF-I receptor agonist antibodies to IGF-I receptors of humans (SEQ ID NO: 2, NP_000866), guinea pigs (SEQ ID NO: 11, XP_003475316), cynomolgus monkeys (SEQ ID NO: 12, NP_001248281), rabbits (SEQ ID NO: 13, XP_017193273), rats (SEQ ID NO: 14, NP_494694), and mice (SEQ ID NO: 15, NP_034643), cell ELISA was performed using cells expressing various IGF-I receptors.
[0099] P3U1 cells were transfected by lipofection with pEF1 expression vectors (Thermofisher) incorporating IGF-I receptor genes of human (SEQ ID NO: 16), guinea pig (SEQ ID NO: 17), cynomolgus monkey (SEQ ID NO: 18), rabbit (SEQ ID NO: 19), rat (SEQ ID NO: 20), and mouse (SEQ ID NO: 21). After lipofection, 0.8 × 10 P3U1 cells were cultured overnight or longer. 5 The cells were added to a 96-well plate (poly-D-lysine coated) at 1000 cells / well and fixed with 10% buffered formalin (Mildform® 10 NM, Wako). The cells were blocked with phosphate buffer containing 3% BSA and used for ELISA.
[0100] For ELISA, 30 μL of an IGF11-16 antibody solution prepared at 10 nM in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour and 30 minutes. The wells were washed twice with washing buffer. 30 μL of an anti-mouse IgG antibody-HRP conjugate solution prepared at various concentrations in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour. The wells were washed twice with washing buffer. 50 μL of substrate (TMB) was added to each well to initiate the reaction. After approximately 20 minutes, 50 μL of 0.5 M sulfuric acid was added to each well, and the absorbance at 450 and 550 nm was measured, and the absorbance at 450-550 nm was calculated. The binding activity was calculated by setting the absorbance at 450-550 nm for cells transfected with a vector not containing the IGF-I receptor gene (Mock cells, SEQ ID NO: 22) as 1 (Table 1).
[0101]
[0102] IGF11-16 increased the binding activity of cells expressing human, guinea pig, cynomolgus monkey, and rabbit IGF-I receptors by more than five times compared to mock cells. On the other hand, the binding activity of IGF11-16 to cells expressing rat and mouse IGF-I receptors was comparable to that of mock cells and did not increase. These results indicate that IGF11-16 binds to human, guinea pig, cynomolgus monkey, and rabbit IGF-I receptors, but not to rat and mouse IGF-I receptors.
[0103] Example 5 Binding Activity to Insulin Receptor (ELISA) To examine the binding activity of the IGF-I receptor agonist antibody to the insulin receptor, cell ELISA was performed using cells expressing the human insulin receptor.
[0104] HEK293T cells were transfected with the pEF1 expression vector (Thermofisher) incorporating the human insulin receptor gene by lipofection. After lipofection, 0.8 × 10 HEK293T cells were transfected. 5 The cells were added to a 96-well plate (poly-D-lysine coated) at 180 μL / well and fixed with 10% buffered formalin (Mildform® 10 NM, Wako). The cells were blocked with phosphate buffer containing 3% BSA and used for ELISA.
[0105] For ELISA, 30 μL of antibody solution prepared at various concentrations in 0.1% skim milk / 3% BSA / PBS was added to each well and allowed to react at room temperature for approximately 1 hour. The wells were washed twice with washing solution (Tween-containing Tris buffer). 30 μL of anti-mouse IgG antibody ALP conjugate solution prepared at various concentrations in 0.1% skim milk / 3% BSA / PBS was added to each well and allowed to react at room temperature for approximately 1 hour. The wells were washed twice with washing solution. 100 μL of substrate (PNPP) was added to each well to initiate the reaction. After approximately 30 minutes, absorbance was measured at 405 and 550 nm, and the absorbance at 405-550 nm was calculated. The binding activity was calculated by setting the absorbance at 405-550 nm to 1 for cells (mock cells, SEQ ID NO: 22) transfected with a vector lacking the IGF-I receptor gene and insulin receptor gene (Table 2).
[0106]
[0107] In an ELISA using immobilized cells expressing the human IGF-I receptor, 0.5 nM and 5 nM of IGF11-16 increased the absorbance at 405-550 nm by approximately 3-fold or more compared to mock cells. On the other hand, in an ELISA using immobilized cells expressing the human insulin receptor, 0.5 nM and 5 nM of IGF11-16 did not increase the absorbance at 405-550 nm by 1.5-fold or more. This indicates that IGF11-16 binds more strongly to the IGF-I receptor than to the insulin receptor.
[0108] Example 6 Analysis of IGF-I Receptor Binding Site (ELISA) In order to identify the epitope of an IGF-I receptor agonist antibody on the IGF-I receptor, the binding of the IGF-I receptor agonist antibody to mutants in which various domains of the IGF-I receptor were replaced with domains of the insulin receptor, which has a similar structure to the IGF-I receptor, was measured.
[0109] The following four substitution products were prepared: one in which the extracellular domain of the human IGF-I receptor (NP_000866) was replaced with the extracellular domain of the insulin receptor; and one in which the extracellular domain of the human insulin receptor (NP_000199) was replaced with the extracellular domain of the IGF-I receptor. (Substitution product 1) A substitution product in which the L1 and L2 domains of the human insulin receptor were replaced with those of the human IGF-I receptor, hIGFIR[L1-L2] / hINSR. (Substitution product 2) A substitution product in which the L1 and L2 domains of the human IGF-I receptor were replaced with those of the human insulin receptor, hINSR[L1-L2] / hIGFIR. (Substitution product 3) A substitution product in which the L1 domain of the human IGF-I receptor was replaced with the L1 domain of the human insulin receptor, hINSR[L1] / hIGFIR. (Substitution 4) hINSR[L2] / hIGFIR, a substitution product in which the L2 domain of the human IGF-I receptor is substituted with the L2 domain of the human insulin receptor.
[0110] P3U1 cells were transfected by lipofection with the pEF1 expression vector (Thermofisher) incorporating the genes of the above four substitution forms of human IGF-I receptor. The gene for hIGFIR[L1-L2] / hINSR (Substitution 1) is shown in SEQ ID NO: 23, the gene for hINSR[L1-L2] / hIGFIR (Substitution 2) is shown in SEQ ID NO: 24, the gene for hINSR[L1] / hIGFIR (Substitution 3) is shown in SEQ ID NO: 25, and the gene for hINSR[L2] / hIGFIR (Substitution 4) is shown in SEQ ID NO: 26. After lipofection, P3U1 cells were cultured overnight or longer and then transfected with 0.8 x 10 5 The cells were added to a 96-well plate (poly-D-lysine coated) at 1000 cells / well and fixed with 10% buffered formalin (Mildform® 10 NM, Wako). The cells were blocked with phosphate buffer containing 3% BSA and used for ELISA.
[0111] For ELISA, 30 μL of antibody solution prepared at 10 nM in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour and 30 minutes. The wells were washed twice with washing buffer. 30 μL of anti-mouse IgG antibody-HRP conjugate solution prepared at 5 nM in 0.1% skim milk / 3% BSA / PBS was added to each well and incubated at room temperature for approximately 1 hour. The wells were washed twice with washing buffer. The reaction was initiated by adding 50 μL of substrate (TMB) to each well. After approximately 20 minutes, the reaction was stopped by adding 50 μL of 0.5 M sulfuric acid. The absorbance at 450 and 550 nm was measured, and the absorbance at 450-550 nm was calculated. The binding activity was calculated by setting the absorbance at 450-550 nm relative to the absorbance at 450-550 nm relative to cells (mock cells) transfected with a vector not containing the gene for each substitution (Table 3).
[0112]
[0113] In an ELISA using immobilized cells expressing hIGFIR[L1-L2] / hINSR, hINSR[L1] / hIGFIR, and hINSR[L2] / hIGFIR, IGF11-16 increased the absorbance at 450-550 nm by more than five-fold compared to mock cells. On the other hand, the binding activity of IGF11-16 to cells expressing hINSR[L1-L2] / hIGFIR was weak. This indicates that IGF11-16 binds to the CR domain of the IGF-I receptor.
[0114] [Example 7] Determination of the epitope of IGF11-16 To identify the epitope in more detail from the CR domain, which is the epitope of IGF11-16, the binding sequence was deduced from the species differences in the binding of IGF11-16 to the IGF-I receptor. Figure 1 shows the amino acid sequences of the CR domain of the IGF-I receptor in each species.
[0115] IGF11-16 binds to the IGF-I receptors of humans, guinea pigs, and rabbits, but not to the IGF-I receptors of mice and rats. Based on this, among the amino acid sequences of the CR domain of the IGF-I receptor, an amino acid sequence common to humans, guinea pigs, and rabbits, but different from that of mice and rats, was predicted to be the epitope of IGF11-16.
[0116] To determine which amino acid in the CR domain of the IGF-I receptor IGF11-16 binds to, the binding to various amino acid substitutions in the CR domain was measured by ELISA.
[0117] Cell ELISA was performed using cells expressing an IGF-I receptor in which the amino acid sequence in the CR domain predicted to bind to IGF11-16 had been mutated.
[0118] The following three types of amino acid substitutions in the CR domain were used. In addition, wild-type human IGF-I receptor was used as a positive control, and wild-type rat IGF-I receptor inserted into the pEF1 expression vector (Thermofisher) was used as a negative control. The expression levels of the various IGF-I receptors were measured using the reactivity of the FLAG M2 antibody to the FLAG tag (AspTyrLysAspAspAspAspLys) added to the intracellular domain of the IGF-I receptor. (CR domain substitution 1) In the amino acid sequence of human IGF-I receptor (NP_000866, SEQ ID NO: 2), aspartic acid and alanine at positions 245 and 247 were substituted with asparagine and threonine, respectively. (CR domain substitution 2) In the amino acid sequence of human IGF-I receptor (NP_000866, SEQ ID NO: 2), glutamic acid at position 294 was substituted with aspartic acid. (CR domain substitution 3) In the amino acid sequence of human IGF-I receptor (NP_000866, SEQ ID NO: 2), glycine and serine at positions 315 and 316 were substituted with serine and threonine, respectively.
[0119] 9 × 10 HEK293T cells 6 The HEK293T cells were seeded at 0.8 × 10 cells / well on a poly-D-lysine-coated 10 cm dish. The following day, each plasmid DNA was introduced into the cells by lipofection. The following day, the HEK293T cells were detached using 0.25% trypsin / EDTA and suspended in culture medium. 0.8 × 10 HEK293T cells were seeded at 0.8 × 10 cells / well on a poly-D-lysine-coated 10 cm dish. The following day, each plasmid DNA was introduced into the cells by lipofection. The following day, the HEK293T cells were detached using 0.25% trypsin / EDTA and suspended in culture medium. 5 The cells were added to a 96-well plate (poly-D-lysine coated) at 1000 cells / well and incubated at 37°C, 5% CO 2The medium was removed from the 96-well plate and fixed with 10% buffered formalin (Mildform® 10 NM, Wako), and the medium was replaced with blocking buffer (3% BSA / PBS / sodium azide) before use in ELISA.
[0120] For ELISA, 50 μL of IGF11-16 antibody or FLAG M2 antibody solution prepared at 1 nM in 0.1% skim milk / 3% BSA / PBS was added to each well and allowed to react at room temperature for approximately 1 hour. The wells were then washed twice with washing buffer. 50 μL of anti-mouse IgG antibody-HRP conjugate solution prepared at various concentrations in 0.1% skim milk / 3% BSA / PBS was added to each well and allowed to react at room temperature for approximately 1 hour. The wells were then washed twice with washing buffer. 100 μL of substrate (TMB) was added to each well to initiate the reaction. After approximately 30 minutes, 100 μL of 0.5 M sulfuric acid was added to stop the reaction, and the absorbance at 450 nm was measured. The absorbance at 450 nm was evaluated as binding activity.
[0121] The results are shown in Figure 2. The reactivity of the FLAG M2 antibody to cells expressing each CR domain substitution was equivalent, and it was confirmed that the expression levels of each CR domain substitution were approximately the same. IGF11-16 increased the absorbance at 450 nm to 2 or more against the wild-type human IGF-I receptor, which does not have a mutation introduced into the CR domain, demonstrating enhanced binding activity. IGF11-16 increased the absorbance at 450 nm to 2 or more against CR domain substitutions 1 and 2, demonstrating enhanced binding activity. On the other hand, the absorbance at 450 nm of CR domain substitution 3 was approximately 1, which was similar to the absorbance of the negative control rat IGF-I receptor, and no binding was observed. These results demonstrate that the 315th and 316th amino acids of the IGF-I receptor are important for the binding activity of IGF11-16 to the CR domain of the IGF-I receptor.
[0122] From the above results, it was predicted that the binding site of IGF11-16 to the human IGF-I receptor is located near Gly (glycine) and Ser (serine) at positions 315 and 316. In general, the recognition sequence of an antibody is 8 amino acid residues (average of 6 to 10 residues), and based on the cross-reactivity of IGF11-16 (no binding to rat IGF-I receptor, binding to rabbit and human IGF-I receptors), the predicted sequence of the binding site of IGF11-16 to the human IGF-I receptor is ProSerGlyPheIleArgAsnGly. * Ser * GlnSerMet (Gly * Ser * indicates the amino acid sequence of the 315th and 316th amino acids).
[0123] [Example 8] Binding affinity to IGF-I receptor by surface plasmon resonance measurement To examine the binding properties (binding rate and dissociation rate) of drugs to IGF-I receptor, measurements were made by surface plasmon resonance (SPR).
[0124] An anti-His monoclonal antibody was immobilized on a CM3 (GE) sensor chip using an Amine Coupling Kit (BR-1000-50, GE) and a His Capture Kit (28-9950-56, GE). The immobilization conditions were NHS / EDC for 7 minutes, 50 μg / mL anti-His monoclonal antibody for 3 minutes, and Ethanolamine for 7 minutes, with a target of ≥3000 RU. Various concentrations of drugs were used as analytes. The ligand used was a recombinant human IGF-I receptor histidine tag (305-GR-050, R&D SYSTEMS, hereafter referred to as IGF-IR-His). The negative control used was Purified Mouse IgG2a, κ, Isotype Ctrl, Clone: MG2a-53 (401502, BioLegend, hereinafter referred to as ctrl IgG2a).
[0125] The sensor chip CM3 with immobilized anti-His monoclonal antibody was placed in a Biacore T200, the reaction temperature was set to 36°C, and a running buffer (HBS-EP+, BR-1006-69, GE) was run at a flow rate of 30 μL / min. The binding amount of the ligand was set to approximately 100 RU, and 0.5 to 2 × 10 IGF-IR-His was run. -8 10 nmol / L Ctrl IgG2a was added and allowed to capture the anti-His monoclonal antibody. 10 nmol / L Ctrl IgG2a was added for 1 minute, and HBS-EP+ was allowed to flow at a flow rate of 30 μL / min for 10 minutes or more. The analyte and HBS-EP+ were added to flow cells (1 and 2) and flow cells (3 and 4), respectively, and allowed to react.
[0126] The reaction conditions were set to a binding time of 600 seconds and a dissociation time of 600 seconds. After the reaction was completed, the reaction mixture was resuspended in renaturation buffer 1 (0.2% SDS), renaturation buffer 2 (100 mmol / L Tris-HCl (pH 8.5), 1 mol / L NaCl, 15 mmol / L MgCl 2 The column was washed with 10 mmol / L glycine-HCl (pH 1.5) and regeneration buffer 3 (10 mmol / L glycine-HCl (pH 1.5)) for 1 minute each at a flow rate of 30 μL / min. Analysis was performed using the 1:1 binding model using Biacore T200 Evaluation software (ver. 2.0), and the dissociation rate constant (ka, 1 / Ms), binding rate constant (kd, 1 / s), and dissociation constant (KD, M) were calculated. The results are shown in Table 4.
[0127]
[0128] The k a of IGF11-16 for the human IGF-I receptor was approximately 1 / 5 of that of IGF-I, and the binding rate was slow. On the other hand, the k d of IGF11-16 for the human IGF-I receptor was lower than the lower limit of measurement of the measurement instrument and lower than 1 / 1000 of that of IGF-I, indicating that the dissociation rate was very slow and that IGF11-16 was unlikely to dissociate once bound to the IGF-I receptor. The K D of IGF11-16 for the human IGF-I receptor was lower than 1 / 50 of that of IGF-I, indicating strong binding strength. It was shown that IGF11-16 has stronger binding activity to the IGF-I receptor than IGF-I.
[0129] Example 9 Activation of IGF-I Receptor or Insulin Receptor by PathHunter (registered trademark) To detect the activating effect of an IGF-I receptor agonist antibody on the IGF-I receptor, activation of downstream signals of the IGF-I receptor was measured using the PathHunter (registered trademark) IGF1R Functional Assay (DiscoverX).
[0130] A cell line was used in which the IGF-I receptor and the adaptor protein SHC1-Enzyme Acceptor (EA) fusion protein, which has an SH2 domain that binds to the intracellular tyrosine kinase of the IGF-I receptor, were forced to be expressed intracellularly. To detect the activating effect of an IGF-I receptor agonist antibody on the insulin receptor, the activation of downstream signals of the insulin receptor was measured using the PathHunter (registered trademark) INSR Functional Assay (DiscoverX). A cell line was used in which the insulin receptor and the adaptor protein PLCG1-EA fusion protein, which has an SH2 domain that binds to the intracellular tyrosine kinase of the insulin receptor, were forced to be expressed intracellularly. In these cell lines, ligand binding to the IGF-I receptor or insulin receptor induces receptor dimerization, followed by receptor phosphorylation, which recruits an adaptor protein containing an SH2 domain to form a receptor signaling complex, promoting the binding of spatially adjacent tyrosine kinases with EA, resulting in the reconstitution of active β-galactosidase. The effect of drugs on receptor tyrosine kinases can be identified by measuring the level of chemiluminescent signal from the substrate hydrolyzed by this β-galactosidase activity.
[0131] Cells expressing IGF-I receptor or insulin receptor were added to poly-D-lysine-coated or collagen-I-coated 96-well plates (Black / clear or White / clear) at 90 μL / well (2 × 10 4 cells / well or 5 x 10 3 cells / well) and incubated at 37°C, 5% CO 2 The next day, 10 μL / well of each drug was added, and the plates were incubated at 37°C, 5% CO 2 The following day, 30 μL of the culture supernatant was taken, 15 μL of substrate solution was added, and the reaction was allowed to proceed for 60 minutes, after which the luminescence signal was measured using a luminometer (Tristar, Berthold). The activation of the IGF-I receptor was calculated by setting the activity in the group treated with the solvent alone as 100%. The results are shown in Table 5.
[0132]
[0133] The activation of insulin receptors was calculated by setting the activity in the group treated with the solvent alone as 100%. The results are shown in Table 6.
[0134]
[0135] The activation of IGF-I receptors by drugs was measured using cell lines expressing IGF-I receptors. In the cell lines expressing IGF-I receptors, IGF-I and IGF11-16 showed IGF-I receptor activation effects compared to the control.
[0136] Using a cell line expressing the insulin receptor, we measured the insulin receptor activation by drugs. The cell line expressing the insulin receptor showed insulin-induced insulin receptor activation. Furthermore, IGF-I activated the insulin receptor in a concentration-dependent manner, and at 50 nM, it showed significant activation. On the other hand, IGF11-16 did not activate the insulin receptor.
[0137] IGF-I is known to be reactive to insulin receptors. Activation of insulin receptors is also known to induce hypoglycemic effects. IGF11-16 has been shown to act specifically on IGF-I receptors and not to have insulin receptor-mediated hypoglycemic effects.
[0138] Example 10 Cell proliferation activity in human myoblasts To examine the proliferation activity of IGF-I receptor agonist antibodies on human myoblasts, the drug was added to human myoblasts, and the amount of intracellular ATP was measured after 4 days.
[0139] Normal human skeletal muscle myoblast cells (HSMM, Lonza) were cultured in SkBM-2 (Lonza, CC-3246) medium containing 1% BSA at 0.1 mL / well (2 × 10 cells) in a 96-well plate (coated with collagen type I). 3 cells / well) and incubated at 37°C, 5% CO 2The day after cell seeding, various drugs were added at 25 μL / well, and the plates were incubated at 37°C, 5% CO 2 The plates were incubated for 4 days under these conditions. The amount of intracellular ATP, as an indicator of cell proliferation, was measured using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega). After 4 days of incubation, the supernatant was removed from the 96-well plate so that the culture medium was 50 μL per well, and the plate was left to stand at room temperature for 30 minutes or more. CellTiter-Glo® reagent was added at 50 μL per well, and the plate was allowed to react for 10 minutes or more, after which the luminescence signal was measured using a luminometer (Tristar, Berthold). Activity in the group receiving only the solvent was calculated as 100%. The results are shown in Table 7.
[0140]
[0141] IGF-I and IGF11-16 enhanced cell proliferation activity compared to the control antibody (FLAG M2, Sigma-Aldrich).
[0142] IGF11-16 at concentrations of 0.00005, 0.0005, 0.005, 0.05, 0.5, 5, 50, and 500 nM enhanced the proliferation activity of human myoblasts in a concentration-dependent manner. 50 were 0.004 nM and 0.61 nM, respectively, and IGF11-16 showed activity 100 times stronger than that of IGF11-16.
[0143] The 16-13 antibody and 26-3 antibody described in Non-Patent Document 35 did not show significant cell proliferation activity compared to the solvent control (containing sodium azide), and the activity was weaker than that of IGF11-16.
[0144] Example 11 Cell proliferation activity in guinea pig myoblasts Guinea pig myoblasts (Cell Applications) were cultured in SkBM-2 (Lonza, CC-3246) medium containing 1% BSA at 0.1 mL / well (4 x 10 3cells / well) and incubated at 37°C, 5% CO 2 The day after cell seeding, various drugs were added at 25 μL / well, and the plates were incubated at 37°C, 5% CO 2 The plates were incubated for 4 days under these conditions. The amount of intracellular ATP, as an indicator of cell proliferation, was measured using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega). After incubation for 4 days, the supernatant was removed from the 96-well plate so that the culture medium was 50 μL per well, and the plate was left to stand at room temperature for 30 minutes or more. CellTiter-Glo® reagent was added at 50 μL per well, and the plate was allowed to react for 10 minutes or more, after which the luminescence signal was measured using a luminometer (Tristar, Berthold).
[0145] IGF11-16 at concentrations of 0.00005, 0.0005, 0.005, 0.05, 0.5, 5, 50, and 500 nM enhanced the proliferation activity of guinea pig myoblasts in a concentration-dependent manner. 50 were 0.004 nM and 0.76 nM, respectively, and IGF11-16 showed activity more than 100 times stronger.
[0146] Example 12 In Vitro Comparison of Durability of Action with IGF-I To compare the durability of action of IGF11-16 with that of IGF-I, the medium was changed 18 hours after the addition of IGF11-16 or IGF-I, and the proliferation activity of human myoblasts was measured under conditions in which IGF11-16 and IGF-I were removed.
[0147] Normal human skeletal muscle myoblast cells (HSMM, Lonza) were cultured in SkBM-2 (Lonza, CC-3246) medium containing 1% BSA at 0.1 mL / well (2 × 10 cells) in a 96-well plate (coated with collagen type I). 3 cells / well) and incubated at 37°C, 5% CO 2The day after cell seeding, IGF11-16 or IGF-I was added at 25 μL / well, and 18 hours after addition, the medium was replaced with medium containing or without IGF11-16 or IGF-I. 2 The plates were incubated for 4 days under these conditions. The amount of intracellular ATP, as an indicator of cell proliferation, was measured using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega). After incubation for 4 days, the supernatant was removed from the 96-well plate so that the culture medium was 50 μL per well, and the plate was left to stand at room temperature for 30 minutes or more. CellTiter-Glo® reagent was added at 50 μL per well, and the plate was allowed to react for 10 minutes or more, after which the luminescence signal was measured using a luminometer (Tristar, Berthold). The cell proliferation activity was calculated as a percentage of the control group to which only solvent was added (control group, 0%). The results are shown in Figure 3.
[0148] In the group to which 1 nM and 5 nM IGF-I were added for 4 days, the cell proliferation activity increased to 39% and 75%, respectively. In the group to which 1 nM and 5 nM IGF-I were added for 18 hours and then washed out, the cell proliferation activity was 8% and 10%, respectively, which was less than 1 / 5 of the activity in the group to which IGF-I was added for 4 days, showing a marked decrease in the effect.
[0149] In the group to which 0.5 nM IGF11-16 was added for 4 days, cell proliferation activity increased to 49%. In the group to which 0.5 nM IGF11-16 was added for 18 hours and then washed out, cell proliferation activity was 30%, which was more than 60% of the activity in the group to which IGF11-16 was added for 4 days.
[0150] When the cell proliferation activity of the 0.5 nM IGF11-16 treatment group and the 1 nM and 5 nM IGF-I treatment groups, which were washed out after drug addition, was compared, IGF11-16 showed statistically significantly stronger activity. These results indicate that IGF11-16 maintains the proliferation activity of human myoblasts even after drug washout and has a stronger effect than IGF-I. Since IGF11-16 maintained cell proliferation activity even after washout, it was shown that, unlike the action of IGF-I, IGF11-16 binds strongly to the IGF-I receptor and has a sustained activation effect on the IGF-I receptor.
[0151] Example 13 Glucose uptake in human differentiated muscle cells To investigate the glucose uptake effect of IGF11-16, the amount of radiolabeled 3H-2-deoxyglucose uptake was measured using human differentiated muscle cells and compared with the effect of IGF-I.
[0152] Normal human skeletal muscle myoblast cells (HSMM, Lonza) were cultured in a 24-well plate (Costar, 3526) at 0.5 mL / well (2 × 10 4 cells / well) and incubated at 37°C, 5% CO 2 The medium (SkBM-2 (Lonza, CC-3246) supplemented with FBS (Lonza, CC-4423W), L-Glutamine (Lonza, CC-4422W), Dexamethasone (Lonza, CC-4421W), rhEGF (Lonza, CC-4420W), and GA-1000 (Lonza, CC-4419W)) was replaced until the cells reached confluence. Confluent HSMM cells were cultured in 0.5 mL / well of differentiation medium (DMEM / F12 (1:1) (Gibco, 11320) containing 2% Horse Serum (Sigma, H1270), 50 U / mL Penicillin, and 50 μg / mL Streptomycin (Gibco, 15070-063)). The cells were then cultured at 37°C and 5% CO. 2The cells were incubated at 4°C for 6 days to initiate differentiation into muscle cells. After about 6 days from the start of differentiation, the cells were used as human differentiated muscle cells for glucose uptake experiments.
[0153] The differentiated human muscle cells were cultured in 0.5 mL / well of starvation medium (1 g / L glucose-containing DMEM (Gibco, 11885) containing 0.1% BSA Fatty Acid-free (Seikagaku Corporation, 82-002-5), 50 U / mL Penicillin, and 50 μg / mL Streptomycin (Gibco, 15070-063)) at 37°C and 5% CO. 2 The next day, the medium was replaced with 0.5 mL / well of starvation medium and incubated at 37°C, 5% CO 2 After washing the wells with 1 mL / well of PBS, 0.5 mL / well of treatment medium containing various drugs was added, and the wells were incubated at 37°C, 5% CO 2 The treatment medium was a glucose uptake buffer (20 mmol / L HEPES (DOJINDO, 342-01375), 150 mmol / L NaCl (SIGMA, S5150), 5 mmol / L KCl (Wako, 163-03545), 5 mmol / L MgSO4 (Wako, 131-00405), 1.2 mmol / L KH 2 P.O. 4 (Wako, 169-04245), 25 mmol / L CaCl 2The cells were prepared using 100% glycerol (Fluka, 21114) and 2 mmol / L pyruvate (Wako, 190-14881) dissolved in water for injection and adjusted to pH 7.4 with NaOH to a final concentration of 0.1 mmol / L glucose, 0.1% BSA, 3H-2-Deoxyglucose (1 uCi / mL), and various concentrations of human recombinant IGF-I or IGF-I receptor agonist antibody. Glucose uptake was terminated by adding 1 mL / well of chilled PBS to the wells and washing three times. Cells were lysed by adding 0.25 mL / well of 1N NaOH to the wells. The entire cell lysate was added to a vial containing 3 mL of liquid scintillator ULTIMA GOLD (PerkinElmer Japan) and mixed. The radioactivity (DPM) of 3H was measured for 3 minutes using a liquid scintillation counter. The glucose uptake rate of the treated group was calculated by setting the mean glucose uptake (DPM) of the untreated group (control group) as 100%. The results are shown in Figure 4.
[0154] IGF-I at 0.8, 4, 20, and 100 nM significantly and concentration-dependently enhanced glucose uptake. On the other hand, IGF11-16 showed no significant effect up to 100 nM. These results suggest that IGF11-16 has an extremely weak effect on glucose uptake in differentiated human muscle cells.
[0155] Example 14 In vivo efficacy (muscle mass increasing effect in guinea pigs) To confirm the efficacy of the IGF-I receptor agonist antibody in vivo, IGF11-16 was administered once to guinea pigs, and the muscle mass was measured two weeks later and compared with the effect of continuous administration of IGF-I. The muscle mass increasing effect is defined as an increase in muscle weight of guinea pigs by 5% or more compared to the control group.
[0156] IGF11-16 (0.03, 0.1, or 0.3 mg / kg) was administered subcutaneously or intravenously in a single dose to normal guinea pigs. As a positive control, human recombinant IGF-I (mecasermin) was implanted subcutaneously using an osmotic pump (Alzet) and continuously administered at 1 mg / kg / day. Two weeks after drug administration, the guinea pigs were sacrificed by exsanguination under anesthesia, and the weight of the extensor digitorum longus muscle was measured. The results are shown in Figure 5.
[0157] The groups receiving intravenous administration of IGF11-16 at 0.03, 0.1, and 0.3 mg / kg (iv) showed a dose-dependent and significant increase in muscle mass compared to the vehicle-treated control group. The group receiving subcutaneous administration of IGF11-16 at 0.3 mg / kg (sc) also showed a significant increase in muscle mass compared to the control group.
[0158] The amount of muscle mass increased in the group receiving a single dose of IGF11-16 at 0.03 to 0.3 mg / kg was comparable to that in the group receiving continuous infusion of human recombinant IGF-I at 1 mg / kg / day (infusion). This indicates that IGF11-16 has a pharmacological effect in vivo when administered intravenously or subcutaneously in a single dose.
[0159] It has been shown that a single administration of IGF11-16 has the same efficacy as continuous administration of IGF-I. The clinical dosage of IGF-I (mecasermin) is once to twice daily. On the other hand, in vivo, IGF11-16 showed efficacy equivalent to continuous administration of IGF-I when administered once every two weeks, demonstrating superior sustained efficacy compared to IGF-I.
[0160] Example 15 In vivo Blood Glucose-Reducing Effect (Blood Glucose-Reducing Effect in Guinea Pigs) To confirm whether an IGF-I receptor agonist antibody has a blood glucose-reducing effect in vivo, IGF11-16 was administered in a single dose to guinea pigs, blood glucose levels were measured over time, and the blood glucose-reducing effect was compared with that of a single administration of IGF-I. The blood glucose-reducing effect is defined as the effect of reducing blood glucose levels to 50 mg / dL or less, or causing hypoglycemic symptoms.
[0161] IGF-I was administered subcutaneously in a single dose to guinea pigs to examine its blood glucose lowering effect. The guinea pigs were fasted for 12 hours, and human recombinant IGF-I (mecasermin) was administered subcutaneously in a single dose of 0.3, 1, 3, or 10 mg / kg. The guinea pigs were fasted until 24 hours after administration. Blood samples were taken from awake guinea pigs before administration (0 hours), and 1, 2, 4, 8, 10, and 24 hours after administration, and blood glucose levels were measured using a Glutest Sensor (Sanwa Kagaku Kenkyusho). The results are shown in Figure 6.
[0162] IGF-I showed a significant blood glucose lowering effect from 0.3 mg / kg onwards, hypoglycemic symptoms were observed at 1 mg / kg or more, and fatal cases were observed at 3 mg / kg or more.
[0163] IGF11-16 was administered subcutaneously in a single dose to guinea pigs to examine its blood glucose lowering effect. The guinea pigs were fasted for 12 hours, and then IGF11-16 was administered subcutaneously in a single dose of 10, 30, or 100 mg / kg. The guinea pigs were fasted until 24 hours after administration. Blood samples were taken from awake guinea pigs before administration (0 hours), and 2, 4, 8, 10, and 24 hours after administration, and blood glucose levels were measured using a Glutest Sensor (Sanwa Kagaku Kenkyusho). The results are shown in Figure 7.
[0164] Compared to the control group administered only the vehicle, there was no significant difference in blood glucose levels even in the 100 mg / kg IGF11-16 administration group, indicating that subcutaneous administration of IGF11-16 does not have a blood glucose-lowering effect and does not affect blood glucose levels.
[0165] IGF11-16 was administered intravenously once to guinea pigs to examine its blood glucose lowering effect. The guinea pigs were fasted for 12 hours, and then IGF11-16 was administered intravenously at 0.1, 1.5, 6, and 20 mg / kg. The guinea pigs were fasted until 24 hours after administration. Blood samples were taken from awake guinea pigs before administration (0 hours), and 0.5, 1, 2, 4, 8, and 24 hours after administration, and blood glucose levels were measured using a Glutest Sensor (Sanwa Kagaku Kenkyusho). The results are shown in Figure 8.
[0166] IGF11-16 did not show a significant difference in blood glucose levels, even in the 20 mg / kg group, compared to the control group administered only the vehicle. This indicates that IGF11-16 does not have a blood glucose-lowering effect and does not affect blood glucose levels, even when administered intravenously.
[0167] IGF11-16 does not have the significant blood glucose lowering effect of IGF-I, whether administered subcutaneously or intravenously, and does not affect blood glucose levels, demonstrating its potential as a drug that overcomes the hypoglycemia, a side effect of IGF-I.
[0168] Example 16: In vivo efficacy (growth-promoting effect in guinea pigs) To confirm the efficacy of an IGF-I receptor agonist antibody on bone in vivo, the effects were compared with those of continuous administration of IGF-I and repeated daily administration of growth hormone (GH). A single dose of IGF11-16 was administered to hypophysectomized guinea pigs, and tibia length and growth plate cartilage thickness were measured two weeks later as indicators of growth-promoting effect. IGF11-16 (0.3 mg / kg and 1 mg / kg) was administered subcutaneously once to hypophysectomized guinea pigs. As a comparative control, human recombinant IGF-I (mecasermin) was implanted subcutaneously using an osmotic pump (Alzet) and continuously administered at 1 mg / kg / day. As another comparative control, human recombinant GH (Genotropin®) was administered subcutaneously at a dose of 1 mg / kg, once daily. Two weeks after the drug administration, the guinea pigs were sacrificed by exsanguination under anesthesia, and the thickness of the growth plate cartilage at the proximal tibia and the length of the tibia were measured. The results are shown in Figures 9 and 10.
[0169] The groups receiving subcutaneous administration of IGF11-16 at 0.3 mg / kg and 1 mg / kg (IGF11-16) showed dose-dependent and significant increases in growth plate cartilage thickness and tibia length compared to the control group (vehicle) in which hypophysectomized guinea pigs were treated with only the solvent, demonstrating a growth-promoting effect. The growth-promoting effect of the group receiving a single dose of IGF11-16 at 0.3 mg / kg was comparable to that of the group receiving continuous administration of human recombinant IGF-I at 1 mg / kg / day (IGF-I). Furthermore, the growth-promoting effect of the group receiving a single dose of IGF11-16 at 1 mg / kg was comparable to that of the group receiving repeated administration of human recombinant GH at 1 mg / kg / day (GH). These results demonstrate that a single administration of IGF11-16 has pharmacological effects equivalent to those of continuous administration of IGF-I and repeated daily administration of GH. The clinical dosage regimens for human recombinant IGF-I (mecasermin) and human recombinant GH (Genotropin (registered trademark)) are subcutaneous injections once to twice daily and six to seven times weekly, respectively. On the other hand, in vivo, IGF11-16, when administered once every two weeks, exhibited efficacy equivalent to continuous administration of IGF-I and repeated administration of GH once daily, demonstrating that it has superior sustained efficacy compared to IGF-I and GH.
[0170] Example 17 Blood Dynamics of IGF-I and IGF11-16 Blood Dynamics of IGF-I Guinea pigs were fasted for 12 hours, and human recombinant IGF-I was administered subcutaneously at 0.3, 1, 3, and 10 mg / kg. The guinea pigs were fasted until 24 hours after administration. Blood was collected from awake guinea pigs before administration (0 hour), and 1, 2, 4, 8, 10, and 24 hours after administration, and the plasma human IGF-I concentration was measured by ELISA (DG100, R&D). The results are shown in Figure 11.
[0171] Plasma IGF-I concentrations increased dose-dependently, and 24 hours after administration, plasma IGF-I concentrations had decreased to approximately 50% of their peak levels. The IGF-I concentrations in the 0.3 mg / kg group 24 hours after administration were below the lower limit of measurable levels. Plasma could not be collected from the 10 mg / kg group because the animals died of hypoglycemia 4 hours after administration.
[0172] Blood kinetics of IGF11-16: Guinea pigs were fasted for 12 hours, and an IGF-I receptor agonist antibody was subcutaneously administered at 0.3, 1, 3, 10, 30, and 100 mg / kg. The guinea pigs were fasted until 24 hours after administration and then refed 24 hours later. Blood was collected from awake guinea pigs before administration (0 hour) and 2, 4, 8, 10, 24, 48, and 72 hours after administration, and plasma IGF11-16 concentrations were measured by ELISA. The results are shown in Figure 12. Plasma IGF11-16 concentrations increased dose-dependently, and even 48 hours after administration, plasma IGF11-16 concentrations remained at approximately 50% or more of those at 24 hours after administration. The blood kinetics of IGF11-16 were shown to be more sustained than those of IGF-I.
[0173] The present invention can provide antibodies that specifically bind to the IGF-I receptor of a vertebrate, increase muscle mass or the thickness of growth plate cartilage via the IGF-I receptor, and do not lower blood glucose levels. Therefore, the present invention can be used for the treatment, prevention, or diagnosis of diseases related to anti-IGF-I receptor antibodies.
Claims
1. An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof, which specifically binds to the IGF-I receptor of vertebrates and has an activity of inducing the proliferation of vertebrate-derived cells.
2. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to claim 1, wherein the activity of inducing the proliferation of vertebrate-derived cells is equal to or greater than that of native IGF-I.
3. The EC 50 value of the activity of inducing the proliferation of vertebrate-derived cells in vitro is 1 / 20 or less with respect to native IGF-I. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to claim 1 or 2.
4. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 1 to 3, wherein the persistence of the proliferation-inducing action on the cultured cells with respect to the contact time with the cultured cells when contacted with vertebrate-derived cells under culture is improved as compared with native IGF-I.
5. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 2 to 4, wherein the native IGF-I is human IGF-I having the amino acid sequence set forth in SEQ ID NO:
1.
6. The EC 50 value of the activity of inducing the proliferation of vertebrate-derived cells in vitro is 0.1 nmol / L or less. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 1 to 5.
7. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 1 to 6, which has an activity of inducing an increase in muscle mass and / or body length of the vertebrate when administered parenterally to the vertebrate.
8. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 1 to 7, which is administered to a vertebrate at a frequency of once or less per week.
9. The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to any one of claims 1 to 8, wherein the vertebrate is a human or a non-human animal including a guinea pig, a monkey, a rabbit, a cow, a pig, a horse, a sheep, a dog or a chicken, or further a non-human animal expressing a human IGF-I receptor.
10. The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to any one of claims 1 to 9, which does not induce glucose uptake in differentiated muscle cells at a dose that induces proliferation of vertebrate-derived cells.
11. The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to claim 10, which does not induce glucose uptake in differentiated muscle cells even at a dose 100 times or more the EC 50 value that shows the proliferation-inducing activity of vertebrate-derived cells in vitro.
12. The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to claim 10 or 11, wherein the vertebrate-derived cells are myoblasts derived from a human or a non-human mammal.
13. The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to any one of claims 7 to 12, which is parenterally administered to a vertebrate and does not decrease the blood glucose level of the vertebrate at a dose that induces an increase in muscle mass and / or body length of the vertebrate.
14. The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to claim 13, which does not change the blood glucose level of the vertebrate even at a dose 10 times or more the effective dose that induces an increase in muscle mass and / or body length of the vertebrate when parenterally administered to the vertebrate.
15. The anti-IGF-I receptor antibody or fragment thereof, or derivative thereof according to any one of claims 1 to 14, which binds to the CR domain of the IGF-I receptor.
16. An anti-IGF-I receptor antibody or fragment thereof, or derivative thereof, which binds to the CR domain of the IGF-I receptor and inhibits the binding of IGF-I or IGF-II to the IGF-I receptor.
17. An anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to claim 15 or 16, which binds to an epitope containing ProSerGlyPheIleArgAsnX (where X is Gly or Ser, and X is Ser or Thr) or in the vicinity thereof in the sequence of the CR domain of the IGF-I receptor. 1 X 2 GlnSerMet (where X 1 is Gly or Ser, and X 2 is Ser or Thr) or in the vicinity thereof.
18. An anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to claim 17, which binds to an epitope containing ProSerGlyPheIleArgAsnGlySerGlnSerMet or in the vicinity thereof in the sequence of the CR domain of the IGF-I receptor.
19. An anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to any one of claims 1 to 18, which has cross-reactivity with the IGF-I receptor of a non-human animal including a human, or a guinea pig, monkey, rabbit, cow, pig, horse, sheep, dog or chicken.
20. The antigen-antibody reaction of the anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof has an affinity strength with a dissociation equilibrium constant (KD) of 1×10 -8 M or less. An anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to any one of claims 1 to 19.
21. An anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to any one of claims 16 to 20, wherein the anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof has at least one of the characteristics 1) to 4). 1) It has the activity of inducing the proliferation of cells derived from vertebrates. 2) It has the activity of inducing an increase in muscle mass and / or body length of the vertebrate by parenteral administration to the vertebrate. 3) It does not induce glucose uptake in differentiated muscle cells at a dose that induces the proliferation of cells derived from vertebrates. 4) When parenterally administered to a vertebrate, it does not change the blood glucose level of the vertebrate at a dose that induces an increase in muscle mass and / or body length of the vertebrate.
22. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 16 to 21, wherein the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof has at least one of the characteristics of 1) to 4). 1) Inhibits the proliferation of vertebrate-derived cells by IGF-I. 2) By parenterally administering to a vertebrate, suppresses cell proliferation in a cell proliferative disease caused by IGF-I in the vertebrate. 3) Does not affect glucose uptake in differentiated muscle cells at a dose that inhibits the proliferation of vertebrate-derived cells by IGF-I. 4) When parenterally administered to a vertebrate and at a dose that suppresses cell proliferation in a cell proliferative disease caused by IGF-I in the vertebrate, does not change the blood glucose level of the vertebrate.
23. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 1 to 22, wherein the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof is a Fab, scFv, diabody or bispecific antibody, or a derivative thereof.
24. An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 1 to 23, comprising an amino acid sequence in which one amino acid residue at any one position of SEQ ID NO: 3 or SEQ ID NO: 3 is substituted, deleted, or inserted as the CDR-1 (CDR-H1) sequence of the heavy chain variable region; an amino acid sequence in which one or two amino acid residues at any one position of SEQ ID NO: 4 or SEQ ID NO: 4 are substituted, deleted, or inserted as the CDR-2 (CDR-H2) sequence of the heavy chain variable region; an amino acid sequence in which one or two amino acid residues at any one position of SEQ ID NO: 5 or SEQ ID NO: 5 are substituted, deleted, or inserted as the CDR-3 (CDR-H3) sequence of the heavy chain variable region; an amino acid sequence in which one or two amino acid residues at any one position of SEQ ID NO: 6 or SEQ ID NO: 6 are substituted, deleted, or inserted as the CDR-1 (CDR-L1) sequence of the light chain variable region; an amino acid sequence in which one amino acid residue at any one position of SEQ ID NO: 7 or SEQ ID NO: 7 is substituted, deleted, or inserted as the CDR-2 (CDR-L2) sequence of the light chain variable region; and an amino acid sequence in which one or two amino acid residues at any one position of SEQ ID NO: 8 or SEQ ID NO: 8 are substituted, deleted, or inserted as the CDR-3 (CDR-L3) sequence of the light chain variable region.
25. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to claim 24, further comprising a framework sequence of an immunoglobulin.
26. The anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to claim 25, wherein the framework sequence of the immunoglobulin is a framework sequence in each class of immunoglobulins of non-human animals including humans, or guinea pigs, monkeys, rabbits, cows, pigs, horses, sheep, dogs, chickens, mice or rats.
27. An anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 1 to 26, comprising an amino acid sequence having the amino acid sequence of SEQ ID NO: 9 or having 90% or more homology with SEQ ID NO: 9 as the heavy chain variable region, and an amino acid sequence having the amino acid sequence of SEQ ID NO: 10 or having 90% or more homology with SEQ ID NO: 10 as the light chain variable region.
28. An anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to any one of claims 1 to 27, further comprising a constant region in each class of immunoglobulins of a non-human animal including a human, guinea pig, monkey, rabbit, cow, pig, horse, sheep, dog, chicken, mouse or rat.
29. A nucleic acid molecule consisting of a polynucleotide sequence encoding an anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to any one of claims 1 to 28.
30. A cloning vector or expression vector comprising at least one nucleic acid molecule according to claim 29.
31. A recombinant cell into which the vector according to claim 30 has been introduced into a host cell.
32. A method for producing an anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to any one of claims 1 to 28, comprising culturing the recombinant cell according to claim 31 and purifying the anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof produced from the recombinant cell.
33. A pharmaceutical composition comprising an anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to any one of claims 1 to 28, the nucleic acid molecule according to claim 29, the vector according to claim 30, or the recombinant cell according to claim 31.
34. A pharmaceutical composition according to claim 33, further comprising an active ingredient other than an anti-IGF-I receptor antibody or fragment thereof, or a derivative thereof according to any one of claims 1 to 28, the nucleic acid molecule according to claim 29, the vector according to claim 30, or the recombinant cell according to claim 31.
35. The pharmaceutical composition according to claim 34, wherein the active ingredient is selected from one or more of growth hormone or an analog thereof, insulin or an analog thereof, IGF-II or an analog thereof, an anti-myostatin antibody, a myostatin antagonist, an anti-activin type IIB receptor antibody, an activin IIB receptor antagonist, a soluble activin type IIB receptor or an analog thereof, ghrelin or an analog thereof, follistatin or an analog thereof, a beta2 agonist, and a selective androgen receptor modulator.
36. The pharmaceutical composition according to claim 34 or 35, comprising a component selected from the group consisting of corticosteroids, antiemetics, ondansetron hydrochloride, granisetron hydrochloride, metoclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, tropisetron, cancer vaccines, GM-CSF inhibitors, GM-CSF DNA vaccines, cell-based vaccines, dendritic cell vaccines, recombinant virus vaccines, heat shock protein (HSP) vaccines, allogeneic tumor vaccines, autologous tumor vaccines, analgesics, ibuprofen, naproxen, choline magnesium trisalicylate, oxycodone hydrochloride, antiangiogenic agents, antithrombotic agents, anti-PD-1 antibodies, nivolumab, pembrolizumab, anti-PD-L1 antibodies, atezolizumab, anti-CTLA4 antibodies, ipilimumab, anti-CD20 antibodies, rituximab, anti-HER2 antibodies, trastuzumab, anti-CCR4 antibodies, mogamulizumab, anti-VEGF antibodies, bevacizumab, anti-VEGF receptor antibodies, soluble VEGF receptor fragments, anti-TWEAK antibodies, anti-TWEAK receptor antibodies, soluble TWEAK receptor fragments, AMG 706, AMG 386, antiproliferative agents, farnesyl protein transferase inhibitors, αvβ3 inhibitors, αvβ5 inhibitors, p53 inhibitors, Kit receptor inhibitors, ret receptor inhibitors, PDGFR inhibitors, growth hormone secretion inhibitors, angiopoietin inhibitors, tumor-infiltrating macrophage inhibitors, c-fms inhibitors, anti-c-fms antibodies, CSF-1 inhibitors, anti-CSF-1 antibodies, soluble c-fms fragments, pegvisomant, gemcitabine, panitumumab, irinotecan, and SN-38.
37. A medicament for the treatment or prevention of a condition related to IGF-I, comprising any one or more of the anti-IGF-I receptor antibodies or fragments thereof, or derivatives thereof according to claims 1 to 28, the nucleic acid molecule according to claim 29, the vector according to claim 30, and the recombinant cell according to claim 31.
38. The medicament according to claim 37, wherein the IGF-I related condition is selected from disuse muscle atrophy, short stature, diabetic nephropathy, chronic renal failure, Laron syndrome, liver cirrhosis, liver fibrosis, aging, intrauterine growth retardation (IUGR), neurological diseases, stroke, spinal cord injury, cardiovascular protection, diabetes, insulin resistance, metabolic syndrome, osteoporosis, cystic fibrosis, wound healing, myotonic dystrophy, AIDS wasting, HIV-associated lipodystrophy syndrome, burns, Crohn's disease, Werner syndrome, X-linked combined immunodeficiency, hearing loss, anorexia nervosa, retinopathy of prematurity, Turner syndrome, Prader-Willi syndrome, Silver-Russell syndrome, idiopathic short stature, obesity, multiple sclerosis, fibromyalgia, ulcerative colitis, low muscle mass, myocardial ischemia and low bone density.
39. The medicament according to claim 37 or 38, which is administered parenterally.
40. The medicament according to any one of claims 37 to 39, which is a veterinary medicament administered to non-human animals.
41. The veterinary medicament according to claim 40, wherein the veterinary medicament is administered for the purpose of increasing muscle mass and / or body length, promoting growth, increasing milk production, promoting reproduction, or preventing aging.
42. The veterinary medicament according to claim 40 or 41, wherein the non-human animal is a guinea pig, a monkey, a rabbit, a cow, a pig, a horse, a sheep, a dog, or a chicken.
43. The medicament according to any one of claims 37 to 42, which is used for the treatment or prevention of diseases caused by the action of IGF-I or IGF-II on the IGF-I receptor.
44. The medicament according to claim 43, wherein the disease caused by the action of IGF-I or IGF-II on the IGF-I receptor is selected from the group consisting of liver cancer, neuroblastoma, rhabdomyosarcoma, osteosarcoma, pediatric cancer, acromegaly, ovarian cancer, pancreatic cancer, benign prostatic hyperplasia, breast cancer, prostate cancer, bone cancer, lung cancer, colorectal cancer, cervical cancer, synovial sarcoma, bladder cancer, gastric cancer, Wilms tumor, metastatic carcinoid, and diarrhea associated with vasoactive intestinal peptide-secreting tumor, bipoma, Werner-Morrison syndrome, Beckwith-Wiedemann syndrome, kidney cancer, renal cell carcinoma, transitional cell carcinoma, Ewing sarcoma, leukemia, acute lymphoblastic leukemia, brain tumor, glioblastoma, non-glioblastoma brain tumor, meningioma, pituitary adenoma, vestibular schwannoma, undifferentiated neuroectodermal tumor, medulloblastoma, astrocytoma, oligodendroglioma, ependymoma, choroid plexus papilloma, gigantism, psoriasis, atherosclerosis, smooth muscle restenosis of blood vessels, inappropriate microvascular proliferation, diabetic retinopathy, Graves' disease, multiple sclerosis, systemic lupus erythematosus, chronic thyroiditis, myasthenia gravis, autoimmune thyroiditis, and Behcet's disease.
45. A method for culturing cells derived from vertebrates in vitro, comprising the step of contacting the cells derived from vertebrates with any one or more of the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof according to any one of claims 1 to 28, the nucleic acid molecule according to claim 29, the vector according to claim 30, and the recombinant cell according to claim 31 during the culturing process.
46. The culturing method according to claim 45, wherein the contacting step is performed for the purpose of promoting the growth or inducing the differentiation of cells derived from vertebrates.
47. The culturing method according to claim 45 or 46, wherein the anti-IGF-I receptor antibody or a fragment thereof, or a derivative thereof is adsorbed or immobilized on a solid phase.
48. A genetically modified animal in which a mutation is introduced into the CR domain of the IGF-I receptor gene, wherein the CR domain of the IGF-I receptor has an amino acid sequence of ProSerGlyPheIleArgAsnGlySerGlnSerMet by genetic recombination.
49. A genetically modified animal into which a heterologous IGF-I receptor gene has been introduced, wherein the amino acid residue of X and / or X in the ProSerGlyPheIleArgAsnX and GlnSerMet portions of the amino acid sequence of the introduced IGF-I receptor gene encoded by the introduced IGF-I receptor gene does not match the amino acid sequence of the IGF-I receptor inherently possessed by the animal, and the IGF-I receptor gene is introduced. 1 X 2 Among the sequences of the ProSerGlyPheIleArgAsnX and GlnSerMet portions, the amino acid residue of X 1 and / or X 2 A genetically modified animal into which an IGF-I receptor gene has been introduced, wherein the amino acid residue does not match the amino acid sequence of the IGF-I receptor inherently possessed by the animal.