Engineered artificial antigen presenting cells for tumor infiltrating lymphocyte expansion

NZ793899BActive Publication Date: 2026-09-01IOVANCE BIOTHERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
NZ793899
Authority / Receiving Office
NZ · NZ
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-04-05
Filing Date
2017-10-31
Publication Date
2026-09-01
Estimated Expiration
2037-10-31

AI Technical Summary

Technical Problem

Existing engineered antigen presenting cells (aAPCs) for tumor infiltrating lymphocyte (TIL) expansion, such as the K562 cell line, suffer from poor performance, high variability, and reliance on allogeneic peripheral blood mononuclear cells (PBMCs, leading to logistical and regulatory challenges in cancer immunotherapy.

Method used

Engineered myeloid lineage cells, including MOLM-13, MOLM-14, EM-3, and EM-2, transduced with costimulatory molecules CD86 and 4-1BBL, provide a robust and efficient method for TIL expansion without the need for PBMCs, achieving at least a 50-fold increase in TIL numbers within 7 days.

Benefits of technology

The engineered myeloid cells offer superior and highly efficient TIL expansion with minimal variability, reducing costs and logistical complexities, while maintaining a favorable CD8+/CD4+ T cell ratio.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000180_0000
    Figure 00000180_0000
  • Figure 00000181_0000
    Figure 00000181_0000
  • Figure 00000182_0000
    Figure 00000182_0000
Patent Text Reader

Abstract

In some embodiments, compositions and methods relating to isolated artificial antigen presenting cells (aAPCs) are disclosed, including aAPCs comprising a myeloid cell transduced with one or more viral vectors, such as a MOLM-14 or a EM-3 myeloid cell, wherein the myeloid cell endogenously expresses HLA-A / B / C, ICOS-L, and CD58, and wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-lBBL and / or OX40L and transduce the myeloid cell to express CD86 and 4-lBBL and / or OX40L proteins. In some embodiments, methods of expanding tumor infiltrating lymphocytes (TILs) with aAPCs and methods of treating cancers using TILs after expansion with aAPCs are also disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

ENGINEERED ARTIFICIAL ANTIGEN PRESENTING CELLS FOR TUMOR INFILTRATING LYMPHOCYTE EXPANSIONCROSS-REFERENCE TO RELATED APPLICATIONS

[001] This international application claims the benefit of priority to U.S. Provisional Application No. 62 / 481,831, filed Apr. 5, 2017, U.S. Provisional Application No. 62 / 475,053, filed Mar. 22, 2017, U.S. Provisional Application No. 62 / 438,600, filed Dec. 23, 2016, and U.S. Provisional Application No. 62 / 415,274, filed Oct. 31, 2016, the entireties of which are incorporated herein by reference.FIELD OF THE INVENTION

[002] Engineered artificial antigen presenting cells (aAPCs) for expansion of tumor infiltrating lymphocytes are disclosed.BACKGROUND OF THE INVENTION

[003] Treatment of bulky, refractory cancers using adoptive autologous transfer of tumor infiltrating lymphocytes (TILs) represents a powerful approach to therapy for patients with poor prognoses. Gattinoni, et aL, Nat. Rev. Immunol. 2006, 6, 383-393. A large number of TILs are required for successful immunotherapy, and a robust and reliable process is needed for commercialization. This has been a challenge to achieve because of technical, logistical, and regulatory issues with cell expansion. IL-2-based TIL expansion followed by a “rapid expansion process” (REP) has become a preferred method for TIL expansion because of its speed and efficiency. Dudley, etal.. Science 2002, 298, 850-54; Dudley, etal., J. Clin. Oncol. 2005, 23, 2346-57; Dudley, etal., J. Clin. Oncol. 2008, 26, 5233-39; Riddell, et aL, Science 1992, 257, 238-41; Dudley, et aL, J. Immunother. 2003, 26, 332-42. However, although REP can result in a 1,000-fold expansion of TILs over a 14-day period, it requires a large excess (e.g., 200-fold) of irradiated allogeneic peripheral blood mononuclear cells (PBMCs), often from multiple donors, as feeder cells, as well as anti-CD3 antibody (OKT-3) and high doses of IL-2. Dudley, et al., J. Immunother. 2003, 26, 332-42. Despite their high performance, PBMCs have multiple drawbacks, including the large numbers of allogeneic PBMCs required, the need to obtain PBMCs by leukapheresis from multiple healthy donors, the resulting interdonor variability inPBMC viability after cryopreservation and variable TIL expansion results, the risk of undetected viral pathogens causing downstream patient infections, and the extensive and costly laboratory testing of each individual donor cell product to confirm sterility and quality (including viral contaminant testing) and to test expansion properties.

[004] Unfortunately, aAPCs developed for use in the expansion of TILs have suffered from poor performance when compared to PBMCs, including alterations of the phenotypic properties of the input TILs, as well as poor expansion performance and / or high variability in expansion results. Because of the large number of potential cells that might be adapted for use as aAPCs and the unpredictability of identifying suitable candidates, the focus of aAPC development for polyclonal TILs to date has been solely on the well-established K562 cell line. Butler and Hirano, Immunol. Rev. 2014, 257, 191-209. For example, K562 cells modified to express 4-1BBL (CD137L) were tested in pre-REP culture (but not in REP culture) to determine enhancement of TIL expansion from tumor digest, but PBMCs were still required to be used in conjunction with K562 cells to obtain TIL expansion. Friedman, etaL, J. Immunother. 2011, 34, 651-661. Other engineered K562 cells modified to express CD64, CD86, and 4-1BBL were tested and achieved TIL expansion that was at best comparable to PBMCs, and most likely less than PBMCs, and also suffered from skewing of the polyclonal TIL phenotype to a less favorable CD8+ / CD4+ T cell ratio. Ye, et aL, J. Translat. Med. 2011, 9, 131. Recently, K562 cells modified to express CD86, 4-1BBL (CD137L), high affinity Fc receptor (CD64) and membranebound IL-15 have also been shown to propagate TIL (post-REP) at equivalent numbers compared to PBMC feeders, but with the additional complexity of membrane-bound IL-15.Forget, etaL, J. Immunother. 2014, 37, 448-60. Other systems developed have lacked critical costimulatory molecules, have led to unfavorable T cell phenotypic skewing, or have required additional interleukins (such as IL-21). Butler and Hirano, Immunol. Rev. 2014, 257, 191-209. Overall, K562 modified aAPCs have not been shown to provide for consistent expansion of TILs with acceptable variability while also performing better than PBMCs in other measures including overall expansion cell counts. Alternative aAPCs besides K562 cells have been successful in other cell expansion methods, but have not achieved the same performance as PBMCs with the unique polyclonal subset of cells that make up TILs. Maus, etaL, Nat. BiotechnoL 2002, 20, 143-148; Suhoski, etal.,Mol. Ther. 2007,15, 981-988.

[005] The MOLM-14 human leukemia cell line was established from the peripheral blood of a patient with relapsed acute monocytic leukemia, and initial phenotypic characterization indicated the presence of at least the following markers: CD4, CD9, CD1 la, CD13, CD14, CD15, CD32, CD33, CD64, CD65, CD87, CD92, CD93, CD116, CD118, and CD155. Matsuo, et aL, Leukemia 1997, 11, 1469-77. Additional phenotypic characterization of MOLM-14 found higher levels of HLA-A / B / C, CD64, CD80, ICOS-L, CD58, and lower levels of CD86. MOLM-14 cells and the closely-related MOLM-13 cells have not been previously reported as useful aAPCs for the expansion of cells for tumor immunotherapy applications.

[006] The EM-3 human cell line was established from the bone marrow of a patient with Philadelphia chromosome-positive CML. Konopka, etaL, Proc. Nat’I Acad. Sci. USA 1985, 82, 1810-4. EM-3 cells and the closely-related EM-2 cell line have not been previously reported as useful aAPCs for the expansion of cells for tumor immunotherapy applications. Phenotypic characterization for EM-3 cells indicates the presence of at least the following markers: CD13, CD15, and CD33.

[007] The present invention provides the unexpected finding that engineered myeloid lineage cells, including MOLM-13, MOLM-14, EM-3, and EM-2 cells, transduced with additional costimulatory molecules, including CD86 (B7-2), 4-1BBL (CD137L), and OX40L (CD134L), provide for superior and highly efficient expansions of TILs in large numbers with minimal variability, reduced cost, and no reliance on human blood samples as a source of PBMCs, with the benefit of using an aAPC which can be produced efficiently from a master cell bank. CD86 and 4-1BBL are costimulatory molecules that provide costimulatory signals for T cell activation. The MOLM-14, MOLM-13, EM-3, and / or EM-2 cells transduced with additional costimulatory molecules are useful, for example, in the expansion of TILs for use in cancer immunotherapy and other therapies.SUMMARY OF THE INVENTION

[008] In an embodiment, the invention provides an artificial antigen presenting cell (aAPC) comprising a myeloid cell transduced with one or more vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein.

[009] In an embodiment, each of the CD86 protein and the 4-1BBL protein are human proteins.

[0010] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the aAPC can stimulate and expand a tumor infiltrating lymphocyte (TIL) contacted with the aAPC.

[0011] It will be apparent that in certain embodiments of the invention, the nucleic acid molecule encoding CD86 may be comprised in a different viral vector to the nucleic acid molecule encoding 4-1BBL or the same viral vector.

[0012] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the aAPC expands a population of TILs by at least 50-fold over a period of 7 days in a cell culture medium comprising IL-2 at a concentration of about 3000 lU / mL and OKT-3 antibody at a concentration of about 30 ng / mL.

[0013] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the aAPC can stimulate and expand a T cell contacted with the aAPC.

[0014] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the myeloid cell endogenously expresses HLA-A / B / C, ICOS-L, and CD58.

[0015] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise anucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the myeloid cell is essentially devoid of membrane-bound IL-15.

[0016] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the myeloid cell is a MOLM-14 cell.

[0017] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the myeloid cell is aMOLM-13 cell.

[0018] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the myeloid cell is a EM-3 cell.

[0019] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the myeloid cell is a EM-2 cell.

[0020] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the CD86 protein comprises an amino acid sequence as set forth in SEQ ID NO:8, or an amino acid sequence comprising one or more conservative amino acid substitutions thereof, and the 4-1BBLprotein comprises SEQ ID NO:9, or an amino acid sequence comprising one or more conservative amino acid substitutions thereof.

[0021] In an embodiment, the invention provides an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, wherein the nucleic acid molecule encoding CD86 comprises a nucleic acid sequence as set forth in SEQ ID NO: 16 and the nucleic acid molecule encoding 4-1BBL comprises a nucleic acid sequence as set forth in SEQ ID NO: 19.

[0022] In an embodiment, the invention provides a method of expanding tumor infiltrating lymphocytes (TILs), the method comprising the step of contacting a population of TILs with an aAPC comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and wherein the population of TILs is expanded. In an embodiment, the method is an in vitro or an ex vivo method.

[0023] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium.

[0024] In an embodiment, the foregoing method is an in vitro or an ex vivo method.

[0025] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population ofartificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the cell culture medium further comprises IL-2 at an initial concentration of about 3000 lU / mL and OKT-3 antibody at an initial concentration of about 30 ng / mL.

[0026] In an embodiment, the foregoing method is an in vitro or an ex vivo method.

[0027] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the population of APCs expands the population of TILs by at least 50-fold over a period of 7 days in a cell culture medium.

[0028] In an embodiment, the foregoing method is an in vitro or an ex vivo method.

[0029] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the myeloid cell endogenously expresses HLA-A / B / C, ICOS-L, and CD58.

[0030] In an embodiment, the foregoing method is an in vitro or an ex vivo method.

[0031] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the myeloid cell is a MOLM-14 cell.

[0032] In an embodiment, the foregoing method is an in vitro or an ex vivo method.

[0033] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the myeloid cell is a MOLM-13 cell.

[0034] In an embodiment, the foregoing method is an in vitro or an ex vivo method.

[0035] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the myeloid cell is a EM-3 cell.

[0036] In an embodiment, the foregoing method is an in vitro or an ex vivo method.

[0037] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the myeloid cell is a EM-2 cell.

[0038] In an embodiment, the foregoing method is an in vitro or an ex vivo method.

[0039] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid molecule encoding CD86 and a nucleic acid molecule encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the CD86 protein comprises an amino acid sequence as set forth in SEQ ID NO:8, or comprises an amino acid sequence comprising one or more conservative amino acid substitutions thereof, and the 4-1BBL protein comprises an amino acid sequence as set forth in SEQ ID NO:9, or comprises an amino acid sequence comprising one or conservative amino acid substitutions thereof.

[0040] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the nucleic acid encoding CD86 comprises a nucleic acid sequence as set forth in SEQ ID NO: 16 and the nucleic acid encoding 4-1BBL comprises a nucleic acid sequence as set forth in SEQ ID NO: 19.

[0041] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the expansion is performed using a gas permeable container.

[0042] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the ratio of the population of TILs to the population of aAPCs is between 1 to 200 and 1 to 400.

[0043] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population ofartificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the ratio of the population of TILs to the population of aAPCs is about 1 to 300.

[0044] In an embodiment, the invention provides a method of expanding tumor infiltrating lymphocytes (TILs), the method comprising contacting a population of TILs comprising a population of TILs with a myeloid artificial antigen presenting cell (aAPC), wherein the myeloid aAPC comprises at least two co-stimulatory ligands that specifically bind with at least two costimulatory molecules on the TILs, wherein binding of the co-stimulatory molecules with the costimulatory ligand induces proliferation of the TILs, thereby specifically expanding TILs, and wherein the at least two co-stimulatory ligands comprise CD86 and 4-1BBL. In an embodiment, the foregoing method is an in vitro or ex vivo method.

[0045] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, and wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein.

[0046] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating cancer, wherein the TILs are a second population of TILs and are obtainable from a method comprising the steps of(a) performing a rapid expansion of a first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain the second population of TILs, wherein the TILs are / have been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; andwherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, and wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein.

[0047] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, wherein the myeloid aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, and wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein.

[0048] In an embodiment, the invention provides a population of tumor infiltrating cells (TILs) for use in treating a cancer, wherein the population of TILs is a second population of TILs and is obtainable by a process comprising:(a) performing a rapid expansion of a first population of TILs using a population of myeloidartificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain the second population of TILs, wherein the first population of TILs are / have been obtained from a tumor resected from a patient, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, wherein the myeloid aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, and wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein.

[0049] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, wherein the myeloid aAPCs comprise EM-3 cells transduced with one or more viral vectors, and wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the EM-3 cells express a CD86 protein and a 4-1BBL protein.

[0050] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, the population of TILs being a second population of TILs and obtainable by a process comprising:(a) performing a rapid expansion of a first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain the second population of TILs, wherein the first population of TILs are / have been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; andwherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, wherein the myeloid aAPCs comprise EM-3 cells transduced with one or more viral vectors, and wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the EM-3 cells express a CD86 protein and a 4-1BBL protein.

[0051] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the rapid expansion is performed over a period not greater than 14 days.

[0052] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, wherein the population of TILs is a second population and is obtainable by a method comprising the steps of:(a) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain the second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion, wherein the myeloid aAPCs endogenously express HLA-A / B / C, ICOS-L and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the rapid expansion is performed over a period not greater than 14 days.

[0053] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the cell culture medium further comprises IL-2 at an initial concentration of about 3000 lU / mL and OKT-3 antibody at an initial concentration of about 30 ng / mL.

[0054] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, the population of TILs being a second population of TILs and obtainable by a process comprising:(a) performing a rapid expansion of a first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain the second population of TILs, wherein the first population of TILs are / have been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and wherein the myeloid aAPCs endogenously express HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the cell culture medium further comprises IL-2 at an initial concentration of about 3000 lU / mL and OKT-3 antibody at an initial concentration of about 30 ng / mL.

[0055] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the expansion is performed using a gas permeable container.

[0056] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, the population of TILs being a second population of TILs and obtainable by a process comprising:(a) performing a rapid expansion of a first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain thesecond population of TILs, wherein the first population of TILs are / have been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and wherein the myeloid aAPCs endogenously express HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the expansion is performed using a gas permeable container.

[0057] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the ratio of the second population of TILs to the population of aAPCs is between 1 to 200 and 1 to 400.

[0058] In an embodiment, the invention provides a population of tumor infiltrating cells (TILs) for use in treating a cancer, the population of TILs being a second population of TILs and obtainable by a process comprising the steps of:(a) performing a rapid expansion of a first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain the second population of TILs, wherein the first population of TILs is / has been obtained from a tumor resected from a patient, and wherein the second population of TILs is atleast 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; andwherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the ratio of the second population of TILs to the population of aAPCs is between 1 to 200 and 1 to 400. In certain embodiments, the ratio of the second population of TILs to the population of aAPCs is about 1 to 300.

[0059] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, and wherein the ratio of the second population of TILs to the population of aAPCs is about 1 to 300.

[0060] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing a rapid expansion of the first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of therapid expansion; and(c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer;wherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, wherein the cancer is selected from the group consisting of melanoma, ovarian cancer, cervical cancer, non-small-cell lung cancer (NSCLC), lung cancer, bladder cancer, breast cancer, cancer caused by human papilloma virus, head and neck cancer, renal cancer, and renal cell carcinoma.

[0061] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, the population of TILs being a second population of TILs and obtainable by a method comprising the steps of:(a) performing a rapid expansion of a first population of TILs using a population of myeloid artificial antigen presenting cells (myeloid aAPCs) in a cell culture medium to obtain the second population of TILs, wherein the first population of TILs is / has been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs after 7 days from the start of the rapid expansion; andwherein the myeloid aAPCs endogenously expresses HLA-A / B / C, ICOS-L, and CD58, wherein the myeloid aAPCs are transduced to express a CD86 protein and a 4-1BBL protein, wherein the cancer is selected from the group consisting of melanoma, ovarian cancer, cervical cancer, non-small-cell lung cancer (NSCLC), lung cancer, bladder cancer, breast cancer, cancer caused by human papilloma virus, head and neck cancer, renal cancer, and renal cell carcinoma.

[0062] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culturemedium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer.

[0063] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein the myeloid aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein.

[0064] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein the myeloid aAPCs comprise EM-3 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the EM-3 cells express a CD86 protein and a 4-1BBL protein.

[0065] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, wherein the population of TILs is a third population of TILs and obtainable by a method comprising the steps of:(a) performing an initial expansion of a first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the first population of TILs is / has been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(b) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium toobtain the third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3.

[0066] In an embodiment, the myeloid aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein. In an embodiment, the myeloid cells comprise MOLM-13 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-13 cells express a CD86 protein and a 4-1BBL protein. In certain embodiments, the myeloid cells comprise EM-3 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the EM-3 cells express a CD86 protein and a 4-1BBL protein. In certain embodiments, the myeloid cells comprise EM-2 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the EM-2 cells express a CD86 protein and a 4-1BBL protein.

[0067] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;(d) treating the patient with a non-myeloablative lymphodepletion regimen, wherein the non-myeloablative lymphodepletion regimen comprises the steps of administration of cyclophosphamide at a dose of 60 mg / m2 / day for two days followed by administration of fludarabine at a dose of 25 mg / m2 / day for five days;(e) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer; and(f) treating the patient with a high-dose IL-2 regimen, wherein the high-dose IL-2 regimen comprises 600,000 or 720,000 lU / kg of aldesleukin administered as a 15-minute bolus intravenous infusion every eight hours until tolerance;wherein the myeloid aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein.

[0068] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;(d) treating the patient with a non-myeloablative lymphodepletion regimen, wherein the non-myeloablative lymphodepletion regimen comprises the steps of administration of cyclophosphamide at a dose of 60 mg / m2 / day for two days followed by administration offludarabine at a dose of 25 mg / m2 / day for five days;(e) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer; and(f) treating the patient with a high-dose IL-2 regimen, wherein the high-dose IL-2 regimen comprises 600,000 or 720,000 lU / kg of aldesleukin administered as a 15-minute bolus intravenous infusion every eight hours until tolerance;wherein the myeloid aAPCs comprise EM-3 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the EM-3 cells express a CD86 protein and a 4-1BBL protein.

[0069] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, wherein the population of TILs are a third population of TILs and obtainable by a method comprising the steps of:(a) an initial expansion of a first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the first population of TILs is / has been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2; and(b) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain the third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;and further wherein the population of TILs is for administration to a patient in combination with a non-myeloablative lymphodepletion regimen, wherein the non-myeloablative lymphodepletion regimen comprises cyclophosphamide which is for administration at a dose of 60 mg / m2 / day for two days followed by fludarabine which is for administration at a dose of 25 mg / m2 / day for fivedays and further wherein the population of TILs is for administration in combination with a high-dose IL-2 regimen, wherein the high-dose IL-2 regimen comprises 600,000 or 720,000 lU / kg of aldesleukin for administration as a 15-minute bolus intravenous infusion every eight hours until tolerance. In certain embodiments, the population of TILs is for administration prior to the high-dose IL-2 regimen and subsequent to the non-myeloablative lymphodepletion regimen.

[0070] In certain embodiments, the myeloid aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein, the myeloid aAPCs comprise MOLM-13 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-13 cells express a CD86 protein and a 4-1BBL protein. In certain embodiments, the myeloid aAPCs comprise EM-3 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the EM-3 cells express a CD86 protein and a 4-1BBL protein.

[0071] In an embodiment, the population of TILs is for use in the treating of a cancer selected from the group consisting of melanoma, ovarian cancer, cervical cancer, non-small-cell lung cancer (NSCLC), lung cancer, bladder cancer, breast cancer, cancer caused by human papilloma virus, head and neck cancer, renal cancer, and renal cell carcinoma.

[0072] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-foldgreater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3; and(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein IL-2 is present at an initial concentration of about 3000 lU / mL and OKT-3 antibody is present at an initial concentration of about 30 ng / mL in the second cell culture medium.

[0073] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, wherein the population of TILs is a third population of TILs and is obtainable by a method comprising the steps:(a) performing an initial expansion of a first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the first population of TILs is / has been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2; and(b) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain the third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3; wherein IL-2 is present at an initial concentration of about 3000 lU / mL and OKT-3 antibody is present at an initial concentration of about 30 ng / mL in the second cell culture medium.

[0074] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs isat least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3; and(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein the rapid expansion is performed over a period not greater than 14 days.

[0075] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, wherein the population of TILs is a third population of TILs and is obtainable by a method comprising the steps:(a) performing an initial expansion of a first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the first population of TILs is / has been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2; and(b) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain the third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3; wherein the rapid expansion is performed over a period not greater than 14 days.

[0076] In embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3; and(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein the initial expansion is performed using a gas permeable container.

[0077] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3; and(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein the rapid expansion is performed using a gas permeable container.

[0078] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, wherein the population of TILs is a third population of TILs and is obtainable by a method comprising the steps:(a) performing an initial expansion of a first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the first population of TILs is / has been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(b) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain the third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3; wherein the initial expansion and / or the rapid expansion is performed using a gas-permeable container.

[0079] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein the ratio of the second population of TILs to the population of aAPCs in the rapid expansion is between 1 to 80 and 1 to 400.

[0080] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein the ratio of the second population of TILs to the population of aAPCs in the rapid expansion is about 1 to 300.

[0081] In an embodiment, the invention provides a population of tumor infiltrating lymphocytes (TILs) for use in treating a cancer, wherein the population of TILs is a third population of TILs and is obtainable by a method comprising the steps:(a) performing an initial expansion of a first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the first population of TILs is / has been obtained from a tumor resected from a patient, and wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(b) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain the third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3, and wherein the ratio of the second population of TILs to the population of aAPCs in the rapid expansion is between 1 to 80 and 1 to 400.

[0082] In an embodiment, the the ratio of the second population of TILs to the population of aAPCs in the rapid expansion is about 1 to 300.

[0083] In an embodiment, the invention provides a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) obtaining a first population of TILs from a tumor resected from a patient;(b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 5-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2;(c) performing a rapid expansion of the second population of TILs using a population of myeloid artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the second population of TILs after 7 days from the start of the rapid expansion; and wherein the second cell culture medium comprises IL-2 and OKT-3;(d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer,wherein the cancer is selected from the group consisting of melanoma, ovarian cancer, cervical cancer, non-small-cell lung cancer (NSCLC), lung cancer, bladder cancer, breast cancer, cancer caused by human papilloma virus, head and neck cancer, renal cancer, and renal cell carcinoma.

[0084] In an embodiment, the invention provides a kit for specifically inducing proliferation of a tumor infiltrating lymphocyte expressing a known co-stimulatory molecule, the kit comprising an effective amount of an aAPC, wherein said aAPC comprises a MOLM-14 cell or a EM-3 cell transduced using a lentiviral vector (LV), wherein the LV comprises a nucleic acid encoding at least one co-stimulatory ligand that specifically binds said known co-stimulatory molecule, wherein binding of the known co-stimulatory molecule with said co-stimulatory ligand stimulates and expands said T cell, the kit further comprising an applicator and an instructional material for the use of said kit.

[0085] In an embodiment, the invention provides a method for assessing the potency of tumor infiltrating lymphocytes (TILs) comprising the steps of:(a) providing a plurality of mouse mastocytoma P815 cells expressing the endogenous CD 16 Fc receptor, wherein the P815 cells are transduced with a lentiviral vector based on enhanced green fluorescent protein (GFP) and Firefly Luciferase;(b) co-culturing the plurality of P815 cells TILs with and without OKT-3 to assess T cell receptor (TCR) activation (specific killing) or lymphokine activated killing (LAK, nonspecific killing), respectively;(c) incubating for four hours;(d) adding Luciferin and incubating for 5 minutes;(e) reading bioluminescence intensity using a luminometer; and(f) and calculating percent cytotoxicity and survival.BRIEF DESCRIPTION OF THE DRAWINGS

[0086] The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings.

[0087] FIG. 1 illustrates the results of rapid expansion of TILs using irradiated allogeneic PBMC feeder cells. Each TIL line (M1015T and M1016T) (1.3 x io5 cells) was co-cultured with 46 different irradiated feeders (1.3 x 107 cells), IL-2 (3000 lU / mL) and OKT-3 (30 ng / mL) in a T25 flask for 7 days. The fold expansion value for TILs was calculated on Day 7. The figure shows the number of fold expansions for two TIL lines in separate stimulation 32experiments, with 46 different feeder lots tested, and highlights the variability of expansion results using PBMC feeder cells.

[0088] FIG. 2 illustrates a vector diagram of the pLV430G human 4-1BBL vector.

[0089] FIG. 3 illustrates a diagram of the 4-1BBL PCRP (polymerase chain reaction product) portion of the pLV430G human 4-1BBL vector.

[0090] FIG. 4 illustrates a vector diagram of the pLV430G human CD86 vector.

[0091] FIG. 5 illustrates a diagram of the CD86 PCRP portion of the pLV430G human CD86 vector.

[0092] FIG. 6 illustrates a vector diagram of the pDONR221 human CD86 donor vector.

[0093] FIG. 7 illustrates a vector diagram of the pDONR221 human 4-1BBL donor vector.

[0094] FIG. 8 illustrates a vector diagram of the pLV430G empty vector.

[0095] FIG. 9 illustrates a vector diagram of the pDONR221 empty vector.

[0096] FIG. 10 illustrates a vector diagram of the psPAX2 helper plasmid for lentivirus production.

[0097] FIG. 11 illustrates a vector diagram of the pCIGO-VSV.G helper plasmid for lentivirus production.

[0098] FIG. 12 illustrates the results of flow cytometry experiments on MOLM-14 cells before lentiviral transfection (“Untransfected”) and after transfection (“Transfected”), confirming the expression of CD137 and CD86 on engineered MOLM-14 cells.

[0099] FIG. 13 illustrates the results of rapid expansion of TILs using irradiated parental unmodified MOLM-14 cells (“Parent M0LM14”), engineered MOLM-14 cells (CD86 / 4-1BBL, “Engineered M0LM14”), or PBMC feeders (“Feeders”) for TIL lot M1032-T2. TIL were cocultured with PBMC feeders or parental or engineered M0LM14 cells at 1:100 ratios with OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL). Cells were counted and split on Day 6 and 11. Each dot represents cell numbers determined on Day 0, 6, 11 and 14 respectively. A logarithmic scale is used.

[00100] FIG. 14 illustrates results as shown in FIG. 13, depicted using a linear scale.

[00101] FIG. 15 illustrates results for TIL lot M1033-T6 with other parameters as given in FIG. 13, using a logarithmic scale.

[00102] FIG. 16 illustrates results as shown in FIG. 14, depicted using a linear scale.

[00103] FIG. 17 illustrates the results of rapid expansions of TILs using engineered MOLM-14 cells expressing CD86 and 4-1BBL (“TIL + Engineered M0LM14 (CD86 / 41BB) + OKT3”) or irradiated PBMC feeders (“TIL + Feeders + OKT3”). TIL were co-cultured with PBMC feeders or engineered MOLM-14 cells (aM0LM14) at 1:100 ratios plus OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL). Cells were counted and split on Day 6 and 11. Each point represents cell numbers determined on Day 14.

[00104] FIG. 18 illustrates the results of experiments in which TILs (2 x 104) were cultured with different ratios (1:10, 1:30, and 1:100, denoted “10”, “30”, and “100”, respectively) of parental MOLM-14 (“M0LM14”) cells, MOLM-14 cells transduced to express CD86 and 4-1BBL (“aM0LM14”), or PBMC feeders (“PBMC+”), each with OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL) in wells of a 24-well G-Rex plate. A control was performed using only OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL) (“PBMC-”). Each condition was cultured in triplicate. Cultures were fed with fresh media and IL-2 on Day 4 and 7. Viable cells were counted on Day 7. The bar graph represented here shows the mean plus standard deviation (SD) of viable cell numbers counted on Day 11. The p-value was calculated by the student‘t’ test.

[00105] FIG. 19 illustrates the results of TILs cultured with different ratios (1:30, 1:100, and 1:300, denoted “30”, “100”, and “300”, respectively) of PBMC feeders (“PBMC”), parental MOLM-14 cells (“M0LM14”), or MOLM-14 cells transduced to express CD86 and 4-1BBL (“aM0LM14”), each with OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL) in the single 24 well G-Rex culture plates. Viable cells were counted on day 11 and plotted. Other conditions are as in FIG. 18.

[00106] FIG. 20 illustrates the results of TILs cultured with different ratios (1:50, 1:100, and 1:200, denoted “50”, “100”, and “200”, respectively) of PBMC feeders (“PBMC”), parental MOLM-14 cells (“M0LM14”), or MOLM-14 cells transduced to express CD86 and 4-1BBL (“aM0LM14”), each with OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL) in the single 24 well G-Rex culture plates. Cells were counted on day 14. Other conditions are as in FIG. 18.

[00107] FIG. 21 illustrates the results of TILs cultured with different ratios (1:100, 1:200, 1:400, and 1:800, denoted “100”, “200”, “400”, and “800”, respectively) of PBMC feeders (“PBMC”), parental MOLM-14 cells (“M0LM14”), or MOLM-14 cells transduced to express CD86 and 4-1BBL (“aM0LM14”), each with OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL) in the single 24 well G-Rex culture plates. Cells were counted on day 14. Other conditions are as in FIG. 18.

[00108] FIG. 22 illustrates a sunburst visualization showing fine distribution of Live, T cell receptor (TCR) a / p, CD4, CD8, CD27, CD28, and CD57 TILs expanded with PBMC feeders.

[00109] FIG. 23 illustrates a sunburst visualization showing fine distribution of Live, TCR a / p, CD4, CD8, CD27, CD28, and CD57 TILs expanded with aM0LM14 aAPCs.

[00110] FIG. 24 depicts a flow cytometry contour plot showing memory subset (CD45RA+ / -, CCR7+ / -) gated on Live, TCR a / p +, CD4+, or CD8+ TILs.

[00111] FIG. 25 illustrates phenotypic characterization of the T cell subset, CD4+ and CD8+ post-REP TILs (expanded with aM0LM14 aAPCs) gated on CD3+ cells using a SPADE tree. The color gradient is proportional to the mean fluorescence intensity (MFI) of LAG3, TIM3, PD1, and CD137.

[00112] FIG. 26 illustrates phenotypic characterization of the T cell subset, CD4+ and CD8+ post-REP TILs (expanded with aM0LM14 aAPCs) gated on CD3+ cells using a SPADE tree. The color gradient is proportional to the MFI CD69, CD 154, KLRG1, and TIGIT

[00113] FIG. 27 illustrates oxygen consumption rate (OCR) of TIL after expansion with Feeders or aM0LM14 measured during a mitochondrial stress test. Each data point represents mean + standard error of the mean (SEM) measured in triplicate.

[00114] FIG. 28 illustrates extracellular acidification rate (ECAR) of TIL after expansion with Feeders or aM0LM14 measured during a mitochondrial stress test. Each data point represents mean + SEM measured in triplicate.

[00115] FIG. 29 illustrates a vector diagram of the destination vector pLV4301G.

[00116] FIG. 30 illustrates a vector diagram of donor vector 1, pMK 7cl2 anti mFC scFv CoOp ECORV SacIILlR5.

[00117] FIG. 31 illustrates a vector diagram of donor vector 2, pMK hCD8a scaffold TN L5 L2.

[00118] FIG. 32 illustrates a vector diagram of final vector used for lentiviral production, pLV4301G 7C12 scFv mlgG hCD8 flag.

[00119] FIG. 33 illustrates a vector diagram of the destination vector pLV4301G.

[00120] FIG. 34 illustrates a vector diagram of donor vector 1, pMK 8B3 anti mFC scFv CoOp ECORV SacIILlR5.

[00121] FIG. 35 illustrates a vector diagram of donor vector 2, pMK hCD8a scaffold TN L5 L2.

[00122] FIG. 36 illustrates a vector diagram of final vector used for lentiviral production, pLV4301G 8B3 scFv mlgG hCD8 flag.

[00123] FIG. 37 illustrates the results of flow cytometry experiments on EM-3 cells before lentiviral transfection (“Untransfected”) and after transfection (“Transfected”), confirming the expression of CD137 and CD86 on engineered EM-3 cells.

[00124] FIG. 38 illustrates the results of experiments wherein TILs were co-cultured with aEM3 (7C12 or 8B3) at a ratio of 1:100 plus OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL). Cells were counted on Day 11 and 14.

[00125] FIG. 39 illustrates the results of experiments wherein TILs were co-cultured with aEM3 (7C12 or 8B3) at a ratio of 1:100 plus OKT-3 (30 ng / mL) and IL-2 (3000 lU / mL). Cells were counted on Day 11 and 14.

[00126] FIG. 40 illustrates the results of experiments wherein TILs were co-cultured with aEM3 or PBMC feeders at a 1:100 ratio with IL-2 (3000 lU / mL), with or without OKT-3 (30 ng / mL). The bar graph shows cell numbers determined on Day 11.

[00127] FIG. 41 illustrates the results of TIL expansions with EM-3 aAPCs at different TIL:aAPC ratios.

[00128] FIG. 42 illustrates the results of TIL expansions with EM-3 aAPCs. TILs (2 x 104) were co-cultured with five different PBMC feeder lots or aEM3 (in triplicate) at a 1:100 ratio with IL-2 (3000 lU / mL) in a G-Rex 24 well plate. Viable cells were counted on Day 14. The graph shows viable cell numbers (mean) with 95% confidence interval counted on Day 14.

[00129] FIG. 43 illustrates the results of TIL expansions with EM-3 aAPCs and MOLM-14 aAPCs. TILs (2 x io4) were co-cultured with five different PBMC feeder lots or aMOLM14 (in triplicate) or aEM3 (also in triplicate) at 1:100 ratio with IL-2 (3000 lU / mL) in a G-Rex 24 well plate. The graph shows viable cell numbers (mean) with 95% confidence interval counted on Day 14.

[00130] FIG. 44 illustrates a sunburst visualization to show fine distribution of Live, TCR a / p, CD4+, and CD8+ TILs expanded with aEM3 aAPCs or PBMC feeders (TIL batch Ml054).

[00131] FIG. 45 illustrates the sunburst visualization to show fine distribution of Live, TCR a / p, CD4+, and CD8+ TILs expanded with aEM3 aAPCs or PBMC feeders (TIL batch Ml055).

[00132] FIG. 46 illustrates the CD4+ and CD8+ SPADE tree of TILs expanded with aEM3 aAPCs or PBMC feeders using CD3+ cells. The color gradient is proportional to the MFI of LAG-3, TIM-3, PD-1, and CD137.

[00133] FIG. 47 illustrates the CD4+ and CD8+ SPADE tree of TILs expanded with aEM3 aAPCs or PBMC feeders using CD3+ cells. The color gradient is proportional to the MFI of CD69, CD 154, KLRG1, and TIGIT.

[00134] FIG. 48 illustrates a summary of spare respiratory capacity measured by the Seahorse XF Mito stress test.

[00135] FIG. 49 illustrates a summary of glycolytic reserve measured by the Seahorse XF Mito stress test.

[00136] FIG. 50 illustrates a mitochondrial stain of live TILs expanded against PBMC or aEM3 using MitoTracker dye, which stains mitochondria in live cells and for which accumulation is dependent upon membrane potential. TILs expanded against PBMC or aEM3 were stained L / D Aqua followed by MitoTracker red dye. Data shown are MitoTracker positive (MFI) cells gated on live population.

[00137] FIG. 51 illustrates results of a P815 BRLA for cytotoxic potency and functional activity, comparing TILs expanded with PBMC feeders to TILs expanded using aM0LM14 aAPCs.

[00138] FIG. 52 illustrates results of a P815 BRLA for cytotoxic potency and functional activity, comparing TILs expanded with PBMC feeders to TILs expanded using aEM3 aAPCs.

[00139] FIG. 53 illustrates IFN-y release for two batches of TILs following overnight stimulation (“S”) with microbeads coated with anti-CD3 / CD28 / 4-lBB in comparison to unstimulated (“US”) TILs, comparing TILs expanded with PBMC feeders to TILs expanded using aM0LM14 aAPCs. * p<0.05, ** p<0.005, *** p<0.001, ns = not significant.

[00140] FIG. 54 illustrates IFN-y release for three batches of TILs following overnight stimulation (“S”) with microbeads coated with anti-CD3 / CD28 / 4-lBB in comparison to unstimulated (“US”) TILs, comparing TILs expanded with PBMC feeders to TILs expanded using aEM3 aAPCs. * p<0.05, ** p<0.005, *** p<0.001, ns = not significant.

[00141] FIG. 55 illustrates Granzyme B release for two batches of TILs following overnight stimulation (“S”) with microbeads coated with anti-CD3 / CD28 / 4-lBB in comparison to unstimulated (“US”) TILs, comparing TILs expanded with PBMC feeders to TILs expanded using aM0LM14 aAPCs. * p<0.05, ** p<0.005, *** p<0.001, ns = not significant.

[00142] FIG. 56 illustrates Granzyme B release for three batches of TILs following overnight stimulation (“S”) with microbeads coated with anti-CD3 / CD28 / 4-lBB in comparison to unstimulated (“US”) TILs, comparing TILs expanded with PBMC feeders to TILs expanded using aEM3 aAPCs. * p<0.05, ** p<0.005, *** p<0.001, ns = not significant.

[00143] FIG. 57 illustrates a TIL expansion and treatment process. aAPCs of the present invention may be used in both the pre-REP stage (top half of figure) or REP stage (bottom half of figure) and may be added when IL-2 is added to each cell culture. Step 1 refers to the addition of 4 tumor fragments into 10 G-Rex 10 flasks. At step 2, approximately 40 * 106 TILs or greater are obtained. At step 3, a split occurs into 36 G-Rex 100 flasks for REP. TILs are harvested by centrifugation at step 4. Fresh TIL product is obtained at step 5 after a total process time of approximate 43 days, at which point TILs may be infused into a patient.

[00144] FIG. 58 illustrates a treatment protocol for use with TILs expanded with aAPCs. Surgery (and tumor resection) occurs at the start, and lymphodepletion chemo refers to non-myeloablative lymphodepletion with chemotherapy as described elsewhere herein.

[00145] FIG. 59 illustrates Bioluminescent Redirected Lysis Assay (BRLA) results, showing percentage cytotoxicity of TIL batch M1033T-1 when co-cultured with P815 Clone G6 (with and without anti-CD3) at individual effector Target ratios.

[00146] FIG. 60 illustrates enzyme-linked immunosorbent assay (ELISA) data showing amount of IFN-y released against different ratios of effector to target cells.

[00147] FIG. 61 illustrates LAMP1 (%) expressed by TIL batch M1033T-1 when co-cultured with P815 Clone G6 in the presence of anti-CD3 at a ratio of 1:1 effector to target cells for 4hr and 24hr co-culture.

[00148] FIG. 62 illustrates BRLA results for TIL batch M1030. Cytotoxicity (measured as LU5O / 1 x 106 TIL) by BRLA is 26 ± 16.

[00149] FIG. 63 illustrates standard chromium release assay for TIL batch M1030. Cytotoxicity (measured as LU5O / 1 x 106 TIL) by the chromium release assay is 22.

[00150] FIG. 64 illustrates BRLA results for TIL batch M1053, showing the lytic units of the TILs by BRLA as 70 ± 17.

[00151] FIG. 65 illustrates standard chromium release assay results for TIL batch M1053, also showing lytic unit of the TILs by chromium assay as 14 ± 5. Comparison of this result with FIG. 64 shows the comparable performance of the BRLA and chromium release assay.

[00152] FIG. 66 illustrates the linear relationship between IFN-y release and cytotoxic potential of TILs.

[00153] FIG. 67 illustrates ELISpot results for IFN-y.

[00154] FIG. 68 illustrates enzymatic IFN-y release for TIL batch M1053.

[00155] FIG. 69 illustrates enzymatic IFN-y release for TIL batch M1030.

[00156] FIG. 70 illustrates ELISpot data showing Granzyme B release by M1053T andM1030T. This data confirms the potency of the TILs shown by the BRLA.

[00157] FIG. 71 illustrates enzymatic Granzyme B release for TIL batch M1053.

[00158] FIG. 72 illustrates enzymatic Granzyme B release for TIL batch M1030.

[00159] FIG. 73 illustrates ELISpot data showing TNF-a release by M1053T and M1030T.This data confirms the potency of the TILs shown by the BRLA.

[00160] FIG. 74 illustrates enzymatic TNF-a release for TIL batch M1053.

[00161] FIG. 75 illustrates enzymatic TNF-a release for TIL batch M1030.

[00162] FIG. 76 illustrates changes in cell populations of aEM3 cells (C712 (A) and 8B5 (B)) when weaning such cell populations off of FBS to hAB serum media.

[00163] FIG. 77 illustrates changes in cell populations of during freeze-thaw-recovery cycles with aEM3 cell populations suspended in various freezing media.

[00164] FIG. 78 illustrates the growth of aEM3 cells in gas permeable cell culture flasks over an eight-day time course.

[00165] FIG. 79 illustrates a flow panel analysis to determine the purity of aEM3 cells.

[00166] FIG. 80 illustrates the results of a flow panel analysis used to determine the purity of aEM3 cells.

[00167] FIG. 81 illustrates the differences in cytokine expression between aEM3 feeder cells and PBMC feeders stimulated by OKT3.

[00168] FIG. 82 illustrates that TIL may advantageously expanded (pre-REP) with serum free media (i.e., CTS Optmizer) to provide increased cell numbers as compared to CM1.

[00169] FIG. 83 and FIG. 84 illustrate that TIL may advantageously expanded with serum free media (i.e., CTS Optmizer) to provide increased cell numbers as compared to CM1 at Day 11 (PreREP) (FIG. 83) and Day 22 (Pre- and Post-REP) (FIG. 84).

[00170] FIG. 85 illustrates that aAPC cells (i.e., aEM3 cells) can be grown and using serum free media. Specifically, CTS OpTimizer and Prime-TCDM were found to be effective in growing aEM3 as compared to cDMEM (10% hSerum). Data shown were mean + SD of five separate experiments. The p value was calculated by the student t-test. *P < 0.05.

[00171] FIG. 86 and FIG. 87 illustrate the results of two experiments that demonstrate the rapid recovery of aEM3 cells from the TIL-R3 cell line on day 3 following cryopreservation. FIG. 86illustrates the total cell counts for experiment one and FIG. 87 illustrates the total cell counts for experiment two.

[00172] FIG. 88 illustrates the growth of aEM3 cells from the TIL-R3 cell line following cryopreservation where the cells were plated and grown for 9 days. Cell counts were measured every three days post thaw.

[00173] FIG. 89 illustrates the growth of aEM3 cells from the TIL-R3 cell line following cry opreservation where the cells were plated in GREX 10 flasks and grown for 8 days. Cell counts were measured every four days post thaw.

[00174] FIG. 90 illustrates a vector diagram of the pLenti-C-Myc-DDK human OX40L vector.

[00175] FIG. 91 illustrates the results of flow cytometry analysis of TILs expanded in a REP with the aEM3 cell line and PBMC feeders, showing that TILs cultured with aEM3 promotes CD8+ TIL skewness.

[00176] FIG. 92 illustrates the numbers of viable cells obtained from experiments wherein TILs were expanded in a REP with the aEM3 cell line and PBMC feeders.

[00177] FIG. 93 illustrates the numbers of CD3+ cells obtained from experiments wherein TILs were expanded in a REP with the aEM3 cell line and PBMC feeders.

[00178] FIG. 94 illustrates the numbers of CD3' cells obtained from experiments wherein TILs were expanded in a REP with the aEM3 cell line and PBMC feeders.

[00179] FIG. 95 illustrates the results of telomere length analysis using a qPCR method.

[00180] FIG. 96 illustrates a schematic diagram of an embodiment of an aAPC of the present invention.

[00181] FIG. 97 illustrates a schematic diagram of an embodiment of an aAPC of the present invention.

[00182] FIG. 98 illustrates a schematic diagram of an embodiment of an aAPC of the present invention.BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[00183] SEQ ID NO: 1 is an amino acid sequence for the heavy chain of muromonab.

[00184] SEQ ID NO:2 is an amino acid sequence for the light chain of muromonab.

[00185] SEQ ID NO:3 is an amino acid sequence for recombinant human IL-2.

[00186] SEQ ID NO:4 is an amino acid sequence for aldesleukin.

[00187] SEQ ID NO:5 is an amino acid sequence for recombinant human IL-7.

[00188] SEQ ID NO:6 is an amino acid sequence for recombinant human IL-15.

[00189] SEQ ID NO:7 is an amino acid sequence for recombinant IL-21.

[00190] SEQ ID NO:8 is the amino acid sequence of human CD86.

[00191] SEQ ID NO:9 is the amino acid sequence of human 4-1BBL (CD137L).

[00192] SEQ ID NO: 10 is the amino acid sequence of human OX40L (CD134L).

[00193] SEQ ID NO: 11 is the amino acid sequence of human CD28.

[00194] SEQ ID NO: 12 is the amino acid sequence of human CTLA-4.

[00195] SEQ ID NO: 13 is the amino acid sequence of human 4-1BB (CD137).

[00196] SEQ ID NO: 14 is the amino acid sequence of human OX40 (CD134).

[00197] SEQ ID NO: 15 is a nucleotide sequence for the pLV430G 4-1BBL empty vector.

[00198] SEQ ID NO: 16 is a nucleotide sequence for the 4-1BBL CoOP portion of the pLV430G human 4-1 BBL vector.

[00199] SEQ ID NO: 17 is a nucleotide sequence for the 4-1BBL PCRP.

[00200] SEQ ID NO: 18 is a nucleotide sequence for the pLV430G hCD86 empty vector.

[00201] SEQ ID NO: 19 is a nucleotide sequence for the hCD86 CoOP portion of the pLV430G human hCD86 vector.

[00202] SEQ ID NO:20 is a nucleotide sequence for the hCD86 CoOP Bl B2 PCRP portion of the pLV430G human hCD86 vector.

[00203] SEQ ID NO:21 is a nucleotide sequence for the pDONR221 hCD86 vector.

[00204] SEQ ID NO:22 is a nucleotide sequence for the pDONR221 4-1BBL vector.

[00205] SEQ ID NO:23 is a nucleotide sequence for the pLV430G vector.

[00206] SEQ ID NO:24 is a nucleotide sequence for the pDONR221 vector.

[00207] SEQ ID NO:25 is a nucleotide sequence for the psPAX2 helper plasmid for lentiviralproduction.

[00208] SEQ ID NO:26 is a nucleotide sequence for the pCIGO-VSV.G helper plasmid for lentiviral production.

[00209] SEQ ID NO:27 is the amino acid sequence of the mFc-7C12 scFv clone.

[00210] SEQ ID NO:28 is the amino acid sequence of the mFc-8B3 scFv clone.

[00211] SEQ ID NO:29 is a nucleotide sequence for the mFC-7C12 scFv.

[00212] SEQ ID NO:30 is a nucleotide sequence for the mFC-8B3 scFv.

[00213] SEQ ID NO:3 lisa nucleotide sequence for the destination vector pLV4301G.

[00214] SEQ ID NO:32 is a nucleotide sequence for the donor vector 1, pMK 7cl2 anti mFC scFv CoOp ECORV SacII L1R5.

[00215] SEQ ID NO:33 is a nucleotide sequence for the donor vector 2, pMK hCD8a scaffold TN L5 L2.

[00216] SEQ ID NO:34 is a nucleotide sequence for the final vector used for lentiviral production, pLV4301G 7C12 scFv mlgG hCD8 flag.

[00217] SEQ ID NO:35 is a nucleotide sequence for the destination vector, pLV4301G.

[00218] SEQ ID NO:36 is a nucleotide sequence for the donor vector 1, pMK 8B3 anti mFC scFv CoOp ECORV SacII L1R5.

[00219] SEQ ID NO:37 is a nucleotide sequence for the donor vector 2, pMK hCD8a scaffold TN L5 L2.

[00220] SEQ ID NO:38 is a nucleotide sequence for the final vector used for lentiviral production, pLV4301G 8B3 scFv mlgG hCD8 flag.

[00221] SEQ ID NO:39 is a nucleotide sequence for pLenti-C-Myc-DDK OX40L vector for lentiviral production.

[00222] SEQ ID NO:40 is a nucleotide sequence for Tel-lb primer used for quantitative polymerase chain reaction measurements of telomere length.

[00223] SEQ ID NO:41 is a nucleotide sequence for Tel-2b primer used for quantitative polymerase chain reaction measurements of telomere length.

[00224] SEQ ID NO:42 is a nucleotide sequence for Tel-lb primer used for quantitative polymerase chain reaction measurements of telomere length.

[00225] SEQ ID NO:43 is a nucleotide sequence for Tel-lb primer used for quantitative polymerase chain reaction measurements of telomere length.DETAILED DESCRIPTION OF THE INVENTION

[00226] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. All patents and publications referred to herein are incorporated by reference in their entireties.Definitions

[00227] The terms “co-administration,” “co-administering,” “administered in combination with,” “administering in combination with,” “simultaneous,” and “concurrent,” as used herein, encompass administration of two or more active pharmaceutical ingredients to a human subject so that both active pharmaceutical ingredients and / or their metabolites are present in the human subject at the same time. Co-administration includes simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which two or more active pharmaceutical ingredients are present. Simultaneous administration in separate compositions and administration in a composition in which both agents are present is also encompassed in the methods of the invention.

[00228] The term “zw vivo" refers to an event that takes place in a subject’s body.

[00229] The term “in vitro" refers to an event that takes places outside of a subject’s body. In vitro assays encompass cell-based assays in which cells alive or dead are employed and may also encompass a cell-free assay in which no intact cells are employed.

[00230] The term “ex vivo ” refers to an event which involves treating or performing a procedure on a cell, tissue and / or organ which has been removed from a subject’s body. Aptly, 44the cell, tissue and / or organ may be returned to the subject’s body in a method of surgery or treatment.

[00231] The term “antigen” refers to a substance that induces an immune response. In some embodiments, an antigen is a molecule capable of being bound by an antibody or a T cell receptor (TCR) if presented by major histocompatibility complex (MHC) molecules. The term “antigen”, as used herein, also encompasses T cell epitopes. An antigen is additionally capable of being recognized by the immune system. In some embodiments, an antigen is capable of inducing a humoral immune response or a cellular immune response leading to the activation of B lymphocytes and / or T lymphocytes. In some cases, this may require that the antigen contains or is linked to a Th cell epitope. An antigen can also have one or more epitopes (e.g., B- and T-epitopes). In some embodiments, an antigen will preferably react, typically in a highly specific and selective manner, with its corresponding antibody or TCR and not with the multitude of other antibodies or TCRs which may be induced by other antigens.

[00232] The term “effective amount” or “therapeutically effective amount” refers to that amount of a compound or combination of compounds as described herein that is sufficient to effect the intended application including, but not limited to, disease treatment. A therapeutically effective amount may vary depending upon the intended application (in vitro or in vivo), or the human subject and disease condition being treated (e.g., the weight, age and gender of the subject), the severity of the disease condition, the manner of administration, etc. which can readily be determined by one of ordinary skill in the art. The term also applies to a dose that will induce a particular response in target cells (e.g., the reduction of platelet adhesion and / or cell migration). The specific dose will vary depending on the particular compounds chosen, the dosing regimen to be followed, whether the compound is administered in combination with other compounds, timing of administration, the tissue to which it is administered, and the physical delivery system in which the compound is carried.

[00233] A “therapeutic effect” as that term is used herein, encompasses a therapeutic benefit and / or a prophylactic benefit in a human subject. A prophylactic effect includes delaying or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof.

[00234] “Pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and inert ingredients. The use of such pharmaceutically acceptable carriers or pharmaceutically acceptable excipients for active pharmaceutical ingredients is well known in the art. Except insofar as any conventional pharmaceutically acceptable carrier or pharmaceutically acceptable excipient is incompatible with the active pharmaceutical ingredient, its use in the therapeutic compositions of the invention is contemplated. Additional active pharmaceutical ingredients, such as other drugs, can also be incorporated into the described compositions and methods.

[00235] The term “rapid expansion” means an increase in the number of antigen-specific TILs of at least about 3-fold (or 4-, 5-, 6-, 7-, 8-, or 9-fold) over a period of a week, more preferably at least about 10-fold (or 20-, 30-, 40-, 50-, 60-, 70-, 80-, or 90-fold) over a period of a week, or most preferably at least about 100-fold over a period of a week. A number of rapid expansion protocols are described herein.

[00236] By “tumor infiltrating lymphocytes” or “TILs” herein is meant a population of cells originally obtained as white blood cells that have left the bloodstream of a subject and migrated into a tumor. TILs include, but are not limited to, CD8+ cytotoxic T cells (lymphocytes), Thl and Thl7 CD4+ T cells, natural killer cells, dendritic cells and Ml macrophages. TILs include both primary and secondary TILs. “Primary TILs” are those that are obtained from patient tissue samples as outlined herein (sometimes referred to herein as “freshly harvested” or “a first population of TILs”), and “secondary TILs” are any TIL cell populations that have been expanded or proliferated as discussed herein, including, but not limited to bulk TILs and expanded TILs (“REP TILs” or “post-REP TILs”, or “second population of TILs” or “third population of TILs” where appropriate).

[00237] TILs can generally be defined either biochemically, using cell surface markers, or functionally, by their ability to infiltrate tumors and effect treatment. TILs can be generally categorized by expressing one or more of the following biomarkers: CD4, CD8, TCR aP, CD27, CD28, CD56, CCR7, CD45Ra, CD95, PD-1, and CD25. Additionally, and alternatively, TILs can be functionally defined by their ability to infiltrate solid tumors upon reintroduction into a patient.

[00238] By “cryopreserved TILs” herein is meant that TILs are treated and stored in the range of about -150 °C to -60 °C. General methods for cryopreservation are also described elsewhere herein, including in the Examples. For clarity, “cryopreserved TILs” are distinguishable from frozen tissue samples which may be used as a source of primary TILs.

[00239] By “thawed cryopreserved TILs” herein is meant a population of TILs that was previously cryopreserved and then treated to return to room temperature or higher, including but not limited to cell culture temperatures or temperatures wherein TILs may be administered to a patient.

[00240] By “population of cells” (including TILs) herein is meant a number of cells that share common traits.

[00241] The term “central memory T cell” refers to a subset of T cells that in the human are CD45R0+ and constitutively express CCR7 (CCR7hi) and CD62L (CD62111). The surface phenotype of central memory T cells also includes TCR, CD3, CD 127 (IL-7R), and IL-15R. Transcription factors for central memory T cells include BCL-6, BCL-6B, MBD2, and BMI1. Central memory T cells primarily secret IL-2 and CD40L as effector molecules after TCR triggering. Central memory T cells are predominant in the CD4 compartment in blood, and in the human are proportionally enriched in lymph nodes and tonsils.

[00242] The term “effector memory T cell” refers to a subset of human or mammalian T cells that, like central memory T cells, are CD45R0+, but have lost the constitutive expression of CCR7 (CCR710) and are heterogeneous or low for CD62L expression (CD62L10). The surface phenotype of central memory T cells also includes TCR, CD3, CD 127 (IL-7R), and IL-15R. Transcription factors for central memory T cells include BLIMP1. Effector memory T cells rapidly secret high levels of inflammatory cytokines following antigenic stimulation, including interferon-y, IL-4, and IL-5. Effector memory T cells are predominant in the CD8 compartment in blood, and in the human are proportionally enriched in the lung, liver, and gut. CD8+ effector memory T cells carry large amounts of perforin.

[00243] The terms “sequence identity,” “percent identity,” and “sequence percent identity” in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acidresidues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences. Suitable programs to determine percent sequence identity include for example the BLAST suite of programs available from the U.S. Government’s National Center for Biotechnology Information BLAST web site. Comparisons between two sequences can be carried using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or MegAlign, available from DNASTAR, are additional publicly available software programs that can be used to align sequences. One skilled in the art can determine appropriate parameters for maximal alignment by particular alignment software. In certain embodiments, the default parameters of the alignment software are used.

[00244] The term “conservative amino acid substitutions” means amino acid sequence modifications which do not abrogate the binding of an antibody to an antigen or a protein to its ligand. Conservative amino acid substitutions include the substitution of an amino acid in one class by an amino acid of the same class, where a class is defined by common physicochemical amino acid side chain properties and high substitution frequencies in homologous proteins found in nature, as determined, for example, by a standard Dayhoff frequency exchange matrix or BLOSUM matrix. Six general classes of amino acid side chains have been categorized and include: Class I (Cys); Class II (Ser, Thr, Pro, Ala, Gly); Class III (Asn, Asp, Gin, Glu); Class IV (His, Arg, Lys); Class V (He, Leu, Vai, Met); and Class VI (Phe, Tyr, Trp). For example, substitution of an Asp for another class III residue such as Asn, Gin, or Glu, is a conservative substitution. Thus, a predicted nonessential amino acid residue in a 4-1BBL or CD86 protein is preferably replaced with another amino acid residue from the same class. Methods of identifying amino acid conservative substitutions which do not eliminate antigen or ligand binding are well-known in the art (see, e.g., Brummell, et aL, Biochemistry 1993, 32, 1180-1187; Kobayashi, et al., Protein Eng. 1999, 12, 879-884 (1999); and Burks, et al.. Proc. Natl. Acad. Sci. USA 1997, 94, 412-417).

[00245] The term “retrovirus” refers to RNA viruses that utilize reverse transcriptase during their replication cycle, wherein retroviral genomic RNA is converted into double-stranded DNA by reverse transcriptase. The double-stranded DNA form is integrated into the chromosome of the infected cell (a “provirus”). The provirus serves as a template for RNA polymerase II and directs the expression of RNA molecules which encode the structural proteins and enzymes needed to produce new viral particles. At each end of the provirus are structures called “long terminal repeats” or “LTRs.” The LTR contains numerous regulatory signals including transcriptional control elements, polyadenylation signals and sequences needed for replication and integration of the viral genome. Several genera included within the family Retroviridae, including Cisternavirus A, Oncovirus A, Oncovirus B, Oncovirus C, Oncovirus D, Lentivirus, Gammaretrovirus, and Spumavirus. Some of the retroviruses are oncogenic (i.e., tumorigenic), while others are not. The oncoviruses induce sarcomas, leukemias, lymphomas, and mammary carcinomas in susceptible species. Retroviruses infect a wide variety of species, and may be transmitted both horizontally and vertically. Because they are integrated into the host DNA, they are capable of transmitting sequences of host DNA from cell to cell. Example gammaretroviral vectors include those derived from the amphotropic Moloney murine leukemia virus (MLV-A), which use cell surface phosphate transporter receptors for entry and then permanently integrate into proliferating cell chromosomes. The amphotropic MLV vector system has been well established and is a popular tool for gene delivery (See, e.g., Gordon and Anderson, Curr. Op.BiotechnoL, 1994, 5, 611-616 and Miller, et al.. Meth. EnzymoL, 1993, 217, 581-599, the disclosures of which are incorporated herein by reference.

[00246] The term “lentivirus” refers to a genus that includes HIV (human immunodeficiency virus; including HIV type 1, and HIV type 2), visna-maedi, which causes encephalitis (visna) or pneumonia (maedi) in sheep, the caprine arthritis-encephalitis virus, which causes immune deficiency, arthritis, and encephalopathy in goats; equine infectious anemia virus, which causes autoimmune hemolytic anemia, and encephalopathy in horses; feline immunodeficiency virus (FIV), which causes immune deficiency in cats; bovine immune deficiency virus (BIV), which causes lymphadenopathy, lymphocytosis, and possibly central nervous system infection in cattle; and simian immunodeficiency virus (SIV), which cause immune deficiency and encephalopathy in sub-human primates. Diseases caused by these viruses are characterized by a long incubationperiod and protracted course. Usually, the viruses latently infect monocytes and macrophages, from which they spread to other cells. HIV, FIV, and SIV also readily infect T lymphocytes (i.e., T cells).

[00247] The term “anti-CD3 antibody” refers to an antibody or variant thereof, e.g., a monoclonal antibody and including human, humanized, chimeric or murine antibodies which are directed against the CD3 receptor in the T cell antigen receptor of mature T cells. Anti-CD3 antibodies include OKT-3, also known as muromonab. Anti-CD3 antibodies also include the UHCT1 clone, also known as T3 and CD3s. Other anti-CD3 antibodies include, for example, otelixizumab, teplizumab, and visilizumab.

[00248] The term “OKT-3” (also referred to herein as “OKT3”) refers to a monoclonal antibody or variant thereof, including human, humanized, chimeric, or murine antibodies, directed against the CD3 receptor in the T cell antigen receptor of mature T cells, and includes commercially-available forms such as OKT-3 (30 ng / mL, MACS GMP CD3 pure, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) and muromonab or variants, conservative amino acid substitutions, glycoforms, or biosimilars thereof. The amino acid sequences of the heavy and light chains of muromonab are given in Table 1 (SEQ ID NO: 1 and SEQ ID NO:2). A hybridoma capable of producing OKT-3 is deposited with the American Type Culture Collection and assigned the ATCC accession number CRL 8001. A hybridoma capable of producing OKT-3 is also deposited with European Collection of Authenticated Cell Cultures (ECACC) and assigned Catalogue No. 86022706.TABLE 1. Amino acid sequences of muromonab.Identifier (Description) Sequence (One-Letter Amino Acid Symbols) SEQ ID NO:1 (Muromonab heavy chain) QVQLQQSGAE NQKFKDKATL KTTAPSVYPL YTLSSSVTVT PSVFLFPPKP STYRWSVLT LTKNQVSLTC QQGNVFSCSV LARPGASVKM TTDKSSSTAY APVCGGTTGS SSTWPSQSIT KDTLMISRTP VLHQDWLNGK LVKGFYPSDI MHEALHNHYT SCKASGYTFT MQLSSLTSED SVTLGCLVKG CNVAHPASST EVTCWVDVS EYKCKVSNKA AVEWESNGQP QKSLSLSPGK RYTMHWVKQR SAVYYCARYY YFPEPVTLTW KVDKKIEPRP HEDPEVKFNW LPAPIEKTIS ENNYKTTPPV PGQGLEWIGY DDHYCLDYWG NSGSLSSGVH KSCDKTHTCP YVDGVEVHNA KAKGQPREPQ LDSDGSFFLY INPSRGYTNY QGTTLTVSSA TFPAVLQSDL PCPAPELLGG KTKPREEQYN VYTLPPSRDE SKLTVDKSRW 60 120 180 240 300 360 420 450 SEQ ID NO:2 (Muromonab light chain) QIVLTQSPAI FRGSGSGTSY SEQLTSGGAS TKDEYERHNS MSASPGEKVT SLTISGMEAE WCFLNNFYP YTCEATHKTS MTCSASSSVS DAATYYCQQW KDINVKWKID TSPIVKSFNR YMNWYQQKSG SSNPFTFGSG GSERQNGVLN NEC TSPKRWIYDT TKLEINRADT SWTDQDSKDS SKLASGVPAH APTVSIFPPS TYSMSSTLTL 60 120 180 213

[00249] The term “IL-2” (also referred to herein as “IL2”) refers to the T cell growth factor known as interleukin-2, and includes all forms of IL-2 including human and mammalian forms, conservative amino acid substitutions, glycoforms, biosimilars, and variants thereof. IL-2 is described, e.g., in Nelson, J. Immunol. 2004,172, 3983-88 and Malek, Annu. Rev. Immunol. 2008, 26, 453-79, the disclosures of which are incorporated by reference herein. The amino acid sequence of recombinant human IL-2 suitable for use in the invention is given in Table 2 (SEQ ID NO:3). For example, the term IL-2 encompasses human, recombinant forms of IL-2 such as aldesleukin (PROLEUKIN, available commercially from multiple suppliers in 22 million IU per single use vials), as well as the form of recombinant IL-2 commercially supplied by CellGenix, Inc., Portsmouth, NH, USA (CELLGRO GMP) or ProSpec-Tany TechnoGene Ltd., East Brunswick, NJ, USA (Cat. No. CYT-209-b) and other commercial equivalents from other vendors. Aldesleukin (des-alanyl-1, serine-125 human IL-2) is a nonglycosylated human recombinant form of IL-2 with a molecular weight of approximately 15 kDa. The amino acid sequence of aldesleukin suitable for use in the invention is given in Table 2 (SEQ ID NO:4). The term IL-2 also encompasses pegylated forms of IL-2, as described herein, including the pegylated IL2 prodrug NKTR-214, available from Nektar Therapeutics, South San Francisco, CA, USA. NKTR-214 and pegylated IL-2 suitable for use in the invention is described in U.S. Patent Application Publication No. US 2014 / 0328791 Al and International Patent Application Publication No. WO 2012 / 065086 Al, the disclosures of which are incorporated by reference herein. Alternative forms of conjugated IL-2 suitable for use in the invention are described in U.S. Patent Nos. 4,766,106, 5,206,344, 5,089,261 and 4902,502, the disclosures of which are incorporated by reference herein. Formulations of IL-2 suitable for use in the invention are described in U.S. Patent No. 6,706,289, the disclosure of which is incorporated by reference herein.

[00250] The term “IL-7” (also referred to herein as “IL7”) refers to a glycosylated tissue-derived cytokine known as interleukin 7, which may be obtained from stromal and epithelial cells, as well as from dendritic cells. Fry and Mackall, Blood 2002, 99, 3892-904. IL-7 can stimulate the development of T cells. IL-7 binds to the IL-7 receptor, a heterodimer consisting of IL-7 receptor alpha and common gamma chain receptor, which in a series of signals important for T cell development within the thymus and survival within the periphery. Recombinanthuman IL-7 suitable for use in the invention is commercially available from multiple suppliers, including ProSpec-Tany TechnoGene Ltd., East Brunswick, NJ, USA (Cat. No. CYT-254) and ThermoFisher Scientific, Inc., Waltham, MA, USA (human IL-7 recombinant protein, Cat. No. Gibco PHC0071). The amino acid sequence of recombinant human IL-7 suitable for use in the invention is given in Table 2 (SEQ ID NO:5).

[00251] The term “IL-15” (also referred to herein as “IL15”) refers to the T cell growth factor known as interleukin-15, and includes all forms of IL-2 including human and mammalian forms, conservative amino acid substitutions, glycoforms, biosimilars, and variants thereof. IL-15 is described, e.g., in Fehniger and Caligiuri, Blood 2001, 97, 14-32, the disclosure of which is incorporated by reference herein. IL-15 shares P and y signaling receptor subunits with IL-2. Recombinant human IL-15 is a single, non-glycosylated polypeptide chain containing 114 amino acids (and an N-terminal methionine) with a molecular mass of 12.8 kDa. Recombinant human IL-15 is commercially available from multiple suppliers, including ProSpec-Tany TechnoGene Ltd., East Brunswick, NJ, USA (Cat. No. CYT-230-b) and ThermoFisher Scientific, Inc., Waltham, MA, USA (human IL-15 recombinant protein, Cat. No. 34-8159-82). The amino acid sequence of recombinant human IL-15 suitable for use in the invention is given in Table 2 (SEQ IDNO:6).

[00252] The term “IL-21” (also referred to herein as “IL21”) refers to the pleiotropic cytokine protein known as interleukin-21, and includes all forms of IL-21 including human and mammalian forms, conservative amino acid substitutions, glycoforms, biosimilars, and variants thereof. IL-21 is described, e.g., in Spolski and Leonard, Nat. Rev. Drug. Disc. 2014,13, 379-95, the disclosure of which is incorporated by reference herein. IL-21 is primarily produced by natural killer T cells and activated human CD4+ T cells. Recombinant human IL-21 is a single, non-glycosylated polypeptide chain containing 132 amino acids with a molecular mass of 15.4 kDa. Recombinant human IL-21 is commercially available from multiple suppliers, including ProSpec-Tany TechnoGene Ltd., East Brunswick, NJ, USA (Cat. No. CYT-408-b) and ThermoFisher Scientific, Inc., Waltham, MA, USA (human IL-21 recombinant protein, Cat. No. 14-8219-80). The amino acid sequence of recombinant human IL-21 suitable for use in the invention is given in Table 2 (SEQ ID NO:7).TABLE 2. Amino acid sequences of interleukins.Identifier (Description) Sequence (One-Letter Amino Acid Symbols) SEQ ID NO:3 MAPTSSSTKK TQLQLEHLLL DLQMILNGIN NYKNPKLTRM LTFKFYMPKK ATELKHLQCL 60 ( recombinant human IL-2 (rhIL-2)) EEELKPLEEV RWITFCQSII LNLAQSKNFH STLT LRPRDLISNI NVIVLELKGS ettfmceyad ETATIVEFLN 120 134 SEQ ID NO:4 PTSSSTKKTQ LQLEHLLLDL QMILNGINNY KNPKLTRMLT FKFYMPKKAT ELKHLQCLEE 60 (aldesleukin) ELKPLEEVLN ITFSQSIIST LAQSKNFHLR LT PRDLISNINV IVLELKGSET TFMCEYADET ATIVEFLNRW 120 132 SEQ ID NO:5 MDCDIEGKDG KQYESVLMVS IDQLLDSMKE IGSNCLNNEF NFFKRHICDA NKEGMFLFRA 60 ( recombinant human IL-7 (rhIL-7)) ARKLRQFLKM KEQKKLNDLC NSTGDFDLHL FLKRLLQEIK LKVSEGTTIL TCWNKILMGT LNCTGQVKGR KEH KPAALGEAQP TKSLEENKSL 120 153 SEQ ID NO:6 MNWVNVISDL KKIEDLIQSM HIDATLYTES DVHPSCKVTA MKCFLLELQV ISLESGDASI 60 ( recombinant human IL-15 (rhIL-15)) HDTVENLIIL ANNSLSSNGN VTESGCKECE ELEEKNIKEF LQSFVHIVQM FINTS 115 SEQ ID NO:7 MQDRHMIRMR QLIDIVDQLK NYVNDLVPEF LPAPEDVETN CEWSAFSCFQ KAQLKSANTG 60 ( recombinant human IL-21 (rhIL-21)) NNERIINVSI HLSSRTHGSE KKLKRKPPST DS NAGRRQKHRL TCPSCDSYEK KPPKEFLERF KSLLQKMIHQ 120 132

[00253] The term “myeloid cell” as used herein refers to cells of the myeloid lineage or derived therefrom. The myeloid lineage includes a number of morphologically, phenotypically, and functionally distinct cell types including different subsets of granulocytes (neutrophils, eosinophils, and basophils), monocytes, macrophages, erythrocytes, megakaryocytes, and mast cells. In certain embodiments, the myeloid cell is a cell derived from a cell line of myeloid lineage.

[00254] “MOLM-14” refers to a human leukemia cell line which was established from the peripheral blood of a patient with relapsed acute monocytic leukemia, and initial phenotypic characterization indicated the presence of at least the following markers: CD4, CD9, CD1 la, CD13, CD14, CD15, CD32, CD33, CD64, CD65, CD87, CD92, CD93, CD116, CD118, and CD155. Matsuo, et aL, Leukemia 1997, 11, 1469-77. Additional phenotypic characterization of MOLM-14 found higher levels of HLA-A / B / C, CD64, CD80, ICOS-L, CD58, and lower levels of CD86. The MOLM-14 cell line is deposited at DSMZ under Accession No. ACC777. The closely related MOLM-13 cell line is deposited at DSMZ under Accession No. ACC554. As used herein the term “MOLM-14 cell” refers to a MOLM-14 cell and / or a cell derived from the deposited MOLM-14 parental cell line. As used herein the term “MOLM-13 cell” refers to a MOLM-13 cell and / or a cell derived from the deposited MOLM-13 parental cell line.

[00255] “EM-3” refers to a human cell line was established from the bone marrow of a patient with Philadelphia chromosome-positive CML. Konopka, etaL, Proc. Nat’I Acad. Sci. USA 1985, 82, 1810-4. Phenotypic characterization for EM-3 cells indicates the presence of at least the following markers: CD13, CD15, and CD33. The EM-3 cell line is deposited at DSMZ under Accession No. ACC 134 whilst the closely related EM-2 cell line is deposited at DSMZ under Accession No. ACC 135. As used herein the term “EM-3 cell” refers to a EM-3 cell and / or a cell derived from the deposited EM-3 parental cell line.

[00256] As used herein, the term “a CD86 protein” may refer to a protein comprising an amino acid sequence as set forth in SEQ ID NO:8 or a protein comprising an amino acid sequence having at least 90% sequence identity to the amino acid sequence depicted in SEQ ID NO:8, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[00257] As used herein, the term “4-1BBL” or “CD137L” may refer to a protein comprising an amino acid sequence as set forth in SEQ ID NO:9 or a protein comprising an amino acid sequence having at least 90% sequence identity to the amino acid sequence depicted in SEQ ID NO:9, e.g, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[00258] As used herein, the term “OX40L” or “CD137L” may refer to a protein comprising an amino acid sequence as set forth in SEQ ID NOTO or a protein comprising an amino acid sequence having at least 90% sequence identity to the amino acid sequence depicted in SEQ ID NOTO, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[00259] The term “biosimilar” means a biological product, including a monoclonal antibody or fusion protein, that is highly similar to a U.S. licensed reference biological product notwithstanding minor differences in clinically inactive components, and for which there are no clinically meaningful differences between the biological product and the reference product in terms of the safety, purity, and potency of the product. Furthermore, a similar biological or “biosimilar” medicine is a biological medicine that is similar to another biological medicine that has already been authorized for use by the European Medicines Agency. The term “biosimilar” is also used synonymously by other national and regional regulatory agencies. Biological products or biological medicines are medicines that are made by or derived from a biological source, such as a bacterium or yeast. They can consist of relatively small molecules such ashuman insulin or erythropoietin, or complex molecules such as monoclonal antibodies. For example, if the reference IL-2 protein is aldesleukin (PROLEUKIN), a protein approved by drug regulatory authorities with reference to aldesleukin is a “biosimilar to” aldesleukin or is a “biosimilar thereof’ of aldesleukin. In Europe, a similar biological or “biosimilar” medicine is a biological medicine that is similar to another biological medicine that has already been authorized for use by the European Medicines Agency (EMA). The relevant legal basis for similar biological applications in Europe is Article 6 of Regulation (EC) No 726 / 2004 and Article 10(4) of Directive 2001 / 83 / EC, as amended and therefore in Europe, the biosimilar may be authorized, approved for authorization or subject of an application for authorization under Article 6 of Regulation (EC) No 726 / 2004 and Article 10(4) of Directive 2001 / 83 / EC. The already authorized original biological medicinal product may be referred to as a “reference medicinal product” in Europe. Some of the requirements for a product to be considered a biosimilar are outlined in the CHMP Guideline on Similar Biological Medicinal Products. In addition, product specific guidelines, including guidelines relating to monoclonal antibody biosimilars, are provided on a product-by-product basis by the EMA and published on its website. A biosimilar as described herein may be similar to the reference medicinal product by way of quality characteristics, biological activity, mechanism of action, safety profiles and / or efficacy. In addition, the biosimilar may be used or be intended for use to treat the same conditions as the reference medicinal product. Thus, a biosimilar as described herein may be deemed to have similar or highly similar quality characteristics to a reference medicinal product. Alternatively, or in addition, a biosimilar as described herein may be deemed to have similar or highly similar biological activity to a reference medicinal product. Alternatively, or in addition, a biosimilar as described herein may be deemed to have a similar or highly similar safety profile to a reference medicinal product. Alternatively, or in addition, a biosimilar as described herein may be deemed to have similar or highly similar efficacy to a reference medicinal product. As described herein, a biosimilar in Europe is compared to a reference medicinal product which has been authorized by the EMA. However, in some instances, the biosimilar may be compared to a biological medicinal product which has been authorized outside the European Economic Area (a non-EEA authorized “comparator”) in certain studies. Such studies include for example certain clinical and in vivo non-clinical studies. As used herein, the term “biosimilar” also relates to abiological medicinal product which has been or may be compared to a non-EEA authorized comparator. Certain biosimilars are proteins such as antibodies, antibody fragments (for example, antigen binding portions) and fusion proteins. A protein biosimilar may have an amino acid sequence that has minor modifications in the amino acid structure (including for example deletions, additions, and / or substitutions of amino acids) which do not significantly affect the function of the polypeptide. The biosimilar may comprise an amino acid sequence having a sequence identity of 97% or greater to the amino acid sequence of its reference medicinal product, e.g., 97%, 98%, 99% or 100%. The biosimilar may comprise one or more post-translational modifications, for example, although not limited to, glycosylation, oxidation, deamidation, and / or truncation which is / are different to the post-translational modifications of the reference medicinal product, provided that the differences do not result in a change in safety and / or efficacy of the medicinal product. The biosimilar may have an identical or different glycosylation pattern to the reference medicinal product. Particularly, although not exclusively, the biosimilar may have a different glycosylation pattern if the differences address or are intended to address safety concerns associated with the reference medicinal product. Additionally, the biosimilar may deviate from the reference medicinal product in for example its strength, pharmaceutical form, formulation, excipients and / or presentation, providing safety and efficacy of the medicinal product is not compromised. The biosimilar may comprise differences in for example pharmacokinetic (PK) and / or pharmacodynamic (PD) profiles as compared to the reference medicinal product but is still deemed sufficiently similar to the reference medicinal product as to be authorized or considered suitable for authorization. In certain circumstances, the biosimilar exhibits different binding characteristics as compared to the reference medicinal product, wherein the different binding characteristics are considered by a Regulatory Authority such as the EMA not to be a barrier for authorization as a similar biological product. The term “biosimilar” is also used synonymously by other national and regional regulatory agencies.

[00260] As used herein, the term “variant” encompasses but is not limited to proteins, antibodies or fusion proteins which comprise an amino acid sequence which differs from the amino acid sequence of a reference protein or antibody by way of one or more substitutions, deletions and / or additions at certain positions within or adjacent to the amino acid sequence of the reference protein or antibody. The variant may comprise one or more conservativesubstitutions in its amino acid sequence as compared to the amino acid sequence of a reference protein or antibody. Conservative substitutions may involve, e.g., the substitution of similarly charged or uncharged amino acids. The variant retains the ability to specifically bind to the antigen of the reference protein or antibody. The term “variant” also includes pegylated antibodies or proteins.

[00261] “Pegylation” refers to a modified antibody, or a fragment thereof, or protein that typically is reacted with polyethylene glycol (PEG), such as a reactive ester or aldehyde derivative of PEG, under conditions in which one or more PEG groups become attached to the antibody, antibody fragment, or protein. Pegylation may, for example, increase the biological (e.g., serum) half life of the antibody or protein. Preferably, the pegylation is carried out via an acylation reaction or an alkylation reaction with a reactive PEG molecule (or an analogous reactive water-soluble polymer). As used herein, the term “polyethylene glycol” is intended to encompass any of the forms of PEG that have been used to derivatize other proteins, such as mono (C1-C10) alkoxy- or aryloxy-polyethylene glycol or polyethylene glycol-maleimide. The antibody or protein to be pegylated may be an aglycosylated antibody. Methods for pegylation are known in the art and can be applied to the antibodies and proteins described herein, as described for example in European Patent Nos. EP 0154316 and EP 0401384.

[00262] The terms “about” and “approximately” mean within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, more preferably still within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the terms “about” or “approximately” depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art. Moreover, as used herein, the terms “about” and “approximately” mean that dimensions, sizes, formulations, parameters, shapes and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art. In general, a dimension, size, formulation, parameter, shape or other quantity or characteristic is “about” or “approximate” whether or not expressly stated to be such. It is noted that embodiments of very different sizes, shapes and dimensions may employ the described arrangements.

[00263] The transitional terms “comprising,” “consisting essentially of,” and “consisting of,” when used in the appended claims, in original and amended form, define the claim scope with respect to what unrecited additional claim elements or steps, if any, are excluded from the scope of the claim(s). The term “comprising” is intended to be inclusive or open-ended and does not exclude any additional, unrecited element, method, step or material. The term “consisting of’ excludes any element, step or material other than those specified in the claim and, in the latter instance, impurities ordinary associated with the specified material(s). The term “consisting essentially of’ limits the scope of a claim to the specified elements, steps or material(s) and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. All compositions, methods, and kits described herein that embody the present invention can, in alternate embodiments, be more specifically defined by any of the transitional terms “comprising,” “consisting essentially of,” and “consisting of.”Artificial Antigen Presenting Cells

[00264] In an embodiment, the invention includes an isolated artificial antigen presenting cell (aAPC) comprising a cell that expresses HLA-A / B / C, CD64, CD80, ICOS-L, and CD58, and is modified to express one or more costimulatory molecules. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell that is modified to express one or more costimulatory molecules. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell that is modified to express one or more costimulatoiy molecules.

[00265] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell that endogenously expresses HLA-A / B / C, CD64, CD80, ICOS-L, and CD58, wherein the cell is modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8, and conservative amino acid substitutions thereof, and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, and conservative amino acid substitutions thereof, and wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-14 cell.

[00266] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cell expresses CD86 and 4-1BBL. In an embodiment, the invention includes an aAPCcomprising a MOLM-13 cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-13 cell expresses CD86 and 4-1BBL. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00267] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8, and conservative amino acid substitutions thereof, and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, and conservative amino acid substitutions thereof, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00268] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-14 cell. In an embodiment, theinvention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00269] In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8, and conservative amino acid substitutions thereof, and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, and conservative amino acid substitutions thereof, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00270] In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence 60with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00271] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise anucleic acid encoding CD86 and a nucleic acid encoding OX40L, and wherein the MOLM-14 cell expresses CD86 and OX40L. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding OX40L, and wherein the MOLM-13 cell expresses CD86 and OX40L. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00272] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8, and conservative amino acid substitutions thereof, and a OX40L protein comprising an amino acid sequence as set forth in SEQ ID NO: 10, and conservative amino acid substitutions thereof, wherein the CD86 protein and the OX40L protein are expressed on the surface of the MOLM-13 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00273] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 97%identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a CD86 protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the MOLM-14 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00274] In any of the foregoing embodiments, it will be understood that an aAPC comprising a MOLM-14 or MOLM-13 cell may be modified to express both OX40L and 4-1BBL.

[00275] The sequences for human CD86, human 4-1BBL (CD137L), and human OX40L (CD134L) are given in Table 3.TABLE 3. Amino acid sequences for human CD86, human 4-1BBL, and human OX40L.Identifier (Description) Sequence (One-Letter Amino Acid Symbols) SEQ ID NO:8 (human CD86) MGLSNILFVM AFLLSGAAPL KIQAYFNETA DLPCQFANSQ NQSLSELWF WQDQENLVLN 60 EVYLGKEKFD SVHSKYMGRT SFDSDSWTLR LHNLQIKDKG LYQCIIHHKK PTGMIRIHQM 120 NSELSVLANF SQPEIVPISN ITENVYINLT CSSIHGYPEP KKMSVLLRTK NSTIEYDGIM 180 QKSQDNVTEL YDVSISLSVS FPDVTSNMTI FCILETDKTR LLSSPFSIEL EDPQPPPDHI 240 PWITAVLPTV IICVMVFCLI LWKWKKKKRP RNSYKCGTNT MEREESEQTK KREKIHIPER 300 SDEAQRVFKS SKTSSCDKSD TCF 323 SEQ ID NO:9 (human 4-1BBL, CD137) MEYASDASLD PEAPWPPAPR ARACRVLPWA LVAGLLLLLL LAAACAVFLA CPWAVSGARA 60 SPGSAASPRL REGPELSPDD PAGLLDLRQG MFAQLVAQNV LLIDGPLSWY SDPGLAGVSL 120 TGGLSYKEDT KELWAKAGV YYVFFQLELR RWAGEGSGS VSLALHLQPL RSAAGAAALA 18 0 LTVDLPPASS EARNSAFGFQ GRLLHLSAGQ RLGVHLHTEA RARHAWQLTQ GATVLGLFRV 240 TPEIPAGLPS PRSE 254 SEQ ID NO:10 (human OX40L, CD134L) MERVQPLEEN VGNAARPRFE RNKLLLVASV IQGLGLLLCF TYICLHFSAL QVSHRYPRIQ 60 SIKVQFTEYK KEKGFILTSQ KEDEIMKVQN NSVIINCDGF YLISLKGYFS QEVNISLHYQ 120 KDEEPLFQLK KVRSVNSLMV ASLTYKDKVY LNVTTDNTSL DDFHVNGGEL ILIHQNPGEF 180 CVL 183

[00276] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as set forth in SEQ ID NO: 13, and conservative amino acid substitutions thereof, and a third protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12, and conservative amino acid substitutions thereof. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as set forth in SEQ ID NO:13, and conservative amino acid substitutions thereof, and a third protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12, and conservative amino acid substitutions thereof. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00277] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence withgreater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00278] In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence withgreater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00279] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as set forth in SEQ ID NO: 14, and conservative amino acid substitutions thereof, and a third protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12, and conservative amino acid substitutions thereof. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as set forth in SEQ ID NO:14, and conservative amino acid substitutions thereof, and a third protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12, and conservative amino acid substitutions thereof. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00280] In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, theinvention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-14 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00281] In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, theinvention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising a MOLM-13 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00282] The sequences for the ligands to which human CD86 binds (CD28 and CTLA-4), the ligand to which human 4-1BBL binds (4-1BB), and the ligand to which human OX40L binds (OX40) are given in Table 4.TABLE 4. Amino acid sequences for human CD28, human CTLA-4, human 4-IBB, and human 0X40.Identifier (Description) Sequence (One-Letter Amino Acid Symbols) SEQ ID NO: 11 MLRLLLALNL FPSIQVTGNK ILVKQSPMLV AYDNAVNLSC KYSYNLFSRE FRASLHKGLD 60 (human CD2 8 ) SAVEVCWYG PYLDNEKSNG SKRSRLLHSD NYSQQLQVYS TIIHVKGKHL YMNMTPRRPG KTGFNCDGKL CPSPLFPGPS PTRKHYQPYA GNESVTFYLQ KPFWVLVWG PPRDFAAYRS NLYVNQTDIY GVLACYSLLV FCKIEVMYPP TVAFIIFWVR 120 180 220 SEQ ID NO: 12 MACLGFQRHK AQLNLATRTW PCTLLFFLLF IPVFCKAMHV AQ PAWLASS RGIASFVCEY 60 (human CTLA-4 ) ASPGKATEVR AMDTGLYICK LTAVSLSKML VTVLRQADSQ VELMYPPPYY KKRSPLTTGV VTEVCAATYM LGIGNGTQIY YVKMPPTEPE MGNELTFLDD VIDPEPCPDS CEKQFQPYFI SICTGTSSGN DFLLWILAAV PIN QVNLTIQGLR SSGLFFYSFL 120 180 223 SEQ ID NO: 13 MGNSCYNIVA TLLLVLNFER TRSLQDPCSN CPAGTFCDNN RNQICSPCPP NSFSSAGGQR 60 (human 4-1BB) TCDICRQCKG CFGTFNDQKR PGHSPQIISF CSCRFPEEEE VFRTRKECSS GICRPWTNCS FLALTSTALL GGCEL TSNAECDCTP LDGKSVLVNG FLLFFLTLRF GFHCLGAGCS TKERDWCGP SWKRGRKKL MCEQDCKQGQ SPADLSPGAS LYIFKQPFMR ELTKKGCKDC SVTPPAPARE PVQTTQEEDG 120 180 240 255 SEQ ID NO: 14 MCVGARRLGR GPCAALLLLG LGLSTVTGLH CVGDTYPSND RCCHECRPGN GMVSRCSRSQ 60 (human OX4 0) NTVCRPCGPG PGVDCAPCPP GPPARPITVQ RRDQRLPPDA FYNDWSSKP GHFSPGDNQA PTEAWPRTSQ HKPPGGGSFR CKPCTWCNLR CKPWTNCTLA GPSTRPVEVP TPIQEEQADA SGSERKQLCT GKHTLQPASN GGRAVAAILG HSTLAKI ATQDTVCRCR SSDAICEDRD LGLVLGLLGP AGTQPLDSYK PPATQPQETQ LAILLALYLL 120 180 240 277

[00283] In an embodiment, the invention includes an isolated artificial antigen presenting cell (aAPC) comprising a cell that expresses HLA-A / B / C, ICOS-L, and CD58, and is modified to express one or more costimulatoiy molecules, wherein the aAPC is derived from an EM-3 parental cell line. In an embodiment, the invention includes an aAPC comprising an EM-3 cell that is modified to express one or more costimulatoiy molecules. In an embodiment, the invention includes an aAPC comprising an EM-2 cell that is modified to express one or more costimulatoiy molecules.

[00284] In an embodiment, the invention includes an aAPC comprising an EM-3 cell that expresses HLA-A / B / C, ICOS-L, and CD58, wherein the cell is modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8, and conservative amino acid substitutions thereof, and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, and conservative amino acid substitutions thereof, and wherein the CD86 protein and the 4-1 BBL protein are expressed on the surface of the EM-3 cell.

[00285] In an embodiment, the invention includes an aAPC comprising an EM-3 cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the EM-3 cell expresses CD86 and 4-1BBL. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00286] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00287] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface ofthe EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00288] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as set forth in SEQ ID NO:13, and conservative amino acid substitutions thereof, and a third protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12, and conservative amino acid substitutions thereof. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00289] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth proteincomprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00290] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a single chain fragment variable (scFv) binding domain, such as clones 7C12 and 8B3 described herein, to bind the Fc domain of a monoclonal antibody, such as OKT-3, providing an additional proliferative signal.

[00291] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00292] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 98% 72identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00293] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as set forth in SEQ ID NO:13, and conservative amino acid substitutions thereof, and a third protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12, and conservative amino acid substitutions thereof. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00294] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 13 and a third protein that binds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00295] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a single chain fragment variable (scFv) binding domain, such as clones 7C12 and 8B3 described herein, to bind the Fc domain of a monoclonal antibody, such as OKT-3, providing an additional proliferative signal.

[00296] In an embodiment, the invention includes an aAPC comprising an EM-3 or an EM-2 cell modified as depicted in FIG. 96. In an embodiment, the invention includes an aAPC comprising an EM-3 or an EM-2 cell modified as depicted in FIG. 97. In an embodiment, the invention includes an aAPC comprising an EM-3 or an EM-2 cell modified as depicted in FIG. 98.

[00297] In an embodiment, the invention includes an aAPC comprising an EM-3 cell that expresses HLA-A / B / C, ICOS-L, and CD58, wherein the cell is modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8, and conservative amino acid substitutions thereof, and a OX40L protein comprising an amino acid sequence as set forth in SEQ ID NO: 10, and conservative amino acid substitutions thereof, and wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-3 cell.

[00298] In an embodiment, the invention includes an aAPC comprising an EM-3 cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding OX40L, and wherein the EM-3 cell expresses CD86 and OX40L. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00299] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00300] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence withgreater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes an aAPC comprising a EM-3 cell modified to express a CD86 protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-3 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00301] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as setforth in SEQ ID NO:14, and conservative amino acid substitutions thereof, and a third protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12, and conservative amino acid substitutions thereof. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00302] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein thatbinds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00303] In an embodiment, the invention includes an aAPC comprising an EM-3 cell modified to express a single chain fragment variable (scFv) binding domain, such as clones 7C12 and 8B3 described herein, to bind the Fc domain of a monoclonal antibody, such as OKT-3, providing an additional proliferative signal.

[00304] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00305] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:8 and aOX40L protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes an aAPC comprising a EM-2 cell modified to express a CD86 protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a OX40L protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 10, wherein the CD86 protein and the OX40L protein are expressed on the surface of the EM-2 cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00306] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as set forth in SEQ ID NO:14, and conservative amino acid substitutions thereof, and a third protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12, and conservative amino acid substitutions thereof. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00307] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 14 and a third protein that binds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00308] In an embodiment, the invention includes an aAPC comprising an EM-2 cell modified to express a single chain fragment variable (scFv) binding domain, such as clones 7C12 and 8B3 described herein, to bind the Fc domain of a monoclonal antibody, such as OKT-3, providing an additional proliferative signal.

[00309] In an embodiment, the invention includes an aAPC comprising an EM-3 or an EM-2 cell modified as depicted in FIG. 96. In an embodiment, the invention includes an aAPC comprising an EM-3 or an EM-2 cell modified as depicted in FIG. 97. In an embodiment, the invention includes an aAPC comprising an EM-3 or an EM-2 cell modified as depicted in FIG. 98.

[00310] In any of the foregoing embodiments, it is understood that an aAPC comprising an EM-3 or EM-2 cell may be modified to express both OX40L and 4-1BBL.

[00311] In an embodiment, the invention includes an isolated artificial antigen presenting cell (aAPC) comprising a cell that expresses CD58, and is modified to express one or more costimulatory molecules, wherein the aAPC is derived from a K562-lineage parental cell line. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell that is modified to express one or more costimulatory molecules. In an embodiment, the K562 lineage parental cell line is deposited under accession no. ATCC CCL-243 and also at European Collection of Authenticated Cell Cultures (ECACCECACC 89121407).

[00312] In an embodiment, the invention includes an aAPC comprising a K562-lineage cell that expresses CD58, wherein the cell is modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8, and conservative amino acid substitutions thereof, and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, and conservative amino acid substitutions thereof, and wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the K562-lineage cell.

[00313] In an embodiment, the invention includes an aAPC comprising a K562-lineage cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the K562-lineage cell expresses CD86 and 4-1BBL. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00314] In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a CD86 protein comprising an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the K562-lineage cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00315] In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a CD86 protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the K562-lineage cell.In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a CD86 protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the K562-lineage cell. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a CD86 protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the K562-lineage cell. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a CD86 protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the K562-lineage cell. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a CD86 protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the K562-lineage cell. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a CD86 protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:8 and a 4-1BBL protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO:9, wherein the CD86 protein and the 4-1BBL protein are expressed on the surface of the K562-lineage cell. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00316] In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a first protein that binds to a second protein comprising an amino acid sequence as set forth in SEQ ID NO: 11, and conservative amino acid substitutions thereof, and athird protein that binds to a fourth protein comprising an amino acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13, and conservative amino acid substitutions thereof. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00317] In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 11 and a third protein that binds to a fourth protein comprising a sequence with greater than 99% identity to an amino acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 11 and a third protein that binds to a fourth protein comprising a sequence with greater than 98% identity to an amino acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13. In an embodiment, the invention includes an aAPC comprising a K562-lineage modified to express a first protein that binds to a second protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 11 and a third protein that binds to a fourth protein comprising a sequence with greater than 97% identity to an amino acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 11 and a third protein that binds to a fourth protein comprising a sequence with greater than 96% identity to an amino acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 11 and a third protein that binds to a fourth protein comprising a sequence with greater than 95% identity to an amino acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13. In an embodiment, the invention includes an aAPC comprising a K562-lineage cell modified to express a first protein that binds to a second protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth inSEQ ID NO: 11 and a third protein that binds to a fourth protein comprising a sequence with greater than 90% identity to an amino acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13. In an embodiment, the invention includes a method of preparing any of the foregoing embodiments of aAPCs.

[00318] In an embodiment, the invention includes an aAPC comprising an K562-lineage cell modified to express a single chain fragment variable (scFv) binding domain, such as clones 7C12 and 8B3 described herein, to bind the Fc domain of a monoclonal antibody, such as OKT-3, providing an additional proliferative signal.Methods of Preparing Artificial Antigen Presenting Cells

[00319] In an embodiment, a method of preparing an aAPC includes the step of stable incorporation of genes for production of CD86 and 4-1BBL. In an embodiment, a method of preparing an aAPC includes the step of retroviral transduction. In an embodiment, a method of preparing an aAPC includes the step of lentiviral transduction. Lentiviral transduction systems are known in the art and are described, e.g., in Levine, et aL,Proc. Nat’I Acad. Sci. 2006,103, 17372-77; Zufferey, et al., Nat. Biotechnol. 1997,15, 871-75; Dull, et al., J. Virology 1998, 72, 8463-71, and U.S. Patent No. 6,627,442, the disclosures of each of which are incorporated by reference herein. In an embodiment, a method of preparing an aAPC includes the step of gamma-retroviral transduction. Gamma-retroviral transduction systems are known in the art and are described, e.g., Cepko and Pear, Cur. Prot. Mol. Biol. 1996, 9.9.1-9.9.16, the disclosure of which is incorporated by reference herein. In an embodiment, a method of preparing an aAPC includes the step of transposon-mediated gene transfer. Transposon-mediated gene transfer systems are known in the art and include systems wherein the transposase is provided as DNA expression vector or as an expressible RNA or a protein such that long-term expression of the transposase does not occur in the transgenic cells, for example, a transposase provided as an mRNA (e.g., an mRNA comprising a cap and poly-A tail). Suitable transposon-mediated gene transfer systems, including the salmonid-type Tel-like transposase (SB or Sleeping Beauty transposase), such as SB 10, SB 11, and SBIOOx, and engineered enzymes with increased enzymatic activity, are described in, e.g., Hackett, etaL,MoL Therapy 2010,18, 674-83 and U.S. Patent No. 6,489,458, the disclosures of each of which are incorporated by reference herein.

[00320] In an embodiment, a method of preparing an aAPC includes the step of stable incorporation of genes for transient production of CD86 and 4-1BBL. In an embodiment, a method of preparing an aAPC includes the step of electroporation. Electroporation methods are known in the art and are described, e.g., in Tsong, Biophys. J. 1991, 60, 297-306, and U.S. Patent Application Publication No. 2014 / 0227237 Al, the disclosures of each of which are incorporated by reference herein. In an embodiment, a method of preparing an aAPC includes the step of calcium phosphate transfection. Calcium phosphate transfection methods (calcium phosphate DNA precipitation, cell surface coating, and endocytosis) are known in the art and are described in Graham and van der Eb, Virology 1973, 52, 456-467; Wigler, et al.. Proc. Natl. Acad. Sci. 1979, 76, 1373-1376; and Chen and Okayarea, Mol. Cell. Biol. 1987, 7, 2745-2752; and in U.S. Patent No. 5,593,875, the disclosures of each of which are incorporated by reference herein. In an embodiment, a method of preparing an aAPC includes the step of liposomal transfection.Liposomal transfection methods, such as methods that employ a 1:1 (w / w) liposome formulation of the cationic lipid 7V-[l-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA) and dioleoyl phophotidylethanolamine (DOPE) in filtered water, are known in the art and are described in Rose, etaL, Biotechniques 1991,10, 520-525 and Feigner, etaL, Proc. Natl. Acad. Sci. USA, 1987, 84, 7413-7417 and in U.S. Patent Nos. 5,279,833; 5,908,635; 6,056,938;6,110,490; 6,534,484; and 7,687,070, the disclosures of each of which are incorporated by reference herein. In an embodiment, a method of preparing an aAPC includes the step of transfection using methods described in U.S. Patent Nos. 5,766,902; 6,025,337; 6,410,517; 6,475,994; and 7,189,705; the disclosures of each of which are incorporated by reference herein.

[00321] In an embodiment, the aAPC is transduced by first using the Gateway cloning method (commercially available from ThermoFisher, Inc.) to prepare vector for lentiviral transduction, followed by lentiviral transduction using the vector and one or more associated helper plasmids, as is also described elsewhere herein. In the Gateway cloning method, a gene is selected (such as CD86) and is then provided with primers and amplified using PCR technology with the help of an attB tagged primer pair. The PCR fragment is then combined with a donor vector (pDONR, such as pDONR221) that includes attP sites to provide an entry clone, using the BP reaction. An integration reaction between the attB and the attP sites combines the PCR fragment with the donor vector. The resulting entry clone contains the gene of interest flanked by attLsites. The LR reaction is then used to combine the entry clone with a destination vector to produce an expression vector. In the LR reaction, a recombination reaction is used to link the entry clone with the destination vector (such as pLV430G) using the attL and attR sites and a clonase enzyme. The attL sites are already found in the entry clone, while the destination vector includes the attR sites. The LR reaction is carried out to transfer the sequence of interest into one or more destination vectors in simultaneous reactions.

[00322] In some embodiments, the aAPCs described herein may be grown and maintained under serum-based media and / or serum free media. According to an exemplary method, aAPCs may be cultured in 24 well plates at a cell density of about 1 x 106 cells per well for 3 to 5 days. The cells may then be isolated and / or washed by centrifugation and resuspended in media or cryopreserved in an appropriate cry opreservation media (e.g., CryoStor 10 (BioLife Solutions)) and stored in a -80 °C freezer.

[00323] In some embodiments, the aAPCs described herein may be grown in the presence of serum-based media. In some embodiments, the aAPCs described herein by may be grown in the presence of serum-based media that includes human serum (hSerum) containing media (e.g., cDMEM with 10% hSerum). In some embodiments, the aAPCs grown in the presence of serumbased media may be selected from the group consisting of aMOLM-13 cells, aMOLM-14 cells, and aEM3 cells.

[00324] In some embodiments, the aAPCs described herein may be grown in the presence of serum free media. In some embodiments, the serum free media may be selected from the group consisting of CTS Optmizer (ThermoFisher), Xvivo-20 (Lonza), Prime T Cell CDM (Irvine), XFSM (MesenCult), and the like. In some embodiments, the aAPCs grown in the presence of serum free media may be selected from the group consisting of aMOLM-13 cells, aMOLM-14 cells, and aEM3 cells.Methods of Expanding Tumor Infiltrating Lymphocytes and T Cells

[00325] In an embodiment, the invention includes a method of expanding tumor infiltrating lymphocytes (TILs), the method comprising contacting a population of TILs comprising at least one TIL with an aAPC described herein, wherein said aAPC comprises at least one costimulatory ligand that specifically binds with a co-stimulatory molecule expressed on thecellular surface of the TILs, wherein binding of said co-stimulatory molecule with said costimulatory ligand induces proliferation of the TILs, thereby specifically expanding TILs.

[00326] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs) using any of the aAPCs of the present disclosure, the method comprising the steps as described in Jin, etaL, J. Immunotherapy 2012, 35, 283-292, the disclosure of which is incorporated by reference herein. For example, the tumor may be placed in enzyme media and mechanically dissociated for approximately 1 minute. The mixture may then be incubated for 30 minutes at 37 °C in 5% CO2 and then mechanically disrupted again for approximately 1 minute. After incubation for 30 minutes at 37 °C in 5% CO2, the tumor may be mechanically disrupted a third time for approximately 1 minute. If after the third mechanical disruption, large pieces of tissue are present, 1 or 2 additional mechanical dissociations may be applied to the sample, with or without 30 additional minutes of incubation at 37 °C in 5% CO2. At the end of the final incubation, if the cell suspension contains a large number of red blood cells or dead cells, a density gradient separation using Ficoll may be performed to remove these cells. TIL cultures were initiated in 24-well plates (Costar 24-well cell culture cluster, flat bottom; Corning Incorporated, Corning, NY), each well may be seeded with lx 106tumor digest cells or one tumor fragment approximately 1 to 8 mm3 in size in 2 mL of complete medium (CM) with IL-2 (6000 lU / mL; Chiron Corp., Emeryville, CA). CM consists of RPMI 1640 with GlutaMAX, supplemented with 10% human AB serum, 25mM Hepes, and 10 mg / mL gentamicin. Cultures may be initiated in gas-permeable flasks with a 40 mL capacity and a 10 cm2 gas-permeable silicon bottom (G-Rex 10; Wilson Wolf Manufacturing, New Brighton, each flask may be loaded with 10-40x106 viable tumor digest cells or 5-30 tumor fragments in 10-40 mL of CM with IL-2. G-Rex 10 and 24-well plates may be incubated in a humidified incubator at 37 °C in 5% CO2 and 5 days after culture initiation, half the media may be removed and replaced with fresh CM and IL-2 and after day 5, half the media may be changed every 2-3 days. Rapid expansion protocol (REP) of TILs may be performed using T-175 flasks and gas-permeable bags or gas-permeable G-Rex flasks, as described elsewhere herein, using the aAPCs of the present disclosure. For REP in T-175 flasks, 1 x 106 TILs may be suspended in 150 mL of media in each flask. The TIL may be cultured with aAPCs of the present disclosure at a ratio described herein, in a 1 to 1 mixture of CM and AIM-V medium (50 / 50 medium), supplementedwith 3000 lU / mL of IL-2 and 30 ng / mL of anti-CD3 antibody (OKT-3). The T-175 flasks may be incubated at 37 °C in 5% CO2. Half the media may be changed on day 5 using 50 / 50 medium with 3000 lU / mL of IL-2. On day 7, cells from 2 T-175 flasks may be combined in a 3L bag and 300mL of AIM-V with 5% human AB serum and 3000 lU / mL of IL-2 may be added to the 300mL of TIL suspension. The number of cells in each bag may be counted every day or two days, and fresh media may be added to keep the cell count between 0.5 and 2.0* 106 cells / mL. For REP in 500 mL capacity flasks with 100 cm2 gas-permeable silicon bottoms (e.g., G-Rex 100, Wilson Wolf Manufacturing, as described elsewhere herein), 5* 106 or 10* 106 TILs may be cultured with aAPCs at a ratio described herein (e.g., 1 to 100) in 400 mL of 50 / 50 medium, supplemented with 3000 lU / mL of IL-2 and 30 ng / mL of anti-CD3 antibody (OKT-3). The G-RexlOO flasks may be incubated at 37 °C in 5% CO2. On day five, 250 mL of supernatant may be removed and placed into centrifuge bottles and centrifuged at 1500 rpm (491 g) for 10 minutes. The obtained TIL pellets may be resuspended with 150 mL of fresh 50 / 50 medium with 3000 lU / mL of IL-2 and added back to the G-Rex 100 flasks. When TIL are expanded serially in G-Rex 100 flasks, on day seven the TIL in each G-Rex 100 are suspended in the 300 mL of media present in each flask and the cell suspension may be divided into three 100 mL aliquots that may be used to seed 3 G-RexlOO flasks. About 150 mL of AIM-V with 5% human AB serum and 3000 lU / mL of IL-2 may then be added to each flask. G-RexlOO flasks may then be incubated at 37 °C in 5% CO2, and after four days, 150 mL of AIM-V with 3000 lU / mL of IL-2 may be added to each G-RexlOO flask. After this, the REP may be completed by harvesting cells on day 14 of culture.

[00327] As described herein, TILs may be expanded advantageously in the presence of serum free media. In some embodiments, the TIL expansion methods described herein may include the use of serum free media rather than serum-based media (e.g., complete media or CM1). In some embodiments, the TIL expansion methods described herein may use serum free media rather than serum-based media. In some embodiments, the serum free media may be selected from the group consisting of CTS Optmizer (ThermoFisher), Xvivo-20 (Lonza), Prime T Cell CDM (Irvine), and the like.

[00328] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium.

[00329] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium,wherein the cell culture medium further comprises IL-2 at an initial concentration of about 3000 lU / mL and OKT-3 antibody at an initial concentration of about 30 ng / mL.

[00330] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium,wherein the population of APCs expands the population of TILs by at least 50-fold over a period of 7 days in a cell culture medium.

[00331] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectorscomprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium,wherein the myeloid cell endogenously expresses HLA-A / B / C, ICOS-L, and CD58.

[00332] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium,wherein the myeloid cell is a MOLM-14 cell.

[00333] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium,wherein the myeloid cell is a MOLM-13 cell.

[00334] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(c) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(d) contacting the population of TILs with the population of aAPCs in a cell culture medium, 90wherein the myeloid cell is a EM-3 cell.

[00335] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium,wherein the CD86 protein comprises an amino acid sequence as set forth in SEQ ID NO:8, or conservative amino acid substitutions thereof, and the 4-1BBL protein comprises an amino acid sequence as set forth in SEQ ID NO:9, or conservative amino acid substitutions thereof.

[00336] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium,wherein the nucleic acid encoding CD86 comprises a nucleic acid sequence as set forth in SEQ ID NO: 19 and the nucleic acid encoding 4-1BBL comprises a nucleic acid sequence as set forth in SEQ ID NO: 16.

[00337] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the expansion is performed using a gas permeable container.

[00338] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium,wherein the ratio of the population of TILs to the population of aAPCs is between 1 to 200 and 1 to 400.

[00339] In an embodiment, the invention provides a method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the myeloid cell expresses a CD86 protein and a 4-1BBL protein, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium, wherein the ratio of the population of TILs to the population of aAPCs is about 1 to 300.

[00340] In an embodiment, the invention provides a method of expanding tumor infiltrating lymphocytes (TILs), the method comprising contacting a population of TILs comprising a population of TILs with a myeloid artificial antigen presenting cell (aAPC), wherein the myeloid aAPC comprises at least two co-stimulatory ligands that specifically bind with at least two costimulatory molecule on the TILs, wherein binding of the co-stimulatory molecules with the costimulatory ligand induces proliferation of the TILs, thereby specifically expanding TILs, and wherein the at least two co-stimulatory ligands comprise CD86 and 4-1BBL.

[00341] In any of the foregoing embodiments, the aAPC may further comprise OX40L in addition to 4-1BBL, or may comprise OX40L instead of 4-1BBL.

[00342] In an embodiment, a method of expanding or treating a cancer includes a step wherein TILs are obtained from a patient tumor sample. A patient tumor sample may be obtained using methods known in the art. For example, TILs may be cultured from enzymatic tumor digests and tumor fragments (about 1 to about 8 mm3 in size) from sharp dissection. Such tumor digests may be produced by incubation in enzymatic media (e.g., Roswell Park Memorial Institute (RPMI) 1640 buffer, 2 mM glutamate, 10 mcg / mL gentamicine, 30 units / mL of DNase and 1.0 mg / mL of collagenase) followed by mechanical dissociation (e.g., using a tissue dissociator). Tumor digests may be produced by placing the tumor in enzymatic media and mechanically dissociating the tumor for approximately 1 minute, followed by incubation for 30 minutes at 37 °C in 5% CO2, followed by repeated cycles of mechanical dissociation and incubation under the foregoing conditions until only small tissue pieces are present. At the end of this process, if the cell suspension contains a large number of red blood cells or dead cells, a density gradient separation using FICOLL branched hydrophilic polysaccharide may be performed to remove these cells. Alternative methods known in the art may be used, such as those described in U.S. Patent Application Publication No. 2012 / 0244133 Al, the disclosure of which is incorporated by reference herein. Any of the foregoing methods may be used in any of the embodiments described herein for methods of expanding TILs or methods treating a cancer.

[00343] In an embodiment, REP can be performed in a gas permeable container using the aAPCs of the present disclosure by any suitable method. For example, TILs can be rapidly expanded using non-specific T cell receptor stimulation in the presence of interleukin-2 (IL-2) or interleukin-15 (IL-15). The non-specific T cell receptor stimulus can include, for example, about 30 ng / mL of an anti-CD3 antibody, e.g. OKT-3, a monoclonal anti-CD3 antibody (commercially available from Ortho-McNeil, Raritan, NJ, USA or Miltenyi Biotech, Auburn, CA, USA) or UHCT-1 (commercially available from BioLegend, San Diego, CA, USA). TILs can be rapidly expanded by further stimulation of the TILs in vitro with one or more antigens, including antigenic portions thereof, such as epitope(s), of the cancer, which can be optionally expressed from a vector, such as a human leukocyte antigen A2 (HLA-A2) binding peptide, e.g., 0.3 pM MART-1 :26-35 (27 L) or gpl 00:209-217 (210M), optionally in the presence of a T cell growth 93factor, such as 300 lU / mL IL-2 or IL-15. Other suitable antigens may include, e.g., NY-ESO-1, TRP-1, TRP-2, tyrosinase cancer antigen, MAGE-A3, SSX-2, and VEGFR2, or antigenic portions thereof. TIL may also be rapidly expanded by re-stimulation with the same antigen(s) of the cancer pulsed onto HLA-A2-expressing antigen-presenting cells. Alternatively, the TILs can be further re-stimulated with, e.g., example, irradiated, autologous lymphocytes or with irradiated HLA-A2+ allogeneic lymphocytes and IL-2.

[00344] In an embodiment, a method for expanding TILs may include using about 5000 mL to about 25000 mL of cell culture medium, about 5000 mL to about 10000 mL of cell culture medium, or about 5800 mL to about 8700 mL of cell culture medium. In an embodiment, a method for expanding TILs may include using about 1000 mL to about 2000 mL of cell medium, about 2000 mL to about 3000 mL of cell culture medium, about 3000 mL to about 4000 mL of cell culture medium, about 4000 mL to about 5000 mL of cell culture medium, about 5000 mL to about 6000 mL of cell culture medium, about 6000 mL to about 7000 mL of cell culture medium, about 7000 mL to about 8000 mL of cell culture medium, about 8000 mL to about 9000 mL of cell culture medium, about 9000 mL to about 10000 mL of cell culture medium, about 10000 mL to about 15000 mL of cell culture medium, about 15000 mL to about 20000 mL of cell culture medium, or about 20000 mL to about 25000 mL of cell culture medium. In an embodiment, expanding the number of TILs uses no more than one type of cell culture medium. Any suitable cell culture medium may be used, e.g., AIM-V cell medium (L-glutamine, 50 pM streptomycin sulfate, and 10 pM gentamicin sulfate) cell culture medium (Invitrogen, Carlsbad, CA, USA). In this regard, the inventive methods advantageously reduce the amount of medium and the number of types of medium required to expand the number of TIL. In an embodiment, expanding the number of TIL may comprise feeding the cells no more frequently than every third or fourth day. Expanding the number of cells in a gas permeable container simplifies the procedures necessary to expand the number of cells by reducing the feeding frequency necessary to expand the cells.

[00345] In an embodiment, the rapid expansion is performed using a gas permeable container. Such embodiments allow for cell populations to expand from about 5 * 105 cells / cm2 to between 10 x 106 and 30 x 106 cells / cm2. In an embodiment, this expansion occurs without feeding. In an embodiment, this expansion occurs without feeding so long as medium resides at a height of 94about 10 cm in a gas-permeable flask. In an embodiment this is without feeding but with the addition of one or more cytokines. In an embodiment, the cytokine can be added as a bolus without any need to mix the cytokine with the medium. Such containers, devices, and methods are known in the art and have been used to expand TILs, and include those described in U.S. Patent Application Publication No. US 2014 / 0377739 Al, International Patent Application Publication No. WO 2014 / 210036 Al, U.S. Patent Application Publication No. US 2013 / 0115617 Al, International Publication No. WO 2013 / 188427 Al, U.S. Patent Application Publication No. US 2011 / 0136228 Al, U.S. Patent No. 8,809,050, International Patent Application Publication No. WO 2011 / 072088 A2, U.S. Patent Application Publication No. US 2016 / 0208216 Al, U.S. Patent Application Publication No. US 2012 / 0244133 Al, International Patent Application Publication No. WO 2012 / 129201 Al, U.S. Patent Application Publication No. US 2013 / 0102075 Al, U.S. Patent No. 8,956,860, International Patent Application Publication No. WO 2013 / 173835 Al, and U.S. Patent Application Publication No. US 2015 / 0175966 Al, the disclosures of which are incorporated herein by reference. Such processes are also described in Jin, etaL, J. Immunotherapy 2012, 35, 283-292, the disclosure of which is incorporated by reference herein.

[00346] In an embodiment, the gas permeable container is a G-Rex 10 flask (Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA). In an embodiment, the gas permeable container includes a 10 cm2 gas permeable culture surface. In an embodiment, the gas permeable container includes a 40 mL cell culture medium capacity. In an embodiment, the gas permeable container provides 100 to 300 million TILs after 2 medium exchanges.

[00347] In an embodiment, the gas permeable container is a G-Rex 100 flask (Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA). In an embodiment, the gas permeable container includes a 100 cm2 gas permeable culture surface. In an embodiment, the gas permeable container includes a 450 mL cell culture medium capacity. In an embodiment, the gas permeable container provides 1 to 3 billion TILs after 2 medium exchanges.

[00348] In an embodiment, the gas permeable container is a G-Rex 100M flask (Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA). In an embodiment, the gas permeable container includes a 100 cm2 gas permeable culture surface. In an embodiment, the gaspermeable container includes a 1000 mL cell culture medium capacity. In an embodiment, the gas permeable container provides 1 to 3 billion TILs without medium exchange.

[00349] In an embodiment, the gas permeable container is a G-Rex 100L flask (Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA). In an embodiment, the gas permeable container includes a 100 cm2 gas permeable culture surface. In an embodiment, the gas permeable container includes a 2000 mL cell culture medium capacity. In an embodiment, the gas permeable container provides 1 to 3 billion TILs without medium exchange.

[00350] In an embodiment, the gas permeable container is a G-Rex 24 well plate (Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA). In an embodiment, the gas permeable container includes a plate with wells, wherein each well includes a 2 cm2 gas permeable culture surface. In an embodiment, the gas permeable container includes a plate with wells, wherein each well includes a 8 mL cell culture medium capacity. In an embodiment, the gas permeable container provides 20 to 60 million cells per well after 2 medium exchanges.

[00351] In an embodiment, the gas permeable container is a G-Rex 6 well plate (Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA). In an embodiment, the gas permeable container includes a plate with wells, wherein each well includes a 10 cm2 gas permeable culture surface. In an embodiment, the gas permeable container includes a plate with wells, wherein each well includes a 40 mL cell culture medium capacity. In an embodiment, the gas permeable container provides 100 to 300 million cells per well after 2 medium exchanges.

[00352] In an embodiment, the cell medium in the first and / or second gas permeable container is unfiltered. The use of unfiltered cell medium may simplify the procedures necessary to expand the number of cells. In an embodiment, the cell medium in the first and / or second gas permeable container lacks beta-mercaptoethanol (BME).

[00353] In an embodiment, the duration of the method comprising obtaining a tumor tissue sample from the mammal; culturing the tumor tissue sample in a first gas permeable container containing cell medium therein; obtaining TILs from the tumor tissue sample; expanding the number of TILs in a second gas permeable container containing cell medium therein using aAPCs for a duration of about 14 to about 42 days, e.g., about 28 days.

[00354] In an embodiment, the rapid expansion uses about 1 x 109 to about 1 x 1011 aAPCs. In an embodiment, the rapid expansion uses about 1 x 109 aAPCs. In an embodiment, the rapid expansion uses about 1 x 1010 aAPCs. In an embodiment, the rapid expansion uses about 1 x 1011 aAPCs.

[00355] In an embodiment, the ratio of TILs to aAPCs (TIL:aAPC) is selected from the group consisting of 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:55, 1:60, 1:65, 1:70, 1:75, 1:80, 1:85, 1:90, 1:95, 1:100, 1:105, 1:110, 1:115, 1:120, 1:125, 1:130, 1:135, 1:140, 1:145, 1:150, 1:155, 1:160, 1:165, 1:170, 1:175, 1:180, 1:185, 1:190, 1:195, 1:200, 1:225, 1:250, 1:275, 1:300, 1:350, 1:400, 1:450, and 1:500. In a preferred embodiment, the ratio of TILs to aAPCs (TIL:aAPC) is about 1:90. In a preferred embodiment, the ratio of TILs to aAPCs (TIL:aAPC) is about 1:95. In a preferred embodiment, the ratio of TILs to aAPCs (TIL:aAPC) is about 1:100. In a preferred embodiment, the ratio of TILs to aAPCs (TIL:aAPC) is about 1:105. In a preferred embodiment, the ratio of TILs to aAPCs (TIL:aAPC) is about 1:110.

[00356] In an embodiment, the ratio of TILs to aAPCs in the rapid expansion is about 1 to 25, about 1 to 50, about 1 to 100, about 1 to 125, about 1 to 150, about 1 to 175, about 1 to 200, about 1 to 225, about 1 to 250, about 1 to 275, about 1 to 300, about 1 to 325, about 1 to 350, about 1 to 375, about 1 to 400, or about 1 to 500. In an embodiment, the ratio of TILs to aAPCs in the rapid expansion is between 1 to 50 and 1 to 300. In an embodiment, the ratio of TILs to aAPCs in the rapid expansion is between 1 to 100 and 1 to 200.

[00357] In an embodiment, the cell culture medium further comprises IL-2. In a preferred embodiment, the cell culture medium comprises about 3000 lU / mL of IL-2. In an embodiment, the cell culture medium comprises about 1000 lU / mL, about 1500 lU / mL, about 2000 lU / mL, about 2500 lU / mL, about 3000 lU / mL, about 3500 lU / mL, about 4000 lU / mL, about 4500 lU / mL, about 5000 lU / mL, about 5500 lU / mL, about 6000 lU / mL, about 6500 lU / mL, about 7000 lU / mL, about 7500 lU / mL, or about 8000 lU / mL of IL-2. In an embodiment, the cell culture medium comprises between 1000 and 2000 lU / mL, between 2000 and 3000 lU / mL, between 3000 and 4000 lU / mL, between 4000 and 5000 lU / mL, between 5000 and 6000 lU / mL, between 6000 and 7000 lU / mL, between 7000 and 8000 lU / mL, or between 8000 lU / mL of IL-2.

[00358] In an embodiment, the cell culture medium comprises an OKT-3 antibody. In a preferred embodiment, the cell culture medium comprises about 30 ng / mL of OKT-3 antibody. In an embodiment, the cell culture medium comprises about 0.1 ng / mL, about 0.5 ng / mL, about 1 ng / mL, about 2.5 ng / mL, about 5 ng / mL, about 7.5 ng / mL, about 10 ng / mL, about 15 ng / mL, about 20 ng / mL, about 25 ng / mL, about 30 ng / mL, about 35 ng / mL, about 40 ng / mL, about 50 ng / mL, about 60 ng / mL, about 70 ng / mL, about 80 ng / mL, about 90 ng / mL, about 100 ng / mL, about 200 ng / mL, about 500 ng / mL, and about 1 pg / mL of OKT-3 antibody. In an embodiment, the cell culture medium comprises between 0.1 ng / mL and 1 ng / mL, between 1 ng / mL and 5 ng / mL, between 5 ng / mL and 10 ng / mL, between 10 ng / mL and 20 ng / mL, between 20 ng / mL and 30 ng / mL, between 30 ng / mL and 40 ng / mL, between 40 ng / mL and 50 ng / mL, and between 50 ng / mL and 100 ng / mL of OKT-3 antibody.

[00359] In an embodiment, a rapid expansion process for TILs may be performed using T-175 flasks and gas permeable bags as previously described (Tran, etal., J. Immunother. 2008, 31, 742-51; Dudley, etaL, J. Immunother. 2003, 26, 332-42) or gas permeable cultureware (G-Rex flasks, commercially available from Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA). For TIL rapid expansion in T-175 flasks, 1 x 106 TILs suspended in 150 mL of media may be added to each T-175 flask. The TILs may be cultured with aAPCs at a ratio of 1 TIL to 100 aAPCs and the cells were cultured in a 1 to 1 mixture of CM and AIM-V medium, supplemented with 3000 IU (international units) per mL of IL-2 and 30 ng per ml of anti-CD3 antibody (e.g., OKT-3). The T-175 flasks may be incubated at 37° C in 5% CO2. Half the media may be exchanged on day 5 using 50 / 50 medium with 3000 IU per mL of IL-2. On day 7 cells from two T-175 flasks may be combined in a 3 liter bag and 300 mL of AIM V with 5% human AB serum and 3000 IU per mL of IL-2 was added to the 300 ml of TIL suspension. The number of cells in each bag was counted every day or two and fresh media was added to keep the cell count between 0.5 and 2.0 x 106 cells / mL.

[00360] In an embodiment, for TIL rapid expansions in 500 mL capacity gas permeable flasks with 100 cm gas-permeable silicon bottoms (G-Rex 100, commercially available from Wilson Wolf Manufacturing Corporation, New Brighton, MN, USA), 5 x 106 or 10 x 106 TIL may be cultured with aAPCs at a ratio of 1 to 100 in 400 mL of 50 / 50 medium, supplemented with 5% human AB serum, 3000 IU per mL of IL-2 and 30 ng per mL of anti-CD3 (OKT-3). The G-Rex 98100 flasks may be incubated at 37°C in 5% CO2. On day 5, 250 mL of supernatant may be removed and placed into centrifuge bottles and centrifuged at 1500 rpm (revolutions per minute; 491 x g) for 10 minutes. The TIL pellets may be re-suspended with 150 mL of fresh medium with 5% human AB serum, 3000 IU per mL of IL-2, and added back to the original G-Rex 100 flasks. When TIL are expanded serially in G-Rex 100 flasks, on day 7 the TIL in each G-Rex 100 may be suspended in the 300 mL of media present in each flask and the cell suspension may be divided into 3 100 mL aliquots that may be used to seed 3 G-Rex 100 flasks. Then 150 mL of AIM-V with 5% human AB serum and 3000 IU per mL of IL-2 may be added to each flask. The G-Rex 100 flasks may be incubated at 37° C in 5% CO2 and after 4 days 150 mL of AIM-V with 3000 IU per mL of IL-2 may be added to each G-Rex 100 flask. The cells may be harvested on day 14 of culture.

[00361] In an embodiment, TILs may be prepared as follows. 2 mm3 tumor fragments are cultured in complete media (CM) comprised of AIM-V medium (Invitrogen Life Technologies, Carlsbad, CA) supplemented with 2 mM glutamine (Mediatech, Inc. Manassas, VA), 100 U / mL penicillin (Invitrogen Life Technologies), 100 pg / mL streptomycin (Invitrogen Life Technologies), 5% heat-inactivated human AB serum (Valley Biomedical, Inc. Winchester, VA) and 600 lU / mL rhIL-2 (Chiron, Emeryville, CA). For enzymatic digestion of solid tumors, tumor specimens were diced into RPMI-1640, washed and centrifuged at 800 rpm for 5 minutes at 15-22°C, and resuspended in enzymatic digestion buffer (0.2 mg / mL Collagenase and 30 units / ml of DNase in RPMI-1640) followed by overnight rotation at room temperature. TILs established from fragments may be grown for 3-4 weeks in CM and expanded fresh or cryopreserved in heat-inactivated HAB serum with 10% dimethylsulfoxide (DMSO) and stored at -180°C until the time of study. Tumor associated lymphocytes (TAL) obtained from ascites collections were seeded at 3 x 106 cells / well of a 24 well plate in CM. TIL growth was inspected about every other day using a low-power inverted microscope.

[00362] In an embodiment, TILs are expanded in gas-permeable containers. Gas-permeable containers have been used to expand TILs using PBMCs using methods, compositions, and devices known in the art, including those described in U.S. Patent Application Publication No. U.S. Patent Application Publication No. 2005 / 0106717 Al, the disclosures of which are incorporated herein by reference. In an embodiment, TILs are expanded in gas-permeable bags.In an embodiment, TILs are expanded using a cell expansion system that expands TILs in gas permeable bags, such as the Xuri Cell Expansion System W25 (GE Healthcare). In an embodiment, TILs are expanded using a cell expansion system that expands TILs in gas permeable bags, such as the WAVE Bioreactor System, also known as the Xuri Cell Expansion System W5 (GE Healthcare). In an embodiment, the cell expansion system includes a gas permeable cell bag with a volume selected from the group consisting of about 100 mL, about 200 mL, about 300 mL, about 400 mL, about 500 mL, about 600 mL, about 700 mL, about 800 mL, about 900 mL, about 1 L, about 2 L, about 3 L, about 4 L, about 5 L, about 6 L, about 7 L, about 8 L, about 9 L, about 10 L, about 11 L, about 12 L, about 13 L, about 14 L, about 15 L, about 16 L, about 17 L, about 18 L, about 19 L, about 20 L, about 25 L, and about 30 L. In an embodiment, the cell expansion system includes a gas permeable cell bag with a volume range selected from the group consisting of between 50 and 150 mL, between 150 and 250 mL, between 250 and 350 mL, between 350 and 450 mL, between 450 and 550 mL, between 550 and 650 mL, between 650 and 750 mL, between 750 and 850 mL, between 850 and 950 mL, and between 950 and 1050 mL. In an embodiment, the cell expansion system includes a gas permeable cell bag with a volume range selected from the group consisting of between 1 L and 2 L, between 2 L and 3 L, between 3 L and 4 L, between 4 L and 5 L, between 5 L and 6 L, between 6 L and 7 L, between 7 L and 8 L, between 8 L and 9 L, between 9 L and 10 L, between 10 L and 11 L, between 11 L and 12 L, between 12 L and 13 L, between 13 L and 14 L, between 14 L and 15 L, between 15 L and 16 L, between 16 L and 17 L, between 17 L and 18 L, between 18 L and 19 L, and between 19 L and 20 L. In an embodiment, the cell expansion system includes a gas permeable cell bag with a volume range selected from the group consisting of between 0.5 L and 5 L, between 5 L and 10 L, between 10 L and 15 L, between 15 L and 20 L, between 20 L and 25 L, and between 25 L and 30 L. In an embodiment, the cell expansion system utilizes a rocking time of about 30 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 15 days, about 16 days, about 17 days, about 18 days, about 19 days, about 20 days, about 21 days, about 22 days, about 23 days,about 24 days, about 25 days, about 26 days, about 27 days, and about 28 days. In an embodiment, the cell expansion system utilizes a rocking time of between 30 minutes and 1 hour, between 1 hour and 12 hours, between 12 hours and 1 day, between 1 day and 7 days, between 7 days and 14 days, between 14 days and 21 days, and between 21 days and 28 days. In an embodiment, the cell expansion system utilizes a rocking rate of about 2 rocks / minute, about 5 rocks / minute, about 10 rocks / minute, about 20 rocks / minute, about 30 rocks / minute, and about 40 rocks / minute. In an embodiment, the cell expansion system utilizes a rocking rate of between 2 rocks / minute and 5 rocks / minute, 5 rocks / minute and 10 rocks / minute, 10 rocks / minute and 20 rocks / minute, 20 rocks / minute and 30 rocks / minute, and 30 rocks / minute and 40 rocks / minute. In an embodiment, the cell expansion system utilizes a rocking angle of about 2°, about 3°, about 4°, about 5°, about 6°, about 7°, about 8°, about 9°, about 10°, about 11°, and about 12°. In an embodiment, the cell expansion system utilizes a rocking angle of between 2° and 3°, between 3° and 4°, between 4° and 5°, between 5° and 6°, between 6° and 7°, between 7° and 8°, between 8° and 9°, between 9° and 10°, between 10° and 11°, and between 11° and 12°.

[00363] In an embodiment, a method of expanding TILs using aAPCs further comprises a step wherein TILs are selected for superior tumor reactivity. Any selection method known in the art may be used. For example, the methods described in U.S. Patent Application Publication No. 2016 / 0010058 Al, the disclosures of which are incorporated herein by reference, may be used for selection of TILs for superior tumor reactivity.

[00364] In an embodiment, the aAPCs of the present invention may be used to expand T cells. Any of the foregoing embodiments of the present invention described for the expansion of TILs may also be applied to the expansion of T cells. In an embodiment, the aAPCs of the present invention may be used to expand CD8+ T cells. In an embodiment, the aAPCs of the present invention may be used to expand CD4+ T cells. In an embodiment, the aAPCs of the present invention may be used to expand T cells transduced with a chimeric antigen receptor (CAR-T). In an embodiment, the aAPCs of the present invention may be used to expand T cells comprising a modified T cell receptor (TCR). The CAR-T cells may be targeted against any suitable antigen, including CD19, as described in the art, e.g., in U.S. Patent Nos. 7,070,995; 7,446,190; 8,399,645; 8,916,381; and 9,328,156; the disclosures of which are incorporated by referenceherein. The modified TCR cells may be targeted against any suitable antigen, including NY-ESO-1, TRP-1, TRP-2, tyrosinase cancer antigen, MAGE-A3, SSX-2, and VEGFR2, or antigenic portions thereof, as described in the art, e.g., in U.S. Patent Nos. 8,367,804 and 7,569,664, the disclosures of which are incorporated by reference herein.Methods of Treating Cancers and Other Diseases

[00365] The compositions and methods described herein can be used in a method for treating diseases. In an embodiment, they are for use in treating hyperproliferative disorders. They may also be used in treating other disorders as described herein and in the following paragraphs. The TILs, populations and compositions thereof described herein may be for use in the treatment of a disease. In an embodiment, the TILs, populations and compositions described herein are for use in the treatment of a hyperproliferative disorder.

[00366] In some embodiments, the hyperproliferative disorder is cancer. In some embodiments, the hyperproliferative disorder is a solid tumor cancer. In some embodiments, the solid tumor cancer is selected from the group consisting of melanoma, ovarian cancer, cervical cancer, nonsmall-cell lung cancer (NSCLC), lung cancer, bladder cancer, breast cancer, cancer caused by human papilloma virus, head and neck cancer, renal cancer, and renal cell carcinoma, pancreatic cancer, and glioblastoma. In some embodiments, the hyperproliferative disorder is a hematological malignancy. In some embodiments, the hematological malignancy is selected from the group consisting of chronic lymphocytic leukemia, acute lymphoblastic leukemia, diffuse large B cell lymphoma, non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, follicular lymphoma, and mantle cell lymphoma.

[00367] In an embodiment, the invention includes a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of (a) obtaining a first population of TILs from a tumor resected from a patient; (b) performing a rapid expansion of the first population of TILs using a population of artificial antigen presenting cells (aAPCs) in a cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 50-fold greater in number than the first population of TILs; and (c) administering a therapeutically effective portion of the second population of TILs to a patient with the cancer. In an embodiment, the aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid 102encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein. In an embodiment, the rapid expansion is performed over a period not greater than 14 days.

[00368] In an embodiment, the invention includes a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of: (a) obtaining a first population of TILs from a tumor resected from a patient; (b) performing an initial expansion of the first population of TILs using a first population of artificial antigen presenting cells (aAPCs) in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 10-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2; (c) performing a rapid expansion of the second population of TILs using a second population of aAPCs in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the first population of TILs; and wherein the second cell culture medium comprises IL-2 and OKT-3; (d) administering a therapeutically effective portion of the third population of TILs to a patient with the cancer. In an embodiment, the aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein. In an embodiment, the rapid expansion is performed over a period not greater than 14 days. In an embodiment, the initial expansion is performed using a gas permeable container.

[00369] In an embodiment, the invention includes a method of treating a cancer with a population of tumor infiltrating lymphocytes (TILs) comprising the steps of: (a) obtaining a first population of TILs from a tumor resected from a patient; (b) performing an initial expansion of the first population of TILs in a first cell culture medium to obtain a second population of TILs, wherein the second population of TILs is at least 10-fold greater in number than the first population of TILs, and wherein the first cell culture medium comprises IL-2; (c) performing a rapid expansion of the second population of TILs using a population of artificial antigen presenting cells (aAPCs) in a second cell culture medium to obtain a third population of TILs, wherein the third population of TILs is at least 50-fold greater in number than the first population of TILs; and wherein the second cell culture medium comprises IL-2 and OKT-3; (d)administering a therapeutically effective portion of the third population of TILs to a patient with the cancer. In an embodiment, the aAPCs comprise MOLM-14 cells transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and a nucleic acid encoding 4-1BBL, and wherein the MOLM-14 cells express a CD86 protein and a 4-1BBL protein. In an embodiment, the rapid expansion is performed over a period not greater than 14 days.

[00370] In an embodiment, the invention includes a method of treating a cancer with a population of TILs, wherein a patient is pre-treated with non-myeloablative chemotherapy prior to an infusion of TILs according to the present disclosure. In an embodiment, the non-myeloablative chemotherapy is cyclophosphamide 60 mg / kg / d for 2 days (days 27 and 26 prior to TIL infusion) and fludarabine 25 mg / m2 / d for 5 days (days 27 to 23 prior to TIL infusion). In an embodiment, after non-myeloablative chemotherapy and TIL infusion (at day 0) according to the present disclosure, the patient receives an intravenous infusion of IL-2 intravenously at 720,000 lU / kg every 8 hours to physiologic tolerance.

[00371] Efficacy of the compounds and combinations of compounds described herein in treating, preventing and / or managing the indicated diseases or disorders can be tested using various models known in the art, which provide guidance for treatment of human disease. For example, models for determining efficacy of treatments for ovarian cancer are described, e.g., in Mullany, etal., Endocrinology 2012,153, 1585-92; and Fong, etal, J. Ovarian Res. 2009, 2, 12. Models for determining efficacy of treatments for pancreatic cancer are described in Herreros-Villanueva, etal., World J. Gastroenterol. 2012,18, 1286-1294. Models for determining efficacy of treatments for breast cancer are described, e.g., in Fantozzi, Breast Cancer Res. 2006, 8, 212. Models for determining efficacy of treatments for melanoma are described, e.g., in Damsky, etaL, Pigment Cell & Melanoma Res. 2010, 23, 853-859. Models for determining efficacy of treatments for lung cancer are described, e.g., in Meuwissen, etal, Genes & Development, 2005,19, 643-664. Models for determining efficacy of treatments for lung cancer are described, e.g., in Kim, Clin. Exp. OtorhinolaryngoL 2009, 2, 55-60; and Sano, Head Neck Oncol. 2009,1, 32.Non-Myeloablative Lymphodepletion with Chemotherapy

[00372] In an embodiment, the invention includes a method of treating a cancer with a population of TILs, wherein a patient is pre-treated with non-myeloablative chemotherapy prior to an infusion of TILs according to the present disclosure. In an embodiment, the invention provides a population of TILs obtainable by a method described herein for use in treating a cancer, wherein the population of TILs is for treating a patient which is pre-treated with non-myeloablative chemotherapy. In an embodiment, the non-myeloablative chemotherapy is cyclophosphamide 60 mg / kg / d for 2 days (days 27 and 26 prior to TIL infusion) and fludarabine 25 mg / m2 / d for 5 days (days 27 to 23 prior to TIL infusion). In an embodiment, after non-myeloablative chemotherapy and TIL infusion (at day 0) according to the present disclosure, the patient receives an intravenous infusion of IL-2 (aldesleukin, commercially available as PROLEUKIN) intravenously at 720,000 lU / kg every 8 hours to physiologic tolerance.

[00373] Experimental findings indicate that lymphodepletion prior to adoptive transfer of tumor-specific T lymphocytes plays a key role in enhancing treatment efficacy by eliminating regulatory T cells and competing elements of the immune system (“cytokine sinks”).Accordingly, some embodiments of the invention utilize a lymphodepletion step (sometimes also referred to as “immunosuppressive conditioning”) on the patient prior to the introduction of the aAPC-expanded TILs of the invention.

[00374] In general, lymphodepletion is achieved using administration of fludarabine or cyclophosphamide (the active form being referred to as mafosfamide) and combinations thereof. Such methods are described in Gassner, etaL, Cancer Immunol. Immunother. 2011, 60, 75-85, Muranski, et al., Nat. Clin. Pract. Oncol., 2006, 3, 668-681, Dudley, et al., J. Clin. Oncol. 2008, 26, 5233-5239, and Dudley, et aL, J. Clin. Oncol. 2005, 23, 2346-2357, all of which are incorporated by reference herein in their entireties.

[00375] In some embodiments, the fludarabine is administered at a concentration of 0.5 pg / mL -10 pg / mL fludarabine. In some embodiments, the fludarabine is administered at a concentration of 1 pg / mL fludarabine. In some embodiments, the fludarabine treatment is administered for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days or more. In some embodiments, the fludarabine is administered at a dosage of 10 mg / kg / day, 15 mg / kg / day, 20 mg / kg / day, 25 mg / kg / day, 30 mg / kg / day, 35 mg / kg / day, 40 mg / kg / day, or 45 mg / kg / day. In some embodiments, the fludarabine treatment is administered for 2-7 days at 35 mg / kg / day. In some 105embodiments, the fludarabine treatment is administered for 4-5 days at 35 mg / kg / day. In some embodiments, the fludarabine treatment is administered for 4-5 days at 25 mg / kg / day.

[00376] In some embodiments, the mafosfamide, the active form of cyclophosphamide, is obtained at a concentration of 0.5 pg / ml -10 pg / ml by administration of cyclophosphamide. In some embodiments, mafosfamide, the active form of cyclophosphamide, is obtained at a concentration of 1 pg / mL by administration of cyclophosphamide. In some embodiments, the cyclophosphamide treatment is administered for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days or more. In some embodiments, the cyclophosphamide is administered at a dosage of 100 mg / m2 / day, 150 mg / m2 / day, 175 mg / m2 / day, 200 mg / m2 / day, 225 mg / m2 / day, 250 mg / m2 / day, 275 mg / m2 / day, or 300 mg / m2 / day. In some embodiments, the cyclophosphamide is administered intravenously (i.v.) In some embodiments, the cyclophosphamide treatment is administered for 2-7 days at 35 mg / kg / day. In some embodiments, the cyclophosphamide treatment is administered for 4-5 days at 250 mg / m2 / day i.v. In some embodiments, the cyclophosphamide treatment is administered for 4 days at 250 mg / m2 / day i.v.

[00377] In some embodiments, lymphodepletion is performed by administering the fludarabine and the cyclophosphamide are together to a patient. In some embodiments, fludarabine is administered at 25 mg / m2 / day i.v. and cyclophosphamide is administered at 250 mg / m2 / day i.v. over 4 days.

[00378] In an embodiment, the lymphodepletion is performed by administration of cyclophosphamide at a dose of 60 mg / m2 / day for two days followed by administration of fludarabine at a dose of 25 mg / m2 / day for five days.Pharmaceutical Compositions, Dosages, and Dosing Regimens

[00379] In an embodiment, TILs expanded using aAPCs of the present disclosure are administered to a patient as a pharmaceutical composition. In an embodiment, the pharmaceutical composition is a suspension of TILs in a sterile buffer. TILs expanded using aAPCs of the present disclosure may be administered by any suitable route as known in the art. Preferably, the TILs are administered as a single infusion, such as an intra-arterial or intravenous infusion, which preferably lasts approximately 30 to 60 minutes. Other suitable routes of administration include intraperitoneal, intrathecal, and intralymphatic administration.

[00380] Any suitable dose of TILs can be administered. Preferably, from about 2.3 * 1010 to about 13.7* 1010 TILs are administered, with an average of around 7.8* 1010 TILs, particularly if the cancer is melanoma. In an embodiment, about 1.2* 1010 to about 4.3 * 1010 of TILs are administered.

[00381] In some embodiments, the number of the TILs provided in the pharmaceutical compositions of the invention is about l><106, 2xl06, 3xl06, 4xl06, 5xl06, 6*106, 7xl06, 8xl06, 9xl06, IxlO7, 2xl07, 3xl07, 4xl07, 5xl07, 6xl07, 7xl07, 8xl07, 9xl07, IxlO8, 2xl08, 3xl08, 4xl08, 5xl08, 6xl08, 7xl08, 8xl08, 9xl08, IxlO9, 2xl09, 3xl09, 4xl09, 5xl09, 6xl09, 7xl09, 8xl09, 9xl09, IxlO10, 2xlO10, 3xl010, 4xlO10, 5xl010, 6xlO10, 7xlO10, 8xl010, 9xlO10, IxlO11, 2xlOu, 3xl0u, 4xlOn, 5xl0u, 6xlOu, 7xlOu, 8xl0u, 9xlOu, IxlO12, 2xl012, 3xl012, 4xl012, 5xl012, 6xl012, 7xl012, 8xl012, 9xl012, IxlO13, 2xl013, 3xl013, 4xl013, 5xl013, 6xl013, 7xl013, 8x 1013, and 9x 1013. In an embodiment, the number of the TILs provided in the pharmaceutical compositions of the invention is in the range of lx106 to 5xl06, 5xl06 to IxlO7, IxlO7 to 5xl07, 5xl07to IxlO8, IxlO8 to 5xl08, 5xl08to IxlO9, IxlO9 to 5xl09, 5xl09to IxlO10, IxlO10 to 5xl010, 5xl010to IxlO11, 5xlOuto IxlO12, IxlO12 to 5xl012, and 5xl012to IxlO13.

[00382] In some embodiments, the concentration of the TILs provided in the pharmaceutical compositions of the invention is less than, for example, 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.009%, 0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001%, 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003%, 0.0002% or 0.0001% w / w, w / v or v / v of the pharmaceutical composition.

[00383] In some embodiments, the concentration of the TILs provided in the pharmaceutical compositions of the invention is greater than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19.75%, 19.50%, 19.25% 19%, 18.75%, 18.50%, 18.25% 18%, 17.75%, 17.50%, 17.25% 17%,16.75%, 16.50%, 16.25% 16%, 15.75%, 15.50%, 15.25% 15%, 14.75%, 14.50%, 14.25% 14%,13.75%, 13.50%, 13.25% 13%, 12.75%, 12.50%, 12.25% 12%, 11.75%, 11.50%, 11.25% 11%,10.75%, 10.50%, 10.25% 10%, 9.75%, 9.50%, 9.25% 9%, 8.75%, 8.50%, 8.25% 8%, 7.75%,7.50%, 7.25% 7%, 6.75%, 6.50%, 6.25% 6%, 5.75%, 5.50%, 5.25% 5%, 4.75%, 4.50%, 4.25%, 4%, 3.75%, 3.50%, 3.25%, 3%, 2.75%, 2.50%, 2.25%, 2%, 1.75%, 1.50%, 125%, 1%, 0.5%, 1070.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.009%, 0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001%, 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003%, 0.0002% or 0.0001% w / w, w / v, or v / v of the pharmaceutical composition.

[00384] In some embodiments, the concentration of the TILs provided in the pharmaceutical compositions of the invention is in the range from about 0.0001% to about 50%, about 0.001% to about 40%, about 0.01% to about 30%, about 0.02% to about 29%, about 0.03% to about 28%, about 0.04% to about 27%, about 0.05% to about 26%, about 0.06% to about 25%, about 0.07% to about 24%, about 0.08% to about 23%, about 0.09% to about 22%, about 0.1% to about 21%, about 0.2% to about 20%, about 0.3% to about 19%, about 0.4% to about 18%, about 0.5% to about 17%, about 0.6% to about 16%, about 0.7% to about 15%, about 0.8% to about 14%, about 0.9% to about 12% or about 1% to about 10% w / w, w / v or v / v of the pharmaceutical composition.

[00385] In some embodiments, the concentration of the TILs provided in the pharmaceutical compositions of the invention is in the range from about 0.001% to about 10%, about 0.01% to about 5%, about 0.02% to about 4.5%, about 0.03% to about 4%, about 0.04% to about 3.5%, about 0.05% to about 3%, about 0.06% to about 2.5%, about 0.07% to about 2%, about 0.08% to about 1.5%, about 0.09% to about 1%, about 0.1% to about 0.9% w / w, w / v or v / v of the pharmaceutical composition.

[00386] In some embodiments, the amount of the TILs provided in the pharmaceutical compositions of the invention is equal to or less than 10 g, 9.5 g, 9.0 g, 8.5 g, 8.0 g, 7.5 g, 7.0 g, 6.5 g, 6.0 g, 5.5 g, 5.0 g, 4.5 g, 4.0 g, 3.5 g, 3.0 g, 2.5 g, 2.0 g, 1.5 g, 1.0 g, 0.95 g, 0.9 g, 0.85 g, 0.8 g, 0.75 g, 0.7 g, 0.65 g, 0.6 g, 0.55 g, 0.5 g, 0.45 g, 0.4 g, 0.35 g, 0.3 g, 0.25 g, 0.2 g, 0.15 g, 0.1 g, 0.09 g, 0.08 g, 0.07 g, 0.06 g, 0.05 g, 0.04 g, 0.03 g, 0.02 g, 0.01 g, 0.009 g, 0.008 g, 0.007 g, 0.006 g, 0.005 g, 0.004 g, 0.003 g, 0.002 g, 0.001 g, 0.0009 g, 0.0008 g, 0.0007 g, 0.0006 g, 0.0005 g, 0.0004 g, 0.0003 g, 0.0002 g, or 0.0001 g.

[00387] In some embodiments, the amount of the TILs provided in the pharmaceutical compositions of the invention is more than 0.0001 g, 0.0002 g, 0.0003 g, 0.0004 g, 0.0005 g, 0.0006 g, 0.0007 g, 0.0008 g, 0.0009 g, 0.001 g, 0.0015 g, 0.002 g, 0.0025 g, 0.003 g, 0.0035 g,0.004 g, 0.0045 g, 0.005 g, 0.0055 g, 0.006 g, 0.0065 g, 0.007 g, 0.0075 g, 0.008 g, 0.0085 g, 0.009 g, 0.0095 g, 0.01 g, 0.015 g, 0.02 g, 0.025 g, 0.03 g, 0.035 g, 0.04 g, 0.045 g, 0.05 g, 0.055 g, 0.06 g, 0.065 g, 0.07 g, 0.075 g, 0.08 g, 0.085 g, 0.09 g, 0.095 g, 0.1 g, 0.15 g, 0.2 g, 0.25 g, 0.3 g, 0.35 g, 0.4 g, 0.45 g, 0.5 g, 0.55 g, 0.6 g, 0.65 g, 0.7 g, 0.75 g, 0.8 g, 0.85 g, 0.9 g, 0.95 g, 1 g, 1.5 g, 2 g, 2.5, 3 g, 3.5, 4 g, 4.5 g, 5 g, 5.5 g, 6 g, 6.5 g, 7 g, 7.5 g, 8 g, 8.5 g, 9 g, 9.5 g, or 10 g-

[00388] The TILs provided in the pharmaceutical compositions of embodiments of the invention are effective over a wide dosage range. The exact dosage will depend upon the route of administration, the form in which the compound is administered, the gender and age of the subject to be treated, the body weight of the subject to be treated, and the preference and experience of the attending physician. The clinically-established dosages of the TILs may also be used if appropriate. The amounts of the pharmaceutical compositions administered using the methods herein, such as the dosages of TILs, will be dependent on the human or mammal being treated, the severity of the disorder or condition, the rate of administration, the disposition of the active pharmaceutical ingredients and the discretion of the prescribing physician.

[00389] In some embodiments, TILs may be administered in a single dose. Such administration may be by injection, e.g., intravenous injection. In some embodiments, TILs may be administered in multiple doses. Dosing may be once, twice, three times, four times, five times, six times, or more than six times per year. Dosing may be once a month, once every two weeks, once a week, or once every other day. Administration of TILs may continue as long as necessary.

[00390] In some embodiments, an effective dosage of TILs is about 1 * 106, 2* 106, 3* 106, 4xl06, 5xl06, 6xl06, 7xl06, 8xl06, 9xl06, IxlO7, 2xl07, 3xl07, 4xl07, 5xl07, 6xl07, 7xl07, 8xl07, 9xl07, IxlO8, 2xl08, 3xl08, 4xl08, 5xl08, 6xl08, 7xl08, 8xl08, 9xl08, IxlO9, 2xl09, 3xl09, 4xl09, 5xl09, 6xl09, 7xl09, 8xl09, 9xl09, IxlO10, 2xlO10, 3xl010, 4xlO10, 5xl010, 6xlO10, 7xlO10, 8xl010, 9xlO10, IxlO11, 2xlOu, 3xl0u, 4xlOu, 5xl0n, 6xlOu, 7xlOu, 8xl0u, 9xlOu, IxlO12, 2xl012, 3xl012, 4xl012, 5xl012, 6xl012, 7xl012, 8xl012, 9xl012, IxlO13, 2xl013, 3xl013, 4xl013, 5xl013, 6xl013, 7xl013, 8xl013, and 9xl013. In some embodiments, an effective dosage of TILs is in the range of IxlO6 to 5xl06, 5xl06 to IxlO7, IxlO7 to 5xl07, 5xl07 toIxlO8, lxl08to 5xl08, 5xl08to 1X109, 1X109 to 5xl09, 5xl09to IxlO10, IxlO10 to 5xlO10, 5xl010to IxlO11, 5xlOuto IxlO12, IxlO12 to 5xl012, and5xl012to IxlO13.

[00391] In some embodiments, an effective dosage of TILs is in the range of about 0.01 mg / kg to about 4.3 mg / kg, about 0.15 mg / kg to about 3.6 mg / kg, about 0.3 mg / kg to about 3.2 mg / kg, about 0.35 mg / kg to about 2.85 mg / kg, about 0.15 mg / kg to about 2.85 mg / kg, about 0.3 mg to about 2.15 mg / kg, about 0.45 mg / kg to about 1.7 mg / kg, about 0.15 mg / kg to about 1.3 mg / kg, about 0.3 mg / kg to about 1.15 mg / kg, about 0.45 mg / kg to about 1 mg / kg, about 0.55 mg / kg to about 0.85 mg / kg, about 0.65 mg / kg to about 0.8 mg / kg, about 0.7 mg / kg to about 0.75 mg / kg, about 0.7 mg / kg to about 2.15 mg / kg, about 0.85 mg / kg to about 2 mg / kg, about 1 mg / kg to about 1.85 mg / kg, about 1.15 mg / kg to about 1.7 mg / kg, about 1.3 mg / kg mg to about 1.6 mg / kg, about 1.35 mg / kg to about 1.5 mg / kg, about 2.15 mg / kg to about 3.6 mg / kg, about 2.3 mg / kg to about 3.4 mg / kg, about 2.4 mg / kg to about 3.3 mg / kg, about 2.6 mg / kg to about 3.15 mg / kg, about 2.7 mg / kg to about 3 mg / kg, about 2.8 mg / kg to about 3 mg / kg, or about 2.85 mg / kg to about 2.95 mg / kg.

[00392] In some embodiments, an effective dosage of TILs is in the range of about 1 mg to about 500 mg, about 10 mg to about 300 mg, about 20 mg to about 250 mg, about 25 mg to about 200 mg, about 1 mg to about 50 mg, about 5 mg to about 45 mg, about 10 mg to about 40 mg, about 15 mg to about 35 mg, about 20 mg to about 30 mg, about 23 mg to about 28 mg, about 50 mg to about 150 mg, about 60 mg to about 140 mg, about 70 mg to about 130 mg, about 80 mg to about 120 mg, about 90 mg to about 110 mg, or about 95 mg to about 105 mg, about 98 mg to about 102 mg, about 150 mg to about 250 mg, about 160 mg to about 240 mg, about 170 mg to about 230 mg, about 180 mg to about 220 mg, about 190 mg to about 210 mg, about 195 mg to about 205 mg, or about 198 to about 207 mg.

[00393] An effective amount of the TILs may be administered in either single or multiple doses by any of the accepted modes of administration of agents having similar utilities, including intranasal and transdermal routes, by intra-arterial injection, intravenously, intraperitoneally, parenterally, intramuscularly, subcutaneously, topically, by transplantation, or by inhalation.EXAMPLES

[00394] The embodiments encompassed herein are now described with reference to the following examples. These examples are provided for the purpose of illustration only and the disclosure encompassed herein should in no way be construed as being limited to these examples, but rather should be construed to encompass any and all variations which become evident as a result of the teachings provided herein.Example 1 - Variability in Expansion of Tumor Infiltrating Lymphocytes using PBMC Feeder Cells

[00395] The variability in TIL expansion obtained by use of PBMC feeder cells may be demonstrated by comparing the results of multiple TIL expansions on the same line of TILs obtained from a patient. FIG. 1 illustrates typical results of rapid expansion of TILs using irradiated allogeneic PBMC feeder cells (PBMC feeders). Two TIL lines labeled M1015T and M1016T (1.3 x io5 cells) were co-cultured with 46 different irradiated feeder cell lots (1.3 x 107), IL-2 (3000 lU / mL, recombinant human IL-2 (e.g., aldesleukin or equivalent), CellGenix, Inc., Portsmouth, NH, USA) and OKT-3 (30 ng / mL, MACS GMP CD3 pure, Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) in a T25 flask for 7 days. The fold expansion value for TILs was calculated on Day 7. The figure shows the number of fold expansions for the two TIL lines in separate stimulation experiments. For each TIL line, 46 different PBMC feeder lots were tested. The results range over more than 100-fold for each TIL line, and highlight the variability of expansion results using PBMC feeder cells. The aAPCs of the present invention offer reduced variability in expansion performance compared to PBMC feeders, as well as other advantages, as shown in the following examples.Example 2 - Selection of Myeloid Cells for aAPC Development

[00396] Phenotypic characterization was performed on various myeloid-lineage cell lines to identify potential candidates for further modification into aAPCs for TIL expansion. The results are summarized in Table 5. The MOLM-14 cell line exhibited endogenous expression of CD64, and was selected for further development. The EM-3 cell line was selected based on the observation of endogenous expression of ICOS-L (which was not observed for the EM-2 cell line, despite being taken from the same patient).TABLE 5. Summary of costimulatory molecules expressed endogenously on candidate cell lines for aAPCs. CML refers to chronic myeloid leukemia, and AML refers to acute myeloid leukemia. “Pop” refers to the population of cells observed to express the marker (1 / 2 pop = 50%).Cell line EM-2 EM-3 KG1-246 KG1-8031 K562 MOLM-14 Origin Myeloid blast crisis, CML Myeloid blast crisis, CML AML AML myeloid erythroleukemia, CML AML HLA-A / B / C + + + + - + CD64 - - - - - + CD80 - - - - - + ICOS-L - + - - - + 4-1BBL - - - - - - PD-L1 - - - - - - CD58 + + + + + + CD86 - - - - - + (1 / 2 pop) Example 3 - Preparation of MOLM-14 Artificial Antigen Presenting Cells (aM0LM14 aAPCs)

[00397] MOLM-14 cells were obtained from Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH. To develop MOLM-14 based aAPCs, MOLM-14 cells were engineered with the costimulatory molecules CD86 and 4-1BBL (CD137L). Human CD86 (hCD86) and human 4-1BBL (h4-lBBL) genes were cloned into commercially-available PLV430G and co-transfected with PDONR221 vectors (Invitrogen / Thermo Fisher Scientific, Carlsbad, CA, USA) using a lentiviral transduction method. The gateway cloning method was used as described in Katzen, Expert Opin. Drug Disc. 2007, 4, 571-589, to clone hCD86 and hCD137L genes onto the PLV430G and PDONR221 vectors. The 293T cell line (human embryonic kidney cells transformed with large T antigen) was used for lentiviral production, transduced to MOLM-14 cells. The transfected cells were sorted (S3e Cell Sorter, Bio-Rad, Hercules, CA, USA) using APC-conjugated CD86 and PE-conjugated CD137L to isolate and enrich the cells. The enriched cells were checked for purity by flow cytometry.

[00398] The vectors and portions thereof used for cloning are depicted in FIG. 2 to FIG. 11, and the nucleotide sequences for each vector are given in Table 6. The pLV430G human 4-1BBLvector is illustrated in FIG. 2, with the polymerase chain reaction product (PCRP) portion shown in FIG. 3. The pLV430G human CD86 vector is illustrated in FIG. 4, with the PCRP portion shown in FIG. 5. The pDONR221 human CD86 donor and human 4-1 BBL donor vectors are shown in FIG. 6 and FIG. 7, resepectively. Diagrams of the empty pLV430G destination vector and empty pDONR221 donor vector for the Gateway cloning method are shown in FIG. 8 and FIG. 9, respectively. FIG. 10 and FIG. 11 illustrate vector diagrams of the psPAX2 and pCIGO-VSV.G helper plasmids used for lentivirus production.TABLE 6. Nucleotide sequences for preparation of lentivirus for transduction of aAPCs.Identifier (Description) Sequence SEQ ID NO:15 cgataaccct aattcgatag catatgcttc ccgttgggta acatatgcta ttgaattagg 60 (pLV430G human gttagtctgg atagtatata ctactacccg ggaagcatat gctacccgtt tagggttcac 120 4-1BBL vector) cggtgatgcc ggccacgatg cgtccggcgt agaggatcta atgtgagtta gctcactcat 180 taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc 240 ggataacaat ttcacacagg aaacagctat gaccatgatt acgccaagcg cgcaattaac 300 cctcactaaa gggaacaaaa gctggagctg caagcttaat gtagtcttat gcaatactct 360 tgtagtcttg caacatggta acgatgagtt agcaacatgc cttacaagga gagaaaaagc 420 accgtgcatg ccgattggtg gaagtaaggt ggtacgatcg tgccttatta ggaaggcaac 480 agacgggtct gacatggatt ggacgaacca ctgaattgcc gcattgcaga gatattgtat 540 ttaagtgcct agctcgatac ataaacgggt ctctctggtt agaccagatc tgagcctggg 600 agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg ccttgagtgc 660 ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc ctcagaccct 720 tttagtcagt gtggaaaatc tctagcagtg gcgcccgaac agggacttga aagcgaaagg 780 gaaaccagag gagctctctc gacgcaggac tcggcttgct gaagcgcgca cggcaagagg 840 cgaggggcgg cgactggtga gtacgccaaa aattttgact agcggaggct agaaggagag 900 agatgggtgc gagagcgtca gtattaagcg ggggagaatt agatcgcgat gggaaaaaat 960 tcggttaagg ccagggggaa agaaaaaata taaattaaaa catatagtat gggcaagcag 1020 ggagctagaa cgattcgcag ttaatcctgg cctgttagaa acatcagaag gctgtagaca 1080 aatactggga cagctacaac catcccttca gacaggatca gaagaactta gatcattata 1140 taatacagta gcaaccctct attgtgtgca tcaaaggata gagataaaag acaccaagga 1200 agctttagac aagatagagg aagagcaaaa caaaagtaag accaccgcac agcaagcggc 1260 cgctgatctt cagacctgga ggaggagata tgagggacaa ttggagaagt gaattatata 1320 aatataaagt agtaaaaatt gaaccattag gagtagcacc caccaaggca aagagaagag 1380 tggtgcagag agaaaaaaga gcagtgggaa taggagcttt gttccttggg ttcttgggag 1440 cagcaggaag cactatgggc gcagcgtcaa tgacgctgac ggtacaggcc agacaattat 1500 tgtctggtat agtgcagcag cagaacaatt tgctgagggc tattgaggcg caacagcatc 1560 tgttgcaact cacagtctgg ggcatcaagc agctccaggc aagaatcctg gctgtggaaa 1620 gatacctaaa ggatcaacag ctcctgggga tttggggttg ctctggaaaa ctcatttgca 1680 ccactgctgt gccttggaat gctagttgga gtaataaatc tctggaacag atttggaatc 1740 acacgacctg gatggagtgg gacagagaaa ttaacaatta cacaagctta atacactcct 1800 taattgaaga atcgcaaaac cagcaagaaa agaatgaaca agaattattg gaattagata 1860 aatgggcaag tttgtggaat tggtttaaca taacaaattg gctgtggtat ataaaattat 1920 tcataatgat agtaggaggc ttggtaggtt taagaatagt ttttgctgta ctttctatag 1980 tgaatagagt taggcaggga tattcaccat tatcgtttca gacccacctc ccaaccccga 2040 ggggacccga caggcccgaa ggaatagaag aagaaggtgg agagagagac agagacagat 2100 ccattcgatt agtgaacgga tctcgacggt atcggtttta aaagaaaagg ggggattggg 2160 gggtacagtg caggggaaag aatagtagac ataatagcaa cagacataca aactaaagaa 2220 ttacaaaaac aaattacaaa aattcaaaat tttatcgatt ttatttagtc tccagaaaaa 2280 ggggggaatg aaagacccca cctgtaggtt tggcaagcta gcttaagtaa cgccattttg 2340 caaggcatgg aaaatacata actgagaata gagaagttca gatcaaggtt aggaacagag 2400 agacagcaga atatgggcca aacaggatat ctgtggtaag cagttcctgc cccggctcag 2460 ggccaagaac agatggtccc cagatgcggt cccgccctca gcagtttcta gagaaccatc 2520 agatgtttcc agggtgcccc aaggacctga aatgaccctg tgccttattt gaactaacca 2580 atcagttcgc ttctcgcttc tgttcgcgcg cttctgctcc ccgagctcaa taaaagagcc 2640 cacaacccct cactcggcgc gccagtcctc cgatagactg cgtcgcccgg gtaccgatat 2700 caacaagttt gtacaaaaaa gcaggcttcg ccaccatgga atacgcctct gatgccagcc 2760 tggaccccga agctccttgg cctcctgccc ctagagccag agcctgtaga gtgctgcctt 2820 gggctctggt tggcttgtcc gactgagaga agggcatgtt ggtacagcga acaccaaaga tgcggagagt ccctgagatc ctagcgaggc gccagagact cacagggcgc ccagccctag aagctagcct cagttatatg taccgctgtt gagatggggt acaagaacac tattgattgg acaatgtggt cactttctcg tgcccggcaa cttggtcatg tgcggaactc tgataactct tgccaactgg ggacgaccct accgaccacg ggaccgtgtg caaatattgc gaccttgagg attaggttaa ccatggcgca gatcttagcc agacaagatc gagctctctg cttcaagtag ttttagtcag ttataacttg aatggttaca cattctagtt tcccgcccct cccatggctg tttcatcctg aactcttggc aagactacgg gaccctcaag gaaagggcct agacgtcagg aaatacattc attgaaaaag cggcattttg aagatcagtt ttgagagttt gtggcgcggt attctcagaa tgacagtaag tacttctgac atcatgtaac agcgtgacac aactacttac caggaccact ccggtgagcg gtatcgtagt tcgctgagat atatacttta tttttgataa accccgtaga gcttgcaaac caactcttttggctggcctt ttgggccgtg gggacctgag cgcccagctg tcctggactg actggtggtg ggtggccggc tgctgcaggc cagaaactcc gggagtgcat tacagtgctg aagcgagtag agtgccattt gatgatgtgg accaattttc tactctctaa atcatacaaa aaagtatgtc tatcctgcgt ccaacttaca cggccaggtc ggccatcagc ctagccgctt gttgtcctat atcctgcgcg tctcggggtc gggcgcacct cacttcgctt ccaaggtctt catacttcaa aggtctttgt atcactagag actttttaaa tgctttttgc gctaactagg tgtgtgcccg tgtggaaaat caaagaaatg aataaagcaa gtggtttgtc aactccgccc actaattttt gagcagactt tgaagctctt gaggctacac agggcattag cgtgatacgc tggcactttt aaatatgtat gaagagtatg ccttcctgtt gggtgcacga tcgccccgaa attatcccgt tgacttggtt agaattatgc aacgatcgga tcgccttgat cacgatgcct tctagcttcc tctgcgctcg tgggtctcgc tatctacacg aggtgcctca gattgattta tctcatgacc aaagatcaaa aaaaaaacca tccgaaggtactccttctgc tcaggcgcca ctgagccccg gtggcccaga gctggcgtgt gccaaggccg gaaggatccg gctgctgcac gcattcgggt ctgcacacag ggcctgttca gacccagctt gttcagtggt tattgggggc ttttgtcttt attttatggg aaatcaaaga aacgaattgt tgatgccttt aggcctttct tgtgccaagt gcatgcgtgg gttttgctcg cccgcaaata ggacgtcctt gcttgggact ctctttacgc cacctctgca acataagagg agactgtttg actaggaggc cggggtacct agaaaagggg ttgtactggg gaacccactg tctgttgtgt ctctagcagt aatatcagag tagcatcaca caaactcatc atcccgcccc tttatttatg tgcagtctgt acaccaatgc caacgtcaat caatagtgtt ctatttttat cggggaaatg ccgctcatga agtattcaac tttgctcacc gtgggttaca gaacgttttc gttgacgccg gagtactcac agtgctgcca ggaccgaagg cgttgggaac gcagcaatgg cggcaacaat gcccttccgg ggtatcattg acggggagtc ctgattaagc aaacttcatt aaaatccctt ggatcttctt ccgctaccag actggcttcatgctgctggc gagcttctcc atgatcctgc acgtgctgct cactgacagg gcgtgtacta gctctgtgtc tggccctgac ttcaaggcag aggccagagc gagtgacccc tcttgtacaa tcgtagggct caagtctgta gggtatacat ttatgtcatt atgttttaga gggtcttttg gtatgcatgt gtgtaaacaa gtttgctgac aaccttttcg cagcaggtct tacatcgttt tgtttacgtc ctctcgtccc ggactccccg cgtcgcatgg actcttggac tttaaagact tgtaggcata ttaagaccaa ggactggaag tctctctggt cttaagcctc gactctggta agtagttcat agtgagagga aatttcacaa aatgtatctt taactccgcc cagaggccga ggactgcaac tgggggacat cagaggggcc tataaggccc aggttaatgt tgcgcggaac gacaataacc atttccgtgt cagaaacgct tcgaactgga caatgatgag ggcaagagca cagtcacaga taaccatgag agctaaccgc cggagctgaa caacaacgtt taatagactg ctggctggtt cagcactggg aggcaactat attggtaact tttaatttaa aacgtgagtt gagatccttt cggtggtttg gcagagcgcacgctgcctgc tggatctgcc cggactgctg gatcgatggc cggcctgagc cgtgttcttt tctggcactg agtggacctg actgctgcac cagacacgcc cgaaattcca agtggtgatt ttcccccact cagcatcttg ttaaacccta ggatgttatg aaacttccta ggttttgctg attcaatcta tacctgaacc gcaaccccca gctcctctgc ggagcaaaca ccatggctgc ccgtcggcgc cttctccgtc tctgtgcctt agaccaccgt tctcagcaat gggaggagtt aattggtctg tgacttacaa ggctaattca tagaccagat aataaagctt actagagatc gtcatcttat acttgtttat ataaagcatt atcatgtctg cagttccgcc ggccggatcc acaacattgc gtacctccca tgtgtagcta ccttgttaat catgataata ccctatttgt ctgataaatg cgcccttatt ggtgaaagta tctcaacagc cacttttaaa actcggtcgc aaagcatctt tgataacact ttttttgcac tgaagccata gcgcaaacta gatggaggcg tattgctgat gccagatggt ggatgaacga gtcagaccaa aaggatctag ttcgttccac ttttctgcgc tttgccggat gataccaaatgctgtgtttc gccagcccca gatctgagac cccctgagct tacaaagagg cagctggaac catctgcagc cctccagcct ctgtctgccg tggcagctga gccggcctgc cgagttaatt gtttggcttt agtccctttt acaaaacaaa ggtccttgcc ttaacaggcc ccccttttac agcaggcttt tttaccccgt ctggctgggg cgatccatac ttatcgggac taggctgtgc tgaatcctgc tgccgttccg ctcatctgcc gaacgcccac gtcaacgacc gggggaggag cgcaccagca ggcagctgta ctcccaacga ctgagcctgg gccttgagtg cctcagaccc tattcagtat tgcagcttat tttttcactg gctctagcta cattctccgc cttgagtggc ctttatgtgt ggggcccagg ccgataagcg tcttgaagac atggtttctt ttatttttct cttcaataat cccttttttg aaagatgctg ggtaagatcc gttctgctat cgcatacact acggatggca gcggccaact aacatggggg ccaaacgacg ttaactggcg gataaagttg aaatctggag aagccctccc aatagacaga gtttactcat gtgaagatcc tgagcgtcag gtaatctgct caagagctac actgtccttctagtgtagcc ctctgctaat tggactcaag gcacacagcc attgagaaag gggtcggaac gtcctgtcgg ggcggagcct ggcctttttg acgcgggcat ctcgcgtcg gtagttaggc cctgttacca acgatagtta cagcttggag cgccacgctt aggagagcgc gtttcgccac atggaaaaac aagctgtccc cccgatgccg caccacttca gtggctgctg ccggataagg cgaacgacct cccgaaggga acgagggagc ctctgacttg gccagcaacg tgatggtcgt ccggaagcga agaactctgt agcaccgcct ccagtggcga taagtcgtgt acatacctcg cttaccgggt gggggttcgt cagcgtgagc gtaagcggca tatctttata tcgtcagggg gccttttgct atggcctgca gccatccagc 7020 7080 7140 7200 7260 7320 7380 7440 7500 7560 7569 cgcagcggtc acaccgaact gaaaggcgga ttccaggggg agcgtcgatt cggccttttt catctacctg gaagaatcat gggctgaacg gagataccta caggtatccg aaacgcctgg tttgtgatgc acggttcctg cctggacagc aatggggaag SEQ ID NO:16 atggaatacg cctctgatgc cagcctggac cccgaagctc cttggcctcc tgcccctaga 60 (4-1BBL CoOP) gccagagcct gtagagtgct gccttgggct ctggtggctg gccttctcct tctgctgctg 120 ctggccgctg cctgcgctgt gtttctggct tgtccttggg ccgtgtcagg cgccagagct 180 tctcctggat ctgccgccag ccccagactg agagagggac ctgagctgag ccccgatgat 240 cctgccggac tgctggatct gagacagggc atgttcgccc agctggtggc ccagaacgtg 300 ctgctgatcg atggccccct gagctggtac agcgatcctg gactggctgg cgtgtcactg 360 acaggcggcc tgagctacaa agaggacacc aaagaactgg tggtggccaa ggccggcgtg 420 tactacgtgt tctttcagct ggaactgcgg agagtggtgg ccggcgaagg atccggctct 480 gtgtctctgg cactgcatct gcagcccctg agatctgctg caggcgctgc tgcactggcc 540 ctgacagtgg acctgcctcc agcctctagc gaggccagaa actccgcatt cgggtttcaa 600 ggcagactgc tgcacctgtc tgccggccag agactgggag tgcatctgca cacagaggcc 660 agagccagac acgcctggca gctgacacag ggcgctacag tgctgggcct gttcagagtg 720 acccccgaaa ttccagccgg cctgcccagc cctagaagcg agtag 765 SEQ ID NO:17 ggggacaagt ttgtacaaaa aagcaggctt cgccaccatg gaatacgcct ctgatgccag 60 (4-1BBL PROP) cctggacccc gaagctcctt ggcctcctgc ccctagagcc agagcctgta gagtgctgcc 120 ttgggctctg gtggctggcc ttctccttct gctgctgctg gccgctgcct gcgctgtgtt 180 tctggcttgt ccttgggccg tgtcaggcgc cagagcttct cctggatctg ccgccagccc 240 cagactgaga gagggacctg agctgagccc cgatgatcct gccggactgc tggatctgag 300 acagggcatg ttcgcccagc tggtggccca gaacgtgctg ctgatcgatg gccccctgag 360 ctggtacagc gatcctggac tggctggcgt gtcactgaca ggcggcctga gctacaaaga 420 ggacaccaaa gaactggtgg tggccaaggc cggcgtgtac tacgtgttct ttcagctgga 480 actgcggaga gtggtggccg gcgaaggatc cggctctgtg tctctggcac tgcatctgca 540 gcccctgaga tctgctgcag gcgctgctgc actggccctg acagtggacc tgcctccagc 600 ctctagcgag gccagaaact ccgcattcgg gtttcaaggc agactgctgc acctgtctgc 660 cggccagaga ctgggagtgc atctgcacac agaggccaga gccagacacg cctggcagct 720 gacacagggc gctacagtgc tgggcctgtt cagagtgacc cccgaaattc cagccggcct 780 gcccagccct agaagcgagt aggacccagc tttcttgtac aaagtggtcc cc 832 SEQ ID NO:18 cgataaccct aattcgatag catatgcttc ccgttgggta acatatgcta ttgaattagg 60 (pLV430G human gttagtctgg atagtatata ctactacccg ggaagcatat gctacccgtt tagggttcac 120 CD86 vector) cggtgatgcc ggccacgatg cgtccggcgt agaggatcta atgtgagtta gctcactcat 180 taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc 240 ggataacaat ttcacacagg aaacagctat gaccatgatt acgccaagcg cgcaattaac 300 cctcactaaa gggaacaaaa gctggagctg caagcttaat gtagtcttat gcaatactct 360 tgtagtcttg caacatggta acgatgagtt agcaacatgc cttacaagga gagaaaaagc 420 accgtgcatg ccgattggtg gaagtaaggt ggtacgatcg tgccttatta ggaaggcaac 480 agacgggtct gacatggatt ggacgaacca ctgaattgcc gcattgcaga gatattgtat 540 ttaagtgcct agctcgatac ataaacgggt ctctctggtt agaccagatc tgagcctggg 600 agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg ccttgagtgc 660 ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc ctcagaccct 720 tttagtcagt gtggaaaatc tctagcagtg gcgcccgaac agggacttga aagcgaaagg 780 gaaaccagag gagctctctc gacgcaggac tcggcttgct gaagcgcgca cggcaagagg 840 cgaggggcgg cgactggtga gtacgccaaa aattttgact agcggaggct agaaggagag 900 agatgggtgc gagagcgtca gtattaagcg ggggagaatt agatcgcgat gggaaaaaat 960 tcggttaagg ccagggggaa agaaaaaata taaattaaaa catatagtat gggcaagcag 1020 ggagctagaa cgattcgcag ttaatcctgg cctgttagaa acatcagaag gctgtagaca 1080 aatactggga cagctacaac catcccttca gacaggatca gaagaactta gatcattata 1140 taatacagta gcaaccctct attgtgtgca tcaaaggata gagataaaag acaccaagga 1200 agctttagac aagatagagg aagagcaaaa caaaagtaag accaccgcac agcaagcggc 1260 cgctgatctt cagacctgga ggaggagata tgagggacaa ttggagaagt gaattatata 1320 aatataaagt agtaaaaatt gaaccattag gagtagcacc caccaaggca aagagaagag 1380 tggtgcagag agaaaaaaga gcagtgggaa taggagcttt gttccttggg ttcttgggag 1440 cagcaggaag cactatgggc gcagcgtcaa tgacgctgac ggtacaggcc agacaattat 1500 tgtctggtat agtgcagcag cagaacaatt tgctgagggc tattgaggcg caacagcatc 1560 tgttgcaact cacagtctgg ggcatcaagc agctccaggc aagaatcctg gctgtggaaa 1620 gatacctaaa ggatcaacag ctcctgggga tttggggttg ctctggaaaa ctcatttgca 1680 ccactgctgt gccttggaat gctagttgga gtaataaatc tctggaacag atttggaatc 1740 acacgacctg gatggagtgg gacagagaaa ttaacaatta cacaagctta atacactcct 1800 taattgaaga atcgcaaaac cagcaagaaa agaatgaaca agaattattg gaattagata 1860 aatgggcaag tcataatgat tgaatagagt ggggacccga ccattcgatt gggtacagtg ttacaaaaac ggggggaatg caaggcatgg agacagcaga ggccaagaac agatgtttcc atcagttcgc cacaacccct caacaagttt tgatggcctt ccgccgacct tgttctggca tcgacagcgt tgcggctgca agaaacccac acttcagcca tgacctgcag ccaagaacag agctgtacga ccatcttttg agctggaaga ccgtgatcat ggcctaggaa ccaagaagcg agagcagcaa tgtacaaagt tagggctttc gtctgtacag tatacattta tgtcattgga ttttagaaaa tcttttgggt tgcatgtatt taaacaatac tgctgacgca cttttcggct caggtctgga atcgtttcca ttacgtcccg tcgtcccctt ctccccgtct cgcatggaga cttggactct aaagactggg aggcataaat agaccaatga ctggaagggc ctctggttag aagcctcaat tctggtaact agttcatgtc gagaggaact ttcacaaata gtatcttatc ctccgcccag aggccgaggc ctgcaacaca gggacatgta aggggcctgt aaggccccct ttaatgtcat gcggaacccc aataaccctgtttgtggaat agtaggaggc taggcaggga caggcccgaa agtgaacgga caggggaaag aaattacaaa aaagacccca aaaatacata atatgggcca agatggtccc agggtgcccc ttctcgcttc cactcggcgc gtacaaaaaa cctgctgtcc gccctgccag ggaccaggaa gcacagcaag caacctgcag cggcatgatc gcccgagatc cagcatccac caccatcgag cgtgagcatc catcctggaa tccccagccc ctgcgtgatg cagctacaag ggagaagatc gaccagcagc ggtgattcga ccccactgtt catcttgagt aaccctaaca tgttatgggt cttcctatta tttgctgccc caatctaagc ctgaaccttt acccccactg cctctgccga gcaaacatta tggctgctag tcggcgctga ctccgtctgc gtgccttctc ccaccgtgaa cagcaatgtc aggagttggg tggtctgcgc cttacaaggc taattcactc accagatctg aaagcttgcc agagatccct atcttattat tgtttattgc aagcattttt atgtctggct ttccgcccat cggatccctt acattgcctt cctcccaggg gtagctaccg tgttaattct gataataatg tatttgttta ataaatgctttggtttaaca ttggtaggtt tattcaccat ggaatagaag tctcgacggt aatagtagac aattcaaaat cctgtaggtt actgagaata aacaggatat cagatgcggt aaggacctga tgttcgcgcg gccagtcctc gcaggcttcg ggagccgccc ttcgccaaca aacctggtcc tacatgggcc atcaaggaca agaatccacc gtgcccatca ggctaccccg tacgacggcg agcctgagcg accgacaaga cctcccgacc gtgttctgcc tgcggcacca cacatccccg tgcgacaaga gttaattaag tggctttcag ccctttttacaaacaaagag ccttgccaca acaggcctat cttttacaca aggctttcac accccgttgc gctggggctt tccatactgc tcgggactga gctgtgctgc atcctgcgga cgttccgacc atctgccgga cgcccaccaa aacgaccgac ggaggagatt accagcacca agctgtagat ccaacgaaga agcctgggag ttgagtgctt cagacccttt tcagtattta agcttataat ttcactgcat ctagctatcc tctccgcccc gagtggcttt tatgtgtaac gcccaggaag ataagcggac tgaagacgaa gtttcttaga tttttctaaa caataatatttaacaaattg taagaatagt tatcgtttca aagaaggtgg atcggtttta ataatagcaa tttatcgatt tggcaagcta gagaagttca ctgtggtaag cccgccctca aatgaccctg cttctgctcc cgatagactg ccaccatggg ctctgaagat gccagaacca tgaacgaggt ggaccagctt agggcctgta agatgaacag gcaacatcac agcccaagaa tgatgcagaa tgagcttccc cccggctgct acatcccctg tgatcctgtg acaccatgga agcggagcga gcgacacctg ctagcctagt ttatatggat cgctgttacc atggggttac agaacacatc tgattggaaa atgtggttat tttctcgcca ccggcaacgg ggtcatgggc ggaactccta taactctgtt caactggatc cgacccttct gaccacgggg ccgtgtgcac atattgccca cttgaggcat aggttaaagg tggcgcaatc cttagccact caagatctgc ctctctggct caagtagtgt tagtcagtgt taacttgcaa ggttacaaat tctagttgtg cgcccctaac atggctgact catcctggag tcttggctga actacgggag cctcaagagg agggcctcgt cgtcaggtgg tacattcaaagaaaaaggaagctgtggtat ttttgctgta gacccacctc agagagagac aaagaaaagg cagacataca ttatttagtc gcttaagtaa gatcaaggtt cagttcctgc gcagtttcta tgccttattt ccgagctcaa cgtcgcccgg cctgagcaac ccaggcctac gagcctgagc gtacctgggc cgacagcgac ccagtgcatc cgagctgtcc cgagaacgtg aatgagcgtg aagccaggac cgacgtgacc gtccagcccc gatcaccgcc gaagtggaag acgggaggaa cgaggcccag cttctaggac gccatttgtt gatgtggtat aattttcttt tctctaaatt atacaaaaaa gtatgtcaac cctgcgttga acttacaagg ccaggtctgt catcagcgca gccgcttgtt gtcctatccc ctgcgcggga cggggtcgct cgcacctctc ttcgcttcac aggtcttaca acttcaaaga tctttgtact actagagcgg ttttaaaaga tttttgcttg aactagggaa gtgcccgtct ggaaaatctc agaaatgaat aaagcaatag gtttgtccaa tccgcccatc aatttttttt cagactttgc agctcttaca gctacaccaa gcattagcaa gatacgccta cacttttcgg tatgtatccg gagtatgagtataaaattat ctttctatag ccaaccccga agagacagat ggggattggg aactaaagaa tccagaaaaa cgccattttg aggaacagag cccggctcag gagaaccatc gaactaacca taaaagagcc gtaccgatat atcctgttcg ttcaacgaga gaactggtgg aaagaaaagt agctggaccc atccaccaca gtgctggcca tacatcaacc ctgctgcgga aacgtgaccg agcaacatga ttcagcatcg gtgctgccca aagaagaagc agcgagcaga cgggtgttca ccagctttct cagtggttcg tgggggccaa tgtctttggg ttatgggtta tcaaagaatg gaattgtggg tgcctttgta cctttctgtg gccaagtgtt tgcgtggaac ttgctcgcag gcaaatatac cgtcctttgt tgggactctc tttacgcgga ctctgcacgt taagaggact ctgtttgttt aggaggctgt ggtaccttta aaagggggga tactgggtct cccactgctt gttgtgtgac tagcagtagt atcagagagt catcacaaat actcatcaat ccgcccctaa atttatgcag agtctgtgga ccaatgctgg cgtcaatcag tagtgtttat tttttatagg ggaaatgtgc ctcatgagac attcaacatttccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag 6060 aaacgctggt gaaagtaaaa gatgetgaag atcagttggg tgcacgagtg ggttacatcg 6120 aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa cgttttccaa 6180 tgatgagcac ttttaaagtt ctgctatgtg gegeggtatt atcccgtgtt gacgccgggc 6240 aagageaact cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag 6300 tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgeagt gctgccataa 6360 ccatgagtga taacactgcg gccaacttac ttctgacaac gateggagga ccgaaggagc 6420 taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg 6480 agetgaatga agccatacca aaegaegage gtgacaccac gatgeetgea gcaatggcaa 6540 caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg caacaattaa 6600 tagaetggat ggaggeggat aaagttgcag gaccacttct gcgctcggcc cttccggctg 6660 gctggtttat tgctgataaa tetggageeg gtgagcgtgg gtctcgcggt atcattgcag 6720 cactggggcc agatggtaag ccctcccgta tegtagttat ctacacgacg gggagteagg 6780 caactatgga tgaaegaaat agacagatcg etgagatagg tgcctcactg attaagcatt 6840 ggtaactgtc agaccaagtt tactcatata taetttagat tgatttaaaa cttcattttt 6900 aatttaaaag gatetaggtg aagatccttt ttgataatet catgaccaaa atcccttaac 6960 gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tettettgag 7020 atcctttttt tetgegegta atetgetget tgcaaacaaa aaaaccaccg ctaccagcgg 7080 tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 7140 gagcgcagat accaaatact gteettetag tgtagccgta gttaggccac cacttcaaga 7200 actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 7260 gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaeeg gataaggege 7320 ageggteggg ctgaacgggg ggttcgtgca cacagcccag ettggagega acgacctaca 7380 ccgaactgag atacctacag cgtgagcatt gagaaagege cacgcttccc gaagggagaa 7440 aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagette 7500 cagggggaaa egeetggtat etttatagte ctgtcgggtt tcgccacctc tgaettgage 7560 gtcgattttt gtgatgeteg tcaggggggc ggagcctatg gaaaaaegee ageaaegegg 7 62 0 cctttttacg gttcctggcc ttttgctggc ctttttgaag ctgtccctga tggtegteat 7680 ctacctgcct ggacagcatg gcctgcaacg cgggcatccc gatgccgccg gaagegagaa 7740 gaatcataat ggggaaggcc atccagcctc gegteg 7776 SEQ ID NO:19 atgggcctga gcaacatcct gttcgtgatg gccttcctgc tgteeggage cgcccctctg 60 (CD86 CoOP) aagatccagg cctacttcaa cgagaccgcc gacctgccct gccagttcgc caacagccag 120 aaccagagcc tgagcgaact ggtggtgttc tggcaggacc aggaaaacct ggtcctgaac 180 gaggtgtacc tgggcaaaga aaagttcgac agcgtgcaca gcaagtacat gggccggacc 240 agcttcgaca gcgacagctg gaccctgcgg ctgcacaacc tgcagatcaa ggacaagggc 300 ctgtaccagt gcatcatcca ccacaagaaa cccaccggca tgatcagaat ccaccagatg 360 aacagcgagc tgteegtget ggccaacttc agccagcccg agategtgee catcagcaac 420 atcaccgaga acgtgtacat caacctgacc tgcagcagca tccacggcta ccccgagccc 480 aagaaaatga gegtgetget gcggaccaag aacagcacca tegagtaega eggegtgatg 540 cagaaaagcc aggacaacgt gaccgagctg taegaegtga gcatcagcct gagegtgage 600 ttccccgacg tgaccagcaa catgaccatc ttttgcatcc tggaaaccga caagacccgg 660 ctgctgtcca gccccttcag catcgagctg gaagatcccc agccccctcc cgaccacatc 720 ccctggatca ccgccgtgct gcccaccgtg atcatctgcg tgatggtgtt ctgcctgatc 780 ctgtggaagt ggaagaagaa gaagcggcct aggaacagct acaagtgcgg caccaacacc 840 atggaacggg aggaaagega gcagaccaag aagegggaga agatccacat ccccgagcgg 900 agegaegagg cccagcgggt gttcaagagc agcaagacca gcagctgcga caagagcgac 960 acctgcttc 969 SEQ ID NQ:20 ggggacaagt ttgtacaaaa aagcaggctt cgccaccatg ggeetgagea acatcctgtt 60 (CD86 PCRP) cgtgatggcc ttcctgctgt ccggagccgc ccctctgaag atccaggcct acttcaacga 120 gaccgccgac ctgccctgcc agttcgccaa cagccagaac cagagcctga gcgaactggt 180 ggtgttctgg caggaccagg aaaacctggt cctgaacgag gtgtacctgg gcaaagaaaa 240 gttcgacagc gtgcacagca agtacatggg ccggaccagc ttcgacagcg acagctggac 300 cctgcggctg cacaacctgc agatcaagga caagggcctg taccagtgca tcatccacca 360 caagaaaccc accggcatga tcagaatcca ccagatgaac agegagetgt ccgtgctggc 420 caacttcagc cagcccgaga tcgtgcccat cagcaacatc accgagaacg tgtacatcaa 480 cctgacctgc agcagcatcc acggctaccc cgagcccaag aaaatgagcg tgctgctgcg 540 gaccaagaac agcaccatcg agtaegaegg cgtgatgcag aaaagccagg acaacgtgac 600 cgagctgtac gaegtgagea teageetgag egtgagette cccgacgtga ccagcaacat 660 gaccatcttt tgcatcctgg aaaccgacaa gacccggctg ctgtccagcc ccttcagcat 720 cgagctggaa gatccccagc cccctcccga ccacatcccc tggatcaccg ccgtgctgcc 780 caccgtgatc atetgegtga tggtgttctg cctgatcctg tggaagtgga agaagaagaa 840 gcggcctagg aacagctaca agtgcggcac caacaccatg gaaegggagg aaagegagea 900 gaccaagaag egggagaaga tccacatccc egageggage gacgaggccc agcgggtgtt 960 caagagcagc aagaccagca gctgcgacaa gagcgacacc tgettetagg acccagcttt 1020 cttgtacaaa gtggtcccc 1039 SEQ ID NO:21 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60 (pDONR221 CD86 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagegagg aageggaaga 120 vector) gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240 tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc ettetgetta 300 gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360 acaacgttca aatccgctcc eggeggattt gtcctactca ggagagcgtt caccgacaaa 420 caacagataa aaegaaagge ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480 gcagttccct actctcgcgt taaegetage atggatgttt tcccagtcac gacgttgtaa 540 aacgacggcc agtettaage tcgggcccca aataatgatt ttattttgac tgatagtgac 600 ctgttcgttg caacacattg atgagcaatg cttttttata atgcacaagt ttgtacaaaa 660 aagcaggctt cgccaccatg ggeetgagea acatcctgtt cgtgatggcc ttcctgctgt 720 ccggagccgc ccctctgaag atccaggcct acttcaacga gaccgccgac ctgccctgcc 780 agttcgccaa cagccagaac cagagcctga gcgaactggt ggtgttctgg caggaccagg 840 aaaacctggt cctgaacgag gtgtacctgg gcaaagaaaa gttcgacagc gtgcacagca 900 agtacatggg ccggaccagc ttcgacagcg acagctggac cctgcggctg cacaacctgc 960 agateaegga caagggcctg taccagtgca tcatccacca caagaaaccc accggcatga 1020 tcagaatcca ccagatgaac agegagetgt ccgtgctggc caacttcagc cagcccgaga 1080 tcgtgcccat cagcaacatc accgagaacg tgtacatcaa cctgacctgc agcagcatcc 1140 acggctaccc cgagcccaag aaaatgagcg tgctgctgcg gaccaagaac agcaccatcg 1200 agtaegaegg cgtgatgcag aaaagccagg acaacgtgac cgagctgtac gaegtgagea 1260 teageetgag egtgagette cccgacgtga ccagcaacat gaccatcttt tgcatcctgg 1320 aaaccgacaa gacccggctg ctgtccagcc ccttcagcat cgagctggaa gatccccagc 1380 cccctcccga ccacatcccc tggatcaccg ccgtgctgcc caccgtgatc atetgegtga 1440 tggtgttctg cctgatcctg tggaagtgga agaagaagaa gcggcctagg aacagctaca 1500 agtgcggcac caacaccatg gaaegggagg aaagegagea gaccaagaag egggagaaga 1560 tccacatccc egageggage gacgaggccc agcgggtgtt caagagcagc aagaccagca 1620 gctgcgacaa gagcgacacc tgettetagg acccagcttt cttgtacaaa gtggtcatta 1680 taagaaagca ttgettatea atttgttgca acgaacaggt cactatcagt caaaataaaa 1740 tcattatttg ccatccagct gatatcccct atagtgagte gtattacatg gtcatagctg 1800 tttcctggca gctctggccc gtgtctcaaa atetetgatg ttacattgca caagataaaa 1860 taatatcatc atgaacaata aaactgtctg cttacataaa cagtaataca aggggtgtta 1920 tgagccatat tcaacgggaa aegtegagge egegattaaa ttccaacatg gatgetgatt 1980 tatatgggta taaatgggct egegataatg tcgggcaatc aggtgcgaca atetateget 2040 tgtatgggaa gcccgatgcg ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca 2100 atgatgttac agatgagatg gtcagactaa actggctgac ggaatttatg cctcttccga 2160 ccatcaagca ttttatccgt actcctgatg atgcatggtt actcaccact gcgatccccg 2220 gaaaaacagc attccaggta ttagaagaat atcctgattc aggtgaaaat attgttgatg 2280 cgctggcagt gttcctgcgc eggttgeatt cgattcctgt ttgtaattgt ccttttaaca 2340 gegategegt atttcgtctc gctcaggcgc aatcacgaat gaataaeggt ttggttgatg 2400 egagtgattt tgatgaegag cgtaatggct ggcctgttga acaagtctgg aaagaaatgc 2460 ataaactttt gccattctca ccggattcag tcgtcactca tggtgatttc teaettgata 2520 accttatttt tgacgagggg aaattaatag gttgtattga tgttggacga gteggaateg 2580 cagaccgata ccaggatctt gccatcctat ggaactgcct cggtgagttt tctccttcat 2640 tacagaaacg gctttttcaa aaatatggta ttgataatcc tgatatgaat aaattgeagt 2700 ttcatttgat getegatgag tttttctaat cagaattggt taattggttg taacactggc 2760 agagcattac getgaettga cgggacggcg caagctcatg accaaaatcc ettaaegtga 2820 gttaegegte gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tettettgag 2880 atcctttttt tetgegegta atetgetget tgcaaacaaa aaaaccaccg ctaccagcgg 2940 tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 3000 gagcgcagat accaaatact gttettetag tgtagccgta gttaggccac cacttcaaga 3060 actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 3120 gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaeeg gataaggege 3180 ageggteggg ctgaacgggg ggttcgtgca cacagcccag ettggagega acgacctaca 3240 ccgaactgag atacctacag egtgagetat gagaaagege cacgcttccc gaagggagaa 3300 aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagette 3360 cagggggaaa egeetggtat etttatagte ctgtcgggtt tcgccacctc tgaettgage 3420 gtcgattttt gtgatgeteg tcaggggggc ggagcctatg gaaaaaegee ageaaegegg 3480 cctttttacg gttcctggcc ttttgctggc cttttgctca catgtt 3526 SEQ ID NO:22 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60 (pDONR221 4- taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagegagg aageggaaga 120 1BBL vector) gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240 tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc ettetgetta 300 gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360 acaacgttca aatccgctcc eggeggattt gtcctactca ggagagcgtt caccgacaaa 420 caacagataa aaegaaagge ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480 gcagttccct actctcgcgt taaegetage atggatgttt tcccagtcac gacgttgtaa 540 aacgacggcc agtettaage tcgggcccca aataatgatt ttattttgac tgatagtgac 600 ctgttcgttg caacacattg atgagcaatg cttttttata atgcacaagt ttgtacaaaa 660 aagcaggctt cgccaccatg gaatacgcct ctgatgccag cctggacccc gaagctcctt 720 ggcctcctgc ccctagagcc agagcctgta gagtgetgee ttgggctctg gtggctggcc 780 ttctccttct getgetgetg gccgctgcct gcgctgtgtt tctggcttgt ccttgggccg 840 tgtcaggcgc cagagcttct cctggatctg ccgccagccc cagactgaga gagggacctg 900 agctgagccc cgatgatcct gccggactgc tggatctgag acagggcatg ttcgcccagc 960 tggtggccca gaacgtgctg ctgatcgatg gccccctgag ctggtacagc gatcctggac 1020 tggctggcgt gtcactgaca ggcggcctga gctacaaaga ggacaccaaa gaactggtgg 1080 tggccaaggc cggcgtgtac tacgtgttct ttcagctgga actgcggaga gtggtggccg 1140 gcgaaggatc cggctctgtg tctctggcac tgcatctgca gcccctgaga tctgctgcag 1200 gcgctgctgc actggccctg acagtggacc tgcctccagc ctctagcgag gccagaaact 1260 ccgcattcgg gtttcaaggc agactgctgc acctgtctgc cggccagaga ctgggagtgc 1320 atctgcacac agaggccaga gccagacacg cctggcagct gacacagggc gctacagtgc 1380 tgggcctgtt cagagtgacc cccgaaattc cagccggcct gcccagccct agaagcgagt 1440 aggacccagc tttcttgtac aaagtggtca ttataagaaa gcattgctta tcaatttgtt 1500 gcaacgaaca ggtcactatc agtcaaaata aaatcattat ttgccatcca gctgatatcc 1560 cctatagtga gtcgtattac atggtcatag ctgtttcctg gcagctctgg cccgtgtctc 1620 aaaatctctg atgttacatt gcacaagata aaataatatc atcatgaaca ataaaactgt 1680 ctgcttacat aaacagtaat acaaggggtg ttatgagcca tattcaacgg gaaacgtcga 1740 ggccgcgatt aaattccaac atggatgctg atttatatgg gtataaatgg gctcgcgata 1800 atgtcgggca atcaggtgcg acaatctatc gcttgtatgg gaagcccgat gcgccagagt 1860 tgtttctgaa acatggcaaa ggtagcgttg ccaatgatgt tacagatgag atggtcagac 1920 taaactggct gacggaattt atgcctcttc cgaccatcaa gcattttatc cgtactcctg 1980 atgatgcatg gttactcacc actgcgatcc ccggaaaaac agcattccag gtattagaag 2040 aatatcctga ttcaggtgaa aatattgttg atgcgctggc agtgttcctg cgccggttgc 2100 attcgattcc tgtttgtaat tgtcctttta acagcgatcg cgtatttcgt ctcgctcagg 2160 cgcaatcacg aatgaataac ggtttggttg atgcgagtga ttttgatgac gagcgtaatg 2220 gctggcctgt tgaacaagtc tggaaagaaa tgcataaact tttgccattc tcaccggatt 2280 cagtcgtcac tcatggtgat ttctcacttg ataaccttat ttttgacgag gggaaattaa 2340 taggttgtat tgatgttgga cgagtcggaa tcgcagaccg ataccaggat cttgccatcc 2400 tatggaactg cctcggtgag ttttctcctt cattacagaa acggcttttt caaaaatatg 2460 gtattgataa tcctgatatg aataaattgc agtttcattt gatgctcgat gagtttttct 2520 aatcagaatt ggttaattgg ttgtaacact ggcagagcat tacgctgact tgacgggacg 2580 gcgcaagctc atgaccaaaa tcccttaacg tgagttacgc gtcgttccac tgagcgtcag 2640 accccgtaga aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct 2700 gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac 2760 caactctttt tccgaaggta actggcttca gcagagcgca gataccaaat actgttcttc 2820 tagtgtagcc gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg 2880 ctctgctaat cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt 2940 tggactcaag acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt 3000 gcacacagcc cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc 3060 tatgagaaag cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca 3120 gggtcggaac aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata 3180 gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg 3240 ggcggagcct atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct 3300 ggccttttgc tcacatgtt 3319 SEQ ID NO:23 cgataaccct aattcgatag catatgcttc ccgttgggta acatatgcta ttgaattagg 60 (pLV430G gttagtctgg atagtatata ctactacccg ggaagcatat gctacccgtt tagggttcac 120 vector) cggtgatgcc ggccacgatg cgtccggcgt agaggatcta atgtgagtta gctcactcat 180 taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc 240 ggataacaat ttcacacagg aaacagctat gaccatgatt acgccaagcg cgcaattaac 300 cctcactaaa gggaacaaaa gctggagctg caagcttaat gtagtcttat gcaatactct 360 tgtagtcttg caacatggta acgatgagtt agcaacatgc cttacaagga gagaaaaagc 420 accgtgcatg ccgattggtg gaagtaaggt ggtacgatcg tgccttatta ggaaggcaac 480 agacgggtct gacatggatt ggacgaacca ctgaattgcc gcattgcaga gatattgtat 540 ttaagtgcct agctcgatac ataaacgggt ctctctggtt agaccagatc tgagcctggg 600 agctctctgg ctaactaggg aacccactgc ttaagcctca ataaagcttg ccttgagtgc 660 ttcaagtagt gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc ctcagaccct 720 tttagtcagt gtggaaaatc tctagcagtg gcgcccgaac agggacttga aagcgaaagg 780 gaaaccagag gagctctctc gacgcaggac tcggcttgct gaagcgcgca cggcaagagg 840 cgaggggcgg cgactggtga gtacgccaaa aattttgact agcggaggct agaaggagag 900 agatgggtgc gagagcgtca gtattaagcg ggggagaatt agatcgcgat gggaaaaaat 960 tcggttaagg ccagggggaa agaaaaaata taaattaaaa catatagtat gggcaagcag 1020 ggagctagaa cgattcgcag ttaatcctgg cctgttagaa acatcagaag gctgtagaca 1080 aatactggga cagctacaac catcccttca gacaggatca gaagaactta gatcattata 1140 taatacagta gcaaccctct attgtgtgca tcaaaggata gagataaaag acaccaagga 1200 agctttagac aagatagagg aagagcaaaa caaaagtaa...

Claims

We claim:

1. An artificial antigen presenting cell (aAPC) comprising a myeloid cell transduced with one or more viral vectors, wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and one or more nucleic acids encoding a costimulatory molecule, and wherein the myeloid cell expresses a CD86 protein and one or more costimulatory molecules.

2. The aAPC of Claim 1, wherein the aAPC can stimulate and expand tumor infiltrating lymphocytes (TILs) contacted with the aAPC.

3. The aAPC of any one of Claims 1 to 2, wherein the aAPC expands a population of TILs by at least 50-fold over a period of 7 days in a cell culture medium comprising IL-2 at a concentration of about 3000 IU / mL and OKT-3 antibody at a concentration of about 30 ng / mL.

4. The aAPC of any one of Claims 1 to 2, wherein the aAPC can stimulate and expand a T cell contacted with the aAPC.

5. The aAPC of any one of Claims 1 to 4, wherein the myeloid cell endogenously expresses HLA-A / B / C, ICOS-L, and CD58.

6. The aAPC of any one of Claims 1 to 5, wherein the myeloid cell is a MOLM-14 cell.

7. The aAPC of any one of Claims 1 to 5, wherein the myeloid cell is a EM-3 cell.

8. The aAPC of Claim 7, wherein the EM-3 cell is further transduced to express a single chain fragment variable (scFv) binding domain capable of binding the Fc domain of OKT-3 antibody.

9. The aAPC of Claim 8, wherein the scFv binding domain comprises clone 7C12 (SEQ ID NO:27) or clone 8B3 (SEQ ID NO:28), or a sequence comprising one or more conservative amino acid substitutions thereof.

10. The aAPC of any one of Claims 1 to 9, wherein the CD86 protein comprises a sequence as set forth in SEQ ID NO:8, or a sequence comprising one or more conservative amino acid substitutions thereof.

11. The aAPC of any one of Claims 1 to 10, wherein the nucleic acid encoding CD86 comprises SEQ ID NO: 19.

12. The aAPC of any one of Claims 1 to 11, wherein the one or more costimulatory molecules comprises a 4-lBBL protein.

13. The aAPC of Claim 12, wherein the 4-lBBL protein comprises a sequence as set forth in SEQ ID NO:9, or a sequence comprising one or more conservative amino acid substitutions thereof.

14. The aAPC of Claim 12, wherein the one or more nucleic acids encoding the 4-lBBL protein comprises SEQ ID NO: 16.

15. The aAPC of any one of Claims 1 to 14, wherein the one or more costimulatory molecules comprises an OX40L protein.

16. The aAPC of Claim 15, wherein the OX40L protein comprises a sequence as set forth in SEQ ID NO: 10, or a sequence comprising one or more conservative amino acid substitutions thereof.

17. The aAPC of any one of Claims 1 to 16, wherein the aAPC has been grown in a serum free media.

18. A method of expanding tumor infiltrating lymphocytes (TILs), the method comprising the step of contacting a population of TILs with an aAPC according to any of Claims 1 to 17, wherein the population of TILs is expanded.

19. A method of expanding a population of tumor infiltrating lymphocytes (TILs), the method comprising the steps of:(a) transducing a myeloid cell with one or more viral vectors to obtain a population of artificial antigen presenting cells (aAPCs), wherein the one or more viral vectors comprise a nucleic acid encoding CD86 and one or more nucleic acids encoding one or more costimulatory molecules and wherein the myeloid cell expresses a CD86 protein and one or more costimulatory molecules, and(b) contacting the population of TILs with the population of aAPCs in a cell culture medium.

20. The method of Claim 19, wherein the cell culture medium further comprises IL-2 at an initial concentration of about 3000 IU / mL and OKT-3 antibody at an initial concentration of about 30 ng / mL.

21. The method of any one of Claims 19 to 20, wherein the population of APCs expands the population of TILs by at least 50-fold over a period of 7 days in a cell culture medium.

22. The method of any one of Claims 19 to 21, wherein the myeloid cell endogenously expresses HLA-A / B / C, ICOS-L, and CD58.

23. The method of any one of Claims 19 to 22, wherein the myeloid cell is a MOLM-14 cell.

24. The method of any one of Claims 19 to 23, wherein the myeloid cell is a EM-3 cell.

25. The method of Claim 24, wherein the EM-3 cell is further transduced to express a single chain fragment variable (scFv) binding domain capable of binding the Fc domain of OKT-3 antibody.

26. The method of Claim 25, wherein the scFv binding domain comprises clone 7C12 (SEQ ID NO:27) or clone 8B3 (SEQ ID NO:28), or a sequence comprising one or more conservative amino acid substitutions thereof.

27. The method of any one of Claims 19 to 26, wherein the CD86 protein comprises SEQ ID NO:8, or a sequence comprising one or more conservative amino acid substitutions thereof.

28. The method of any one of Claims 18 to 26, wherein the nucleic acid encoding CD86comprises SEQ ID NO: 19.

29. The method of any one of Claims 18 to 28, wherein the one or more costimulatory molecules comprises a 4-1BBL protein.