Nucleic acid vaccines targeting methanogens
Patent Information
- Application Number
- NZ835512
- Authority / Receiving Office
- NZ · NZ
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-10
- Filing Date
- 2025-01-10
- Publication Date
- 2025-07-17
AI Technical Summary
Existing methods to inhibit methanogens in ruminants, such as vaccines using freeze-dried or formaldehyde-killed methanogens, have limited efficacy in reducing methane production, as they target immunodominant antigens that do not effectively neutralize methanogen growth or methane production, and are not suitable for extensive production environments.
Development of nucleic acid vaccines targeting specific cell surface proteins or fragments of methanogens, which induce a targeted immune response and antibody production, effectively reducing methane and hydrogen emissions by neutralizing methanogens in the rumen.
The nucleic acid vaccines significantly reduce methane and hydrogen emissions, improving feed conversion efficiency and animal productivity, while also treating diseases associated with methanogens, including periodontal disease and lactic acidosis.
Smart Images

Figure 1_ABST
Abstract
Description
[0001]ARD-00925 NUCLEIC ACID VACCINES TARGETING METHANOGENS CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No.63 / 619578, filed January 10, 2024; and U.S. Provisional Application No.63 / 645242, filed May 10, 2024. The entire contents of each of said applications are incorporated herein in their entirety by this reference. INCORPORATION BY REFERENCE OF SEQUENCE LISTING The application contains a Sequence Listing which has been submitted electronically in the form of an XML file, created January 4, 2025, and named ARD-00925_SL.xml (92,968,091 bytes), the contents of which are incorporated herein by reference in their entirety. BACKGROUND OF THE INVENTION Methane (CH4) is the world’s second most abundant greenhouse gas after carbon dioxide (CO2), accounting for 16% of total greenhouse gas emissions. Livestock emissions, in particular, account for ~32% of all anthropogenic CH4 emissions - equating to ~6% of all CO2 equivalents (CO2e) of greenhouse gas emissions and ~3 billion Tonnes / yr of CO2e. CH4 is a powerful greenhouse gas with a potential global warming effect ~28-fold higher than that of CO2over a 100 year period and ~80-fold higher than that of CO2over a 20 year period. Furthermore, CH4has an atmospheric half-life of ~10 years, thus reducing enteric CH4 emissions could have an immediate and dramatic effect on limiting the rate of global warming, which would be of great significance to efforts to reduce global greenhouse gas emissions. Furthermore, CH4emissions also represent energy losses during ruminant production. On average, approximately 2–12% of the energy consumed in feed is lost in the form of CH4emissions.For rumiants, CH4is predominantly formed in the ruminant fore-stomach (rumen) by methanogens, a subgroup of the Archaea. During normal rumen function, plant material is broken down by fiber-degrading microorganisms and fermented mainly to volatile fatty acids, ammonia, hydrogen (H2) and CO2. Ruminal methanogens principally use H2to reduce CO2to CH4in a series of reactions that are coupled to ATP synthesis. Additional biochemical pathways to produce CH4 from acetate and methanol / methylamine substrates are also present, but represent a lower fraction of the total CH4 biosynthesis in the rumen. Attempts have been made to inhibit the action of methanogens in the rumen using a variety of interventions but most have failed, or were met with only limited success, due to low efficacy, poor selectivity, toxicity of compounds against the host, and / or build-up of resistance to anti-methanogen compounds. Further most solutions, e.g., feed additives and antibiotics, are only applicable to intensive production environments where the animal’s diet can be effectively ARD-00925 controlled to ensure precise daily dosages of the intervention. These solutions are, thus, not effective in extensive, grass-fed production environments where the animals a rarely handled and / or operations where feed cannot readily be mixed daily. Accordingly, there is a great need in the art for effective, selective, and safe compositions and methods for inhibiting methanogens. SUMMARY OF THE INVENTION The present invention is based, at least in part, on the discovery that vaccines (e.g., nucleic acid vaccines) of the present disclosure against a methanogen cell surface antigen or a fragment thereof (e.g., antigenic fragment, epitope), when administered to a subject (e.g., animal, ruminant), are surprisingly effective in inducing immunue response and antibody production against the methanogen, and reducing the methane production in the subject. Previous attempts to vaccinate ruminants have been made using freeze-dried or formaldehyde-killed methanogens or cell wall fractions. While such vaccination induced strong antibody responses, the vaccination demonstrated only up to 8% methane reduction in vivo, largely because immunodomiant antigens present on methanogens did not represent antigens that are targets for antibody-mediated neutralization of the growth of methanogens and / or production of methane. Moverover, it has also been challenging because of the mechanism used (see World Wide Web at dairyherd.com / news / dairy-production / vaccine-could-provide-cattle-ghg-solution). Specifically, the vaccine must produce antibodies against a methanogen, and the antibodies must be introduced into a subject’s saliva, which then pass to the subject’s rumen or the equivalent and bind with the methanogens that convert hydrogen into methane. The antibody must then neutralize the methanogen and result in inhibition of methane production by the methanogen. Unfortunately, while the vaccination was able to induce strong immune response and production of antibodies against methanogens, it was not possible to induce production of a consistently large amount of antibodies which are introduced to the rumen via saliva; and to produce effective antibodies that can neutralize the growth of the methanogen and / or the production of methane. The vaccines of the present disclosure take a targeted approach, aiming at least one cell surface protein or a fragment thereof (e.g., antigenic fragment, epitope) of at least one methanogen that is effective in neutralizing the methanogen, thereby increasing the specificity and effectiveness of the vaccine. The vaccine compositions and methods of the present disclosure are surpringly effective in reducing the CH4emission reductions. In addition to CH4emission reductions, vaccine compositions and methods of the present disclosure have shown surprising and unexpected ARD-00925 reductions in emitted H2following treatment. These results are both surprising and unexpected as reductions in CH4 following treatment with small molecule inhibitors and feed additives have contrarily shown increases in H2 emissions. The reduction in both CH4 and H2 emissions suggest that the vaccine compositions and methods of the present disclosure have utility in improving the feed conversion efficiency and thereby the productivity of treated animals, e.g., increasing the production and / or ruminal concentration of one or more volatile fatty acids (e.g., propionate, butyrate, acetate) in the rumen of the animal, increasing the average daily gain of the animal, reducing the dry matter intake of the animal, reducing the feed requirements of the animal during lactation, and / or increasing the milk production of the animal. Increasing productivity of treated animals can further reduce the carbon intensity of resultant animal products (e.g., milk and meat) as treated animals are not only emit less CH4but also produce more product per animal. Thus, the total reduction in carbon intensity of animal-derived products from animals treated with a vaccine composition of the present disclosure may can be calculated as the composite of the CH4reduction of the animal following treatment in combination with the reduced carbon footprint associated with growing and maintaining those animals (e.g., less total feed, manure, urine, etc.). The vaccine compositions and methods of the present disclosure are useful beyond reducing the methane emission in ruminants. It is well documented that methanogens are associated with various diseases, including a periodontal disease, inflammatory bowel disease (IBD), irritable bowel syndrome (ISB), e.g., IBS-C, small instestinal bacterial overgrowth (SIBO), colorectal cancer, obesity and metabolic syndrome, diverticulosis and diverticulitis, gingivitis, and bloat. Thus, the vaccine compositions and methods of the present disclosure have utility in treating these diseases in animals including humans. The vaccines of the present disclosure also provide a surprising and unexpected effect on lactic acidosis (e.g., reducing rumen lactate, increasing pH, or combination thereof). Therefore, the vaccine compositions methods of the present disclosure have utility in treating diseases associated with elevated, increased, or severe lactic acidosis, e.g., liver abscess. BRIEF DESCRIPTION OF FIGURES Fig.1A shows a schematic diagram showing an exemplary design of the nucleoside- modified mRNA-LNP vaccines. A) Design of the nucleoside-modified mRNA-LNP vaccines. The important structures of mRNA are the 5ʹ cap (e.g., the 7–methylguanosine cap), the 5ʹ and 3ʹ untranslated regions (UTRs), sequence encoding at least one cell surface protein or a fragment thereof of at least one methanogen, and the polyA tail. mRNA cap is incorporated either in one step during transcription in the presence of CAP analogs (e.g., Clean-Cap) or in two steps, after IVT mRNA production, by enzymatic capping reaction. Replacement of native ARD-00925 nucleosides in in-vitro-transcribed mRNA with chemically modified versions reduces immunogenicity and increases translation efficiency. A vaccine may comprise nucleoside- modified transcripts with substitution of uridines for N1-methyl pseudouridine is (1mψ). Each of these structural elements of mRNA can be optimized and modified to modulate the stability, translation capacity, and immunestimulatory profile of mRNA. B) Schematic depiction of mRNA vaccine encapsulated into LNP formulations for improved in vivo mRNA delivery, which are typically composed of (1) an ionizable or cationic lipid (e.g., SM-102 or ALC-0315), bearing tertiary or quaternary amines to encapsulate the polyanionic mRNA; (2) a helper lipid (e.g., helper lipid 1,2-distearoyl-snglycero-3-phosphocholine (DSPC)) that resembles the lipids in the cell membrane; (3) cholesterol to stabilize the lipid bilayer of the LNP; and (4) a polyethylene glycol (PEG)-lipid [e.g., (2-[(polyethylene glycol)-2000]-N,N- ditetradecylacetamide (PEG2000-DMA), or 1,2-dimyristoyl-rac-glycero3-methoxypolyethylene glycol-2000 (PEG2000-DMG)] to lend the nanoparticle a hydrating layer, improve colloidal stability, and reduce protein absorption. Adapted from Granados-Riveron and Aquino-Jarquin (2021) Biomedicine & Pharmacotherapy 142:111953. Fig.1B shows a schematic diagram of an exemplary RNA vaccine. Fig.2A-Fig.2B show an exemplary IVT mRNA formulated in lipid nanoparticle vaccines using a cell-free production. Fig.2A shows in vitro transcribed (IVT) mRNA contains five structural elements: a 5′ cap containing 7- methylguanosine linked through a triphosphate bridge to a 2′- O- methylated nucleoside, flanking 5′ and 3′ untranslated regions (UTRs), an open reading frame (ORF) and a polyA tail. Fig.2A shows mRNA that is synthetically produced and formulated into vaccines. (1) Once the sequence of at least one cell surface protein of at least one methanogen is identified, said sequence is designed and inserted into a plasmid DNA construct. (2) Plasmid DNA is transcribed into mRNA by bacteriophage polymerases in vitro and (3) mRNA transcripts are purified by high performance liquid chromatography (HPLC) to remove contaminants and reactants. (4) Purified mRNA is mixed with lipids in a microfluidic mixer to form lipid nanoparticles. Rapid mixing causes the lipids to encapsulate mRNA instantaneously and precipitate as self- assembled nanoparticles. (5) The nanoparticle solution is dialysed or filtered to remove non- aqueous solvents and any unencapsulated mRNA and (6) the filtered mRNA vaccine solution is stored in sterilized vials. Adapted from Chaudhary et al. (2021) Nature Reviews, 20:817-838. Fig.3A-Fig.3B show representative mRNA delivery vehicles contain cationic or ionizable molecules. Fig.3A shows lipid nanoparticles encapsulate mRNA in their core. They consist of four components: ionizable lipids, e.g., DLin- MC3- DMA, SM-102, ALC-0315, ARD-00925 A18- Iso5-2DC18, A6, or 306Oi10; cholesterol or its variants, e.g., β-sitosterol or 20α- hydroxycholesterol; helper lipids, e.g., DSPC and DOPE; and PEGylated lipids, e.g., ALC-0159, PEG- DMG. Fig.3B (upper panel) shows polymers, e.g., PEI, PBAE, PEG-PAsp(DET), or CART form polymer–mRNA complexes. Fig.3B (bottom panel) shows cationic nanoemulsions containing a squalene core surrounded by an outer shell made of cationic lipid (for example, DOTAP) and surfactants, such as Tween 80 and Span 85. The mRNA adsorbs to the surface via electrostatic binding. Adapted from Chaudhary et al. (2021) Nature Reviews, 20:817-838. Fig.4 shows an exemplary mechanism by which immune response is elicited by an mRNA vaccine. For example, messenger RNA vaccines elicit immunity through transfection of antigen-presenting cells. (1) Injected mRNA vaccines are endocytosed by antigen- presenting cells. (2) After escaping the endosome and entering the cytosol, mRNA is translated into protein by the ribosome. The translated antigenic protein can stimulate the immune system in several ways. (3) Intracellular antigen is broken down into smaller fragments by the proteasome complex, and the fragments are displayed on the cell surface to cytotoxic T cells by major histocompatibility complex (MHC) class I proteins. (4) Activated cytotoxic T cells kill infected cells by secreting cytolytic molecules, such as perforin and granzyme. (5) Additionally, secreted antigens can be taken up by cells, degraded inside endosomes and presented on the cell surface to helper T cells by MHC class II proteins. (6) Helper T cells facilitate the clearance of circulating pathogens by stimulating B cells to produce neutralizing antibodies, and by activating phagocytes, such as macrophages, through inflammatory cytokines. BCR, B cell receptor; ER, endoplasmic reticulum; TCR, T cell receptor. Adapted from Chaudhary et al. (2021) Nature Reviews, 20:817-838. Fig.5 illustrates administration of a nucleic acid vaccine (501) encoding a methanogen cell surface protein to a ruminant (502), such as a cow. Once administered, expression of the methanogen cell surface protein elicits an immune response generating salivary antibodies (503) generated in the saliva (504) that are delivered to the rumen (505). In the rumen, salivary antibodies (503) bind to an reduce the fitness of ruminal methanogens (506) thereby decreasing eructated methane (507). Fig.6 illustrates an exemplary testing methodology. Nucleic acids, e.g., mRNA, (601) are mixed with lipids (602) to form lipid nanoparticles (603). The lipid nanoparticles (603) are formulated into a vaccine (604) and used to vaccinate a ruminant (605), such as a cow. Blood (606) is collected and clarified into serum (607). Sera antibodies (608) are combined with methanogens (609) and the result change in fitness is measured. ARD-00925 Fig.7A shows an illustrative schematic of various nucleic acid vaccine constructs: (top) comprising a 5 ‘UTR, a sequence encoding an antigen, a 3’ UTR, and a poly A tail; (middle) a 5 ‘UTR, a signal peptide (SP) a sequence encoding an antigen, a 3’ UTR, and a poly A tail; (bottom) a 5 ‘UTR, a signal peptide (SP) a sequence encoding an antigen, a transmembrane domain, a 3’ UTR, and a poly A tail. Fig.7B shows an illustrative schematic of various protein expression and antigen presentation modalities: (701) cytosolic protein expression and antigen presentation to the immune system through major histocompatibility complex; (702) protein expression and secretion for antigen presentation to the immune system; (703) protein expression and anchoring on the extracellular surface of the cell membrane for presentation to the immune system. Fig.8A shows encapsulation of mRNA (801) followed by particle size and dispersity analysis (802). Fig.8B shows particle dispersity (y-axis) and size (x-axis) for exemplary LNP preparations. Fig.9 shows relative IgG (y-axis; antigen treated / empty treated) for 9 animals vaccinated with three exemplary mRNA constructs. Fig.10 shows average OVA-specific IgG (y-axis) as measured by ELISA for animals treated with ARK015 LNPs following intramuscular or subcutaneous vaccination. Fig.11 shows Methanogen abundance in ruminant microbiome samples. Methanbrevibacter ruminantium and Methanobrevibacter gottschalkii comprise ~65% of methanogens in the ruminal microbiome. Fig.12 shows particle size and polydispersity of various nucleic acid LNP vaccines. Fig.13 shows particle size and polydispersity of various nucleic acid LNP vaccines. Fig.14 shows denaturing agarose gel electrophoresis analysis of various nucleic acid LNP vaccines. Fig.15 shows an exemplary methodology for measuring methane production from methanogen monocultures treated with sera collected from vaccinated animals. Briefly, BY medium is inoculated with a methanogen-of-interest and combined with serum. The culture tube is crimped closed and pressurized with 80% hydrogen, 20% carbon dioxide. The cultures are incubated and methane in measured intermittently using a GazoMat handheld methane monitoring device. Methane is plotted as a function of time for the various treatment groups and the control group. Fig.16A shows species selective reduction in methane production when treated with vaccinated sera. Briefly, animals were vaccinated with ARK007, a nucleic acid vaccine encoding a protein present in M. ruminantium but not M. gottschalkii. Methane production (y- ARD-00925 axis) over time (x-axis) is plotted for a culture of Methanobrevibacter ruminantium combined with a serum sample collected at day 14 after vaccination with ARK007 (light gray, triangles) compared to the same animal pre-vaccination (dark gray, circles). Methane production rate is reduced by 3x in the sample treated with the day 14 serum. Methane reaches maximal production at ~300 hrs in the sample treated with the day 14 serum as compared to ~100 hrs when treated with pre-vaccination serum. Fig.16B shows methane production over time for a culture of Methanobrevibacter gottschalkii treated with the same sera samples. There is no notable reduction in methane production for M. gottschalkii when treated with either the day 14 or pre-vaccination sera. This demonstrates the ability to generate highly specific and selective antibodies by vaccination with nucleic acids encoding methanogen cell surface proteins. Fig.17A shows increased reduction in methane production by monocultures of Methanobrevibacter ruminantium when treated with sera collected pre-vaccination, after a first injection on day 0, and after a boost injection on day 21. Methane production rate is reduced ~2x when treated with serum collected after a single vaccination (day 21) and ~20x when treated with serum collected after a boost vaccination (day 35). Fig.17B shows reduction is methane production rate when treated with a small molecule inhibitor of methanogenesis (lauric acid) at 3 different concentrations. This demonstrates that the vaccinated sera samples are preforming with similar efficacy to known small molecule inhibitors of methanogenesis. Fig.18 shows a computational pipeline for selection of Methanobrevibacter ruminantium and Methanobrevibacter gottschalkii cell surface proteins for vaccine production. The pipeline includes collation of all ORFs, filtering based on cell localization, filtering based on transcriptomic analysis of genes expressed during small molecule challenge, and then filtered for function. Fig.19 shows a biochemical map of methanogenesis-related proteins. Several proteins identified are involved in metal uptake, specifically molybdate, cobalt, nickel, and iron, which are critical for methanogenesis. Fig.20 shows an exemplary methodology for characterizing nucleic acid vaccines encoding methanogen cell surface proteins. Fig.21A An exemplary vaccination protocol. In some embodiments, at least one vaccine (e.g., a nucleic acid vaccine comprising a nucleic acid sequence encoding at least one methanogen surface antigen) is prepared. The at least one vaccine is used to vaccinate a pregnant subject (e.g., animal, ruminant). The unborn fetus is exposed to the antibodies against methanogen generated by the mother. After birth, the child subject receives milk laden with the ARD-00925 antibodies against the at least one methanogen surface antigen. The child subject is vaccinated with at least one vaccine of the present disclosure prior to weaning. The child subject may be vaccinated with a vaccine encoding the same or different methanogen surface antigen. Fig.21B An exemplary vaccination protocol. In some embodiments, at least one vaccine (e.g., a nucleic acid vaccine comprising a nucleic acid sequence encoding at least one methanogen surface antigen) is prepared. A subject is treated with a combinatory therapy, which comprises any two or more selected from a vaccine, antibodies, milk, animal feed, an agent (e.g., an agent that reduces methane production in a subject, a probiotic bacterial strain, a small molecule inhibitor, etc.), and other composition of the present disclosure (e.g., those reducing methane production in a subject). Here, a reduction in methane production that is greater than the use of a single therapy alone is achieved. Fig.22A shows a computational pipeline (left) for selection of Methanogen cell surface proteins for vaccine production. The pipeline includes collation of all ORFs, filtering based on uniqueness to methanogens, cell localization, and function. A network map of key methanogen cell surface protein functions is shown to the right. Fig.22B shows a schematic representation of the protein fragments described in Table 21. The amino acid sequence of each folded domain is designated as a “protein fragment” in Table 21, each of which is useful as an antigen for the vaccines of the present disclosure. Fig.23 A subway diagram of our improved metatdenovo pipeline. Fig.24A Heatmap of the expression values of 192 genes of interest within the M. gottchalkii transcriptome. Each row represents the expression of a single gene and is labeled by its corresponding protein ID. Each column represents one M. gottschalkii monoculture harvested in exponential phase. Row annotations include any enriched GO terms (GO_group) or Pfams (Pfam_group) and the number of mass spectrometry samples in which the protein was found MS_Samples). Genes with multiple enriched GO terms or Pfams are labeled as such for simplicity. Fig.24B Heatmap of the normalized and transformed expression values of the metaT de novo assembly contigs that best matched to a gene of interest. Each row represents the expression of a single contig and is labeled by the corresponding gene of interest’s protein ID and the contig ID, separated by an underscore. Each column represents one rumen sample harvested under different conditions. Fig.25 is a schematic of a biochemical pathway and enzymes for the production of methane from acetate (i.e., the acetoclastic pathway), hydrogen and carbon dioxide (i.e., the hydrogenotrophic pathway), and methanol and derivatives thereof (i.e., the methylotrophic pathway). ARD-00925 Fig.26 is a schematic describing the reduction of methyl-CoM and coenzyme B into methane by methyl-coenzyme M reductase (MCR), a key enzyme present in methane production via the acetoclastic, hydrogenotrophic, and methylotrophic pathways. Fig.27 is a schematic describing the application of small molecules that affect MCR activity to modulate methane production. Fig.28 is a cross-sectional diagram of the application of a composition for reduction of deleterious atmospheric gases and / or precursors thereof to a water source, such as a trough or a pond. The water source (401) comprises the composition (402). While the composition (402) is shown to be at the bottom of the water source (401), the composition (402) can be at any suitable position, for example floating at the top, admixed within, or dissolved within the water source (401). Fig.29 shows aerial delivery of a composition for reduction of deleterious atmospheric gases and / or precursors thereof to a water source. A aerial delivery device (501) delivers (502) a composition (within the device) to a water source (503), such as a trough or a pond. Fig.30 shows 3NOP concentration (mM) v. adsorbent (~20mM stock solution). Fig.31 shows 3NOP concentration (mM) v. adsorbent (~8mM stock solution). Fig.32 shows exemplary multilayer polyelectrolyte coatings of 15% activated carbon tablets. Fig.33 shows exemplary multilayer polyelectrolyte coatings of 25% activated carbon tablets. Fig.34 shows exemplary multilayer polyelectrolyte coatings of 15% activated carbon tablets with 5% sodium lignosulfonate. Fig.35 shows exemplary multilayer polyelectrolyte coatings of 15% activated carbon with 5% hydroxypropyl cellulose. Fig.36 is a graph showing the release profiled of a silica v. activated carbon adsorbent. Fig.37 is a table showing the composition of various polycaprolactone-based formulations according to some embodiments of the invention. Fig.38 is a bar graph showing 3NOP release in mM for exemplary polycaprolactone- based formulations. Fig.39 is a graph showing normalized 3NOP concentration v. release time in days of exemplary polybutylene succinate-based formulations. Fig.40 is a bar graph showing 3NOP release (%) from exemplary PEC microcapsules. Samples are prepared with a 3NOP concentration of 100 μM. Final pH solution ~7. K, L, F, and E refer to lysine, leucine, phenylalanine, and glutamic acid, respectively. PSS refers to ARD-00925 polystyrene sulfonate. Table 40 discloses (KKLF)3 as SEQ ID NO: 71463, (EELF)3 as SEQ ID NO: 71464 and (kKlF)3 as SEQ ID NO: 71465. Fig.41 is bar graph showing 3NOP release (%) from exemplary PEC microcapsules. Samples are prepared with a 3NOP concentration of 100 μM. Final pH solution ~7. PLR refers to poly (L-arginine), and PLK refers to poly (L-lysine). SLS and PSS refer to sodium lignosulfonate and polystyrene sulfonate. Fig.42A-Fig.42B are bar graphs showing representative ELISA data of the total IgG level (Fig.42A) and total IgGA level (Fig.42B) in the serum of the cows that have been vaccinated with lipid nanoparticles (LNPs) comprising one of ARK001-ARK010, ARK012, ARK013, and ARK015. Also shown are the ELISA data for cows vaccinated with empty LNPs. Three cows were vaccinated with each sample. The numbers 1-5 on the X axis correspond to Day 0, Day 14, Day 21, Day 28, and Day 35, respectively, since the time of vaccination. Each “TAMU” number refers to an individual cow. DETAILED DESCRIPTION OF THE INVENTION Provided herein are vaccines (e.g., nucleic acid vaccines) against at least one cell surface antigen or a fragment thereof (e.g., antigenic fragment, epitope) of at least one methanogen, which are effective in inducing immune response and antibody production against the methanogen antigen, and reducing the methane production in subjects. The vaccines of the present disclosure are also useful in treating diseases in subjects (e.g., animals, mammals, ruminants, humans) that are associated with methanogens (e.g., a periodontal disease, Inflammatory Bowel Disease (IBD), irritable bowel syndrome (ISB), IBS-C, small instestinal bacterial overgrowth (SIBO), colorectal cancer, obesity and metabolic syndrome, diverticulosis and diverticulitis, gingivitis, and / or bloat). The vaccines of the present disclosure are also useful in treating diseases in subjects (e.g., animals, mammals, ruminants, humans) that are associated with elevated, increased, or severe lactic acidosis, e.g., liver abscess. DEFINITIONS The articles “a” and “an” are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. As used herein, the term "about" when used before a numerical designation, e.g., temperature, time, amount, concentration, and such other, including a range, indicates approximations which may vary by (+) or (-) 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%. The term “administering” is intended to include routes of administration which allow an agent (e.g., a vaccine composition, an agent that reduces methane production in a subject) to perform its intended function. Examples of routes of administration which can be used include ARD-00925 injection (subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal, intradermal, intramuscular, etc.), oral, inhalation, and transdermal routes. The injections can be bolus injections or can be continuous infusion. Depending on the route of administration, the agent (e.g., a vaccine composition, an agent that reduces methane production in a subject) can be coated with or disposed in a selected material to protect it from natural conditions which may detrimentally affect its ability to perform its intended function. The agent may be administered alone, or in conjunction with a pharmaceutically acceptable carrier or adjuvant. The agent (e.g., a vaccine composition, an agent that reduces methane production in a subject) also may be administered as a prodrug, which is converted to its active form in vivo. The term “conjoint” or “combination” administration, as used herein, refers to the administration of two or more agents that aid in reducing methane production in a subject. The different agents comprising the combination may be administered concomitant with, prior to, or following the administration of one or more agents. The term “fragment,” as used herein encompasses any and all that is less than the full length. In some embodiments, a fragment of a polypeptide of the present disclosure is an antigenic fragment of the polypeptide. Such antigenic fragment may comprise at least one epitope that binds to the antibody. In preferred embodiments, a fragment of a polypeptide of the present disclosure is a fragment of the polypeptide that is effective in eliciting immune response and / or inducing antibody production when administered to a subject. The term “methanogen,” as used herein, refers to a microorganism that produces methane as a metabolic byproduct. Methanogens belong to the domain Archaea, and include, but are not limited to those of a family Methanobacteriaceae, e.g., those of genera Methanobrevibacter, Methanosphaera, Methanomicrobium, Methanobacterium, Methanocorpusulum, Methanosaeta, Methanoculleus, Methanosarcina, and Thermoplasmatales. Specific methanogens include, but are not limited to, Methanobrevibacter ruminantium (i.e., the M1 strain or strain DSM 1093 (see e.g., World Wide Web at dsmz.de / microorganisms / html / strains / strain.dsm001093. htm) and Methanobrevibacter gottschalkii. Additional relevant species are further described below. The term "nucleic acid" (also called “polynucleotide”) in its broadest sense, includes any compound and or substance that comprise a polymer of nucleotides linked via a phospohdiester bond. The nucleotides or a portion thereof may be natural or synthetic; or may be structurally or chemically modified. The term “polydispersity index” is a ratio that describes the homogeneity of the particle size distribution of a system. A small value, e.g., less than 0.3, indicates a narrow particle size distribution. ARD-00925 The term “ruminant” refers to a hoofed herbivorous grazing or browsing mammal that is able to acquire nutrients from plant-based food by fermenting it in a specialized stomach prior to digestion, principally through microbial actions. The process, which takes place in the front part of the digestive system and therefore is called foregut fermentation, typically requires the fermented ingesta (known as cud) to be regurgitated and chewed again. The roughly 200 species of ruminants include both domestic and wild species. Ruminants include, but are not limited to, cattle (e.g., large domesticated ruminant animals, e.g., cows (including dairy cattle), bulls), all domesticated and wild bovines (i.e., those belonged to the family Bovidae; e.g., cows, cattle, bulls, bisons, yaks, African buffalos, water buffalos, antelopes), goats, sheep, giraffes, deer, caribou, and gazelles. In preferred embodiments, ruminants are domesticated. As used herein, the term “ruminant” includes ruminant-like animals or pseudo-ruminant animals such as macropods, llamas, camels, and alpacas. In some embodiments, a ruminant has not been administered with an agent that reduces methane. In other embodiments, a ruminant has been administered or is being administered with an agent that reduces methane. As used herein, the term “valency” refers to the number of antigenic components in the vaccine or nucleic acid polynucleotide (e.g., DNA or RNA polynucleotide) or polypeptide. In some embodiments, the vaccines are monovalent. In some embodiments, the vaccines are divalent. In some embodments the vaccines are trivalent. In some embodiments the vaccines are multi-valent. Multivalent vaccines may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,12,13,14, 15, 16, 17, 18, 19, 20, or more antigens or antigenic moieties (e.g., antigenic peptides, etc.). The antigenic components of the vaccines may be in a single nucleic acid molecule or in separate nucleic acid molecules. The term “subject” refers to any healthy or diseased animal, including any mammal, ruminant, canine, feline, or human. METHANOGENS The diversity of the rumen methanogens is much smaller, and their diversity is much lower than that of rumen bacteria, with archaeal SSU rRNA only accounting for 6.8% of rumen total SSU rRNA. Archaea in the rumen is represented by <3.3% of the total rRNA (both 16S and 18S) therein. Representative family of methanogens includes Methanobacteriaceae. Rumen methanogens typically comprises 2-3% of the total microbial biomass in the rumen. Representative genera of methanogens include Methanobrevibacter, Methanosphaera, Methanomicrobium, Methanobacterium, Methanocorpusulum, Methanosaeta, Methanoculleus, Methanosarcina, and Thermoplasmatales. Certain species of ruminal methanogens have been isolated into pure cultures: Methanobacterium formicicum, Methanobacterium bryantii, Methanobrevibacter ARD-00925 ruminantium, Methanobrevibacter millerae, Methanobrevibacter olleyae, Methanomicrobium mobile, Methanoculleus olentangyi, and Methanosarcina barkeri. Additional species have been recently isolated, including Methanobrevibacter boviskoreani (isolated from the rumen of Korean native cattle), Methanobacterium beijingense (isolated from the rumen of goat), Methanoculleus marisnigri (isolated from the rumen of Indian crossbred cattle), Methanoculleus bourgensis (isolated from the rumen of Holstein cattle), and Methanosarcina mazei (isolated from the rumen of Korean Hanwoo cattle) (based on the RDP database). A Thermoplasmatales-like pyrrolysine-dependent archaeon BRNA1 was also isolated from bovine (GenBank access number: CP002916). Collectively, 16S rRNA gene sequences from cultured methanogens only accounted for approximately 0.7% of the total archaeal sequences of rumen origin, and several taxa do not have a single cultured representative. Most of the isolates are members of the family Methanobacteriaceae. Compared to other anaerobic habitats where >100 species of methanogens of 28 genera have been isolated, the diversity and species richness of ruminal methanogens are quite low, reflecting the highly selective ruminal environment for methanogens. In addition, sequenced ruminal 16S rRNA gene clones shared >95% sequence similarity with that of Methanobrevibacter gottschalkii, Methanobrevibacter thaueri, Methanobrevibacter smithii and Methanosphaera stadtmanae, indicating that these species may be common ruminal methanogens. Much of the ruminal methanogen diversity was characterized by 16S rRNA gene sequences. The RDP Release 11 (Update 3) contains 8623 archaeal 16S rRNA gene sequences of rumen origin. These sequences were generated using the Sanger sequencing technology, which produces higher sequence accuracy than NGS technologies, in 96 separate studies including 48 unpublished studies. About 90% of these sequences were assigned to methanogens. These sequences were classified to 10 known genera, with Methanobrevibacter being represented by 63.2% of all the sequences followed by Methanosphaera (9.8%), Methanomicrobium (7.7%), and Methanobacterium (1.2%). The order Thermoplasmatales, which was previously referred to as the rumen cluster C (RCC) group, is represented by 7.4% of the total archaeal sequences. CELL SURFACE PROTEINS OF METHANOGENS Provided herein is at least one cell surface protein or a fragment thereof (e.g., an antigenic fragment, e.g., a fragment comprising an epitope, e.g., a fragment comprising an extracellular domain or a portion thereof) of at least one methanogen and nucleic acid(s) encoding same that can be used in a vaccine composition (e.g., nucleic acid vaccine), which can ARD-00925 elicit immune response, antibody production, and antibody-mediated neutralization of the growth of methanogens and / or production of methane. In certain aspects, the at least one cell surface protein or a fragment thereof (e.g., an antigenic fragment, e.g., a fragment comprising an epitope, e.g., a fragment comprising an extracellular domain or a portion thereof) of at least one methanogen is of a family Methanobacteriaceae. In some embodiments, the at least one methanogen is of a genus selected from: Methanobrevibacter, Methanosphaera, Methanomicrobium, Methanobacterium, Methanocorpusulum, Methanosaeta, Methanoculleus, Methanosarcina, and Thermoplasmatales. In some embodiments, the at least one methanogen comprises Methanobacterium formicicum, Methanobacterium bryantii, Methanobrevibacter ruminantium, Methanobrevibacter millerae, Methanobrevibacter olleyae, Methanomicrobium mobile, Methanoculleus olentangyi, Methanosarcina barkeri, Methanobrevibacter boviskoreani, Methanobacterium beijingense, Methanoculleus marisnigri, Methanoculleus bourgensis, Methanosarcina mazei, Thermoplasmatales archaeon BRNA1, Methanobrevibacter gottschalkii, Methanobrevibacter thaueri, Methanobrevibacter smithii, Methanosphaera stadtmanae, Methanococcoides burtonii, Methanolobus psychrophilus R15, Methanobacterium paludism, Methanohalobium evestigatum, Methanomethylovorans hollandica, Methanothrix soehngenii, Methanocaldococcus vulcanius, Methanosalsum zhilinae, Methanocorpusculum labreanum, Methanoregula formicica, Methanoculleus marisnigri, Methanocella arvoryzae, Methanoculleus bourgensis, Methanolacinia petrolearia, Methanospirillum hungatei, Methanoplanus limicola, Methanohalophilus mahii, Methanococcus aeolicus, Methanosphaerula palustris, Methanocaldococcus fervens, Methanocaldococcus jannaschii, Methanocaldococcus sp. FS406- 22, Methanoregula boonei, Methanobrevibacter sp. AbM4, Methanobrevibacter ruminantium, Methanosphaera, Methanobacterium formicicum, Methanocaldococcus villosus, Methanosarcina barkeri, Methanobacterium lacus, Methanotorris igneus, Methanotorris formicicus, Methanocaldococcus infernus, Methanofollis liminatans, Methanothermococcus okinawensis, Methanobrevibacter smithii, Methanobrevibacter, Methanocella conradii, Methanothermococcus thermolithotrophicus, Methanococcus maripaludis, Methanococcus maripaludis, Methanococcus vannielii, Methanothermus fervidus, Methanosarcina acetivorans, Methanosarcina mazei, Methanosaeta harundinacea 6Ac, Methanococcus maripaludis, Methanococcus voltae, Methanolinea tarda, Methanolobus psychrophilus, Methanosaeta harundinacea, or any combination thereof. In some embodiments, the at least one methanogen comprises Methanobrevibacter ruminantium. In some embodiments, the at least one methanogen comprises ARD-00925 Methanobrevibacter ruminantium M1 (DSM 1093). In preferred embodiments, the atleast one methanogen comprises Methanobrevibacter gottschalkii. In some embodiments, the at least one methanogen comprises Methanobrevibacter gottschalkii DSM11977. In certain embodiments, a vaccine composition comprises a nucleic acid (e.g., mRNA, DNA, or a modified variant thereof) encoding at least one of cell surface protein. In some embodiments, the nucleic acid encodes at least one fragment (e.g., an antigenic fragment, an epitope) of at least one cell surface protein. In some embodiments, the nucleic acid encodes the extracellular domain, or a fragment thereof, of at least one cell surface protein. In some embodiments, the nucleic acid does not encode the transmembrane and / or intracellular domains or a fragment thereof of the at least one cell surface protein. In some embodiments, the nucleic acid (e.g., mRNA, DNA, or a modified variant thereof) for a vaccine composition comprises at least one of the nucleic acid sequence, or a fragment thereof (e.g., those encoding at least a portion of the extracellular domain), encoding the adhesion-like proteins, adhesin-like proteins with cysteine protease domain, adhesin-like proteins with transglutaminase domain. Such nucleic acids, proteins, and sequences are also provided in Leahy et al. (2010) PLoS One, 5(1):e8926 and US 10,314,895, each of which is incorporated herein by reference. The representative nucleic acid sequences encoding the cell surface antigens of a methanogen and the representative amino acid sequences of the cell surface antigens of a methanogen are provided in Tables of the present disclosure, including Tables 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A-6E, 17A, 19, 20, and 21. In some embodiments, a vaccine composition comprises a polypeptide or a fragment thereof (e.g., an antigenic fragment, an epitope) of at least one cell surface protein. In some embodiments, the polypeptide comprises the extracellular domain or a fragment thereof of at least one cell surface protein. In some embodiments, the polypeptide or a fragment thereof does not comprise the transmembrane and / or intracellular domains or a fragment thereof of the at least one cell surface protein. In certain aspects, provided herein are vaccine compositions comprising at least one nucleic acid encoding at least one cell surface protein or a fragment thereof (e.g., an antigenic fragment, e.g., a fragment comprising an epitope, e.g., a fragment comprising an extracellular domain or a portion thereof) of at least one methanogen. In some embodiments, the at least one nucleic acid encodes a protein, which does not comprise a signal peptide. In some embodiments, the at least one nucleic acid encodes a protein, which does not comprise a transmembrane domain. ARD-00925 In some embodiments, the at least one cell surface protein or a fragment thereof comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to an amino acid sequence presented herein. In some embodiments, the at least one cell surface protein or a fragment thereof comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to an amino acid sequence set forth in any one of Tables C, 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A-6F, 17A, and 19-21, or a fragment thereof. In some embodiments, the at least one cell surface protein or a fragment thereof comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to an amino acid sequence encoded by at least one nucleic acid presented herein. In some embodiments, the at least one nucleic acid comprises a nucleotide sequence set forth in any one of Tables C, 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A-6F, 17A, and 19-21, or a fragment thereof. In some embodiments, the at least one nucleic acid comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to a nucleotide sequence presented herein. In some embodiments, the at least one nucleic acid comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to a nucleotide sequence set forth in Tables C, 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A-6F, 17A, and 19- 21, or a fragment thereof. In some embodiments, the at least one nucleic acid encoding at least one cell surface protein or a fragment thereof further comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 heterologous amino acid residues that are not native to the cell surface protein of a methanogen. In some embodiments, the at least one nucleic acid encoding at least one cell surface protein or a fragment thereof further comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 heterologous amino acid residues that are not native to the cell surface protein of a methanogen. In some embodiments, the at least one nucleic acid encoding at least one cell surface protein or a fragment thereof further comprises no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, ARD-00925 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 heterologous amino acid residues that are not native to the cell surface protein of a methanogen. In some embodiments, the heterologous amino acid residues comprise a heterologous signal peptide and / or a heterologous transmembrane domain. In some embodiments, a vaccine composition comprises at least one nucleic acid encoding at least one fragment of at least one cell surface protein. In some embodiments, a vaccine composition comprises at least one nucleic acid, which does not encode a full-length cell surface protein of at least one methanogen. In some embodiments, the at least one fragment of at least one cell surface protein lacks at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acid residues from its native full-length protein sequence. In some embodiments, the at least one fragment of at least one cell surface protein lacks about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acid residues from its native full-length protein sequence. In some embodiments, the at least one fragment of at least one cell surface protein lacks no more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acid residues from its native full-length protein sequence. In some embodiments, the at least one fragment of at least one cell surface protein lacks at least, about, or no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acid residues from the N-terminus of its native full-length protein sequence. ARD-00925 In some embodiments, the at least one fragment of at least one cell surface protein lacks at least, about, or no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acid residues from the C-terminus of its native full-length protein sequence. In preferred embodiments, the at least one fragment of at least one cell surface protein comprises one or more extracellular domain or a portion thereof. A person of ordinary skill in the art can readily predict an extracellular portion of any given sequence by using a suitable tool known in the art, e.g., TMbed or TMHMM. In some embodiments, the at least one fragment of at least one cell surface protein lacks a native signal peptide. In some embodiments, the at least one fragment of at least one cell surface protein lacks a native transmembrane domain. In certain aspects, certain classes of methanogen cell surface proteins are particularly useful in generating an effective vaccine composition of the present disclosure (e.g., comprising at least one nucleic acid encoding at least one cell surface protein or a fragment thereof of at least one methanogen). In some embodiments, the at least one cell surface protein comprises at least one of the following structures and / or functions: adhesin-like, ATP-processing, cell wall biosynthesis, cofactor biosynthesis, CRISPR (provides methanogens an immunity against viruses), energy metabolism, enzyme, fatty acid synthesis, general metabolism, membrane protein, metal- binding, methanogenesis, methanogenesis Mtr proteins, methanogenesis MtrE proteins, phage related, proteolysis, transcription regulation, ribosomal, substrate binding, transcription, transport, and a protein whose gene expression changes in response to lauric acid stress (see Table 6F below). A person of ordinary skill in the art can determine the polypeptide sequences from the nucleic acid sequences, or determine the nucleic acid sequences from the polypeptide sequences presented herein or those known in the art. The nucleic acid and amino acid sequence information for nucleic acid and polypeptide molecules useful in the present invention are well-known in the art and readily available on publicly available databases, such as the National Center for Biotechnology Information (NCBI). The representative cell surface antigens of various methanogens and their nucleic acid sequences and amino acid sequences are provided in the US Application No.18 / 350526 (e.g., ARD-00925 Table 2A, Table 2B, Table 3, Table 17A, Table 19, Table 20, and Table 21), US Application No. 63 / 359,978, or US Application No.63 / 524,513, the entire contents of each of which are incorporated herein by reference in its entirety. Certain representative antigens and their amino acid and nucleic acid sequences are also presented in Tables C, 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A-6F, 17A, and 19-21 of the present disclosure. SEQUENCES As used herein, coding region refers to regions of a nucleotide sequence comprising codons which are translated into amino acid residues, whereas noncoding region refers to regions of a nucleotide sequence that are not translated into amino acids (e.g., 5' and 3' untranslated regions). Complement [to] or complementary refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that an adenine residue of a first nucleic acid region is capable of forming specific hydrogen bonds (base pairing) with a residue of a second nucleic acid region which is antiparallel to the first region if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of base pairing with a residue of a second nucleic acid strand which is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are arranged in an antiparallel fashion, at least one nucleotide residue of the first region is capable of base pairing with a residue of the second region. In some embodiments, the first region comprises a first portion and the second region comprises a second portion, whereby, when the first and second portions are arranged in an antiparallel fashion, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. In other embodiments, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues in the second portion. A nucleic acid is operably linked when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence. With respect to transcription regulatory sequences, operably linked means that the DNA sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. For switch sequences, operably linked indicates that the sequences are capable of effecting switch recombination. ARD-00925 There is a known and definite correspondence between the amino acid sequence of a particular protein and the nucleotide sequences that can code for the protein, as defined by the genetic code (shown below). Likewise, there is a known and definite correspondence between the nucleotide sequence of a particular nucleic acid and the amino acid sequence encoded by that nucleic acid, as defined by the genetic code. GENETIC CODE Alanine (Ala, A) GCA, GCC, GCG, GCT Arginine (Arg, R) AGA, ACG, CGA, CGC, CGG, CGT Asparagine (Asn, N) AAC, AAT Aspartic acid (Asp, D) GAC, GAT Cysteine (Cys, C) TGC, TGT Glutamic acid (Glu, E) GAA, GAG Glutamine (Gln, Q) CAA, CAG Glycine (Gly, G) GGA, GGC, GGG, GGT Histidine (His, H) CAC, CAT Isoleucine (Ile, I) ATA, ATC, ATT Leucine (Leu, L) CTA, CTC, CTG, CTT, TTA, TTG Lysine (Lys, K) AAA, AAG Methionine (Met, M) ATG Phenylalanine (Phe, F) TTC, TTT Proline (Pro, P) CCA, CCC, CCG, CCT Serine (Ser, S) AGC, AGT, TCA, TCC, TCG, TCT Threonine (Thr, T) ACA, ACC, ACG, ACT Tryptophan (Trp, W) TGG Tyrosine (Tyr, Y) TAC, TAT Valine (Val, V) GTA, GTC, GTG, GTT Termination signal (end) TAA, TAG, TGA An important and well-known feature of the genetic code is its redundancy, whereby, for most of the amino acids used to make proteins, more than one coding nucleotide triplet may be employed (illustrated above). Therefore, a number of different nucleotide sequences may code for a given amino acid sequence. Such nucleotide sequences are considered functionally equivalent since they result in the production of the same amino acid sequence in all organisms (although certain organisms may translate some sequences more efficiently than they do others). Moreover, occasionally, a methylated variant of a purine or pyrimidine may be found in a given ARD-00925 nucleotide sequence. Such methylations do not affect the coding relationship between the trinucleotide codon and the corresponding amino acid. In making the changes in the amino sequences of polypeptide, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art. It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (- 0.7); serine (-0.8); tryptophane (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (- 3.5); glutamine (-3.5); aspartate (<RTI 3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5). It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, i.e. still obtain a biological functionally equivalent protein. As outlined above, amino acid substitutions are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well-known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. In view of the foregoing, the nucleotide sequence of a DNA or RNA encoding a cell surface antigen nucleic acid (or any portion thereof) can be used to derive the polypeptide amino acid sequence, using the genetic code to translate the DNA or RNA into an amino acid sequence. Likewise, for polypeptide amino acid sequences, corresponding nucleotide sequences that can encode the polypeptide can be deduced from the genetic code (which, because of its redundancy, will produce multiple nucleic acid sequences for any given amino acid sequence). Thus, description and / or disclosure herein of a nucleotide sequence which encodes a polypeptide should be considered to also include description and / or disclosure of the amino acid sequence encoded by the nucleotide sequence. Similarly, description and / or disclosure of a polypeptide amino acid sequence herein should be considered to also include description and / or disclosure of all possible nucleotide sequences that can encode the amino acid sequence. ARD-00925 Table 1A: Representative Antigens (full-length proteins) of Methanobrevibacter gottschalkii Set 1 (amino acid sequences (SEQ ID NOS 71466-72102)) Table 1B: Representative Antigens (full-length proteins) of Methanobrevibacter gottschalkii Set 1 (nucleic acid sequences) Left column sequences disclosed as SEQ ID NOS 72103-72739 and right column sequences disclosed as SEQ ID NOS 72740-73376. Table 2A: Representative Antigens (full-length proteins) of Methanobrevibacter gottschalkii Set 2 (amino acid sequences (SEQ ID NOS 73377-73752)) Table 2B: Representative Antigens (full-length proteins) of Methanobrevibacter gottschalkii Set 2 (nucleic acid sequences) Left column sequences disclosed as SEQ ID NOS 73753-74128 and right column sequences disclosed as SEQ ID NOS 74129-74504. Table 3A: Representative Antigens (full-length proteins) of Methanobrevibacter gottschalkii Set 3 (amino acid sequences (SEQ ID NOS 74505-74603)) Table 3B: Representative Antigens (full-length proteins) of Methanobrevibacter gottschalkii Set 3 (nucleic acid sequences) Left column sequences disclosed as SEQ ID NOS 74604-74702 and right column sequences disclosed as SEQ ID NOS 74703-74801. Table 4A: Representative Antigens (fragments) of Methanobrevibacter gottschalkii Set 4 (amino acid sequences (SEQ ID NOS 74802-75333)) Table 4B: Representative Antigens (fragments) of Methanobrevibacter gottschalkii Set 4 (nucleic acid sequences) Left column sequences disclosed as SEQ ID NOS 75333-75865 and right column sequences disclosed as SEQ ID NOS 75866-76397. Table 5A: Representative Antigens (fragments) of Methanobrevibacter gottschalkii Set 5 (amino acid sequences (SEQ ID NOS 76398-76721)) Table 5B: Representative Antigens (fragments) of Methanobrevibacter gottschalkii Set 5 (nucleic acid sequences) Left column sequences disclosed as SEQ ID NOS 76722-77045 and right column sequences disclosed as SEQ ID NOS 77046-77369. Table 6A: Representative Antigens (fragments) of Methanobrevibacter gottschalkii Set 6 (amino acid sequences (SEQ ID NOS 77370-77462)) Table 6B: Representative Antigens (fragments) of Methanobrevibacter gottschalkii Set 6 (nucleic acid sequences) Left column sequences disclosed as SEQ ID NOS 77463-77555 and right column sequences disclosed as SEQ ID NOS 77556-77648. Table 6C: Representative sequences of the cell surface proteins of Methanobrevibacter ruminantium M1 (GenBank: CP001719.1) See SEQ ID NO.1 to SEQ ID NO.2217 for the native nucleic acid sequences. See SEQ ID NO.2218 to SEQ ID NO.4434 for the bovine codon-optimized nucleic acid sequences. See SEQ ID NO.4435 to SEQ ID NO.6651 for the aminio acid sequences. ARD-00925 Table 6D: Representative sequences of the cell surface proteins of Methanobrevibacter gottschalkii See SEQ ID NO.6652 to SEQ ID NO.8451 for the native nucleic acid sequences. See SEQ ID NO.8452 to SEQ ID NO.10251 for the bovine codon-optimized nucleic acid sequences. See SEQ ID NO.10252 to SEQ ID NO.12051 for the aminio acid sequences. Table 6E: Representative mtrE sequences of methanogens See SEQ ID NO.12100 to SEQ ID NO.12147 for the nucleic acid sequences. See SEQ ID NO.12052 to SEQ ID NO.12099 for the aminio acid sequences. Table 6F: Exemplary structural / functional groups of representative cell surface proteins This table contains SEQ ID NOs of amino acid sequences of proteins; or SEQ ID NOs of nucleic acid sequences that encode the proteins that belong to the indicated structural and / or functional groups. (1) Adhesin-like proteins (SEQ ID NOs) 4438 4449 4453 4454 4465 4472 4482 4498 4506 4510 4511 4513 4516 4517 4518 4519 4520 4524 4577 4594 4618 4656 4679 4689 4747 4751 4752 4760 4761 4765 4772 4850 4851 4852 4883 4884 4922 4926 5137 5156 5160 5205 5208 5244 5257 5261 5272 5275 5276 5329 5335 5395 5396 5403 5409 5410 5411 5412 5509 5510 5521 5556 5563 5639 5642 5654 5679 5753 5774 5790 5808 5818 5819 5848 5849 5856 5897 5929 5930 5931 5932 5938 5945 6036 6038 6082 6083 6158 6230 6387 6403 6428 6475 6480 6481 6484 6485 6486 6487 6491 6522 6555 6556 6566 6579 6610 6621 6628 10279 10280 10281 10282 10336 10337 10341 10342 10357 10369 10514 10522 10539 10540 10591 10613 10614 10616 10617 10618 10627 10637 10638 10639 10640 10665 10671 10677 10697 10723 10731 10810 10935 11091 11311 11331 11528 11594 11595 11596 11646 11902 11903 11904 11909 11961 11987 16974 16975 16976 16977 16774 16777 16780 16784 16785 16786 16787 16789 16791 16792 16793 16794 16795 16797 16799 16800 16801 16802 16803 16804 16805 16806 16807 16808 16857 16861 16863 16864 16865 16868 16869 16871 16872 53218 53219 53220 53221 53222 53223 53224 53225 53226 53227 53228 53229 53230 53231 53232 53233 53234 53235 53236 53237 53238 53239 53240 53241 53242 53250 53251 53252 53253 53254 53255 53256 53257 53258 53259 53260 53261 53262 53263 53264 53265 53266 53267 53268 53269 53270 53271 53272 53273 53274 53275 53276 53277 53278 53279 53280 53281 53282 53283 53284 53285 53286 53287 53288 53289 53290 53291 53292 53293 53294 53295 53296 53297 53298 53299 53300 53301 53302 53303 53304 53305 53306 53307 53308 53309 53310 53311 53312 53313 53314 53315 53316 53317 53318 53319 53320 53321 53322 53323 53324 53325 53326 53327 53328 53329 53330 53331 53332 53333 53334 53335 53336 53337 53338 53339 53340 53341 53342 53343 53344 53345 53346 53347 53348 53349 53350 53351 53352 53353 53354 53355 53356 53357 53358 53359 53360 53361 53362 53363 53364 53365 53366 53367 53368 53370 53371 53372 53373 53374 53375 53376 53377 53378 53379 53380 53381 53382 53383 53384 53385 53386 53387 53388 53389 53390 53391 53392 53393 53394 53395 53396 53397 53398 53399 53400 53401 53402 53403 53406 53407 53408 53409 53410 53411 53412 53413 53414 53415 53416 53417 53418 53419 53420 53421 53422 53423 53424 53425 53426 53427 53428 53429 53430 53431 53432 53433 53434 53435 53436 53437 53438 53439 53440 53441 53442 53443 53444 53445 53446 53447 53448 53449 53450 53451 53452 53453 53454 53455 53456 53457 53458 53459 53460 53461 53462 53463 53464 53465 53466 53467 53468 53477 53478 53479 53480 53481 53482 53483 53484 53485 53486 53487 53488 53489 53490 53491 53492 53493 53494 53495 53496 53497 53498 53499 53500 53501 53502 53503 53504 53505 53508 53509 53510 53511 53512 53522 53523 53524 53525 53526 53527 53528 53529 53530 53531 53532 53533 53534 53535 ARD-00925 53536 53537 53538 53539 53540 53541 53542 53546 53547 53548 53549 53550 53551 53552 53553 53554 53555 53556 53557 53558 53559 53560 53561 53562 53563 53564 53571 53572 53573 53574 53575 53576 53577 53578 53579 53580 53581 53582 53583 53584 53585 53586 53587 53594 53595 53596 53597 53598 53599 53603 53604 53605 53606 53607 53608 53609 53610 53611 53612 53613 53614 53615 53616 53617 53618 53619 53620 53621 53622 53623 53624 53625 53626 53627 53628 53629 53630 53631 53632 53633 53634 53635 53636 53637 53638 53639 53640 53641 53642 53643 53644 53645 53646 53647 53648 53649 53657 53658 53659 53660 53661 53662 53663 53664 53665 53666 53667 53668 53669 53670 53671 53672 53673 53674 53675 53684 53685 53694 53695 53696 53697 53698 53699 53700 53701 53702 53703 53704 53705 53706 53707 53708 53709 53710 53711 53712 53713 53714 53715 53716 53717 53718 53719 53720 53721 53722 53723 53724 53725 53726 53727 53728 53729 53730 53731 53732 53733 53734 53735 53736 53737 53738 53739 53740 53741 53742 53743 53744 53745 53746 53747 53748 53749 53750 53751 53752 53753 53754 53755 53756 53757 53758 53759 53760 53761 53762 53763 53764 53765 53766 53767 53768 53769 53770 53771 53772 53773 53774 53775 53776 53777 53778 53779 53780 53781 53782 53783 53784 53785 53786 53787 53788 53789 53790 53791 53792 53793 53794 53796 53797 53798 53799 53800 53801 53802 53803 53804 53805 53806 53807 53808 53809 53810 53811 53812 53813 53820 53821 53822 53823 53824 53825 53826 53827 53828 53829 53830 53831 53832 53833 53834 53835 53836 53837 53838 53839 53840 53841 53842 53843 53844 53845 53846 53847 53848 53849 53850 53851 53852 53853 53854 53855 53856 53857 53858 53859 53860 53861 53862 53866 53867 53868 53869 53870 53871 53872 53873 53874 53875 53876 53877 53878 53879 53880 53906 53907 53908 53909 53910 53911 53916 53917 53918 53919 53920 53921 53922 53923 53924 53925 53926 53927 53928 53929 53930 53931 53932 53934 53935 53936 53937 53938 53939 53940 53941 53942 53943 53944 53945 53946 53947 53948 53949 53950 53951 53952 53953 53954 53955 53956 53957 53958 53959 53960 53961 53962 53963 53964 53965 53966 53967 53968 53969 53970 53972 53973 53974 53976 53977 53978 53979 53980 53981 53982 53983 53984 53986 53987 53988 53989 53990 54010 54011 54034 54035 54036 54037 54038 54039 54040 54041 54042 54043 54044 54045 54046 54047 54048 54049 54050 54051 54052 54053 54054 54055 54056 54057 54058 54059 54060 54061 54062 54063 54064 54065 54066 54067 54068 54069 54070 54071 54072 54075 54076 54077 54078 54079 54081 54082 54093 54099 54100 54110 54111 54112 54113 54114 54115 54116 54117 54118 54122 54132 54133 54134 54135 54136 54137 54138 54139 54140 54149 54150 54151 54152 54155 54156 54188 54189 54190 54191 54192 54193 54194 54195 54196 54197 54198 54199 54200 54201 54202 54203 54204 54205 54222 54223 54224 54225 54242 54243 54247 54248 54249 54250 54251 54252 54253 54262 54263 54264 54265 54266 54267 54268 54269 54270 54271 54272 54283 54284 54285 54286 54287 54288 54289 54290 54291 54292 54293 54296 54297 54313 54314 54315 54316 54318 54328 54329 54330 54331 54332 54333 54334 54335 54336 54337 54353 54371 54372 54373 54374 54375 54376 54377 54378 54387 54392 54393 54417 54462 54463 54464 54465 54466 54467 54468 54469 54472 54473 54474 54475 54493 54494 54495 54496 54497 54498 54499 54500 54501 54502 54503 54504 54505 54506 54519 54520 54521 54526 54527 54542 54543 54544 54545 54646 54647 54648 54649 54650 54651 54652 54653 54654 54655 54656 54657 54699 54707 54708 54709 54710 54711 54712 54713 54716 54732 54733 54734 54735 54736 54737 54738 54739 54740 54748 54749 54750 54751 54755 54756 54757 54758 54773 54774 54775 54826 54827 54828 54829 54830 54831 54832 54833 54834 54835 54836 54837 54838 54854 54887 55009 55075 55076 55077 55078 55079 55080 55081 55082 55083 55084 55088 55089 55096 55097 55102 55103 55104 55105 55106 55114 55115 55116 55117 55118 55125 55126 55127 55128 55129 55130 55131 55142 55161 55162 55166 55167 55168 55169 55188 55189 55190 55191 55258 55259 55260 55261 55285 55286 55287 55288 55290 55291 55329 55370 55375 55376 55462 55463 55464 55465 55466 55467 55468 55469 55470 55471 55472 55473 55725 55726 55727 55732 55733 55797 55798 55799 55800 55805 55810 55811 55812 55813 55843 55844 55894 55895 55896 55897 55898 55899 55970 55971 56160 56161 56162 56163 56164 56165 56166 56180 56471 56472 56473 56552 56553 56554 56555 56591 56640 56641 56668 56669 56704 56705 56747 56748 56757 56758 56763 56764 56772 56773 56774 56775 56776 56777 56778 56779 57110 57111 57112 57144 57145 57153 ARD-00925 57154 57181 57199 57200 57201 57202 57206 57221 57225 57250 57251 57252 57265 57266 57318 57319 57343 57344 57345 57375 57376 57381 57382 57383 57384 57407 57421 57422 57428 57429 57448 57449 57483 57484 57485 57486 57529 57530 57546 57619 57641 57642 57643 57644 57645 57689 57696 57697 57814 57815 57841 57842 57843 57844 57848 57922 58229 58230 58231 58232 58266 58267 58279 58280 58281 58282 58283 58284 58311 58312 58313 58314 58315 58351 58352 58353 58354 58355 58356 58357 58358 58578 58579 58703 58704 58705 58706 58707 58708 58709 58740 58741 58742 58743 58746 58747 58752 58761 58762 58768 58769 58841 58842 58940 58941 59909 59910 60356 60357 60445 60446 60468 60569 60663 60664 60676 60677 60751 60754 60755 60784 60785 60786 60787 60788 60789 60790 60791 60792 60814 60815 60940 60941 60942 60943 60944 60945 60946 60947 60997 60998 60999 61000 61001 61002 61006 61083 61093 61094 61095 61131 61136 61137 61138 61139 61140 61141 61142 61143 61162 61378 61379 61380 61492 61493 61494 61633 61679 61680 61681 61735 61736 61737 61738 61778 61779 61780 61911 61912 61913 61914 61915 61959 62019 62054 62055 62060 62061 62076 62077 62078 62079 62080 62081 62082 62083 62084 62103 62104 62107 62108 62137 62261 62262 62263 62270 62292 62293 62294 62295 62311 62332 62345 62384 62385 62540 62541 62542 62624 62625 62626 62627 62645 62646 62647 62648 62649 62650 62651 62652 62916 62917 62942 62957 63054 63066 63203 63204 63205 63206 63207 63211 63212 63213 63214 63215 63497 63551 63552 63553 63554 63555 63556 63557 63558 63632 63703 63706 63724 63735 63899 64177 64178 64179 64180 64181 64182 64183 64184 64200 64216 64252 64253 64254 64296 64297 64298 64299 64314 64337 64338 64339 64340 64341 64342 64343 64390 64471 64515 64516 64517 64528 64529 64535 64536 64537 64569 64570 64633 64634 64635 64636 64715 64716 64723 64724 64732 64733 64734 64739 64740 64741 64742 64755 64756 64776 64777 64778 64779 64780 64952 64953 64985 65050 65051 65127 65170 65320 65323 65506 65507 65508 65509 65510 65523 65531 65571 65586 65618 65642 65643 65664 65736 65810 65811 65812 65833 65948 65949 65950 65951 65952 66006 66144 66145 66393 66394 66396 66438 66439 66458 66538 66656 66670 66687 66716 66839 66892 66907 66908 66909 66952 67160 67161 67221 67281 67520 67774 67775 67776 67880 67924 68140 68141 68284 68402 68409 68421 68436 68476 68482 68571 68648 68649 68650 68690 68695 68698 68722 68723 68741 68742 68743 68744 68911 68989 69071 69116 69124 69160 69161 69162 69201 69202 69203 69204 69233 69278 69299 69300 69301 69333 69343 69344 69425 69464 69508 69523 69524 69574 69577 69585 69603 69613 69734 69839 69896 69897 69958 70062 70078 70081 70107 70114 70142 70143 70145 70154 70162 70204 70214 70231 70241 70249 70256 70289 70316 70320 70326 70334 70370 70402 70444 70446 70475 70500 70509 70511 70519 70521 70524 70537 70538 70539 70543 70546 70548 70558 70559 70569 70576 70585 70586 70587 70590 70591 70599 70601 70603 70613 70614 70616 70617 70619 70625 70631 70646 70648 70649 70658 70659 70666 70667 70668 70669 70677 70679 70692 70693 70696 70707 70731 70737 70741 70752 70757 70768 70796 70807 70808 70811 70819 70820 70821 70829 70837 70841 70843 70851 70852 70860 70865 70879 70880 70881 70882 70890 70891 70895 70896 70905 70906 70907 70918 70920 70926 70931 70951 70993 71009 71014 71015 71017 71020 71022 71031 71035 71038 71055 71062 71478 71479 71481 71500 71501 71502 71503 71512 71517 71578 71582 71591 71592 71610 71613 71614 71615 71616 71617 71622 71628 71629 71630 71631 71644 71647 71649 71651 71658 71661 71696 71739 71779 71857 71866 71927 71956 71957 71958 71976 72049 72050 72051 72054 72070 72078 74808 74809 74811 74828 74829 74830 74831 74832 74833 74834 74835 74836 74837 74838 74839 74850 74855 74856 74899 74904 74910 74911 74921 74922 74923 74924 74925 74926 74927 74928 74929 74930 74938 74942 74943 74944 74945 74963 74965 74966 74967 74979 74982 75009 75010 75011 75012 75013 75014 75015 75050 75082 75136 75142 75143 75144 75145 75146 75147 75148 75149 75150 75151 75152 75153 75154 75155 75198 75221 75222 75223 75232 75286 75287 75288 75290 75303 75304 75305 75306 75307 75308 75309 75310 75314 71312 71313 71314 71315 71418 71421 71424 71428 71429 71430 71431 71433 71435 71436 71437 71438 71439 71441 71443 71444 71445 71446 71447 71448 71449 71450 71451 71452 processing proteins (SEQ ID NOs) ARD-00925 5132 5619 6156 6234 6293 6369 10378 10839 10840 11388 11452 53881 53882 53883 53884 53933 53991 53992 53993 53994 53995 54005 54006 54007 54008 54009 54073 54074 54172 54173 54174 54212 54213 54238 54239 54277 54278 54279 54280 54281 54282 54294 54295 54298 54299 54302 54303 54306 54320 54321 54324 54325 54369 54370 54388 54389 54390 54391 54394 54395 54396 54397 54398 54399 54400 54401 54402 54403 54404 54405 54406 54407 54408 54409 54410 54411 54412 54413 54414 54415 54416 54418 54419 54420 54421 54422 54423 54424 54425 54426 54427 54428 54429 54430 54431 54440 54442 54443 54536 54537 54844 54845 55542 55559 55560 55561 55562 55567 55577 55615 55616 55705 55724 55791 55793 55795 55796 55804 55806 55807 55809 56212 56213 56585 56586 56725 56726 57045 57046 57196 57207 57208 57363 57364 58862 58970 59114 59115 60701 61682 61994 61997 61998 61999 62000 62001 62002 62003 62008 62009 62010 62014 62015 62016 62017 62018 62022 62117 62279 62280 62281 62282 62308 62318 62333 62614 62615 62616 62617 63506 66812 66813 66814 67056 67761 68729 68731 69049 69050 69051 69081 69082 69168 69356 69595 69608 69614 69640 69659 69663 69665 69671 69715 69718 69726 69732 69735 69736 69741 69745 69747 69748 69781 69794 69960 70169 70180 70185 70350 70508 70609 70726 70761 70970 71047 71477 71491 71493 71521 71539 71545 71546 71606 71633 71641 71682 71701 71702 71705 71706 71782 71785 71790 71799 71805 71841 71853 71872 71889 71900 71901 71903 71904 71979 71980 72002 72004 72080 72082 72091 74857 75016 75017 75173 (3) Cell wall biosynthesis proteins (SEQ ID NOs) 16876 69386 69387 70804 (4) Cofactor biosynthesis proteins (SEQ ID NOs) 55348 55349 55350 56938 56939 56940 57423 57424 58518 58519 58520 58521 65125 68706 71029 (5) CRISPR proteins (provides methanogens an immunity against viruses) (SEQ ID NOs) 70636 71045 (6) Energy metabolism proteins (SEQ ID NOs) 58756 58757 61126 61127 61128 (7) Enzymes (SEQ ID NOs) 4617 4774 4986 6013 6559 11013 11468 11485 11506 11773 11845 16771 53045 53046 53047 53048 53049 53050 53051 53052 53053 53054 53055 53056 53057 53058 53059 53060 53061 53062 53063 53064 53065 53066 53067 53068 53069 53070 53071 53072 53073 53074 53075 53076 53077 53078 53079 53080 53081 53082 53083 53084 53085 53086 53087 53088 53089 53090 53091 53092 53093 53094 53095 53096 53097 53098 53099 53100 53101 53102 53103 53104 53105 53106 53107 53108 53109 53110 53111 53112 53113 53114 53115 53116 53117 53118 53119 53120 53121 53122 53123 53124 53125 53126 53127 53128 53129 53130 53131 53132 53133 53134 53135 53136 53137 53138 53139 53140 53141 53142 53143 53144 53145 53146 53147 53148 53149 53150 53151 53152 53153 53154 53155 53156 53157 53158 53159 53160 53161 53162 53163 53164 53165 53166 53167 53168 53169 53170 53171 53172 53173 53174 53175 53176 53177 53178 53179 53180 53181 53182 53183 53184 53185 53186 53187 53188 53189 53190 53191 53192 53193 53194 53195 53196 53197 53198 53199 53200 53201 53202 53203 53204 53205 53206 53207 53208 53209 53210 53211 53212 53213 53214 53215 53216 53217 53243 53244 53245 53246 53247 53248 53249 53404 54379 54380 54441 54517 54518 54798 54799 54800 54801 54807 54808 54809 54810 55017 55018 55019 55257 55434 55694 55714 55738 55767 55772 55781 55782 55792 55794 55808 56331 56332 56333 56606 56734 56735 56744 56745 56746 57077 57078 57120 57121 57122 57173 57174 57175 57176 57182 57183 57184 57332 57333 57430 57431 57432 57433 57434 57439 57440 57560 57561 57599 57600 57822 57823 57870 57871 58169 58170 58316 58436 58437 58438 58439 58588 58712 58713 58714 58720 58721 58729 58730 58731 58855 58893 58894 58901 58902 58909 58910 58959 58960 59122 59123 59124 59958 59959 59960 60337 60338 60339 60361 60362 60363 60364 60507 60508 60509 60510 60511 60512 60629 60630 60631 60632 60633 60641 60642 60643 60644 60645 60646 60647 60648 60649 60650 60651 60652 60653 60654 60655 60656 60657 60658 60675 60717 60718 60719 60763 60764 60765 60766 60896 60897 60898 61029 61030 61201 61202 61203 61204 61205 61206 61207 61208 61256 61257 61258 61259 61284 61285 61286 61287 61288 61289 61295 61383 61384 61385 ARD-00925 61386 61387 61388 61389 61390 61391 61392 61393 61394 61395 61396 61397 61398 61399 61400 61401 61402 61403 61404 61409 61410 61411 61412 61413 61414 61417 61418 61419 61420 61421 61422 61423 61424 61425 61426 61427 61428 61429 61430 61431 61432 61433 61434 61435 61436 61437 61438 61439 61440 61444 61445 61446 61447 61448 61449 61709 61710 61711 61752 61753 61754 61830 61831 61832 61855 61856 61924 62056 62057 62085 62089 62099 62110 62133 62148 62208 62209 62210 62211 62212 62228 62389 62390 62391 62392 62393 62394 62395 62396 62405 62406 62420 62421 62422 62463 62464 62465 62481 62482 62483 62484 62493 62494 62495 62496 62497 62498 62499 62509 62510 62511 62512 62513 62514 62518 62519 62520 62521 62522 62523 62524 62525 62526 62527 62535 62536 62537 62547 62548 62549 62557 62558 62559 62565 62566 62567 62571 62572 62573 62574 62575 62576 62577 62578 62579 62590 62591 62641 62642 62673 62674 62675 62676 62677 63385 63502 63564 63565 63965 64067 64278 64563 64589 64604 64605 64606 64607 64608 64626 64627 64628 64629 64637 64651 64660 64679 64682 64687 64688 64693 64750 64784 64785 64786 64920 64921 65076 65237 65449 65479 65480 65481 65499 65532 65537 65589 65740 65775 65776 65992 65993 65994 65995 65996 65997 65998 66200 66201 66202 66203 66204 66205 66206 66207 66208 66229 66230 66231 66359 66477 66523 66536 66561 67804 67884 67885 67886 67910 67911 68392 68393 68394 68395 68396 68412 68413 68414 68661 68662 68664 68665 68701 68702 68719 68720 68762 68763 68825 68843 69060 69061 69167 69210 69217 69367 69368 69369 69398 69422 69423 69514 69556 69570 69600 69616 69617 69618 69623 69638 69639 69677 69708 69723 69956 69972 70038 70128 70171 70194 70284 70317 70318 70351 70354 70412 70413 70421 70466 70608 70633 70650 70651 70685 70686 70714 70733 70748 70758 70765 70925 71026 71036 71046 71058 71474 71490 71513 71515 71527 71563 71573 71583 71589 71593 71596 71601 71603 71608 71611 71625 71626 71642 71646 71650 71654 71680 71689 71692 71727 71729 71735 71743 71746 71752 71754 71769 71771 71772 71774 71775 71781 71806 71813 71827 71828 71830 71831 71840 71843 71844 71847 71854 71873 71905 71913 71922 71926 71934 71935 71952 71962 71963 71983 71998 71999 72005 72007 72019 72020 72021 72025 72031 72033 72035 72038 72039 72040 72052 72074 72098 72099 75062 75063 75064 75065 75066 75067 75068 75181 75189 75190 75191 75192 75193 75194 75269 75282 71415 (8) Fatty acid synthesis (SEQ ID NOs) 68659 68660 (9) General metabolism (SEQ ID NOs) 5480 5955 11908 16866 16867 16874 53369 53405 54450 54451 54452 54453 54454 54888 54889 54890 54891 54892 55649 56541 56542 56550 56551 56556 56557 56558 56559 56560 56561 56562 56563 56749 56750 56759 56760 56761 56762 56801 56802 56826 56827 57308 57309 57902 57903 58386 58387 58388 58389 58413 58414 58415 58416 61231 61232 61233 62215 62216 62217 62223 62224 62963 63030 63031 63582 63916 63917 63918 63919 63920 63972 63973 63974 64450 64451 65272 65273 65539 65722 65723 65724 65766 65767 65786 66530 66616 66655 67200 67201 67253 67934 67946 67947 68134 68135 68306 68434 68435 68669 68670 68673 68682 68683 68709 68759 68784 68787 68840 68841 69175 69176 69226 69586 69591 69664 69672 69690 70033 70295 70310 70381 70485 70486 70610 70675 70921 71499 71532 71564 71588 71598 71720 71724 71737 71770 71784 71801 71815 71818 71862 71867 71881 71969 72009 72053 72084 72087 75289 (10) Membrane proteins (SEQ ID NOs) 4452 4478 4481 4483 4500 4505 4515 4529 4547 4580 4581 4584 4601 4606 4621 4627 4630 4657 4658 4659 4664 4665 4667 4668 4671 4682 4712 4713 4740 4749 4762 4764 4790 4791 4795 4809 4810 4811 4812 4842 4845 4848 4857 4861 4866 4879 4893 4903 4921 4923 4924 4928 4932 4942 4943 4945 4948 4954 4957 4975 4976 4978 4980 5000 5014 5029 5030 5031 5035 5037 5047 5055 5058 5064 5067 5072 5096 5103 5104 5116 5119 5126 5127 5139 5149 5150 5151 5153 5159 5169 5178 5179 5180 5188 5192 5193 5202 5235 5238 5264 5265 5266 5271 5273 5310 5334 5363 5373 5397 5400 5401 5408 5422 5433 5454 5455 5460 5463 5474 5487 5492 5513 5517 5529 5534 5549 5557 5576 5624 5626 5627 5628 5638 ARD-00925 5645 5651 5664 5665 5666 5721 5734 5754 5762 5763 5768 5775 5807 5817 5855 5874 5883 5912 5925 5966 5967 5974 5982 5987 6010 6017 6030 6037 6039 6067 6068 6073 6074 6085 6086 6089 6125 6126 6170 6191 6217 6226 6227 6235 6264 6265 6266 6290 6314 6316 6321 6324 6332 6378 6382 6384 6401 6422 6423 6447 6455 6476 6482 6488 6489 6497 6538 6540 6550 6562 6568 6575 6578 6588 6604 6607 6612 6616 6617 6634 10272 10291 10306 10322 10325 10329 10347 10349 10350 10353 10368 10373 10383 10385 10391 10392 10408 10432 10438 10439 10443 10460 10462 10465 10497 10501 10502 10503 10504 10510 10512 10513 10515 10517 10538 10543 10545 10559 10564 10573 10586 10626 10641 10653 10667 10703 10721 10727 10734 10735 10736 10743 10744 10745 10752 10770 10792 10793 10797 10799 10848 10939 10940 10941 10944 10945 10978 10983 10984 11021 11024 11041 11042 11056 11057 11115 11126 11137 11138 11146 11158 11165 11177 11183 11186 11199 11217 11218 11219 11233 11234 11238 11247 11248 11268 11272 11276 11277 11301 11305 11312 11322 11326 11338 11351 11357 11358 11365 11385 11410 11428 11432 11434 11457 11474 11475 11476 11482 11537 11561 11565 11597 11599 11600 11622 11623 11631 11636 11637 11639 11643 11647 11679 11682 11683 11685 11691 11692 11701 11703 11709 11724 11752 11753 11763 11766 11778 11779 11784 11803 11874 11914 11916 11931 11932 11935 11937 11944 11954 11962 11963 11967 11976 12005 12010 12020 12021 12031 12049 53513 53514 53515 53516 53517 53518 53519 53520 53521 53601 53602 53650 53651 53652 53653 53654 53655 53656 53676 53677 53678 53679 53680 53681 53682 53683 53686 53687 53688 53689 53690 53691 53692 53693 53795 53912 53913 53914 53915 53971 53975 54014 54015 54016 54017 54080 54083 54084 54085 54086 54087 54088 54089 54090 54091 54092 54101 54102 54103 54104 54105 54106 54107 54123 54124 54125 54126 54127 54128 54129 54130 54131 54305 54447 54448 54449 54470 54471 54491 54492 54625 54626 54627 54660 54661 54662 54677 54693 54694 54746 54747 54761 54762 54763 54764 54765 54766 54767 54768 54769 54770 54771 54772 54776 54781 54782 54783 54784 54879 54880 54881 55015 55016 55065 55074 55090 55100 55101 55110 55111 55112 55113 55119 55120 55121 55122 55123 55124 55133 55134 55135 55136 55137 55138 55139 55140 55141 55143 55144 55145 55146 55147 55148 55149 55150 55151 55152 55153 55154 55155 55156 55157 55158 55159 55160 55163 55164 55165 55170 55171 55172 55173 55175 55176 55177 55197 55198 55199 55200 55201 55202 55205 55206 55207 55208 55209 55210 55211 55212 55213 55214 55215 55216 55217 55218 55219 55220 55221 55222 55223 55224 55225 55226 55227 55228 55229 55230 55231 55232 55233 55235 55236 55237 55239 55240 55241 55242 55243 55244 55245 55246 55247 55248 55249 55250 55251 55252 55253 55254 55255 55256 55262 55263 55264 55265 55266 55267 55268 55269 55270 55271 55272 55273 55274 55275 55276 55277 55278 55280 55281 55282 55283 55284 55293 55294 55295 55297 55298 55299 55300 55301 55303 55304 55305 55309 55310 55312 55313 55314 55315 55316 55317 55318 55319 55320 55321 55322 55323 55324 55325 55326 55327 55328 55330 55331 55332 55333 55334 55335 55336 55337 55338 55339 55340 55341 55342 55343 55344 55345 55346 55347 55351 55352 55353 55354 55355 55362 55363 55364 55365 55366 55367 55368 55377 55378 55379 55380 55381 55382 55388 55391 55392 55393 55394 55395 55396 55397 55407 55408 55409 55412 55418 55419 55420 55422 55424 55425 55427 55428 55429 55430 55431 55432 55433 55435 55436 55437 55438 55439 55440 55441 55442 55443 55444 55451 55452 55453 55454 55455 55456 55457 55458 55460 55461 55474 55475 55476 55478 55479 55483 55484 55485 55492 55493 55496 55497 55505 55506 55507 55508 55509 55510 55511 55513 55514 55515 55516 55521 55522 55523 55524 55525 55529 55530 55531 55532 55533 55534 55535 55536 55538 55539 55540 55541 55543 55544 55545 55548 55549 55550 55551 55552 55553 55554 55555 55556 55557 55563 55564 55568 55569 55570 55571 55572 55573 55574 55575 55576 55578 55579 55580 55581 55582 55583 55584 55587 55588 55589 55593 55594 55595 55597 55598 55600 55601 55602 55603 55604 55605 55606 55607 55608 55609 55610 55611 55612 55613 55614 55617 55618 55619 55620 55621 55622 55623 55625 55626 55627 55628 55635 55639 55640 55641 55642 55643 55644 55645 55646 55647 55648 55652 55653 55656 55657 55658 55659 55660 55661 55662 55663 55664 55665 55666 55667 55668 55669 55670 55671 55672 55673 55674 55675 55676 55677 55678 55679 55680 55681 55682 55683 55684 55685 55686 55687 55691 55692 55693 ARD-00925 55701 55702 55703 55704 55706 55707 55708 55709 55710 55739 55740 55741 55742 55743 55744 55745 55746 55747 55748 55749 55757 55758 55759 55783 55784 55830 55831 55832 55969 55986 55987 56001 56002 56003 56004 56005 56006 56007 56012 56013 56014 56015 56081 56082 56083 56107 56108 56109 56110 56111 56112 56130 56131 56132 56133 56134 56135 56136 56153 56154 56155 56156 56157 56170 56171 56172 56173 56184 56185 56186 56187 56188 56197 56198 56199 56206 56207 56208 56209 56210 56214 56215 56216 56217 56218 56221 56222 56223 56224 56225 56259 56260 56261 56262 56271 56272 56273 56274 56275 56276 56277 56280 56281 56282 56283 56284 56288 56289 56290 56295 56296 56297 56298 56299 56300 56301 56302 56303 56307 56308 56309 56310 56311 56312 56313 56314 56315 56316 56317 56326 56327 56328 56329 56330 56334 56335 56336 56337 56338 56339 56340 56341 56347 56348 56349 56350 56412 56413 56414 56419 56420 56421 56449 56450 56451 56452 56465 56466 56476 56477 56478 56486 56500 56501 56502 56504 56505 56506 56507 56525 56526 56527 56528 56564 56565 56566 56567 56568 56569 56570 56571 56576 56577 56587 56588 56593 56594 56595 56596 56597 56598 56601 56654 56655 56682 56684 56685 56686 56687 56688 56689 56690 56691 56698 56699 56710 56711 56724 56736 56737 56738 56739 56740 56751 56752 56753 56754 56768 56769 56770 56771 56780 56781 56806 56807 56808 56830 56831 56832 56848 56849 56850 56866 56867 56868 56903 56904 56905 56947 56948 56960 56961 56962 56963 56996 56997 56998 56999 57016 57017 57018 57032 57033 57034 57035 57053 57054 57055 57097 57098 57099 57100 57101 57102 57103 57104 57105 57106 57113 57114 57115 57116 57117 57118 57119 57123 57124 57125 57126 57127 57128 57129 57137 57138 57148 57149 57150 57151 57165 57166 57211 57212 57294 57295 57298 57299 57300 57377 57378 57397 57398 57402 57403 57404 57405 57406 57425 57426 57427 57441 57442 57443 57444 57450 57451 57452 57453 57480 57481 57482 57492 57493 57497 57498 57508 57509 57524 57525 57550 57551 57552 57553 57554 57574 57575 57656 57657 57658 57684 57685 57698 57699 57724 57725 57726 57727 57795 57796 57797 57798 57799 57800 57801 57802 57806 57807 57837 57893 57894 58162 58163 58164 58168 58218 58222 58226 58239 58240 58241 58328 58329 58330 58406 58407 58408 58429 58430 58431 58641 58642 58643 58644 58645 58646 58661 58701 58702 58732 58733 58734 58735 58736 58737 58738 58739 58744 58745 58758 58759 58760 58763 58764 58765 58766 58770 58771 58772 58773 58774 58775 58776 58777 58778 58779 58780 58781 58782 58783 58784 58785 58786 58787 58798 58799 58800 58801 58806 58807 58808 58816 58817 58825 58826 58853 58854 58859 58860 58861 58864 58865 58866 58867 58868 58869 58870 58871 58872 58873 58878 58879 58880 58881 58882 58883 58884 58885 58886 58887 58888 58889 58890 58891 58892 58895 58896 58897 58898 58899 58900 58903 58904 58905 58906 58907 58908 58918 58919 58920 58921 59018 59169 59170 59179 59180 59184 59185 59216 59217 59236 59237 59244 59300 59301 59333 59334 59335 59336 59344 59345 59367 59368 59387 59388 59389 59400 59401 59436 59437 59438 60082 60083 60084 60085 60222 60268 60383 60384 60385 60414 60415 60416 60417 60476 60477 60478 60479 60491 60543 60599 60600 60601 60602 60662 60668 60671 60672 60673 60674 60678 60679 60685 60694 60695 60697 60698 60727 60728 60729 60747 60748 60749 60843 60844 60875 60876 60894 60895 60903 60904 60908 60909 60917 60918 60919 60920 60921 60922 60923 60924 60925 60926 60927 60928 60929 60930 60931 60932 60933 60934 60935 60936 60937 60938 60939 60952 60953 60954 60955 60956 60957 60958 60959 60960 60966 60967 60968 60971 60972 60973 60974 60975 60976 60977 60978 60979 60980 60981 60982 60983 60984 60985 60986 60987 60988 60989 60990 60994 61016 61023 61027 61028 61031 61099 61106 61112 61113 61114 61115 61116 61117 61118 61119 61144 61151 61152 61156 61157 61158 61159 61167 61168 61169 61170 61171 61175 61176 61177 61181 61182 61183 61184 61185 61186 61187 61188 61190 61191 61192 61193 61194 61195 61196 61197 61209 61210 61211 61212 61213 61214 61215 61216 61217 61221 61222 61223 61224 61225 61226 61227 61228 61229 61230 61234 61235 61236 61237 61238 61239 61250 61251 61252 61253 61254 61255 61263 61264 61265 61266 61267 61268 61269 61270 61276 61279 61280 61296 61315 61316 61317 61328 61331 61374 61375 61415 61416 61456 61462 61464 61474 61475 61476 61477 61478 61479 61480 61499 61500 61501 61528 61538 61590 61604 61608 61630 61645 61649 61650 61656 61657 61658 61659 61663 61664 61665 61671 61690 61695 61696 61697 61698 61699 61700 61701 61702 61716 61717 ARD-00925 61741 61742 61743 61746 61747 61755 61756 61757 61760 61761 61762 61763 61764 61771 61772 61773 61781 61800 61801 61802 61811 61812 61813 61818 61819 61820 61821 61822 61829 61836 61837 61838 61839 61840 61841 61842 61843 61862 61863 61864 61865 61866 61882 61895 61898 61901 61902 61918 61919 61920 61930 61931 61935 61936 61939 61940 61941 61969 61970 61971 61989 62004 62005 62006 62007 62049 62050 62051 62052 62053 62058 62059 62065 62066 62067 62068 62072 62073 62074 62086 62087 62088 62090 62091 62092 62094 62095 62096 62097 62098 62100 62106 62109 62111 62112 62113 62122 62128 62129 62134 62135 62136 62144 62145 62146 62147 62155 62156 62157 62231 62232 62233 62234 62235 62236 62237 62240 62241 62242 62243 62252 62265 62275 62283 62284 62285 62286 62287 62288 62289 62298 62299 62300 62301 62302 62303 62325 62326 62327 62334 62335 62336 62337 62338 62339 62340 62341 62342 62343 62344 62349 62350 62351 62352 62353 62354 62355 62356 62358 62359 62360 62407 62408 62409 62410 62411 62412 62413 62414 62415 62439 62440 62441 62442 62443 62448 62449 62450 62451 62452 62453 62454 62467 62468 62469 62470 62471 62472 62473 62474 62475 62485 62486 62487 62488 62489 62490 62491 62492 62500 62501 62502 62503 62528 62529 62538 62539 62550 62551 62552 62553 62554 62555 62556 62583 62584 62585 62586 62587 62588 62589 62607 62608 62609 62610 62611 62620 62621 62622 62628 62630 62631 62632 62633 62643 62660 62661 62662 62663 62664 62665 62684 62685 62686 62687 62688 62689 62690 62691 62692 62693 62694 62695 62696 62701 62702 62703 62704 62710 62711 62714 62715 62716 62717 62718 62719 62720 62722 62723 62724 62725 62726 62727 62728 62729 62730 62731 62732 62733 62734 62735 62736 62737 62741 62742 62743 62744 62745 62750 62751 62752 62753 62754 62755 62756 62757 62758 62759 62760 62761 62763 62764 62769 62770 62775 62776 62777 62780 62781 62782 62783 62784 62785 62786 62787 62788 62789 62790 62791 62792 62793 62796 62797 62798 62800 62801 62802 62803 62804 62805 62806 62807 62808 62809 62810 62811 62812 62813 62814 62815 62816 62817 62818 62819 62823 62824 62825 62826 62830 62831 62832 62833 62834 62838 62839 62840 62841 62842 62843 62844 62845 62846 62847 62848 62849 62850 62851 62852 62853 62854 62855 62856 62857 62858 62859 62860 62865 62866 62867 62868 62869 62870 62871 62872 62873 62874 62875 62876 62877 62878 62879 62883 62884 62885 62886 62887 62888 62889 62890 62891 62892 62893 62894 62895 62896 62897 62898 62899 62900 62901 62902 62903 62905 62906 62907 62911 62912 62918 62919 62920 62921 62922 62923 62924 62925 62926 62927 62928 62930 62933 62934 62937 62938 62939 62940 62941 62947 62948 62952 62956 62962 62964 62966 62970 62973 62974 62983 62984 62985 62991 62992 62993 62994 62995 63009 63010 63011 63015 63016 63017 63019 63020 63021 63022 63023 63024 63027 63032 63033 63034 63037 63038 63039 63040 63041 63042 63046 63047 63048 63055 63056 63057 63060 63061 63062 63063 63064 63065 63067 63068 63069 63080 63081 63082 63083 63084 63087 63088 63089 63090 63091 63092 63093 63094 63098 63099 63100 63101 63102 63103 63104 63105 63106 63107 63108 63109 63110 63111 63112 63116 63123 63124 63125 63126 63127 63128 63134 63135 63136 63137 63138 63139 63146 63147 63148 63149 63150 63151 63161 63162 63163 63167 63168 63169 63170 63171 63172 63173 63174 63175 63198 63202 63225 63226 63227 63233 63234 63235 63236 63237 63238 63239 63240 63241 63242 63243 63244 63257 63258 63259 63266 63267 63268 63269 63270 63278 63279 63280 63281 63282 63288 63289 63290 63291 63292 63293 63297 63298 63299 63300 63301 63305 63306 63307 63308 63309 63311 63312 63313 63314 63315 63316 63317 63318 63319 63320 63321 63322 63323 63333 63334 63335 63336 63337 63338 63339 63340 63341 63342 63343 63344 63345 63346 63347 63348 63349 63350 63351 63352 63353 63354 63355 63356 63357 63358 63359 63363 63364 63365 63366 63367 63368 63369 63370 63371 63372 63373 63374 63375 63376 63377 63378 63379 63380 63381 63382 63383 63384 63386 63387 63388 63389 63390 63391 63392 63393 63394 63395 63396 63397 63398 63399 63400 63401 63402 63403 63411 63412 63413 63414 63415 63416 63417 63418 63420 63421 63422 63423 63424 63425 63426 63431 63432 63433 63442 63443 63444 63445 63448 63449 63450 63451 63452 63453 63454 63455 63456 63457 63471 63475 63476 63477 63478 63479 63480 63481 63483 63486 63487 63488 63489 63490 63491 63492 63493 63496 63499 63503 63507 63508 63509 63510 63511 63512 63513 63514 63515 63516 63517 63518 63519 63520 63524 63525 63526 63527 63528 63529 63530 63531 63532 63533 63534 63539 63540 63541 ARD-00925 63545 63546 63547 63548 63549 63550 63561 63562 63578 63579 63580 63581 63583 63584 63585 63586 63590 63591 63592 63593 63594 63595 63596 63597 63598 63604 63605 63606 63607 63608 63625 63626 63627 63634 63635 63636 63637 63638 63644 63654 63655 63656 63657 63660 63661 63662 63663 63664 63667 63669 63670 63678 63679 63680 63681 63682 63683 63684 63687 63691 63692 63693 63694 63698 63699 63700 63701 63702 63704 63705 63710 63711 63712 63713 63714 63727 63728 63729 63730 63744 63745 63748 63757 63761 63763 63775 63779 63782 63783 63784 63785 63787 63798 63800 63803 63812 63815 63816 63817 63818 63819 63820 63821 63822 63832 63837 63838 63839 63840 63842 63859 63860 63861 63862 63863 63864 63866 63867 63868 63873 63874 63875 63876 63907 63908 63909 63910 63914 63915 63926 63927 63928 63930 63931 63934 63959 63960 63961 63975 63976 63997 63998 63999 64000 64004 64042 64047 64048 64049 64050 64070 64078 64091 64101 64125 64142 64149 64150 64153 64154 64155 64156 64157 64158 64159 64160 64161 64162 64163 64164 64166 64167 64168 64171 64173 64174 64175 64176 64186 64187 64194 64195 64196 64197 64198 64201 64202 64203 64207 64208 64212 64217 64218 64219 64220 64228 64229 64230 64231 64235 64236 64237 64238 64239 64240 64241 64242 64243 64247 64248 64250 64251 64255 64257 64258 64259 64261 64262 64263 64264 64267 64268 64274 64277 64279 64280 64288 64289 64290 64293 64304 64305 64306 64307 64308 64309 64310 64313 64315 64316 64317 64321 64322 64323 64324 64325 64326 64327 64328 64329 64330 64336 64347 64349 64353 64354 64355 64356 64357 64358 64359 64363 64365 64367 64368 64369 64370 64371 64372 64373 64374 64375 64376 64380 64381 64382 64383 64385 64386 64387 64388 64389 64394 64395 64396 64397 64398 64400 64401 64402 64406 64407 64408 64409 64410 64411 64412 64419 64420 64421 64423 64424 64425 64435 64441 64443 64464 64465 64466 64467 64468 64469 64480 64489 64490 64491 64495 64508 64514 64545 64558 64559 64565 64566 64573 64575 64576 64577 64583 64590 64594 64595 64596 64597 64609 64610 64611 64612 64613 64617 64618 64619 64630 64631 64632 64642 64655 64656 64661 64662 64663 64664 64665 64666 64670 64671 64672 64676 64677 64678 64683 64684 64685 64690 64691 64712 64713 64717 64718 64719 64729 64731 64743 64744 64745 64748 64749 64751 64752 64753 64754 64762 64763 64764 64765 64766 64768 64769 64770 64771 64772 64773 64774 64775 64783 64787 64793 64798 64799 64800 64801 64802 64803 64804 64805 64806 64817 64822 64823 64824 64825 64829 64831 64832 64833 64852 64853 64854 64866 64867 64868 64884 64885 64901 64902 64903 64912 64913 64936 64937 64938 64954 64955 64956 64969 64970 64972 64973 64974 64975 64979 64980 64981 64982 64988 64990 64991 64992 64993 64998 64999 65000 65002 65003 65004 65008 65009 65010 65011 65015 65016 65017 65020 65021 65022 65024 65025 65026 65034 65035 65036 65037 65038 65039 65040 65041 65042 65043 65044 65045 65046 65047 65048 65052 65053 65054 65055 65056 65057 65058 65059 65060 65061 65062 65063 65068 65069 65070 65071 65072 65073 65074 65077 65078 65079 65080 65081 65085 65086 65100 65104 65105 65106 65108 65109 65110 65111 65112 65122 65123 65124 65131 65132 65133 65134 65135 65137 65141 65142 65144 65145 65146 65147 65148 65149 65154 65155 65156 65157 65158 65159 65162 65163 65164 65165 65166 65171 65172 65173 65174 65175 65176 65177 65178 65179 65180 65181 65184 65185 65186 65187 65191 65192 65193 65194 65195 65196 65197 65198 65199 65200 65202 65203 65204 65205 65206 65207 65208 65209 65214 65215 65216 65219 65220 65221 65226 65227 65228 65229 65231 65232 65233 65234 65239 65240 65241 65242 65250 65251 65252 65253 65254 65255 65259 65260 65261 65265 65266 65267 65279 65280 65281 65282 65284 65285 65286 65287 65288 65289 65290 65296 65297 65298 65307 65308 65309 65313 65314 65317 65318 65325 65326 65327 65328 65330 65331 65336 65337 65338 65339 65340 65341 65342 65343 65344 65345 65346 65347 65348 65349 65350 65351 65352 65355 65356 65359 65360 65361 65362 65363 65364 65365 65366 65372 65374 65377 65378 65383 65384 65393 65394 65395 65396 65397 65398 65399 65400 65401 65402 65403 65404 65405 65410 65411 65412 65413 65415 65416 65420 65421 65422 65423 65431 65432 65433 65434 65435 65436 65439 65440 65442 65443 65446 65447 65448 65461 65462 65463 65465 65466 65468 65475 65476 65482 65483 65484 65485 65487 65490 65491 65492 65493 65498 65500 65504 65505 65514 65515 65516 65518 65524 65525 65526 65527 65528 65529 65533 65541 65542 65543 65544 65549 65551 65556 65557 65558 65564 65566 65567 65576 65577 65580 65585 65612 65613 65627 ARD-00925 65628 65629 65634 65635 65636 65637 65646 65647 65648 65649 65650 65654 65655 65657 65658 65661 65662 65663 65680 65681 65684 65691 65692 65710 65711 65716 65719 65720 65721 65732 65735 65742 65743 65754 65755 65759 65760 65764 65768 65769 65770 65772 65784 65787 65791 65792 65793 65794 65795 65796 65797 65801 65802 65807 65808 65809 65816 65817 65818 65821 65822 65823 65827 65831 65832 65834 65835 65836 65837 65843 65844 65845 65846 65847 65856 65857 65858 65859 65860 65861 65862 65875 65883 65884 65885 65886 65888 65889 65890 65895 65913 65914 65915 65917 65919 65920 65921 65922 65923 65927 65930 65931 65932 65935 65936 65938 65939 65944 65945 65946 65953 65954 65955 65956 65957 65958 65966 65968 65970 65971 65972 65973 65974 65975 65976 65977 65978 65979 65980 65981 65982 65985 65986 65987 65988 65989 65990 65991 65999 66000 66003 66004 66005 66011 66012 66017 66018 66019 66020 66021 66027 66028 66037 66043 66044 66050 66051 66052 66055 66058 66083 66084 66086 66087 66088 66096 66103 66104 66105 66106 66107 66108 66109 66111 66112 66113 66114 66117 66118 66119 66122 66123 66124 66125 66126 66127 66128 66129 66130 66131 66132 66134 66135 66136 66137 66140 66141 66148 66151 66152 66155 66156 66157 66158 66159 66160 66162 66163 66164 66165 66169 66182 66183 66185 66188 66190 66192 66193 66194 66211 66225 66226 66227 66232 66233 66236 66237 66238 66243 66246 66247 66263 66267 66273 66274 66279 66280 66284 66285 66286 66288 66293 66294 66295 66296 66297 66302 66303 66304 66305 66306 66307 66308 66309 66311 66312 66313 66315 66316 66317 66318 66319 66320 66321 66322 66323 66324 66325 66326 66327 66328 66329 66330 66331 66333 66334 66335 66336 66337 66338 66339 66340 66341 66342 66343 66344 66345 66346 66347 66348 66349 66350 66351 66352 66353 66354 66355 66356 66357 66358 66360 66361 66362 66363 66364 66365 66366 66367 66368 66369 66372 66373 66374 66375 66376 66377 66378 66379 66380 66381 66382 66383 66384 66385 66388 66392 66395 66400 66403 66404 66410 66411 66412 66414 66415 66416 66417 66418 66419 66420 66421 66422 66423 66424 66425 66427 66428 66429 66430 66431 66432 66433 66434 66435 66436 66437 66440 66441 66442 66443 66444 66445 66447 66451 66452 66453 66454 66455 66456 66457 66459 66460 66461 66462 66466 66467 66468 66469 66470 66471 66472 66474 66475 66478 66479 66481 66482 66483 66484 66485 66486 66487 66488 66489 66494 66495 66496 66497 66498 66499 66502 66505 66506 66507 66508 66509 66513 66516 66517 66519 66520 66521 66522 66524 66526 66527 66528 66529 66533 66534 66535 66541 66542 66543 66544 66547 66550 66555 66556 66557 66559 66562 66563 66564 66565 66566 66568 66569 66570 66571 66574 66575 66576 66579 66582 66583 66584 66585 66586 66587 66588 66589 66590 66592 66593 66594 66595 66596 66597 66598 66599 66600 66601 66602 66603 66604 66605 66606 66607 66608 66609 66610 66612 66613 66614 66615 66617 66618 66619 66620 66621 66624 66625 66626 66627 66631 66634 66639 66642 66652 66657 66658 66659 66665 66671 66672 66673 66674 66675 66676 66677 66678 66679 66680 66681 66682 66683 66686 66688 66691 66694 66695 66696 66697 66698 66699 66702 66703 66704 66705 66706 66707 66710 66711 66712 66713 66714 66715 66717 66720 66721 66722 66727 66728 66730 66731 66732 66733 66734 66735 66738 66742 66743 66748 66749 66750 66751 66752 66755 66756 66757 66760 66761 66764 66765 66771 66772 66773 66774 66775 66776 66777 66778 66779 66780 66781 66782 66783 66785 66788 66792 66793 66799 66809 66817 66818 66819 66820 66821 66837 66838 66840 66841 66842 66849 66850 66851 66854 66855 66856 66859 66867 66868 66871 66872 66879 66880 66881 66882 66883 66884 66885 66893 66894 66895 66896 66897 66898 66899 66900 66902 66903 66919 66920 66922 66923 66924 66925 66926 66927 66930 66939 66941 66942 66943 66946 66947 66949 66953 66954 66955 66956 66957 66958 66959 66961 66962 66963 66964 66965 66966 66967 66968 66972 66974 66975 66976 66978 66979 66980 66983 66984 66991 66992 66993 66994 66995 66996 66997 66998 67002 67003 67004 67005 67006 67018 67019 67023 67024 67025 67029 67030 67031 67032 67033 67034 67035 67036 67037 67038 67042 67043 67045 67046 67047 67059 67062 67063 67070 67089 67090 67091 67092 67093 67098 67099 67106 67112 67116 67117 67121 67122 67138 67142 67143 67144 67145 67146 67147 67150 67154 67155 67156 67159 67162 67165 67166 67167 67168 67169 67170 67172 67173 67174 67178 67179 67180 67181 67182 67183 67184 67185 67186 67187 67188 67191 67193 67194 67195 67196 67197 67198 67199 67202 67203 67204 67205 67206 67207 67209 67210 67211 67213 67214 67215 67216 ARD-00925 67217 67218 67219 67220 67222 67223 67224 67225 67226 67229 67230 67231 67234 67235 67236 67237 67238 67239 67240 67241 67242 67243 67244 67245 67247 67248 67249 67251 67252 67254 67257 67258 67260 67261 67262 67263 67264 67265 67266 67267 67268 67269 67270 67271 67272 67273 67274 67282 67283 67284 67285 67286 67290 67296 67302 67305 67306 67307 67317 67318 67319 67320 67332 67340 67344 67359 67365 67366 67370 67371 67372 67382 67392 67393 67397 67398 67399 67404 67405 67406 67410 67417 67421 67431 67435 67436 67444 67445 67446 67447 67451 67455 67456 67457 67458 67459 67460 67461 67462 67463 67464 67465 67466 67467 67468 67469 67470 67472 67473 67474 67477 67478 67482 67483 67484 67485 67490 67491 67492 67493 67494 67501 67502 67506 67507 67508 67513 67514 67515 67516 67517 67518 67519 67521 67522 67523 67524 67525 67526 67527 67528 67529 67530 67533 67534 67535 67536 67537 67538 67539 67541 67543 67544 67545 67546 67547 67548 67550 67551 67552 67553 67554 67555 67559 67560 67562 67563 67564 67567 67570 67574 67581 67583 67584 67585 67587 67588 67589 67590 67592 67597 67598 67603 67604 67605 67606 67607 67608 67609 67611 67614 67615 67616 67617 67618 67619 67620 67621 67622 67626 67627 67628 67629 67633 67634 67635 67636 67637 67638 67639 67642 67646 67650 67651 67655 67660 67663 67673 67674 67675 67676 67679 67680 67681 67684 67695 67708 67709 67716 67717 67733 67734 67736 67737 67740 67741 67750 67751 67758 67764 67771 67779 67780 67799 67813 67814 67815 67816 67817 67818 67825 67826 67827 67830 67833 67836 67837 67838 67839 67840 67843 67844 67850 67851 67852 67853 67854 67857 67858 67861 67862 67866 67867 67878 67879 67887 67898 67899 67908 67915 67916 67919 67922 67923 67925 67927 67928 67929 67943 67948 67951 67955 67964 67965 67969 67970 67973 67974 67975 67978 67979 67980 67982 67983 67984 67990 67991 67992 67998 68000 68001 68003 68004 68005 68006 68010 68019 68029 68030 68033 68040 68041 68042 68043 68044 68045 68049 68060 68063 68071 68072 68078 68079 68091 68092 68095 68096 68097 68098 68103 68104 68105 68114 68115 68116 68148 68149 68150 68194 68195 68210 68211 68212 68213 68216 68219 68220 68221 68238 68239 68240 68241 68260 68261 68262 68266 68279 68289 68292 68293 68298 68301 68302 68303 68308 68309 68312 68313 68314 68315 68319 68324 68325 68334 68335 68340 68341 68342 68346 68347 68348 68358 68360 68361 68366 68367 68368 68376 68377 68378 68379 68380 68381 68384 68385 68386 68391 68399 68400 68401 68403 68404 68410 68411 68415 68416 68417 68419 68422 68423 68424 68428 68429 68430 68437 68438 68439 68440 68441 68442 68443 68444 68445 68446 68447 68460 68465 68466 68469 68470 68471 68472 68473 68477 68478 68480 68481 68483 68484 68485 68486 68487 68488 68489 68493 68494 68496 68497 68498 68499 68503 68504 68505 68506 68507 68508 68509 68512 68513 68514 68515 68516 68517 68525 68536 68537 68538 68542 68543 68547 68548 68549 68550 68567 68572 68573 68594 68595 68603 68604 68611 68629 68632 68633 68634 68642 68644 68645 68646 68647 68652 68653 68654 68655 68656 68657 68663 68668 68674 68676 68677 68680 68681 68684 68685 68686 68687 68688 68689 68691 68692 68696 68697 68699 68700 68703 68704 68705 68707 68708 68713 68714 68715 68716 68717 68718 68726 68728 68730 68738 68745 68746 68747 68750 68753 68754 68764 68765 68766 68767 68768 68770 68771 68772 68775 68776 68777 68781 68782 68783 68785 68786 68788 68789 68790 68791 68792 68793 68796 68797 68798 68799 68800 68801 68802 68804 68805 68806 68807 68808 68809 68812 68813 68814 68815 68816 68817 68818 68819 68820 68821 68822 68823 68824 68826 68827 68828 68832 68834 68835 68836 68846 68847 68848 68851 68852 68853 68854 68855 68859 68860 68861 68862 68868 68869 68873 68880 68881 68882 68883 68884 68885 68886 68887 68890 68891 68892 68893 68894 68895 68896 68897 68900 68901 68902 68903 68905 68906 68907 68908 68909 68910 68912 68913 68914 68915 68917 68918 68920 68921 68922 68925 68926 68930 68931 68932 68933 68937 68940 68941 68943 68944 68945 68946 68952 68956 68967 68968 68970 68971 68975 68976 68979 68984 68987 68988 68992 68993 69005 69006 69012 69013 69014 69016 69022 69023 69025 69026 69027 69028 69029 69032 69038 69039 69042 69044 69045 69047 69052 69054 69055 69062 69063 69065 69066 69069 69070 69074 69075 69076 69077 69083 69084 69086 69087 69088 69089 69090 69093 69094 69096 69097 69098 69099 69105 69106 69115 69126 69133 69137 69138 69139 69143 69144 69146 69147 69148 69149 69150 69151 69153 69154 69155 69156 69157 69158 69159 69163 69164 69169 69170 69173 69174 69177 69178 69181 ARD-00925 69186 69187 69188 69191 69192 69193 69194 69195 69196 69197 69205 69207 69209 69211 69213 69214 69216 69223 69224 69227 69228 69229 69230 69231 69232 69234 69235 69238 69239 69240 69243 69245 69246 69247 69248 69249 69250 69251 69252 69254 69255 69256 69257 69258 69259 69262 69263 69268 69269 69270 69271 69272 69273 69275 69276 69277 69279 69280 69281 69282 69284 69289 69291 69292 69293 69296 69298 69302 69306 69307 69315 69316 69317 69318 69319 69323 69327 69330 69331 69332 69336 69337 69341 69342 69345 69346 69347 69348 69351 69354 69355 69357 69358 69359 69363 69364 69365 69370 69372 69373 69374 69377 69378 69382 69385 69388 69390 69391 69393 69394 69395 69396 69397 69399 69401 69402 69403 69404 69405 69407 69408 69409 69410 69411 69412 69413 69414 69415 69416 69417 69418 69419 69420 69421 69426 69427 69428 69429 69431 69432 69433 69434 69435 69438 69442 69443 69444 69445 69448 69449 69461 69462 69463 69465 69468 69473 69474 69477 69478 69479 69480 69482 69483 69485 69492 69493 69495 69496 69503 69504 69509 69512 69513 69517 69518 69519 69520 69521 69526 69530 69531 69535 69536 69538 69539 69540 69543 69546 69547 69548 69549 69551 69552 69553 69554 69555 69560 69563 69564 69566 69568 69569 69571 69572 69573 69575 69578 69579 69580 69581 69587 69588 69589 69590 69592 69596 69597 69598 69599 69604 69605 69606 69607 69609 69611 69619 69620 69622 69624 69625 69626 69627 69628 69630 69631 69635 69636 69641 69643 69645 69646 69647 69648 69649 69651 69653 69657 69660 69661 69662 69666 69670 69673 69674 69675 69676 69680 69684 69685 69686 69687 69689 69691 69692 69693 69694 69697 69698 69699 69700 69701 69702 69703 69704 69706 69710 69711 69713 69714 69716 69717 69720 69721 69724 69725 69727 69728 69729 69730 69733 69737 69738 69742 69743 69746 69749 69750 69751 69753 69754 69755 69756 69757 69758 69759 69760 69762 69763 69764 69765 69766 69767 69768 69770 69771 69772 69774 69775 69776 69777 69782 69783 69784 69785 69786 69788 69789 69790 69793 69800 69801 69802 69806 69807 69808 69809 69811 69814 69815 69821 69824 69827 69833 69835 69837 69838 69841 69842 69844 69845 69848 69851 69852 69853 69855 69857 69858 69865 69866 69868 69869 69870 69871 69872 69873 69875 69879 69880 69881 69884 69887 69888 69890 69892 69894 69898 69900 69901 69904 69907 69908 69909 69911 69912 69914 69915 69916 69917 69919 69925 69926 69929 69931 69933 69937 69945 69946 69950 69952 69959 69985 69988 69989 69991 69992 69993 69994 69998 69999 70002 70003 70004 70005 70006 70009 70011 70012 70013 70014 70016 70017 70019 70023 70026 70027 70028 70029 70030 70032 70034 70036 70037 70042 70043 70045 70046 70047 70049 70051 70052 70054 70055 70057 70059 70061 70063 70064 70065 70072 70073 70075 70076 70079 70080 70083 70085 70086 70089 70090 70091 70092 70093 70094 70095 70096 70098 70099 70100 70102 70103 70105 70106 70108 70109 70110 70111 70113 70115 70116 70117 70118 70119 70122 70127 70129 70133 70134 70135 70138 70139 70141 70144 70147 70148 70149 70150 70151 70155 70159 70160 70161 70163 70165 70170 70174 70176 70182 70187 70188 70191 70192 70195 70197 70198 70199 70200 70201 70202 70203 70205 70206 70207 70208 70209 70212 70213 70215 70216 70217 70219 70220 70221 70222 70223 70224 70225 70226 70229 70233 70234 70235 70236 70238 70239 70240 70243 70244 70245 70247 70248 70252 70254 70255 70257 70259 70260 70262 70264 70266 70267 70270 70271 70272 70273 70274 70275 70276 70277 70279 70280 70281 70282 70283 70286 70287 70290 70291 70292 70294 70296 70297 70298 70299 70300 70301 70303 70304 70307 70308 70311 70312 70313 70314 70315 70319 70321 70322 70328 70330 70331 70335 70337 70338 70342 70344 70345 70347 70348 70349 70352 70353 70356 70357 70358 70359 70360 70361 70363 70364 70365 70366 70367 70368 70369 70373 70374 70375 70376 70377 70378 70380 70382 70384 70385 70386 70387 70390 70391 70392 70393 70394 70396 70399 70400 70401 70409 70415 70416 70417 70422 70425 70429 70430 70436 70443 70450 70469 70473 70474 70476 70477 70479 70481 70483 70484 70488 70489 70492 70493 70494 70495 70498 70501 70504 70522 70526 70531 70536 70555 70562 70563 70564 70574 70577 70579 70580 70583 70593 70594 70605 70611 70618 70624 70630 70632 70638 70639 70640 70641 70642 70644 70647 70656 70660 70662 70663 70664 70665 70676 70678 70691 70701 70704 70708 70709 70712 70715 70717 70718 70719 70720 70722 70723 70727 70728 70729 70730 70732 70734 70738 70739 70740 70743 70744 70745 70746 70747 70749 70750 70751 70756 70759 70760 70762 70766 70767 70771 70772 70773 70774 70775 70776 70777 70779 70780 70781 ARD-00925 70782 70783 70785 70786 70787 70788 70789 70790 70791 70792 70793 70794 70795 70797 70798 70799 70800 70802 70803 70805 70806 70809 70812 70813 70814 70815 70816 70818 70822 70824 70825 70827 70828 70833 70834 70835 70836 70838 70840 70844 70845 70846 70847 70848 70849 70853 70854 70855 70856 70857 70858 70859 70861 70862 70863 70864 70866 70867 70868 70869 70874 70875 70877 70878 70883 70884 70885 70886 70888 70889 70892 70897 70898 70899 70901 70902 70903 70904 70909 70910 70911 70912 70913 70915 70917 70919 70922 70923 70927 70930 70932 70934 70935 70937 70938 70939 70940 70941 70942 70943 70944 70946 70947 70949 70950 70952 70953 70955 70956 70957 70958 70960 70961 70962 70963 70964 70965 70966 70967 70968 70969 70971 70972 70975 70976 70977 70978 70979 70981 70982 70983 70984 70985 70986 70987 70988 70989 70990 70991 70995 70996 70998 70999 71000 71001 71002 71003 71004 71006 71007 71008 71010 71011 71013 71016 71018 71019 71021 71023 71024 71027 71033 71042 71044 71051 71053 71056 71057 71061 71064 71065 71066 71466 71473 71484 71489 71492 71495 71496 71505 71506 71507 71509 71516 71519 71524 71526 71528 71529 71536 71541 71542 71543 71544 71547 71548 71550 71552 71553 71555 71556 71557 71558 71559 71561 71562 71566 71569 71570 71571 71572 71575 71576 71577 71579 71581 71590 71594 71595 71599 71600 71602 71609 71621 71632 71637 71645 71653 71657 71659 71662 71663 71664 71667 71668 71669 71672 71676 71681 71687 71688 71690 71691 71709 71740 71741 71742 71744 71745 71748 71749 71750 71757 71758 71763 71764 71767 71768 71787 71792 71794 71795 71800 71802 71804 71808 71811 71814 71817 71824 71825 71826 71834 71835 71836 71838 71839 71845 71846 71849 71850 71855 71856 71858 71860 71863 71868 71876 71878 71879 71882 71884 71885 71888 71891 71894 71896 71898 71902 71908 71909 71910 71912 71930 71936 71938 71939 71940 71943 71944 71947 71959 71960 71961 71965 71966 71968 71970 71971 71973 71974 71975 71977 71984 71987 71988 71990 71991 71992 71993 71994 71996 72000 72013 72014 72016 72017 72022 72023 72026 72027 72028 72032 72044 72058 72060 72062 72063 72064 72065 72066 72068 72069 72071 72072 72073 72075 72085 72088 72095 72096 72097 72101 72102 74813 74823 74824 74826 74827 74841 74844 74845 74846 74854 74860 74861 74862 74866 74870 74871 74872 74873 74876 74877 74878 74879 74880 74884 74895 74896 74897 74898 74900 74903 74912 74913 74914 74915 74937 74953 74964 74974 74978 74983 74984 74989 74990 75027 75051 75052 75056 75057 75058 75059 75060 75061 75071 75072 75075 75091 75092 75096 75098 75100 75102 75103 75111 75112 75113 75114 75121 75122 75123 75124 75125 75127 75128 75132 75133 75134 75135 75137 75156 75164 75169 75170 75172 75175 75176 75177 75185 75186 75187 75188 75201 75207 75208 75209 75210 75212 75224 75225 75227 75229 75230 75231 75236 75241 75242 75244 75245 75246 75247 75248 75253 75254 75262 75263 75264 75265 75266 75267 75268 75270 75271 75276 75295 75297 75299 75300 75301 75302 75311 75312 75313 75317 75319 75328 75329 75330 75331 75332 (11) Metal-binding proteins (SEQ ID NOs) 4825 4936 4973 5174 5220 5224 5382 6020 6050 6142 6317 6337 6468 6605 10463 10856 10857 10862 10885 11032 11034 11431 11869 11994 12018 16978 16769 16778 16779 16781 16782 16783 16858 16862 16873 16877 16878 16879 16880 54097 54098 54143 54144 54145 54146 54147 54148 54153 54154 54157 54158 54159 54160 54161 54162 54163 54164 54165 54166 54167 54168 54169 54170 54171 54175 54176 54177 54178 54179 54180 54181 54182 54183 54184 54185 54186 54187 54209 54210 54211 54214 54215 54216 54217 54218 54219 54226 54227 54228 54229 54230 54231 54232 54233 54234 54235 54236 54237 54240 54241 54244 54245 54246 54307 54308 54455 54456 54457 54458 54459 54460 54511 54512 54513 54514 54665 54666 54667 54802 55005 55480 55566 55630 55631 55632 55842 56663 56664 56700 56701 56702 56703 56731 56732 56733 56815 56816 56828 56829 57141 57142 57143 57159 57160 57161 57162 57213 57214 58180 58181 58262 58263 58264 58265 58268 58269 58270 58271 58299 58300 58301 58302 58305 58306 58307 58308 58317 58318 58319 58320 58394 58395 58396 58397 58458 58459 58460 58461 58544 58545 58546 58547 59096 59097 59098 59099 59100 60610 60611 60612 60613 60614 61600 61601 62043 62044 62045 62166 62167 62367 62368 62369 62370 62438 63120 63121 63122 63179 63180 63277 63629 63630 63631 64185 64350 64351 64352 65143 65188 65225 65324 65545 65559 65581 65582 65591 65592 65607 65828 ARD-00925 65829 65830 65841 65842 65848 65849 65850 65865 65918 65964 65983 65984 66007 66008 66059 66060 66061 66062 66066 66075 66076 66077 66078 66079 66092 66093 66094 66095 66097 66098 66177 66184 66386 66387 66532 66560 66567 66646 66647 67110 67111 67212 67540 67586 67692 67950 67987 68345 68510 68511 68535 68592 68593 68671 68672 69056 69057 69104 69182 69183 69253 69265 69266 69267 69557 69558 69612 69632 69744 69797 69798 69863 69944 69971 70020 70021 70041 70070 70104 70156 70346 70371 70427 70442 70447 70448 70449 70451 70453 70455 70458 70459 70463 70465 70467 70468 70470 70471 70487 70490 70491 70497 70506 70507 70510 70514 70530 70535 70540 70554 70556 70557 70561 70626 70653 70873 71012 71054 71067 71468 71482 71549 71716 71717 71721 71725 71728 71730 71753 71755 71760 71761 71762 71816 71837 71852 71895 71997 72006 72018 72043 72081 72093 74874 75037 75038 75039 75046 75069 75070 75283 75284 75285 75326 71316 71413 71422 71423 71425 71426 71427 (12) Methanogenesis proteins (SEQ ID NOs) 5833 5835 5836 5837 5838 5839 5840 5841 5842 5843 5844 6360 6432 6436 6437 6438 6439 6440 6441 6442 6443 6444 6445 10474 10475 10476 10477 10478 10479 10480 10481 10482 10483 10484 10485 11511 11549 11554 11555 11556 11557 11558 11559 11560 11562 16859 54741 54742 54743 54744 54745 54786 54787 54788 54789 54790 54871 54872 54873 54874 54875 56843 56844 57209 57210 57215 57216 57217 57218 57219 57220 57230 57231 57232 57233 57234 57235 57267 57268 57269 57270 57271 57272 57273 57274 57275 57276 57277 57346 57347 57348 57349 57350 57351 57365 57366 57367 57368 57416 57417 57418 57461 57462 57463 57464 57499 57500 57501 57510 57511 57512 57706 57707 57708 57721 57722 57723 57734 57735 57736 57737 57738 57739 57979 57980 57981 57982 57983 57984 57998 57999 58000 58001 58002 58003 58011 58012 58013 58017 58018 58019 58023 58024 58025 58029 58030 58031 58035 58036 58037 58047 58048 58049 58065 58066 58067 58077 58078 58079 58080 58081 58082 58104 58105 58106 58107 58108 58109 58113 58114 58115 58119 58120 58121 58144 58145 58146 58185 58186 58187 58188 58189 58190 58191 58192 58193 58194 58195 58196 58200 58201 58202 58203 58204 58205 58206 58209 58210 58211 58212 58213 58214 58242 58243 58244 58245 58246 58843 58844 58845 58846 59842 59843 59844 59845 59846 59847 60615 60616 60617 60618 60624 60625 60626 60627 60628 60634 60635 60636 60637 60659 61096 61097 61098 61240 61241 61242 61243 61511 61531 61532 61533 61534 61712 61713 61714 61715 61790 61793 61796 61806 61833 61846 61851 61854 61857 61871 61874 61883 61888 61891 61925 61944 61945 61956 61962 62778 62779 63283 63284 63844 63845 63846 63851 63903 63911 63924 63925 63929 63932 63933 63935 63936 63937 63938 63939 63940 63941 63942 63943 63944 63945 63949 63951 63955 63956 63957 63958 63962 63966 63967 63968 63977 63981 63982 63983 63984 63985 63986 64041 64141 64165 65295 65303 65305 65310 65315 65316 65329 65334 65467 65469 65486 65503 65511 65517 65519 65530 65534 65538 65540 65546 65550 65656 65880 66628 67044 67561 67566 67568 67569 67571 67572 67575 67578 67580 67582 67669 67670 67682 67683 67694 67700 67711 67712 67718 67719 67720 67723 67724 67729 67732 67735 67738 67739 67742 67743 67754 67755 67756 67757 67783 67784 67789 67790 67795 67796 67802 67803 67805 67806 67809 67810 67811 67812 67821 67822 67823 67824 67831 67832 67841 67842 67845 67846 67863 68637 68712 68721 68732 68733 68734 68735 68736 68737 68739 68740 68748 68749 68751 68752 68755 68757 68758 68760 68761 68769 68856 68857 68871 68874 68878 68916 69112 69113 69114 69140 69145 69215 69244 69290 69297 69303 69310 69329 69335 69338 69350 69360 69361 69366 69389 69392 69406 69439 69455 69469 69475 69476 69481 69484 69489 69491 69494 69497 69498 69500 69501 69502 69505 69506 69525 69527 69534 69582 69920 69924 69934 69939 69940 69941 69942 69943 69948 69949 69951 69953 69954 69961 69962 69964 69967 69968 69970 69973 69974 69975 69977 69978 69979 69980 69981 69982 69983 69986 69987 69990 69995 69997 70022 70040 70048 70056 70068 70074 70097 70112 70124 70146 70153 70175 70193 70261 70309 70339 70343 70355 70389 70395 70408 70428 70452 70457 70464 70520 70523 70529 70534 70544 70547 70550 70553 70560 70565 70566 70573 70578 70581 70584 70588 70592 70595 70597 70598 70600 70606 70607 70670 70687 70689 70695 70697 70699 ARD-00925 70702 70703 70705 70706 70711 70713 70736 70769 70770 70870 70945 71732 71733 71923 75197 (13) Methanogenesis Mtr proteins (SEQ ID NOs) 6349 6350 6351 6352 6353 6354 11495 11496 11498 11499 11500 65965 66149 66150 66166 66173 66174 66948 67048 67049 67153 67192 67246 67443 67479 67480 67481 67486 67489 67495 67500 67512 67542 67601 68002 70323 70324 70332 70333 70397 70398 70671 70673 70680 70688 70690 70710 70980 71678 71899 71914 71915 71916 71917 71918 71919 71920 72047 75195 (14) Methanogenesis MtrE proteins (SEQ ID NOs) 6355 11501 12052 12053 12054 12055 12056 12057 12058 12059 12060 12061 12062 12063 12064 12065 12066 12067 12068 12069 12070 12071 12072 12073 12074 12075 12076 12077 12078 12079 12080 12081 12082 12083 12084 12085 12086 12087 12088 12089 12090 12091 12092 12093 12094 12095 12096 12097 12098 12099 16969 16970 16971 16972 16973 64574 65049 65136 65190 65201 65238 65294 65312 65962 65963 66049 66091 66635 66636 66808 (15) Phage related (SEQ ID NOs) 4742 4744 4745 4750 57399 57400 57401 69072 (16) Proteolysis (SEQ ID NOs) 4466 4564 4672 4754 5032 5120 5314 5461 5560 5678 5695 5744 5936 6069 6109 6130 6600 10411 10525 10580 10737 11111 11232 11426 11638 11652 11798 16770 16788 16790 53469 53470 53471 53472 53473 53474 53475 53476 53506 53507 53814 53815 53816 53817 53818 53819 53863 53864 53865 53885 53886 53887 53888 53889 53890 53891 53892 53893 53894 53895 53896 53897 53898 53899 53900 53901 53902 53903 53904 53905 53996 53997 53998 53999 54000 54001 54002 54003 54004 54012 54013 54022 54023 54024 54025 54026 54027 54028 54029 54030 54031 54032 54033 54141 54254 54300 54301 54322 54323 55371 55372 55373 55374 55500 56158 56159 57152 57223 57224 57359 57410 57411 57412 57885 57886 57887 57888 57889 58584 58585 60294 60295 60296 60297 60690 60691 60692 60693 60773 60774 60775 60776 60777 60778 60779 60845 60874 61622 61623 61909 61910 61934 61976 61979 61982 61983 61990 62063 62064 62093 62105 62165 62175 62176 62183 62189 62190 62191 62192 62193 62196 62197 62202 62203 62204 62213 62214 62222 62227 62229 62230 62255 62256 62361 62362 62386 62433 62434 62436 62437 62444 62445 62446 62447 62944 62945 62946 63152 63153 63467 63950 64060 64061 64062 64063 64064 64065 64066 64204 64205 64206 64265 64270 64272 64273 64294 64295 64331 64332 64333 64379 64391 64392 64393 64403 64404 64405 64413 64414 64415 64427 64428 64429 64436 64437 64438 64452 64453 64454 64458 64459 64460 64473 64474 64475 64482 64483 64484 64488 64506 64511 64513 64520 64521 64522 64564 64591 64592 64593 64598 64599 64600 64620 64621 64622 64643 64644 64645 64646 64647 64648 64652 64653 64654 64667 64668 64669 64699 64700 64701 64720 64929 64930 64957 64958 64959 65012 65013 65014 65120 65121 65138 65139 65140 65277 65278 65283 65301 65302 65357 65358 65367 65368 65379 65380 65381 65382 65385 65386 65387 65388 65389 65390 65391 65406 65407 65408 65409 65418 65419 65424 65425 65426 65427 65429 65430 65437 65438 65444 65445 65450 65451 65453 65454 65455 65456 65457 65458 65459 65460 65470 65565 65788 65789 65790 65798 65799 65800 65813 65814 65815 65874 65891 65892 66033 66034 66038 66133 66161 66171 66172 66191 66212 66228 66239 66240 66264 66700 66886 66887 66888 67060 67061 67325 67326 67327 67531 67532 67666 67667 67705 67706 67707 67807 67808 67855 67856 67859 67860 67936 67995 68017 68018 68022 68023 68076 68077 68110 68111 68112 68113 68131 68132 68142 68143 68146 68147 68166 68167 68168 68169 68170 68171 68176 68177 68182 68183 68186 68187 68196 68197 68202 68203 68204 68205 68214 68215 68222 68223 68226 68227 68228 68229 68230 68231 68242 68243 68244 68245 68250 68251 68254 68255 68269 68270 68271 68272 68273 68274 68326 68327 68328 68329 68362 68373 68374 68418 68602 68628 68635 68636 68643 68675 69127 69128 69129 69179 69180 69199 69200 69236 69237 69328 69446 69447 69593 69787 69862 69882 69883 70035 70157 70184 70288 70340 70379 70383 70411 70461 70462 70533 70654 70655 70894 71480 71531 71538 71584 71607 71665 71786 71807 71833 71893 71972 71978 72030 74810 74868 74869 74905 74906 74907 74920 74985 75119 75120 75174 75274 75275 71414 71432 71434 ARD-00925 (17) Transcription regulation (SEQ ID NOs) 54777 54778 54779 54780 70620 (18) Ribosomal (SEQ ID NOs) 61896 61897 62721 66723 66724 66725 66726 66729 67400 71612 71751 72048 (19) Substrate binding (SEQ ID NOs) 16860 (20) Transcription (SEQ ID NOs) 57620 57621 59813 65150 65151 65152 68305 68658 69018 69019 69020 70177 70179 70285 70621 70622 71530 71627 71756 71823 72003 72042 (21) Transport (SEQ ID NOs) 4437 4442 4450 4451 4480 4503 4527 4550 4573 4574 4575 4632 4634 4635 4640 4641 4649 4650 4673 4685 4686 4699 4717 4763 4766 4786 4792 4800 4813 4839 4840 4841 4900 4915 4929 4930 4967 4970 4972 4974 4991 4992 5003 5004 5040 5042 5049 5069 5092 5093 5129 5130 5138 5157 5222 5241 5254 5260 5308 5316 5317 5318 5383 5419 5426 5435 5503 5514 5515 5516 5623 5633 5634 5653 5717 5757 5764 5765 5772 5802 5805 5815 5860 5869 5871 5888 5942 5954 5956 6029 6044 6048 6049 6059 6060 6090 6134 6140 6141 6145 6153 6154 6167 6183 6197 6208 6209 6218 6221 6272 6273 6312 6377 6385 6400 6416 6452 6456 6477 6478 6479 6483 6608 6609 6629 6638 6640 6650 10256 10271 10275 10276 10284 10295 10296 10302 10303 10343 10352 10354 10355 10365 10380 10381 10405 10406 10407 10409 10425 10496 10499 10516 10527 10528 10578 10623 10624 10625 10629 10630 10648 10651 10652 10655 10656 10657 10663 10701 10718 10728 10738 10753 10841 10842 10845 10847 10850 10851 10854 10855 10863 10864 10870 10905 10932 10976 11054 11073 11083 11095 11121 11124 11134 11140 11141 11142 11159 11205 11214 11215 11227 11274 11329 11341 11342 11343 11355 11371 11421 11433 11469 11470 11513 11514 11530 11544 11564 11572 11574 11575 11583 11626 11671 11677 11680 11681 11684 11705 11725 11742 11751 11787 11813 11817 11839 11912 11980 11991 12007 12013 12017 12019 16772 16773 16775 16776 16796 16798 16870 16875 53543 53544 53545 53565 53566 53567 53568 53569 53570 53588 53589 53590 53591 53592 53593 53600 53985 54018 54019 54020 54021 54094 54095 54096 54119 54120 54121 54142 54206 54207 54208 54220 54221 54255 54256 54257 54258 54259 54260 54261 54273 54274 54275 54276 54304 54309 54310 54311 54312 54317 54319 54326 54327 54338 54339 54340 54341 54342 54343 54344 54345 54346 54347 54348 54349 54350 54351 54352 54354 54355 54356 54357 54358 54359 54360 54361 54362 54363 54364 54365 54366 54367 54368 54381 54382 54383 54384 54385 54386 54432 54433 54434 54435 54436 54437 54438 54439 54444 54445 54446 54461 54476 54477 54507 54508 54509 54510 54515 54516 54522 54523 54524 54525 54528 54529 54530 54531 54532 54533 54534 54535 54538 54539 54540 54541 54546 54547 54548 54549 54550 54551 54552 54553 54554 54555 54556 54557 54558 54559 54560 54561 54562 54563 54564 54565 54566 54567 54568 54569 54570 54571 54572 54573 54574 54575 54576 54577 54578 54579 54580 54581 54582 54583 54584 54585 54586 54587 54588 54589 54590 54591 54592 54593 54594 54595 54596 54597 54598 54599 54600 54601 54602 54603 54604 54605 54606 54607 54608 54609 54610 54611 54612 54613 54614 54615 54616 54617 54618 54619 54620 54621 54622 54623 54624 54628 54629 54630 54631 54632 54633 54634 54635 54636 54637 54638 54639 54640 54641 54642 54643 54644 54645 54658 54659 54663 54664 54668 54669 54670 54671 54672 54673 54674 54675 54676 54678 54679 54680 54681 54682 54683 54684 54685 54686 54687 54688 54689 54690 54691 54692 54695 54696 54697 54698 54700 54701 54702 54703 54704 54705 54714 54715 54717 54718 54719 54720 54721 54722 54723 54724 54725 54726 54727 54728 54729 54730 54731 54752 54753 54754 54759 54760 54785 54795 54796 54797 54803 54804 54805 54806 54815 54816 54817 54841 54842 54843 54846 54847 54848 54849 54850 54851 54852 54853 54855 54856 54857 54858 54859 54860 54861 54862 54863 54864 54865 54866 54867 54868 54869 54870 54876 54877 54878 54882 54883 54884 54885 54886 54893 54894 54895 54896 54897 54898 54899 54900 54901 54902 54903 54904 54905 54906 54907 54908 54909 54910 54911 54912 54913 54914 54915 54916 54917 54918 54919 54920 54921 54922 54923 54924 54925 54926 54927 54928 54929 54930 54931 54932 54933 54934 54935 54936 54937 54938 54939 ARD-00925 54940 54941 54942 54943 54944 54945 54946 54947 54948 54949 54950 54951 54952 54953 54954 54955 54956 54957 54958 54959 54960 54961 54962 54963 54964 54965 54966 54967 54968 54969 54970 54971 54972 54973 54974 54975 54976 54977 54978 54979 54980 54981 54982 54983 54984 54985 54986 54987 54988 54989 54990 54991 54992 54993 54994 54995 54996 54997 54998 54999 55000 55001 55002 55003 55004 55006 55007 55008 55010 55011 55012 55013 55014 55020 55021 55022 55023 55024 55025 55026 55027 55028 55029 55030 55031 55032 55033 55034 55035 55036 55037 55038 55039 55040 55041 55042 55043 55044 55045 55046 55047 55048 55049 55050 55051 55052 55053 55054 55055 55056 55057 55058 55059 55060 55061 55062 55063 55064 55066 55067 55068 55069 55070 55071 55072 55073 55085 55086 55087 55091 55092 55093 55094 55095 55098 55099 55107 55108 55109 55132 55174 55178 55179 55180 55181 55182 55192 55193 55194 55195 55196 55203 55204 55234 55238 55279 55289 55292 55296 55302 55306 55307 55308 55311 55356 55357 55358 55359 55360 55361 55369 55389 55390 55398 55399 55400 55401 55402 55403 55404 55405 55406 55410 55411 55413 55414 55415 55416 55417 55421 55423 55426 55445 55446 55447 55448 55449 55450 55459 55477 55481 55482 55486 55487 55488 55489 55490 55491 55494 55495 55498 55499 55501 55502 55503 55504 55512 55517 55518 55519 55520 55526 55527 55528 55537 55546 55547 55558 55565 55585 55586 55590 55591 55592 55596 55599 55624 55629 55633 55634 55636 55637 55638 55650 55651 55654 55655 55688 55689 55690 55695 55696 55697 55698 55699 55700 55711 55712 55713 55715 55716 55717 55718 55719 55720 55721 55722 55723 55728 55729 55730 55731 55734 55735 55736 55737 55750 55751 55752 55753 55754 55755 55756 55760 55761 55762 55763 55764 55765 55766 55768 55769 55770 55771 55773 55774 55775 55776 55777 55778 55779 55780 55785 55786 55787 55788 55789 55790 55801 55802 55803 55814 55815 55816 55817 55818 55819 55820 55821 55822 55823 55824 55825 55826 55827 55828 55829 55833 55834 55835 55836 55837 55838 55839 55840 55841 55845 55846 55847 55848 55849 55850 55851 55852 55853 55854 55855 55856 55857 55858 55859 55860 55861 55862 55863 55864 55865 55866 55867 55868 55869 55870 55871 55872 55873 55874 55875 55876 55877 55878 55879 55880 55881 55882 55883 55884 55885 55886 55887 55888 55889 55890 55891 55892 55893 55900 55901 55902 55903 55904 55905 55906 55907 55908 55909 55910 55911 55912 55913 55914 55915 55916 55917 55918 55919 55920 55921 55922 55923 55924 55925 55926 55927 55928 55929 55930 55931 55932 55938 55939 55940 55941 55942 55943 55944 55945 55946 55947 55948 55949 55950 55951 55952 55953 55954 55955 55956 55957 55958 55959 55960 55961 55962 55963 55964 55965 55966 55967 55968 55972 55973 55974 55975 55976 55977 55978 55979 55980 55981 55982 55983 55984 55985 55988 55989 55990 55991 55992 55993 55994 55995 55996 55997 55998 55999 56000 56008 56009 56010 56011 56016 56017 56018 56019 56020 56021 56022 56023 56024 56025 56026 56027 56028 56029 56030 56031 56032 56033 56034 56035 56036 56037 56038 56039 56040 56041 56042 56043 56044 56045 56046 56047 56048 56049 56050 56051 56052 56053 56054 56055 56056 56057 56058 56059 56060 56061 56062 56063 56064 56065 56066 56067 56068 56069 56070 56071 56072 56073 56074 56075 56076 56077 56078 56079 56080 56084 56085 56086 56087 56088 56089 56090 56091 56092 56093 56094 56095 56096 56097 56098 56099 56100 56101 56102 56103 56104 56105 56106 56113 56114 56115 56116 56117 56118 56119 56120 56121 56122 56123 56124 56125 56126 56127 56128 56129 56137 56138 56139 56140 56141 56142 56143 56144 56145 56146 56147 56148 56149 56150 56151 56152 56167 56168 56169 56174 56175 56176 56177 56178 56179 56181 56182 56183 56189 56190 56191 56192 56193 56194 56195 56196 56200 56201 56202 56203 56204 56205 56211 56219 56220 56226 56227 56228 56229 56230 56231 56232 56233 56234 56235 56236 56237 56238 56239 56240 56241 56242 56243 56244 56245 56246 56247 56248 56249 56250 56251 56252 56253 56254 56255 56256 56257 56258 56263 56264 56265 56266 56267 56268 56269 56270 56278 56279 56285 56286 56287 56291 56292 56293 56294 56304 56305 56306 56318 56319 56320 56321 56322 56323 56324 56325 56342 56343 56344 56351 56352 56353 56354 56355 56356 56357 56358 56359 56360 56361 56362 56363 56364 56365 56366 56367 56368 56369 56370 56371 56372 56373 56374 56375 56376 56377 56378 56379 56380 56381 56382 56383 56384 56385 56386 56387 56388 56389 56390 56391 56392 56393 56394 56395 56396 56397 56398 56399 56400 56401 56402 56403 56404 56405 56406 56407 56408 56409 56410 56411 56415 ARD-00925 56416 56417 56418 56422 56423 56424 56425 56426 56427 56428 56429 56430 56431 56432 56433 56434 56435 56436 56437 56440 56441 56442 56443 56444 56445 56446 56447 56448 56455 56456 56457 56458 56459 56462 56463 56464 56467 56468 56469 56470 56474 56475 56479 56480 56481 56482 56483 56484 56485 56487 56488 56489 56490 56491 56492 56493 56494 56495 56496 56497 56498 56499 56503 56508 56509 56510 56511 56512 56513 56514 56515 56516 56517 56518 56519 56520 56521 56522 56523 56524 56529 56530 56531 56532 56533 56534 56535 56536 56537 56538 56539 56540 56543 56544 56545 56546 56547 56548 56549 56572 56573 56574 56575 56578 56579 56580 56581 56582 56583 56584 56589 56590 56592 56602 56603 56604 56605 56607 56608 56609 56610 56611 56612 56613 56614 56615 56616 56617 56618 56619 56620 56621 56622 56623 56624 56625 56626 56627 56628 56629 56630 56631 56632 56633 56634 56635 56636 56637 56638 56639 56642 56643 56644 56645 56646 56647 56648 56649 56650 56651 56652 56653 56658 56659 56660 56661 56662 56665 56666 56667 56670 56671 56672 56673 56674 56675 56676 56677 56678 56679 56683 56692 56693 56694 56695 56696 56697 56706 56707 56708 56709 56712 56713 56714 56715 56716 56717 56727 56728 56729 56730 56741 56742 56743 56765 56766 56767 56782 56783 56784 56785 56786 56787 56788 56798 56799 56800 56803 56804 56805 56809 56810 56811 56812 56813 56814 56817 56818 56819 56820 56821 56822 56823 56824 56825 56833 56834 56835 56836 56837 56838 56839 56840 56841 56842 56845 56846 56847 56851 56852 56853 56854 56855 56856 56857 56858 56859 56860 56861 56862 56863 56864 56865 56869 56870 56871 56872 56873 56874 56875 56876 56877 56878 56879 56880 56881 56882 56883 56884 56885 56886 56887 56888 56889 56890 56891 56892 56893 56894 56895 56896 56897 56898 56899 56900 56901 56902 56906 56907 56908 56909 56910 56911 56912 56913 56914 56915 56916 56917 56918 56919 56920 56921 56922 56923 56924 56925 56926 56927 56928 56929 56930 56931 56932 56933 56934 56935 56936 56937 56941 56942 56943 56944 56945 56946 56949 56950 56951 56952 56953 56954 56955 56956 56957 56958 56959 56964 56965 56966 56967 56968 56969 56970 56971 56972 56973 56974 56975 56976 56977 56978 56979 56980 56981 56982 56983 56984 56985 56986 56987 56988 56993 56994 56995 57000 57001 57002 57003 57004 57005 57006 57007 57008 57009 57010 57011 57012 57013 57014 57015 57019 57020 57021 57022 57023 57024 57025 57026 57027 57028 57029 57030 57031 57036 57037 57038 57039 57040 57041 57042 57043 57044 57047 57048 57049 57050 57051 57052 57056 57057 57058 57059 57060 57061 57062 57063 57064 57065 57066 57067 57068 57069 57070 57071 57072 57073 57074 57075 57076 57079 57080 57081 57082 57083 57084 57085 57086 57087 57088 57089 57090 57091 57092 57093 57094 57095 57096 57107 57108 57109 57130 57131 57132 57133 57134 57135 57136 57139 57140 57146 57147 57155 57156 57157 57158 57163 57164 57167 57168 57169 57170 57171 57172 57177 57178 57179 57180 57185 57186 57187 57188 57189 57190 57191 57192 57193 57194 57195 57197 57198 57203 57204 57205 57222 57226 57227 57228 57229 57236 57237 57238 57239 57240 57241 57242 57243 57244 57245 57246 57247 57248 57249 57253 57254 57255 57256 57257 57258 57259 57260 57261 57262 57263 57264 57278 57279 57280 57281 57286 57287 57288 57289 57290 57291 57292 57293 57296 57297 57301 57302 57303 57304 57305 57306 57307 57310 57311 57312 57313 57314 57315 57316 57317 57322 57323 57324 57325 57326 57327 57328 57329 57330 57331 57334 57335 57336 57337 57338 57339 57340 57341 57342 57352 57353 57354 57355 57356 57357 57358 57369 57370 57371 57372 57373 57374 57408 57409 57413 57414 57415 57435 57436 57437 57438 57445 57446 57447 57454 57455 57456 57457 57458 57459 57460 57465 57466 57467 57468 57469 57470 57471 57472 57473 57474 57475 57476 57477 57478 57479 57487 57488 57489 57490 57491 57494 57495 57496 57505 57506 57507 57513 57514 57515 57516 57517 57518 57519 57520 57521 57522 57523 57526 57527 57528 57531 57532 57533 57534 57535 57536 57537 57538 57539 57540 57541 57542 57543 57544 57545 57547 57548 57549 57555 57556 57557 57558 57559 57562 57563 57564 57565 57566 57567 57568 57569 57570 57571 57572 57573 57576 57577 57578 57579 57580 57581 57582 57583 57584 57585 57586 57587 57588 57589 57590 57591 57592 57593 57594 57595 57596 57597 57598 57601 57602 57603 57604 57605 57606 57607 57608 57609 57610 57611 57612 57613 57614 57615 57616 57617 57618 57622 57623 57624 57625 57626 57627 57628 57629 57630 57631 57632 57633 57634 57635 57636 57637 57638 57639 57640 57646 57647 57648 57649 57650 57653 57654 ARD-00925 57655 57659 57660 57661 57662 57663 57664 57665 57666 57667 57668 57669 57670 57671 57672 57673 57674 57675 57676 57677 57678 57679 57680 57681 57682 57683 57686 57687 57688 57690 57691 57692 57693 57694 57695 57700 57701 57702 57703 57704 57705 57709 57710 57711 57712 57713 57714 57715 57716 57717 57718 57719 57720 57728 57729 57730 57731 57740 57741 57742 57743 57744 57745 57746 57747 57748 57749 57750 57751 57752 57753 57754 57755 57756 57757 57758 57759 57760 57763 57764 57765 57766 57767 57768 57769 57770 57771 57772 57773 57774 57775 57776 57777 57778 57779 57780 57781 57782 57783 57784 57785 57786 57787 57788 57789 57790 57791 57792 57793 57794 57803 57804 57805 57808 57809 57810 57811 57812 57813 57816 57817 57818 57819 57820 57821 57824 57825 57826 57827 57828 57829 57830 57834 57835 57836 57838 57839 57840 57845 57846 57847 57849 57850 57851 57852 57853 57854 57855 57856 57857 57858 57859 57860 57861 57862 57863 57864 57865 57866 57867 57868 57869 57872 57873 57874 57875 57876 57877 57878 57879 57880 57881 57882 57883 57884 57890 57891 57892 57895 57896 57897 57898 57899 57900 57901 57904 57905 57906 57907 57908 57909 57910 57911 57912 57913 57914 57915 57916 57917 57918 57919 57920 57921 57923 57924 57925 57926 57927 57928 57929 57930 57931 57932 57933 57934 57935 57936 57937 57938 57939 57940 57941 57942 57943 57944 57945 57946 57947 57948 57949 57950 57951 57952 57953 57954 57955 57956 57957 57958 57959 57960 57961 57962 57963 57964 57965 57966 57967 57968 57969 57970 57971 57972 57973 57974 57975 57976 57977 57978 57985 57986 57987 57988 57989 57990 57991 57992 57993 57994 57995 57996 57997 58004 58005 58006 58007 58008 58009 58010 58014 58015 58016 58020 58021 58022 58026 58027 58028 58032 58033 58034 58038 58039 58040 58041 58042 58043 58044 58045 58046 58050 58051 58052 58053 58054 58055 58056 58057 58058 58059 58060 58061 58062 58063 58064 58068 58069 58070 58071 58072 58073 58074 58075 58076 58083 58084 58085 58086 58087 58088 58089 58090 58091 58092 58093 58094 58095 58096 58097 58098 58099 58100 58101 58102 58103 58110 58111 58112 58116 58117 58118 58122 58123 58124 58125 58126 58127 58128 58129 58130 58131 58132 58133 58134 58135 58136 58137 58138 58139 58140 58141 58142 58143 58147 58148 58149 58150 58151 58152 58153 58154 58155 58156 58157 58158 58159 58160 58161 58165 58166 58167 58171 58172 58173 58174 58175 58176 58177 58178 58179 58182 58183 58184 58197 58198 58199 58215 58216 58217 58219 58220 58221 58223 58224 58225 58227 58228 58233 58234 58235 58236 58237 58238 58247 58248 58249 58250 58251 58252 58253 58254 58255 58256 58257 58258 58259 58260 58261 58272 58273 58274 58275 58276 58277 58278 58285 58286 58287 58288 58289 58290 58291 58292 58293 58294 58295 58296 58297 58298 58309 58310 58321 58322 58323 58324 58325 58326 58327 58331 58332 58333 58334 58335 58336 58337 58338 58339 58340 58341 58342 58343 58344 58345 58346 58347 58348 58349 58350 58359 58360 58361 58362 58363 58364 58365 58366 58367 58368 58369 58370 58371 58372 58373 58374 58375 58376 58377 58378 58379 58380 58381 58382 58383 58384 58385 58390 58391 58392 58393 58398 58399 58400 58401 58402 58403 58404 58405 58409 58410 58411 58412 58417 58418 58419 58420 58421 58422 58423 58424 58425 58426 58427 58428 58432 58433 58434 58435 58440 58441 58442 58443 58444 58445 58446 58447 58448 58449 58450 58451 58452 58453 58454 58455 58456 58457 58462 58463 58464 58465 58466 58467 58468 58469 58470 58471 58472 58473 58474 58475 58476 58477 58478 58479 58480 58481 58482 58483 58484 58485 58486 58487 58488 58489 58490 58491 58492 58493 58494 58495 58496 58497 58498 58499 58500 58501 58502 58503 58504 58505 58506 58507 58508 58509 58510 58511 58512 58513 58514 58515 58516 58517 58522 58523 58524 58525 58526 58527 58528 58529 58530 58531 58532 58533 58534 58535 58536 58537 58538 58539 58540 58541 58542 58543 58548 58549 58550 58551 58552 58553 58554 58555 58556 58557 58558 58559 58560 58561 58562 58563 58564 58565 58566 58567 58568 58569 58570 58571 58572 58573 58574 58575 58576 58577 58580 58581 58582 58583 58586 58587 58589 58590 58591 58592 58593 58594 58595 58596 58597 58598 58599 58600 58601 58602 58603 58604 58605 58606 58607 58608 58609 58610 58611 58612 58613 58614 58615 58616 58617 58618 58619 58620 58621 58622 58623 58624 58625 58626 58627 58628 58629 58630 58631 58632 58633 58634 58635 58636 58637 58638 58639 58640 58647 58648 58649 58650 58651 58652 58653 58654 58655 58656 58657 58658 58659 58660 58662 58663 58664 58665 58666 58667 58668 58669 58670 58671 58672 ARD-00925 58673 58674 58675 58676 58677 58678 58679 58680 58681 58682 58683 58684 58685 58686 58687 58688 58689 58690 58691 58692 58693 58694 58695 58696 58697 58698 58699 58700 58710 58711 58715 58716 58717 58718 58719 58722 58723 58724 58725 58726 58727 58728 58748 58749 58750 58751 58753 58754 58755 58767 58788 58789 58790 58791 58792 58793 58794 58795 58796 58797 58802 58803 58804 58805 58809 58810 58811 58812 58813 58814 58815 58818 58819 58820 58821 58822 58823 58824 58827 58828 58829 58830 58831 58832 58833 58834 58835 58836 58837 58838 58839 58840 58847 58848 58849 58850 58851 58852 58856 58857 58858 58863 58874 58875 58876 58877 58911 58912 58913 58914 58915 58916 58917 58922 58923 58924 58925 58926 58927 58928 58929 58930 58931 58932 58933 58934 58935 58936 58937 58938 58939 58942 58943 58944 58945 58946 58947 58948 58949 58950 58951 58952 58953 58954 58955 58956 58957 58958 58961 58962 58963 58964 58965 58966 58967 58968 58969 58971 58972 58973 58974 58975 58976 58977 58978 58979 58980 58981 58982 58983 58984 58985 58986 58987 58988 58989 58990 58991 58992 58993 58994 58995 58996 58997 58998 58999 59000 59001 59002 59003 59004 59005 59006 59007 59011 59012 59013 59014 59015 59016 59017 59019 59020 59021 59022 59023 59024 59025 59026 59027 59028 59029 59030 59031 59032 59033 59034 59035 59036 59037 59038 59039 59040 59041 59042 59043 59044 59045 59046 59047 59048 59049 59050 59051 59052 59053 59054 59055 59056 59057 59058 59059 59060 59061 59062 59063 59064 59065 59066 59067 59068 59069 59070 59071 59072 59073 59074 59075 59076 59077 59078 59079 59080 59081 59082 59083 59084 59085 59086 59087 59088 59089 59090 59091 59092 59093 59094 59095 59101 59102 59103 59104 59105 59106 59107 59108 59109 59110 59111 59112 59113 59116 59117 59118 59119 59120 59121 59125 59126 59127 59128 59129 59130 59131 59132 59133 59134 59135 59136 59137 59138 59139 59140 59141 59142 59143 59144 59145 59146 59147 59148 59149 59150 59151 59152 59153 59154 59155 59156 59157 59158 59159 59160 59161 59162 59163 59164 59165 59166 59167 59168 59171 59172 59173 59174 59175 59176 59177 59178 59181 59182 59183 59186 59187 59188 59189 59190 59191 59192 59193 59194 59195 59196 59197 59198 59199 59200 59201 59202 59203 59204 59205 59206 59207 59208 59209 59210 59211 59212 59213 59214 59215 59218 59219 59220 59221 59222 59223 59224 59225 59226 59227 59228 59229 59230 59231 59232 59233 59234 59235 59238 59239 59240 59241 59242 59243 59245 59246 59247 59248 59249 59250 59251 59252 59253 59254 59255 59256 59257 59258 59259 59260 59261 59262 59263 59264 59265 59266 59267 59268 59269 59270 59271 59272 59273 59274 59275 59276 59277 59278 59279 59280 59281 59282 59283 59284 59285 59286 59287 59288 59289 59290 59291 59292 59293 59294 59295 59296 59297 59298 59299 59302 59303 59304 59305 59306 59307 59308 59309 59310 59311 59312 59313 59314 59315 59316 59317 59318 59319 59320 59321 59322 59323 59324 59325 59326 59327 59328 59329 59330 59331 59332 59337 59338 59339 59340 59341 59342 59343 59346 59347 59348 59349 59350 59351 59352 59353 59354 59355 59356 59357 59358 59359 59360 59361 59362 59363 59364 59365 59366 59369 59370 59371 59372 59373 59374 59375 59376 59377 59378 59379 59380 59381 59382 59383 59384 59385 59386 59393 59394 59395 59396 59397 59398 59399 59402 59403 59404 59405 59406 59407 59408 59409 59410 59411 59412 59413 59414 59415 59416 59417 59418 59419 59420 59421 59422 59423 59424 59425 59426 59427 59428 59429 59430 59431 59432 59433 59434 59435 59439 59440 59441 59442 59443 59444 59445 59446 59447 59448 59449 59450 59451 59452 59453 59454 59455 59456 59457 59458 59459 59460 59461 59462 59463 59464 59465 59466 59467 59468 59469 59470 59471 59472 59473 59474 59475 59476 59477 59478 59479 59480 59481 59482 59483 59484 59485 59486 59487 59488 59489 59490 59491 59492 59493 59494 59495 59496 59497 59498 59499 59500 59501 59502 59503 59504 59505 59506 59507 59508 59509 59510 59511 59512 59513 59514 59515 59516 59517 59518 59519 59520 59521 59522 59523 59524 59525 59526 59527 59528 59529 59530 59531 59532 59533 59534 59535 59536 59537 59538 59539 59540 59541 59542 59543 59544 59545 59546 59547 59548 59549 59550 59551 59552 59553 59554 59555 59556 59557 59558 59559 59560 59561 59562 59563 59564 59565 59566 59567 59568 59569 59570 59571 59572 59573 59574 59575 59576 59577 59578 59579 59580 59581 59582 59583 59584 59585 59586 59587 59588 59589 59590 59591 59592 59593 59594 59595 59596 59597 59598 59599 59600 59601 59602 59603 59604 59605 59606 59607 59608 59609 59610 59611 59612 59613 59614 59615 ARD-00925 59616 59617 59618 59619 59620 59621 59622 59623 59624 59625 59626 59627 59628 59629 59630 59631 59632 59633 59634 59635 59636 59637 59638 59639 59640 59641 59642 59643 59644 59645 59646 59647 59648 59649 59650 59651 59652 59653 59654 59655 59656 59657 59658 59659 59660 59661 59662 59663 59664 59665 59666 59667 59668 59669 59670 59671 59672 59673 59674 59675 59676 59677 59678 59679 59680 59681 59682 59683 59684 59685 59686 59687 59688 59689 59690 59691 59692 59693 59694 59695 59696 59697 59698 59699 59700 59701 59702 59703 59704 59705 59706 59707 59708 59709 59710 59711 59712 59713 59714 59715 59716 59717 59718 59719 59720 59721 59722 59723 59724 59725 59726 59727 59728 59729 59730 59731 59732 59733 59734 59735 59736 59737 59738 59739 59740 59741 59742 59743 59744 59745 59746 59747 59748 59749 59750 59751 59752 59753 59754 59755 59756 59757 59758 59759 59760 59761 59762 59763 59764 59765 59766 59767 59768 59769 59770 59771 59772 59773 59774 59775 59776 59777 59778 59779 59780 59781 59782 59783 59784 59785 59786 59787 59788 59789 59790 59791 59792 59793 59794 59795 59796 59797 59798 59799 59800 59801 59802 59803 59804 59805 59806 59807 59808 59809 59810 59811 59812 59814 59815 59816 59817 59818 59819 59820 59821 59822 59823 59824 59825 59826 59827 59828 59829 59830 59831 59832 59833 59834 59835 59836 59837 59838 59839 59840 59841 59848 59849 59850 59851 59852 59853 59854 59855 59856 59857 59858 59859 59860 59861 59862 59863 59864 59865 59866 59867 59868 59869 59870 59871 59872 59873 59874 59875 59876 59877 59878 59879 59880 59881 59882 59883 59884 59885 59886 59887 59888 59889 59890 59891 59892 59893 59894 59895 59896 59897 59898 59899 59900 59901 59902 59903 59904 59905 59906 59907 59908 59911 59912 59913 59914 59915 59916 59917 59918 59919 59920 59921 59922 59923 59924 59925 59926 59927 59928 59929 59930 59931 59932 59933 59934 59935 59936 59937 59938 59939 59940 59941 59942 59943 59944 59945 59946 59947 59948 59949 59950 59951 59952 59953 59954 59955 59956 59957 59961 59962 59963 59964 59965 59966 59967 59968 59969 59970 59971 59972 59973 59974 59975 59976 59977 59978 59979 59980 59981 59982 59983 59984 59985 59986 59987 59988 59989 59990 59991 59992 59993 59994 59995 59996 59997 59998 59999 60000 60001 60002 60003 60004 60005 60006 60007 60008 60009 60010 60011 60012 60013 60014 60015 60016 60017 60018 60019 60020 60021 60022 60023 60024 60025 60026 60027 60028 60029 60030 60031 60032 60033 60034 60035 60036 60037 60038 60039 60040 60041 60042 60043 60044 60045 60046 60047 60048 60049 60050 60051 60052 60053 60054 60055 60056 60057 60058 60059 60060 60061 60062 60063 60064 60065 60066 60067 60068 60069 60070 60071 60072 60073 60074 60075 60076 60077 60078 60079 60080 60081 60086 60087 60088 60089 60090 60091 60092 60093 60094 60095 60096 60097 60098 60099 60100 60101 60102 60103 60104 60105 60106 60107 60108 60109 60110 60111 60112 60113 60114 60115 60116 60117 60118 60119 60120 60121 60122 60123 60124 60125 60126 60127 60128 60129 60130 60131 60132 60133 60134 60135 60136 60137 60138 60139 60140 60141 60142 60143 60144 60145 60146 60147 60148 60149 60150 60151 60152 60153 60154 60155 60156 60157 60158 60159 60160 60161 60162 60163 60164 60165 60166 60167 60168 60169 60170 60171 60172 60173 60174 60175 60176 60177 60178 60179 60180 60181 60182 60183 60184 60185 60186 60187 60188 60189 60190 60191 60192 60193 60194 60195 60196 60197 60198 60199 60200 60201 60202 60203 60204 60205 60206 60207 60208 60209 60210 60211 60212 60213 60214 60215 60216 60217 60218 60219 60220 60221 60223 60224 60225 60226 60227 60228 60229 60230 60231 60232 60233 60234 60235 60236 60237 60238 60239 60240 60241 60242 60243 60244 60245 60246 60247 60248 60249 60250 60251 60252 60253 60254 60255 60256 60257 60258 60259 60260 60261 60262 60263 60264 60265 60266 60267 60269 60270 60271 60272 60273 60274 60275 60276 60277 60278 60279 60280 60281 60282 60283 60284 60285 60286 60287 60288 60289 60290 60291 60292 60293 60298 60299 60300 60301 60302 60303 60304 60305 60306 60307 60308 60309 60310 60311 60312 60313 60314 60315 60316 60317 60318 60319 60320 60321 60322 60323 60324 60325 60326 60327 60328 60329 60330 60333 60334 60335 60336 60340 60341 60342 60343 60344 60345 60346 60347 60348 60349 60350 60351 60352 60353 60354 60355 60358 60359 60360 60365 60366 60367 60368 60369 60370 60371 60372 60373 60374 60375 60376 60377 60378 60379 60380 60381 60382 60386 60387 60388 60392 60393 60394 60395 60396 60397 60398 60399 60400 60401 60402 60403 60404 60405 60406 60407 60408 60409 60410 ARD-00925 60411 60412 60413 60418 60419 60420 60421 60422 60423 60424 60425 60426 60427 60428 60429 60430 60431 60432 60433 60434 60435 60436 60437 60438 60439 60440 60441 60442 60443 60444 60447 60448 60449 60450 60451 60452 60453 60454 60455 60456 60457 60458 60459 60460 60469 60470 60471 60472 60473 60474 60475 60480 60481 60482 60483 60484 60485 60486 60487 60488 60489 60490 60492 60493 60494 60495 60496 60497 60498 60499 60500 60501 60502 60503 60504 60505 60506 60513 60514 60515 60516 60517 60518 60519 60520 60521 60522 60523 60524 60525 60526 60527 60528 60529 60530 60531 60532 60533 60534 60535 60536 60537 60538 60539 60540 60541 60542 60544 60545 60546 60547 60548 60549 60550 60551 60552 60553 60554 60555 60556 60557 60558 60559 60560 60561 60562 60563 60564 60565 60566 60567 60568 60570 60571 60572 60573 60574 60575 60576 60577 60578 60579 60580 60581 60582 60583 60584 60585 60586 60587 60588 60589 60590 60591 60592 60593 60594 60595 60596 60597 60598 60603 60604 60605 60606 60607 60608 60609 60619 60620 60621 60622 60623 60638 60639 60640 60660 60661 60665 60666 60667 60669 60670 60680 60681 60682 60683 60684 60686 60687 60688 60689 60696 60699 60700 60702 60703 60704 60705 60706 60707 60708 60709 60710 60711 60712 60713 60714 60715 60716 60720 60721 60722 60723 60724 60725 60726 60730 60731 60732 60733 60734 60735 60736 60737 60738 60739 60740 60741 60742 60743 60744 60745 60746 60750 60752 60753 60756 60757 60758 60759 60760 60761 60762 60767 60768 60769 60770 60771 60772 60780 60781 60782 60783 60793 60794 60795 60796 60797 60798 60799 60800 60801 60802 60803 60804 60805 60806 60807 60808 60809 60810 60811 60812 60813 60816 60817 60818 60819 60820 60821 60822 60823 60824 60825 60826 60827 60828 60829 60830 60831 60832 60833 60834 60835 60836 60837 60838 60839 60840 60841 60842 60846 60847 60848 60849 60850 60851 60852 60853 60854 60855 60856 60857 60858 60859 60860 60861 60862 60863 60864 60865 60866 60867 60868 60869 60870 60871 60872 60873 60877 60878 60879 60880 60881 60882 60883 60884 60885 60886 60887 60888 60889 60890 60891 60892 60893 60899 60900 60901 60902 60905 60906 60907 60910 60911 60912 60913 60914 60915 60916 60948 60949 60950 60951 60961 60962 60963 60964 60965 60969 60970 60991 60992 60993 60995 60996 61003 61004 61005 61007 61008 61009 61010 61011 61012 61013 61014 61015 61017 61018 61019 61020 61021 61022 61024 61025 61026 61032 61033 61034 61035 61036 61037 61038 61039 61040 61041 61042 61043 61044 61045 61046 61047 61048 61049 61050 61051 61052 61053 61054 61055 61056 61057 61058 61059 61060 61061 61062 61063 61064 61065 61066 61067 61068 61069 61070 61071 61072 61073 61074 61075 61076 61077 61078 61079 61080 61081 61082 61084 61085 61086 61087 61088 61089 61090 61091 61092 61100 61101 61102 61103 61104 61105 61107 61108 61109 61110 61111 61122 61123 61124 61125 61132 61133 61134 61135 61145 61146 61147 61148 61149 61150 61153 61154 61155 61160 61161 61163 61164 61165 61166 61172 61173 61174 61178 61179 61180 61189 61198 61199 61200 61218 61219 61220 61244 61245 61246 61247 61248 61249 61260 61261 61262 61271 61272 61273 61274 61275 61277 61278 61281 61282 61283 61290 61291 61292 61293 61294 61297 61298 61299 61300 61301 61302 61303 61304 61305 61306 61307 61308 61309 61310 61311 61312 61313 61314 61318 61319 61320 61321 61322 61323 61324 61325 61326 61327 61329 61330 61332 61333 61334 61335 61336 61337 61338 61339 61340 61341 61342 61343 61344 61345 61346 61347 61348 61349 61350 61351 61352 61353 61354 61355 61356 61357 61358 61359 61360 61361 61362 61363 61364 61365 61366 61367 61368 61369 61370 61371 61372 61373 61376 61377 61381 61382 61405 61406 61407 61408 61441 61442 61443 61450 61451 61452 61453 61454 61455 61457 61458 61459 61460 61461 61463 61465 61466 61467 61468 61469 61470 61471 61472 61473 61481 61482 61483 61484 61485 61488 61489 61490 61491 61495 61496 61497 61498 61502 61503 61504 61505 61506 61507 61508 61509 61510 61512 61513 61514 61515 61516 61517 61518 61519 61520 61521 61522 61523 61524 61525 61526 61527 61529 61530 61535 61536 61537 61539 61540 61541 61542 61543 61544 61545 61546 61547 61548 61549 61550 61551 61552 61553 61554 61555 61556 61557 61558 61559 61560 61561 61562 61563 61564 61565 61566 61567 61568 61569 61570 61571 61572 61573 61574 61575 61576 61577 61578 61579 61580 61581 61582 61583 61584 61585 61586 61587 61588 61589 61591 61592 61593 61594 61595 61596 61597 61598 61599 61602 61603 61605 61606 61607 61609 61610 61611 61612 61613 61614 61615 61616 61617 61618 61619 61620 61621 61624 61625 ARD-00925 61626 61627 61628 61629 61631 61632 61634 61635 61636 61637 61638 61639 61640 61641 61642 61643 61644 61646 61647 61648 61651 61652 61653 61654 61655 61660 61661 61662 61666 61667 61668 61669 61670 61672 61673 61674 61675 61676 61677 61678 61683 61684 61685 61686 61687 61688 61689 61691 61692 61693 61694 61703 61704 61705 61706 61707 61708 61718 61719 61720 61721 61722 61723 61724 61725 61726 61727 61728 61729 61730 61731 61732 61733 61734 61739 61740 61744 61745 61748 61749 61758 61759 61765 61766 61767 61768 61769 61770 61774 61775 61782 61783 61784 61785 61786 61787 61788 61789 61791 61792 61794 61795 61797 61798 61799 61803 61804 61805 61807 61808 61809 61810 61814 61815 61816 61817 61823 61824 61825 61826 61827 61828 61834 61835 61844 61845 61847 61848 61849 61850 61852 61853 61858 61859 61860 61861 61867 61868 61869 61870 61872 61873 61875 61876 61877 61878 61879 61880 61881 61884 61885 61886 61887 61889 61890 61892 61893 61894 61899 61900 61903 61904 61905 61906 61907 61908 61916 61917 61921 61922 61923 61932 61933 61937 61938 61942 61943 61946 61947 61948 61949 61950 61951 61952 61953 61954 61955 61957 61958 61960 61961 61963 61964 61965 61966 61967 61968 61972 61973 61974 61975 61977 61978 61980 61981 61984 61985 61986 61987 61988 61991 61992 61993 61995 61996 62011 62012 62013 62020 62021 62023 62024 62025 62026 62027 62028 62029 62030 62031 62032 62033 62034 62035 62036 62037 62038 62039 62040 62041 62042 62046 62047 62048 62062 62069 62070 62071 62075 62101 62102 62114 62115 62116 62118 62119 62120 62121 62123 62124 62125 62126 62127 62130 62131 62132 62138 62139 62140 62141 62142 62143 62149 62150 62151 62152 62153 62154 62158 62159 62160 62161 62162 62163 62164 62170 62171 62172 62173 62174 62177 62178 62179 62180 62181 62182 62184 62185 62186 62187 62188 62194 62195 62198 62199 62200 62201 62205 62206 62207 62225 62226 62238 62239 62244 62245 62246 62247 62248 62249 62250 62251 62253 62254 62264 62266 62267 62268 62269 62271 62272 62273 62274 62276 62277 62278 62290 62291 62296 62297 62304 62305 62306 62307 62309 62310 62312 62313 62314 62315 62316 62317 62319 62320 62321 62322 62323 62324 62328 62329 62330 62331 62346 62347 62348 62357 62363 62364 62365 62366 62371 62372 62373 62374 62375 62376 62377 62378 62379 62380 62381 62382 62383 62387 62388 62397 62398 62399 62400 62401 62402 62403 62404 62416 62417 62418 62419 62423 62424 62425 62426 62427 62428 62429 62430 62431 62432 62435 62455 62456 62457 62458 62459 62460 62461 62462 62466 62476 62477 62478 62479 62480 62504 62505 62506 62507 62508 62515 62516 62517 62530 62531 62532 62533 62534 62543 62544 62545 62546 62560 62561 62562 62563 62564 62568 62569 62570 62580 62581 62582 62592 62593 62594 62595 62596 62597 62598 62599 62600 62601 62602 62603 62604 62605 62606 62612 62613 62618 62619 62623 62629 62634 62635 62636 62637 62638 62639 62640 62644 62653 62654 62655 62656 62657 62658 62659 62666 62667 62668 62669 62670 62671 62672 62678 62679 62680 62681 62682 62683 62697 62698 62699 62700 62705 62706 62707 62708 62709 62712 62713 62738 62739 62740 62746 62747 62748 62749 62762 62765 62766 62767 62768 62771 62772 62773 62774 62794 62795 62799 62820 62821 62822 62827 62828 62829 62835 62836 62837 62861 62862 62863 62864 62880 62881 62882 62904 62908 62909 62910 62913 62914 62915 62929 62931 62932 62935 62936 62943 62949 62950 62951 62953 62954 62955 62958 62959 62960 62961 62965 62967 62968 62969 62971 62972 62975 62976 62977 62978 62979 62980 62981 62982 62986 62987 62988 62989 62990 62996 62997 62998 62999 63000 63001 63002 63003 63004 63005 63006 63007 63008 63018 63025 63026 63028 63029 63035 63036 63043 63044 63045 63049 63050 63051 63052 63053 63058 63059 63070 63071 63072 63073 63085 63086 63095 63096 63097 63113 63114 63115 63117 63118 63119 63129 63130 63131 63132 63133 63140 63141 63142 63143 63144 63145 63154 63155 63156 63157 63158 63159 63160 63164 63165 63166 63176 63177 63178 63181 63182 63183 63184 63185 63186 63187 63188 63189 63190 63191 63192 63193 63194 63195 63196 63197 63199 63200 63201 63208 63209 63210 63216 63217 63218 63219 63220 63221 63222 63223 63224 63228 63229 63230 63231 63232 63245 63246 63247 63248 63249 63250 63251 63252 63253 63254 63255 63256 63260 63261 63262 63263 63264 63265 63271 63272 63273 63274 63275 63276 63285 63286 63287 63294 63295 63296 63302 63303 63304 63310 63324 63325 63326 63327 63328 63329 63330 63331 63332 63360 63361 63362 63404 63405 63406 63407 63408 63409 63410 63419 63427 63428 63429 63430 63434 63435 63436 63437 63438 63439 ARD-00925 63440 63441 63446 63447 63458 63459 63460 63461 63462 63463 63464 63465 63466 63468 63469 63470 63472 63473 63474 63482 63484 63485 63494 63495 63498 63500 63501 63504 63505 63521 63522 63523 63535 63536 63537 63538 63542 63543 63544 63559 63560 63563 63566 63567 63568 63569 63570 63571 63572 63573 63574 63575 63576 63577 63587 63588 63589 63599 63600 63601 63602 63603 63609 63610 63611 63612 63613 63614 63615 63616 63617 63618 63619 63620 63621 63622 63623 63624 63628 63633 63639 63640 63641 63642 63643 63645 63646 63647 63648 63649 63650 63651 63652 63653 63658 63659 63665 63666 63668 63671 63672 63673 63674 63675 63676 63677 63685 63686 63688 63689 63690 63695 63696 63697 63707 63708 63709 63715 63716 63717 63718 63719 63720 63721 63722 63723 63725 63726 63731 63732 63733 63734 63736 63737 63738 63739 63740 63741 63742 63743 63746 63747 63749 63750 63751 63752 63753 63754 63755 63756 63758 63759 63760 63762 63764 63765 63766 63767 63768 63769 63770 63771 63772 63773 63774 63776 63777 63778 63780 63781 63786 63788 63789 63790 63791 63792 63793 63794 63795 63796 63797 63799 63801 63802 63804 63805 63806 63807 63808 63809 63810 63811 63813 63814 63823 63824 63825 63826 63827 63828 63829 63830 63831 63833 63834 63835 63836 63841 63843 63847 63848 63849 63850 63852 63853 63854 63855 63856 63857 63858 63865 63869 63870 63871 63872 63877 63878 63879 63880 63881 63882 63883 63884 63885 63886 63887 63888 63889 63890 63891 63892 63893 63894 63895 63896 63897 63898 63900 63901 63902 63904 63905 63906 63912 63913 63921 63922 63923 63946 63947 63948 63952 63953 63954 63963 63964 63969 63970 63971 63978 63979 63980 63987 63988 63989 63990 63991 63992 63993 63994 63995 63996 64001 64002 64003 64005 64006 64007 64008 64009 64010 64011 64012 64013 64014 64015 64016 64017 64018 64019 64020 64021 64022 64023 64024 64025 64026 64027 64028 64029 64030 64031 64032 64033 64034 64035 64036 64037 64038 64039 64040 64043 64044 64045 64046 64051 64052 64053 64054 64055 64056 64057 64058 64059 64068 64069 64071 64072 64073 64074 64075 64076 64077 64079 64080 64081 64082 64083 64084 64085 64086 64087 64088 64089 64090 64092 64093 64094 64095 64096 64097 64098 64099 64100 64102 64103 64104 64105 64106 64107 64108 64109 64110 64111 64112 64113 64114 64115 64116 64117 64118 64119 64120 64121 64122 64123 64124 64126 64127 64128 64129 64130 64131 64132 64133 64134 64135 64136 64137 64138 64139 64140 64143 64144 64145 64146 64147 64148 64151 64152 64169 64170 64172 64188 64189 64190 64191 64192 64193 64199 64209 64210 64211 64213 64214 64215 64221 64222 64223 64224 64225 64226 64227 64232 64244 64245 64246 64249 64256 64260 64266 64269 64271 64275 64276 64281 64282 64283 64284 64285 64286 64287 64291 64292 64300 64301 64302 64303 64311 64312 64318 64319 64320 64334 64335 64344 64345 64346 64348 64360 64361 64362 64364 64366 64377 64378 64384 64399 64416 64417 64418 64422 64426 64430 64431 64432 64433 64434 64439 64440 64442 64444 64445 64446 64447 64448 64449 64455 64456 64457 64461 64462 64463 64470 64472 64476 64477 64478 64479 64481 64485 64486 64487 64492 64493 64494 64496 64497 64498 64499 64500 64501 64502 64503 64504 64505 64507 64509 64510 64512 64518 64519 64523 64524 64525 64526 64527 64530 64531 64532 64533 64534 64538 64539 64540 64541 64542 64543 64544 64546 64547 64548 64549 64550 64551 64552 64553 64554 64555 64556 64557 64560 64561 64562 64567 64568 64571 64572 64578 64579 64580 64581 64582 64584 64585 64586 64587 64588 64601 64602 64603 64614 64615 64616 64623 64624 64625 64638 64639 64640 64641 64649 64650 64657 64658 64659 64673 64674 64675 64680 64681 64686 64689 64692 64694 64695 64696 64697 64698 64702 64703 64704 64705 64706 64707 64708 64709 64710 64711 64714 64721 64722 64725 64726 64727 64728 64730 64735 64746 64747 64757 64758 64759 64761 64767 64781 64782 64788 64789 64790 64791 64792 64794 64795 64796 64797 64807 64808 64809 64810 64811 64812 64813 64814 64815 64816 64818 64819 64820 64821 64826 64827 64828 64830 64834 64835 64836 64837 64838 64839 64840 64841 64842 64843 64844 64845 64846 64847 64848 64849 64850 64851 64855 64856 64857 64858 64859 64860 64861 64862 64863 64864 64865 64869 64870 64871 64872 64873 64874 64875 64876 64877 64878 64879 64880 64881 64882 64883 64886 64887 64888 64889 64890 64891 64892 64893 64894 64895 64896 64897 64898 64899 64900 64904 64905 64906 64907 64908 64909 64910 64911 64914 64915 64916 64917 64918 64919 64922 64923 64924 64925 64926 64927 64928 64931 64932 64933 64934 64935 64939 64940 64941 64942 64943 64944 64945 ARD-00925 64946 64947 64948 64949 64950 64951 64960 64961 64962 64963 64964 64965 64966 64967 64968 64971 64976 64977 64978 64983 64984 64986 64987 64989 64994 64995 64996 64997 65001 65005 65006 65007 65018 65019 65023 65027 65028 65029 65030 65031 65032 65033 65064 65065 65066 65067 65075 65082 65083 65084 65087 65088 65089 65090 65091 65092 65093 65094 65095 65096 65097 65098 65099 65101 65102 65103 65107 65113 65114 65115 65116 65117 65118 65119 65126 65128 65129 65130 65153 65160 65161 65167 65168 65169 65182 65183 65189 65210 65211 65212 65213 65222 65223 65224 65230 65235 65236 65243 65244 65245 65246 65247 65248 65249 65256 65257 65258 65262 65263 65264 65268 65269 65270 65271 65274 65275 65276 65291 65292 65293 65299 65300 65304 65306 65311 65319 65321 65322 65332 65333 65335 65369 65370 65371 65373 65375 65376 65392 65414 65417 65428 65441 65452 65464 65473 65474 65477 65478 65488 65489 65494 65495 65496 65497 65501 65502 65512 65513 65520 65521 65522 65535 65536 65547 65548 65552 65553 65554 65555 65560 65561 65562 65563 65568 65569 65570 65572 65573 65574 65575 65578 65579 65583 65584 65587 65588 65590 65593 65594 65595 65596 65597 65598 65599 65600 65601 65602 65603 65604 65605 65606 65608 65609 65610 65611 65614 65615 65616 65617 65619 65620 65621 65622 65623 65624 65625 65626 65630 65631 65632 65633 65640 65641 65644 65645 65659 65660 65665 65666 65667 65668 65669 65670 65671 65672 65673 65674 65675 65676 65677 65678 65679 65682 65683 65685 65686 65687 65688 65689 65690 65693 65694 65695 65696 65699 65700 65701 65702 65703 65704 65705 65706 65707 65708 65709 65712 65713 65714 65715 65717 65718 65725 65726 65727 65728 65729 65730 65731 65733 65734 65737 65739 65741 65744 65745 65746 65747 65748 65749 65750 65751 65752 65753 65756 65757 65758 65761 65762 65763 65765 65771 65773 65774 65777 65778 65779 65780 65781 65782 65783 65785 65803 65804 65805 65806 65819 65820 65824 65825 65826 65838 65839 65840 65851 65852 65853 65854 65855 65863 65864 65866 65867 65868 65869 65870 65871 65872 65873 65876 65877 65878 65879 65881 65882 65887 65893 65894 65896 65897 65898 65899 65900 65901 65902 65903 65904 65905 65906 65907 65908 65909 65910 65911 65912 65916 65924 65925 65926 65928 65929 65933 65934 65937 65940 65941 65942 65943 65947 65959 65960 65961 65967 65969 66001 66002 66013 66014 66015 66016 66022 66023 66024 66025 66026 66029 66030 66031 66032 66035 66036 66039 66040 66041 66042 66045 66046 66047 66048 66053 66054 66063 66064 66065 66067 66068 66069 66070 66071 66072 66073 66074 66080 66081 66082 66085 66089 66090 66099 66100 66101 66102 66115 66116 66120 66121 66138 66139 66142 66143 66146 66147 66153 66154 66167 66168 66175 66176 66178 66179 66180 66181 66186 66187 66189 66195 66196 66197 66198 66199 66209 66210 66213 66214 66215 66216 66217 66218 66219 66220 66221 66222 66223 66224 66234 66235 66241 66242 66244 66245 66248 66249 66250 66251 66252 66253 66254 66255 66256 66257 66258 66259 66265 66266 66268 66269 66270 66271 66272 66275 66276 66277 66278 66281 66282 66283 66287 66289 66290 66298 66299 66310 66314 66332 66370 66371 66389 66390 66391 66397 66398 66399 66401 66402 66405 66406 66407 66408 66409 66413 66426 66446 66448 66449 66450 66463 66464 66465 66473 66476 66480 66490 66491 66492 66493 66500 66501 66503 66504 66510 66511 66512 66514 66515 66518 66525 66531 66537 66539 66540 66545 66546 66548 66549 66551 66552 66553 66554 66558 66572 66573 66577 66578 66580 66581 66591 66611 66622 66623 66629 66630 66632 66633 66637 66638 66640 66641 66643 66644 66645 66648 66649 66650 66651 66653 66654 66660 66661 66662 66663 66664 66666 66667 66668 66669 66684 66685 66689 66690 66692 66693 66701 66708 66709 66718 66719 66736 66737 66744 66745 66746 66747 66753 66754 66758 66759 66762 66763 66766 66767 66768 66769 66770 66786 66787 66789 66790 66791 66794 66795 66796 66797 66798 66800 66801 66802 66803 66804 66805 66806 66807 66810 66811 66815 66816 66822 66823 66824 66825 66826 66827 66828 66829 66830 66831 66832 66833 66834 66835 66836 66843 66844 66845 66846 66847 66848 66852 66853 66857 66858 66860 66861 66862 66863 66864 66865 66866 66869 66870 66873 66874 66875 66876 66877 66878 66889 66890 66891 66901 66904 66905 66906 66910 66911 66914 66915 66916 66917 66918 66921 66928 66929 66931 66932 66933 66937 66938 66940 66944 66945 66950 66951 66960 66969 66970 66971 66973 66977 66981 66982 66985 66986 66987 66988 66989 66990 66999 67000 67001 67007 67008 67009 67010 67011 67012 67013 67014 67015 67016 67017 67020 67021 67022 67026 67027 67028 67039 ARD-00925 67040 67041 67050 67051 67052 67053 67054 67055 67057 67058 67064 67065 67066 67067 67068 67069 67071 67072 67073 67074 67075 67076 67077 67078 67079 67080 67081 67082 67083 67084 67085 67086 67087 67088 67094 67095 67096 67097 67100 67101 67102 67103 67104 67105 67107 67108 67109 67113 67114 67115 67118 67119 67120 67123 67124 67125 67126 67127 67128 67129 67130 67131 67132 67133 67134 67135 67136 67137 67139 67140 67141 67148 67149 67151 67152 67157 67158 67163 67164 67171 67175 67176 67177 67189 67190 67208 67227 67228 67232 67233 67250 67255 67256 67259 67275 67276 67277 67278 67279 67280 67287 67288 67289 67291 67292 67293 67294 67295 67297 67298 67299 67300 67301 67303 67304 67308 67309 67310 67311 67312 67313 67314 67315 67316 67321 67322 67323 67324 67328 67329 67330 67331 67333 67334 67335 67336 67337 67338 67339 67341 67342 67343 67345 67346 67347 67348 67349 67350 67351 67352 67353 67354 67355 67356 67357 67358 67360 67361 67362 67363 67364 67367 67368 67369 67373 67374 67375 67376 67377 67378 67379 67380 67381 67383 67384 67385 67386 67387 67388 67389 67390 67391 67394 67395 67396 67401 67402 67403 67407 67408 67409 67411 67412 67413 67414 67415 67416 67418 67419 67420 67422 67423 67424 67425 67426 67427 67428 67429 67430 67432 67433 67434 67437 67438 67439 67440 67441 67442 67448 67449 67450 67452 67453 67454 67471 67475 67476 67487 67488 67496 67497 67498 67499 67503 67504 67505 67509 67510 67511 67549 67556 67557 67558 67573 67576 67577 67579 67591 67593 67594 67595 67596 67599 67600 67602 67610 67612 67613 67623 67624 67625 67630 67631 67632 67640 67641 67643 67644 67645 67647 67648 67649 67652 67653 67654 67656 67657 67658 67659 67661 67662 67664 67665 67668 67671 67672 67677 67678 67685 67686 67687 67688 67689 67690 67691 67693 67696 67697 67698 67699 67701 67702 67703 67704 67710 67713 67714 67715 67721 67722 67725 67726 67727 67728 67730 67731 67744 67745 67746 67747 67748 67749 67752 67753 67759 67760 67762 67763 67765 67766 67767 67768 67769 67770 67772 67773 67777 67778 67781 67782 67785 67786 67787 67788 67791 67792 67793 67794 67797 67798 67800 67801 67819 67820 67828 67829 67834 67835 67847 67848 67849 67864 67865 67868 67869 67870 67871 67872 67873 67874 67875 67876 67877 67881 67882 67883 67888 67889 67890 67891 67892 67893 67894 67895 67896 67897 67900 67901 67902 67903 67904 67905 67906 67907 67909 67912 67913 67914 67917 67918 67920 67921 67926 67930 67931 67932 67933 67935 67937 67938 67939 67940 67941 67942 67944 67945 67953 67954 67956 67957 67958 67959 67960 67961 67962 67963 67967 67968 67971 67972 67976 67977 67981 67985 67986 67988 67989 67993 67994 67996 67997 67999 68007 68008 68009 68011 68012 68013 68014 68015 68016 68020 68021 68024 68025 68026 68027 68028 68031 68032 68034 68035 68036 68037 68038 68039 68046 68047 68048 68050 68051 68052 68053 68054 68055 68056 68057 68058 68059 68061 68062 68064 68065 68066 68067 68068 68069 68070 68073 68074 68075 68080 68081 68082 68083 68084 68085 68086 68087 68088 68089 68090 68093 68094 68099 68100 68101 68102 68106 68107 68108 68109 68117 68118 68119 68120 68121 68122 68123 68124 68125 68126 68127 68128 68129 68130 68133 68136 68137 68138 68139 68144 68145 68151 68152 68153 68154 68155 68156 68157 68158 68159 68160 68161 68162 68163 68164 68165 68172 68173 68174 68175 68178 68179 68180 68181 68184 68185 68188 68189 68190 68191 68192 68193 68198 68199 68200 68201 68206 68207 68208 68209 68217 68218 68224 68225 68232 68233 68234 68235 68236 68237 68246 68247 68248 68249 68252 68253 68256 68257 68258 68259 68263 68264 68265 68267 68268 68275 68276 68277 68278 68280 68281 68282 68283 68285 68286 68287 68288 68290 68291 68294 68295 68296 68297 68299 68300 68304 68307 68310 68311 68316 68317 68318 68320 68321 68322 68323 68330 68331 68332 68333 68336 68337 68338 68339 68343 68344 68349 68350 68351 68352 68353 68354 68355 68356 68357 68359 68363 68364 68365 68369 68370 68371 68372 68375 68382 68383 68387 68388 68389 68390 68397 68398 68405 68406 68407 68408 68420 68425 68426 68427 68431 68432 68433 68448 68449 68450 68451 68452 68453 68454 68455 68456 68457 68458 68459 68461 68462 68463 68464 68467 68468 68474 68475 68479 68490 68491 68492 68495 68500 68501 68502 68518 68519 68520 68521 68522 68523 68524 68526 68527 68528 68529 68530 68531 68532 68533 68534 68539 68540 68541 68544 68545 68546 68551 68552 68553 68554 68555 68556 68557 68559 68560 68561 68562 68563 68564 68565 68566 68568 68569 68570 68574 68575 68576 68577 68578 68579 68580 68581 68582 68583 68584 68585 68586 ARD-00925 68587 68588 68589 68590 68591 68596 68597 68598 68599 68600 68601 68605 68606 68607 68608 68609 68610 68612 68613 68614 68615 68616 68617 68618 68619 68620 68621 68622 68623 68624 68625 68626 68627 68630 68631 68638 68639 68640 68641 68651 68666 68667 68678 68679 68693 68694 68710 68711 68724 68725 68727 68756 68773 68774 68778 68779 68780 68794 68795 68803 68810 68811 68829 68830 68831 68837 68838 68839 68842 68844 68845 68849 68850 68858 68863 68864 68865 68866 68867 68870 68872 68875 68876 68877 68879 68888 68889 68898 68899 68904 68919 68923 68924 68927 68928 68929 68936 68938 68939 68942 68947 68948 68949 68950 68951 68953 68954 68955 68957 68958 68959 68960 68961 68962 68963 68964 68965 68966 68969 68972 68973 68974 68977 68978 68980 68981 68982 68983 68985 68986 68990 68991 68994 68995 68996 68997 68998 68999 69000 69001 69002 69003 69004 69007 69008 69009 69010 69011 69015 69017 69021 69030 69031 69033 69034 69035 69036 69037 69040 69041 69043 69046 69048 69053 69058 69064 69073 69078 69079 69080 69085 69091 69092 69095 69100 69101 69102 69103 69107 69108 69109 69110 69111 69117 69120 69121 69125 69130 69131 69132 69134 69135 69136 69141 69142 69152 69184 69185 69189 69190 69198 69206 69208 69218 69219 69220 69221 69222 69225 69260 69261 69274 69283 69285 69286 69287 69288 69294 69295 69304 69305 69308 69309 69311 69312 69313 69314 69320 69321 69322 69325 69326 69334 69349 69352 69353 69362 69371 69375 69376 69379 69380 69381 69383 69384 69400 69424 69430 69436 69437 69440 69441 69450 69451 69452 69453 69454 69456 69457 69458 69459 69460 69466 69467 69470 69471 69472 69486 69487 69488 69490 69499 69507 69510 69511 69515 69516 69522 69528 69529 69532 69533 69537 69541 69542 69544 69545 69550 69559 69561 69562 69565 69567 69583 69584 69594 69601 69610 69615 69621 69629 69633 69634 69637 69642 69644 69650 69652 69654 69655 69656 69658 69667 69668 69678 69679 69681 69682 69683 69688 69695 69696 69705 69707 69709 69712 69719 69722 69731 69739 69740 69761 69769 69773 69778 69779 69780 69791 69792 69795 69796 69799 69803 69804 69805 69810 69812 69813 69816 69817 69818 69819 69820 69822 69823 69825 69826 69828 69829 69830 69831 69832 69834 69836 69840 69843 69846 69847 69849 69850 69854 69856 69859 69860 69861 69864 69867 69874 69876 69877 69878 69885 69886 69889 69891 69893 69895 69899 69903 69905 69906 69910 69913 69918 69921 69922 69923 69927 69928 69930 69932 69935 69936 69938 69947 69957 69965 69966 69969 69976 69996 70000 70001 70007 70008 70010 70015 70024 70025 70031 70039 70044 70050 70053 70058 70060 70069 70082 70084 70087 70088 70101 70120 70121 70123 70125 70126 70130 70131 70136 70137 70152 70164 70166 70167 70168 70172 70183 70186 70189 70196 70210 70211 70218 70227 70228 70230 70232 70237 70242 70246 70250 70251 70253 70258 70263 70265 70268 70269 70278 70302 70305 70306 70325 70327 70329 70336 70341 70362 70372 70388 70403 70404 70405 70406 70407 70410 70418 70419 70420 70423 70424 70426 70431 70432 70433 70434 70435 70437 70438 70439 70440 70441 70445 70456 70460 70472 70478 70480 70482 70499 70502 70503 70505 70512 70513 70515 70516 70517 70518 70525 70527 70528 70532 70541 70542 70545 70549 70551 70552 70567 70568 70570 70571 70572 70575 70582 70589 70596 70602 70604 70612 70615 70623 70627 70628 70629 70634 70635 70637 70643 70645 70652 70661 70672 70674 70681 70682 70683 70694 70700 70721 70724 70725 70735 70742 70753 70754 70755 70763 70764 70778 70784 70801 70810 70817 70823 70826 70831 70832 70842 70850 70871 70872 70887 70893 70900 70908 70914 70916 70924 70928 70929 70933 70936 70948 70954 70959 70973 70974 70992 70994 70997 71005 71028 71030 71032 71034 71037 71039 71040 71041 71043 71048 71049 71050 71052 71059 71060 71063 71467 71472 71475 71476 71483 71485 71486 71487 71488 71504 71508 71510 71511 71514 71520 71522 71523 71533 71534 71535 71537 71540 71551 71554 71560 71565 71568 71580 71585 71586 71587 71605 71618 71619 71620 71623 71624 71634 71635 71636 71638 71639 71640 71643 71652 71656 71660 71666 71673 71703 71704 71707 71708 71710 71711 71712 71713 71714 71715 71718 71719 71722 71723 71726 71731 71738 71747 71766 71773 71777 71780 71783 71789 71791 71793 71796 71797 71798 71803 71819 71821 71822 71829 71848 71865 71869 71870 71871 71875 71877 71886 71887 71892 71897 71906 71907 71924 71925 71928 71932 71933 71937 71941 71942 71945 71946 71948 71949 71950 71951 71953 71954 71967 71981 71982 71985 71986 71989 71995 72001 72008 72011 72012 72024 72029 72034 72036 72037 72056 72077 72079 72086 72090 72092 72094 74802 ARD-00925 74803 74804 74805 74806 74807 74812 74814 74815 74816 74817 74818 74819 74820 74821 74822 74840 74842 74843 74847 74848 74849 74851 74852 74853 74858 74859 74863 74864 74865 74867 74875 74881 74882 74883 74891 74892 74893 74894 74901 74902 74908 74909 74917 74918 74919 74931 74932 74933 74934 74935 74936 74939 74940 74941 74946 74947 74948 74949 74950 74951 74952 74954 74955 74956 74957 74958 74959 74960 74961 74962 74968 74969 74970 74971 74972 74973 74975 74976 74977 74980 74981 74986 74987 74988 75018 75019 75020 75021 75022 75023 75024 75025 75026 75028 75029 75030 75031 75032 75033 75034 75035 75036 75040 75041 75042 75043 75044 75045 75047 75049 75053 75054 75055 75073 75074 75076 75077 75078 75079 75080 75083 75084 75086 75087 75088 75089 75090 75093 75094 75095 75097 75104 75105 75106 75115 75116 75117 75118 75129 75130 75131 75141 75157 75158 75159 75160 75161 75162 75163 75165 75166 75167 75168 75171 75178 75179 75180 75182 75183 75184 75199 75202 75203 75204 75205 75206 75211 75213 75214 75215 75216 75217 75218 75219 75228 75233 75234 75235 75237 75238 75239 75240 75243 75249 75250 75251 75252 75255 75256 75257 75259 75260 75261 75272 75273 75277 75278 75279 75280 75281 75292 75293 75294 75315 75316 75318 75321 75322 75323 75324 75325 75327 71416 71417 71419 71420 71440 71442 (22) Protein whose gene expression changes in response to lauric acid stress (SEQ ID NOs) 4449 4453 4454 4465 4503 4518 4594 4617 4618 4634 4635 4665 4679 4685 4686 4742 4744 4745 4747 4749 4750 4751 4760 4761 4763 4765 4766 4772 4786 4850 4972 4973 5120 5396 5556 5695 5815 5840 5842 5849 5897 5932 5938 5942 6013 6049 6082 6140 6141 6142 6158 6208 6218 6293 6350 6468 6475 6481 6522 6579 10271 10275 10276 10280 10281 10295 10296 10357 10369 10476 10478 10498 10514 10516 10539 10540 10580 10614 10618 10638 10640 10656 10657 10677 10723 10731 10745 10752 10855 10862 10863 10864 10905 11057 11091 11238 11311 11343 11452 11496 11594 11622 11623 11682 11684 11839 11904 11987 12018 12019 16769 16770 16771 16772 16773 16774 16775 16776 16777 16780 16782 16783 16784 16785 16786 16787 16788 16789 16790 16791 16792 16793 16794 16795 16799 16800 16801 16802 16803 16804 16805 16806 16807 16808 71472 71475 71476 71477 71479 71480 71485 71486 71512 71517 71553 71555 71567 71573 71578 71580 71591 71592 71607 71614 71617 71629 71631 71639 71640 71641 71649 71658 71661 71669 71672 71678 71683 71689 71713 71715 71719 71721 71722 71723 71731 71756 71768 71779 71809 71836 71841 71857 71859 71871 71872 71890 71901 71904 71916 71956 71965 71966 71987 71989 71998 72024 72037 72046 72051 72078 72093 72094 74802 74803 74804 74805 74806 74807 74809 74810 74814 74815 74816 74850 74855 74856 74885 74886 74887 74888 74889 74890 74899 74901 74902 74910 74911 74920 74923 74930 74943 74945 74955 74956 74957 74958 74959 74966 74979 74982 74990 75034 75035 75036 75039 75040 75041 75042 75043 75044 75047 75075 75082 75123 75136 75161 75162 75163 75221 75227 75241 75243 75280 75281 75288 75314 75326 75327 71413 71414 71415 71416 71417 71418 71419 71420 71421 71424 71426 71427 71428 71429 71430 71431 71432 71433 71434 71435 71436 71437 71438 71439 71443 71444 71445 71446 71447 71448 71449 71450 71451 71452 Included in all nucleic acid sequences disclosed herein are DNA nucleic acid molecules, RNA nucleic acid molecules (e.g., thymidine replaced with uridine), nucleic acid molecules encoding orthologs of the encoded proteins, as well as DNA or RNA nucleic acid sequences or any variant thereof (a structural variant or a chemical variant (e.g., chemically modified nucleotide)) comprising a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the nucleic acid sequence of any SEQ ID NO presented herein, or a portion thereof. Such nucleic acid molecules can have a function of the ARD-00925 full-length nucleic acid (e.g., for the intended function of inducing an immune response) as described further herein. Included in all amino acid sequences disclosed herein are amino acid sequences or any variant thereof (a structural variant or a chemical variant) comprising an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the amino acid sequence of any SEQ ID NO listed in presented herein, or a portion thereof. Such polypeptides can have a function of the full-length polypeptide (e.g., for the intended function of inducing an immune response) as described further herein. HOMOLOGY Function-conservative variants are those in which a given amino acid residue in a protein or enzyme has been changed without altering the overall conformation and function of the polypeptide, including, but not limited to, replacement of an amino acid with one having similar properties (such as, for example, polarity, hydrogen bonding potential, acidic, basic, hydrophobic, aromatic, and the like). Amino acids other than those indicated as conserved may differ in a protein so that the percent protein or amino acid sequence similarity between any two proteins of similar function may vary and may be, for example, from 70% to 99% as determined according to an alignment scheme such as by the Cluster Method, wherein similarity is based on the MEGALIGN algorithm. A function-conservative variant also includes a polypeptide which has at least 60% amino acid identity as determined by BLAST or FASTA algorithms, preferably at least 75%, more preferably at least 85%, still preferably at least 90%, and even more preferably at least 95%, and which has the same or substantially similar properties or functions as the native or parent protein to which it is compared. Homology, as used herein, refers to nucleotide sequence similarity between two regions of the same nucleic acid strand or between regions of two different nucleic acid strands. When a nucleotide residue position in both regions is occupied by the same nucleotide residue, then the regions are homologous at that position. A first region is homologous to a second region if at least one nucleotide residue position of each region is occupied by the same residue. Homology between two regions is expressed in terms of the proportion of nucleotide residue positions of the two regions that are occupied by the same nucleotide residue. By way of example, a region having the nucleotide sequence 5'-ATTGCC-3' and a region having the nucleotide sequence 5'- TATGGC-3' share 50% homology. Preferably, the first region comprises a first portion and the second region comprises a second portion, whereby, at least about 50%, and preferably at least about 75%, at least about 90%, or at least about 95% of the nucleotide residue positions of each ARD-00925 of the portions are occupied by the same nucleotide residue. More preferably, all nucleotide residue positions of each of the portions are occupied by the same nucleotide residue. For nucleic acids, the term “substantial homology” indicates that two nucleic acids, or designated sequences thereof, when optimally aligned and compared, are identical, with appropriate nucleotide insertions or deletions, in at least about 80% of the nucleotides, usually at least about 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, or more of the nucleotides, and more preferably at least about 97%, 98%, 99% or more of the nucleotides. Alternatively, substantial homology exists when the segments will hybridize under selective hybridization conditions, to the complement of the strand. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity= # of identical positions / total # of positions x 100), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, as described in the non-limiting examples below. The percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available on the world wide web at the GCG company website), using a NWSgapdna. CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. The percent identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:1117 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol. (48):444453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available on the world wide web at the GCG company website), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. The nucleic acid and protein sequences of the present invention can further be used as a “query sequence” to perform a search against public databases to, for example, identify related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol.215:40310. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the present invention. To obtain gapped ARD-00925 alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res.25(17):33893402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (available on the world wide web at the NCBI website). CODON OPTIMIZATION In preferred embodiments, the nucleic acid (e.g., DNA or RNA) vaccines of the present disclosure comprise those that are codon-optimized for expression in a host cell or a subject. Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing peptide chain. Codon preference or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Given the large number of gene sequences available for a wide variety of animal, plant and microbial species, it is possible to calculate the relative frequencies of codon usage. Codon usage tables are readily available, for example, at the “Codon Usage Database,” available World Wide Web at kazusa.or.jp / codon / , and these tables can be adapted in a number of ways. See Nakamura, Y., et al. “Codon usage tabulated from the international DNA sequence databases: status for the year 2000” Nucl. Acids Res.28:292 (2000). In preferred embodiments, codon tables from the following webiste are used: World Wide Web at kazusa.or.jp / codon / . As examples, a codon usage table for cow, calculated from GenBank Release 128.0, is reproduced below as Table 7A. Table 7A uses mRNA nomenclature, and so instead of thymine (T) which is found in DNA, the tables use uracil (U) which is found in RNA. The table has been adapted so that frequencies are calculated for each amino acid, rather than for all 64 codons. Table 7A. Codon Usage Table for Cow Genes (Bos taurus) ARD-00925 ARD-00925 By utilizing Table 7A or the like available at e.g., the website provided above, one of ordinary skill in the art can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide, but which uses codons more optimal for a given species. Accordingly, the term”codon-optimized” encompasses any modification of the nucleic acid sequence to comprise at least one codon that is more frequently used in a given host cell or subject. The term “codon-optimized” is not intended to mean that all codons in the nucleic acid are optimized for expression in a given host cell or subject. NUCLEIC ACID VACCINES Provided herein are nucleic acid vaccines that induce an immune response against at least one cell surface protein or a fragment thereof of at least one methanogen. The nucleic acid may be DNA or RNA; in both cases it provides the instructions for making a specific protein (e.g., an antigenic fragment of at least one cell surface protein of at least one methanogen), which the immune system will recognize as foreign. Once inserted into host cells, this nucleic acid is read by the cell’s own protein-making machinery and used to manufacture the protein, which then trigger an immune response. As used herein, the term "nucleic acid" (also called “polynucleotide”) in its broadest sense, includes any compound and or substance that comprise a polymer of nucleotides linked via a phospohdiester bond. The nucleotide or a portion thereof may be natural or synthetic. In ARD-00925 some embodiments, the nucleotide or a portion thereof may be structurally or chemically modified. Exemplary nucleic acids include ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a β-D-ribo configuration, α-LNA having an α-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino-α-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA), or hybrids or combinations thereof. They may comprise RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, tRNA, RNAs that induce triple helix formation, aptamers, vectors, etc. In some embodiments, the nucleic acid comprises coding sequences and non-coding sequences. In some embodiments, the shortest length of a nucleic acid of the present disclosure can be the length of the nucleic acid sequence that may be sufficient to encode for a dipeptide. In some embodiments, the length of the nucleic acid sequence may be sufficient to encode for a tripeptide. In some embodiments, the length of the nucleic acid sequence may be sufficient to encode for a tetrapeptide. In some embodiments, the length of the nucleic acid sequence may be sufficient to encode for a pentapeptide. In some embodiments, the length of the nucleic acid sequence may be sufficient to encode for a hexapeptide. In some embodiments, the length of the nucleic acid sequence may be sufficient to encode for a heptapeptide. In some embodiments, the length of the nucleic acid sequence may be sufficient to encode for an octapeptide. In some embodiments, the length of the nucleic acid sequence may be sufficient to encode for a nonapeptide. In some embodiments, the length of the nucleic acid sequence may be sufficient to encode for a decapeptide. In some embodiments, the length of the nucleic acid (e.g., mRNA) sequence may be sufficient to encode an antigen that triggers the immune response in a subject. Generally, the length of a nucleic acid of the present disclosure may be greater than about 30 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides). In some embodiments, the nucleic acid of the present invention includes from about 30 to about 100,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 1 ,000, from 30 to 1 ,500, from 30 to 3,000, from 30 to 5,000, from 30 to 7,000, ARD-00925 from 30 to 10,000, from 30 to 25,000, from 30 to 50,000, from 30 to 70,000, from 100 to 250, from 100 to 500, from 100 to 1 ,000, from 100 to 1 ,500, from 100 to 3,000, from 100 to 5,000, from 100 to 7,000, from 100 to 10,000, from 100 to 25,000, from 100 to 50,000, from 100 to 70,000, from 100 to 100,000, from 500 to 1 ,000, from 500 to 1 ,500, from 500 to 2,000, from 500 to 3,000, from 500 to 5,000, from 500 to 7,000, from 500 to 10,000, from 500 to 25,000, from 500 to 50,000, from 500 to 70,000, from 500 to 100,000, from 1,000 to 1,500, from 1 ,000 to 2,000, from 1,000 to 3,000, from 1,000 to 5,000, from 1 ,000 to 7,000, from 1,000 to 10,000, from 1,000 to 25,000, from 1 ,000 to 50,000, from 1 ,000 to 70,000, from 1,000 to 100,000, from 1,500 to 3,000, from 1 ,500 to 5,000, from 1 ,500 to 7,000, from 1,500 to 10,000, from 1 ,500 to 25,000, from 1,500 to 50,000, from 1 ,500 to 70,000, from 1,500 to 100,000, from 2,000 to 3,000, from 2,000 to 5,000, from 2,000 to 7,000, from 2,000 to 10,000, from 2,000 to 25,000, from 2,000 to 50,000, from 2,000 to 70,000, and from 2,000 to 100,000). In some embodiments, the nucleic acid of the present disclosure may comprise sequences that encode at least one peptide or polypeptide of interest. In some embodiments, the nucleic acid of the present disclosure may comprise sequences that are non-coding. In some embodiments, the length of a portion / region of the nucleic acid encoding at least one peptide polypeptide of interest is greater than about 30 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or up to and including 100,000 nucleotides). DNA vaccine The first proof of concept of a DNA vaccine was made in 1990 and involved the injection of DNA molecules, expressing chloramphenicol acetyltransferase, luciferase, and beta- galactosidase into mouse skeletal muscle, and the expression of reporter genes in vivo, which can be detected for up to two months after infection. In brief, DNA vaccine consists of delivering genes or fragments of it, encoding immunogenic antigens to the host’s cells by using DNA plasmids as a vector. This approach induces both humoral and cell-mediated immune responses efficiently. The vaccine formulation is made such that the genetic material is translocated to the host’s cell nucleus. Once it reaches there, the mammalian promoter present in the vector structure is activated, triggering the transcription of the gene used for the vaccine through the host’s cellular machinery. The antigen-presenting cells (APCs) are the major target cells to receive the genetic material. In addition, myocytes have been reported to play a crucial role. After the translation of the translocated gene into a protein or protein fragment, it is further processed into peptides that bind to major histocompatibility complex (MHC) class I or II. Cells ARD-00925 other than APC, such as the myocytes, use MHCI for the antigen presentation, and APC, such as dendritic cells (DCs), can use MHC-II, resulting in cross-priming and presentation of antigens to both CD4+ and CD8+ T cells. In addition to this cellular immune response, humoral responses can be triggered if the produced immunogen is released from the cells and recognized by B cell receptors. In addition, intrinsic elements of plasmid DNA, such as CpG unmethylated sequences, can activate innate immune responses, thereby enhancing adaptive immune responses against the expressed antigens. Clinical trials using DNA vaccines in humans induced both cellular and humoral responses. DNA vaccines have been licensed for use in veterinary medicine (see e.g., Silveira et al. (2017) Vaccine, 35:5559-5567; Ingolotti et al. (2014) Expert Review of Vaccines, 747-763), making it an approriate way of vaccinating a subject. Compared with traditional live or attenuated vaccines, DNA vaccines have several advantages, such as induction of broad immune responses without any risk being associated with replicating microorganisms; stimulation of both cellular and humoral immunity; construction of a vector encoding different antigens in a single vaccine; efficient largescale, low-cost, roduction; and high storage stability. In the vaccinology field, storage is a crucial factor, as preserving the high quality of the vaccine contents and, thus, the protective potential is necessary. Hence, cold storage is essential to ensure the survival of live vaccines and preserve their content. On the other hand, DNA vaccines are highly stable and have less need for refrigeration, which may be highly practical for use in endemic areas. Chemical modification(s) of nucleic acid (e.g., DNA) In some embodiments, the nucleic acid may be modified (e.g., with chemical modification). In some embodiments, such chemical modification(s) protect the nucleic acid (e.g., DNA) from being degraded by DNA exonucleases. Exemplary modifications are further described below. 1. Phosphorothioate linkages A phosphorothioate (pt) bond is a phosphodiester linkage where one of the two non- bridging oxygens has been replaced by a sulfur. This modification has been used for decades to inhibit nuclease phosphodiesterase and phosphoryl transferase activities. Chemically, the substitution of oxygen with sulfur does not dramatically change the reactivity of the bond, and pt-containing polynucleotides can still function in many enzymatic reactions. In a typical phosphodiester bond, the two non-bridging oxygens are chemically equivalent. When one of these oxygens is replaced by sulfur, however, the phosphorus is now connected to four distinct groups, rendering it a chiral center with two possible configurations referred to as “SP” and “RP.” It is this key feature that confers resistance for the majority of nuclease enzymes; one ARD-00925 configuration will react at rates similar to a phosphodiester, while the other is significantly inhibitory or completely unreactive. Isomer reactivity varies from enzyme to enzyme, and different pt isomers can inhibit enzymes that catalyze the same reaction (e.g., phosphoryl transfer). For example, DNA Polymerase I can incorporate deoxynucleotide triphosphates with a pt ester at the α phosphate (dNTPαS), allowing formation of pt-bonded polynucleotides. However, it can only react with SP configured dNTPαS molecules, and does so with inversion of the stereocenter to form exclusively RP-configured pt bonds in the product. Conversely, the 3´→ 5´exo activity of this polymerase cleaves RPbut not SPconfigured bonds. Alternatively, the 3´→ 5´ exo activity of E. coli Exonuclease III cleaves SP but not RP configured pt bonds (24). Therefore, DNA created from the incorporation of dNTPαS by DNA Pol I is highly resistant to exonuclease cleavage by Exo III. Phosphorothioates can block many, but not all, exonucleases. To block exonuclease cleavage, the pt bonds must be placed at the end(s) where the enzyme initiates, e.g., the 5´ end for Lambda Exo and the 3´ end for Exo III. It is important to note that a single pt bond is insufficient to fully protect an oligonucleotide from exonuclease digestion. When the pt bond is installed via an oxidation step during phosphoramidite synthesis, a nearly equal amount of each isomer (SPand RP) is formed at each pt linkage. Since most enzymes can cleave one of these isomers, a single chemically installed pt will protect only half the molecules from digestion by a given exonuclease. Thus, it is typically recommended that 3–6 pt bonds be used to block exonuclease digestion, to prevent this read-through. One might expect that because each bond is a 50:50 mixture of isomers, when presented with 5 consecutive isomers, a given enzyme could cleave the first bond on half the molecules, then half of the molecules that had the first bond hydrolyzed would have the second hydrolyzed, and so on, such that there would be a range of partially degraded products. In practice, it has been reported that five consecutive pt bonds completely block all exonuclease activity at all pt bond positions. The exact reasons for this are not currently known, but it is likely that exonucleases engage multiple bases at once, and the net effect of the isomeric mixture somehow prevents the active site from properly organizing around bonds that are the normally cleavable pt isomer. There are several commonly used exonucleases that are not blocked even by 5 consecutive pt bonds; for example, Exo V, Exo VII and T5 Exonuclease all can cleave, leaving short oligos instead of cutting at every bond in a series, and thus can digest DNA by skipping over termini blocked by multiple pt bonds and cleaving at the first phosphodiester. Importantly, any enzyme with endonuclease activity, like DNase I, will simply ignore the ends and degrade the polynucleotides from the inside out (unless every phosphodiester bond is replaced by a phosphorothioate). Keeping these important exceptions in mind, phosphorothioate bonds remain ARD-00925 the most generally applicable (and relatively inexpensive) way to protect oligonucleotides from digestion by exonucleases. 2. 2’-modified nucleosides Certain 2´-O-modified riboses are both stable to spontaneous hydrolysis and offer strong resistance to exonuclease activity.2´-O-methyl, 2’-fluoro, or 2´-O-methoxyethyl (MOE) nucleosides, which contain bulky substituents off the sugar ring, have been shown to grant strong resistance to nucleases and additionally increase the strength of annealing to complementary DNA and RNA. These sugar modifications also work in vitro to block exonuclease activity quite strongly. While a single terminal MOE nucleoside only weakly inhibits exonuclease activity, three successive MOE modifications provide enhanced resistance to many exonucleases, including Exo I, Exo III, Lambda Exo, RecJF and polymerase exonucleases activities, such as that of DNA Polymerase I, Large (Klenow) Fragment. Similar to pt bonds, several exonucleases can digest through these regions, notably T5 Exo, T7 Exo, Exo V, Exo VII and Exo VIII. Overall, exonuclease inhibition by MOE is quite strong, but pt bonds are cheaper to install for most manufacturers. However, if for some reason the pt chemistry is not desired, 2´-O-modified ribose moieties are a viable alternative. 3. Other 5’ / 3’ end modifications Several other modifications, such as the inverted deoxythymidine bases and dideoxynucleotides have been reported to suppress serum nuclease activity when appended to the end of synthetic oligonucleotides. Many other modifications may be attached through “linkers” at either the 5´ or 3´ end, includingfluorescent tags, biotin or other affinity labels, or reactive groups for attachment to beads or surfaces. These linkers are typically connected to the 5´ or 3´ end via a phosphodiester. Such modifications can be used alone or in combination with other modifications, e.g., pt bonds and / or 2’-modified nucleosides. In sum, various useful terminal modifications (e.g., 5’ terminus and / or 3’ terminus) protect DNA from degradation. Exemplary modifications include but are not limited to, biotin, phosphorothioate, triethylene glycol (TEG), Locked Nucleic Acid (LNA, a 2’-oxygen-4’-carbon methylene linkage), hexaethylene glycol (Sp18), 1,3-propanediol (SpC3), 2’-O-methoxyethyl (MOE) ribonucleotides, 2’-O-methyl ribonucleotides (2’-OMe), 2’-fluoro (2’-F) nucleotides, or any combination thereof. These modifications are further described in WO2021 / 081358, which is incorporated herein by reference. Types of DNA The DNA in DNA vaccines can be liner or circular. In some embodiments, the DNA is double-stranded or single stranded. ARD-00925 In some embodiments, the DNA is single-stranded and comprises at least one hairpin. In some such embodiments, the hairpin comprises a portion of a protelomerase target sequence (see e.g., US 11,149,302, the methods and compositions in which are incorporated herein by reference). In some embodiments, the DNA is double-stranded and is a closed linear DNA. In some such embodiments, the DNA may be a doggybone DNA (dbDNA™; Touchlight, Hampton, UK), which is a linear, double-stranded DNA that is covalently closed through the action of the protelomerase enzyme TelN. The dbDNA™ comprises ~28 bps of telomeric sequence at both ends, and can encode long, complex, or unstable DNA sequences, eliminates bacterial sequences and has a strong expression profile. The dbDNA™ is often synthesized via in vitro amplification process, which uses rolling-circle amplication by phi29 polymerase to produce long concatameric repeats of the template DNA. These concatamers are subsequently reduced to individual closed linear DNA called dbDNA™ through the action of the protelomerase enzyme TelN. In addition to a fast in vitro production, the dbDNA™ may be more safer in a clinical setting, as it does not evoke recognition by TLR9 such that it minimizes the immune response. The methods of producing the dbDNA™ is described in Karda et al. (2019) Gene Therapy 26:86-92, which is incorporated herein by reference. In some embodiments, the DNA vaccines may be synthesized according to the compositions and methods as described in US 11,149,302 B2, US 2021 / 0269793 A1, US 9,499,847 B2, US 9,109,250 B2, US 9,029,134 B2, US 9,765,343 B2; each of which is incorporated herein by reference. Certain exemplary features Accordingly, in some embodiments, the vaccine comprises DNA (e.g., encoding at least one cell surface protein or a fragment thereof of at least one methanogen). Such DNA may comprise a coding sequence and / or a non-coding sequence. In some embodiments, the DNA is operably linked to a promoter. In some embodiments, the coding sequence is operably linked to a promoter. In some embodiments, the promoter is selected form CMV promoter, CAG promoter, SCP promoter, CMVe-SCP, CMVmax, JET, PGK, EF-1a, AHSP promoter, MND promoter, Wiskott-Aldrich promoter, and PKLR promoter. In some embodiments, the DNA comprises: (a) a transcription regulatory element (e.g., an enhancer, a transcription termination sequence, a proximal promoter element, a locus control region); and / or (b) a translation regulatory element (e.g., Kozak sequence, an untranslated region (5’ UTR or 3’ UTR), a polyadenylation signal sequence). ARD-00925 In some embodiments, the DNA further comprises a sequence operatively coding for the secretion of the at least one cell surface protein or a fragment thereof. In some embodiments, the DNA is linear or circular. In some embodiments, the DNA comprises a telomeric sequence. In some embodiments, the DNA is double-stranded or single-stranded. In some embodiments, the DNA is single-stranded and comprises at least one hairpin. In some embodiments, the DNA is double-stranded and comprises a telomeric sequence (e.g., a closed linear DNA, e.g., dbDNA™). In some embodiments, the the DNA comprises at least one chemical modification. In some embodiments, the at least one chemical modification is a terminal modification, which is present at 5’ end and / or 3’ end. In some embodiments, the at least one chemical modification comprises phosphorothioate, triethylene glycol (TEG), Locked Nucleic Acid (LNA, a 2’- oxygen-4’-carbon methylene linkage), hexaethylene glycol (Sp18), 1,3-propanediol (SpC3), 2’- O-methoxyethyl (MOE) ribonucleotides, 2’-O-methyl ribonucleotides (2’-OMe), 2’-fluoro (2’- F) nucleotides, or any combination thereof. In some embodiments, the at least one chemical modification comprises at least five consecutive phosphorothioate bonds. In some embodiments, the at least one chemical modification comprises at least three consecutive 2’-O-methyl nucleosides and / or 2’-O-methoxyethyl nucleosides. In some embodiments, the DNA is in a vector. In some embodiments, the vector is a plasmid. In some embodiments, the DNA is packaged in a virus, e.g., AAV, e.g., bovine AAV (e.g., for transduction to a subject). In some embodiments, the DNA vaccine is in a composition (e.g., pharmaceutical composition) further comprising an adjuvant. In some embodiments, the adjuvant comprises: (a) (±)-N-(3-aminopropyl)-N,N- dimethyl-2,3-bis(syn-9-tetradeceneyloxy)-1-propanaminium bromide (GAP-DMORIE) and a neutral lipid; (b) a cytokine; (c) mono-phosphoryl lipid A and trehalosedicorynomycolateAF (MPL+TDM); (d) a solubilized mono-phosphoryl lipid A formulation; and / or (e) CRL1005 / BAK. In some embodiments, the neutral lipid in (a) comprises (a) 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE); (b) l,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPyPE); and / or (c) 1,2-dimyristoyl-glycer-3-phosphoethanolamine (DMPE). In some embodiments, the DNA vaccine is in a composition (e.g., pharmaceutical composition) further comprising a transfection facilitating compound. In some embodiments, the transfection facilitating compound comprises (±)-N-(2- hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide) (DMRIE). ARD-00925 RNA vaccine The RNA vaccine (e.g., comprising mRNA) does not need to reach the cell nucleus like the DNA ones, which is one of the potential practical advantages. Thus, the mode of application and effectiveness of RNA vaccines may be increased. In preferred embodiments, the RNA vaccine comprises mRNA that encodes a protein antigen. Although RNA is known to be a relatively unstable molecule, it has been proven that the RNA vaccine designs improve its stability and protein translation efficiency, which enhanced immune response. Accordingly, in some embodiments, the nucleic acid is messenger RNA (mRNA). The mRNA of the present disclosure may encode one or more peptides or polypeptides. In some embodiments, the nucleic acids of the present disclosure are linear. In preferred embodiments, the linear nucleic acids are produced by in vitro transcription. The linear nucleic acids encoding one or more antigens of the nucleic acid vaccines of the present disclosure which are made using in vitro transcription (IVT) enzymatic synthesis methods are referred to as “IVT polynucleotides” or “IVT mRNA.” In some embodiments, the nucleic acids of the present disclosure are circular or cyclic. The circular nucleic acid is a single stranded nucleic acid whose termini are joined in some fashion, whether by ligation, covalent bond, common association with the same protein or other molecule or complex or by hybridization. As used herein, the cicular nucleic acid acts substantially like, and has the properties of, an RNA. The circular nucleic acid or circular polynucleotides are described in WO2015 / 034925 and WO2016 / 011222, each of which is incorporated herein by reference. Mode of action of mRNA vaccines According to mechanistic studies on the fate of mRNA LNPs in rhesus monkeys, primarily monocytes and dendritic cell (DC) subsets translate the mRNA, likely involving ApoE dependent endocytosis. These locally transfected antigen-presenting cells (APCs) subsequently migrate to the draining lymph nodes (LN) where they present the mRNAencoded antigens to B cells and T cells. Moreover, owing to their relatively small size (~100 nm), neutral surface charge and diffusible PEG lipid coating, mRNA LNPs might also enter the lymphatics to directly target LN-resident APCs and B cells. Finally, although these cells are often overlooked in flow cytometry studies, it is very likely that cell types such as myocytes, epithelial cells and fibroblasts also contribute to local mRNA expression. At the same time, mRNA vaccines also need to engage the innate immune system to improve their ability to induce, and tailor, antigenspecific immune responses. Upon sensing inflammatory stimuli, lymphatic migration of innate immune cells is promoted, while APCs become activated (i.e. maturation), in their turn providing costimulatory signals and cytokine responses. mRNA can mediate type I IFN ARD-00925 responses upon cellular uptake, which can vary greatly depending on their structural design. Among other effects on antiviral immunity, type I IFNs restrict viral replication in infected host cells and induce stimulatory-genes involved in the maturation process of DCs. Furthermore, IFN-α directly acts as a third cytokine signal during T cell priming. The type I IFN response can act as a driving force for mRNA vaccines to elicit cytotoxic T cell responses. Several studies have indicated that an unmodified mRNA platform induces a more pronounced type-I IFN- polarized innate immune response. Both the mRNA and the LNP vehicle can have intrinsic adjuvant properties. Cationic lipids have been associated with the activation of several cellular pathways like proapoptotic and pro-inflammatory cascades. For Moderna’s LNP formulation, Hassett et al. reported that the SM-102 lipid was selected based on its improved tolerability profile in non-human primates, as evidenced by a reduced local reactogenicity (e.g., edema and erythema) and lowest induction of systemic cytokine responses (e.g., IL-6), without affecting the ability to induce antibody production. Exemplary design to reduce innate immune response Several modifications to the mRNA structure can drastically improve the final outcome. The design of (non-coding) structural elements of the mRNA such as the CAP structure, polyA tail and untranslated regions (UTRs) all have a major impact on the mRNA stability and translation capacity (see e.g., Orlandini von Niessen et al. (2019) Mol Therapy 27(4):824-836; Holtkamp et al. (2006) Blood 108(13): 4009-4017). For example, mRNA comprising a 5’-cap that is the diastereomer D 1 of beta-S-ARCA has been shown to improve mRNA stability and translation capacity (WO2011015347A1). Codon optimization in the mRNA sequence to e.g., match host transfer (t)RNA abundances, or as a determinant of introducing secondary structures, can drastically impact the protein synthesis rate and ribosome dwell time (i.e. mRNA functional half-life). In this context, N1-methylpseudouridine (1mΨ) nucleotide-modifications for uridine were shown to provide additional base pair stability, giving rise to a high degree of secondary structure which significantly improves the mRNA translation (Mauger et al. (2019) Proc Natl Acad Sci U.S.A., 116:24075). Furthermore, the secondary structure design of mRNA can be optimized in order to improve mRNA stability against cleavage by endonucleases and chemical degradation processes, including hydrolysis (Wayment-Steele et al. (2021) Nucleic Acids Res, 49(18):10604-10617). BNT162b2 and mRNA-1273 implement a combination of modified nucleotide 1mΨ replacement and removal of dsRNA fragments in the mRNA production process, which strongly reduces the innate immune signaling in response to mRNA through decreased activation of TLR signaling and cytosolic RNA sensors. Moderna demonstrated that with such an approach, both local and systemic innate immune effects upon mRNA (vaccine) ARD-00925 administration can be limited to a bare minimum in mice, which not only allows improved mRNA expression but also repeat dosing of the mRNA vaccine (Nelson et al. (2020) Sci Adv 6(26): 1-13). In contrast to BNT162b2 and mRNA-1273, the CVnCoV vaccine candidate contains an “unmodified” mRNA, which employs sequence engineering (e.g., reduction in uridine content), selected UTRs, and a stringent purification protocol to remove dsRNA fragments, demonstrating diverse approach to mRNA vaccines (Lutz et al. (2017) npj Vaccines 2(29): 1-9). In some embodiments, nucleic acid vaccines of the present disclosure do not substantially induce an innate immune response of a cell into which the nucleic acid (e.g., mRNA) is introduced. Features of an induced innate immune response include 1) increased expression of pro-inflammatory cytokines, 2) activation of intracellular pattern recognition receptors (PRRs) (e.g., RIG-I, MDA5, etc.), and / or 3) termination or reduction in protein translation. RNA design and modifications In some embodiments, the nucleic acid of the present disclosure is modified. In some embodiments, the nucleic acid may be structurally modified or chemically modified. As used herein, a “structural” modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Accordingly, the structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide "ATCG" may be chemically modified to "AT-5meC-G". The same polynucleotide may be structurally modified from "ATCG" to "ATCCCG". Here, the dinucleotide "CC" has been inserted, resulting in a structural modification to the polynucleotide. In some embodiments, the nucleic acid of the present disclosure may comprise one or more naturally occurring components, including any of the canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In some embodiments, all or substantially all of the nucleotides comprising (a) the 5’-UTR, (b) the open reading frame (ORF), (c) the 3’-UTR, (d) the poly A tail, and any combination of (a, b, c, or d above) comprise naturally occurring canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In some embodiments, the nucleic acid may be naturally or non-naturally occurring. Nucleic acids may include one or more modified ( e.g., altered or alternative) nucleobases, nucleosides, nucleotides, or combinations thereof. Nucleic acids may or may not be uniformly altered along the entire length of the molecule. In some embodiments, one or more or all types of nucleotide (e.g., purine or ARD-00925 pyrimidine, or any one or more or all of A, G, U, C) may or may not be uniformly altered in a nucleic acid, or in a given predetermined sequence region thereof. Different sugar alterations and / or internucleoside linkages (e.g., backbone structures) may exist at various positions in a nucleic acid. One of ordinary skill in the art will appreciate that the nucleotide analogs or other alteration(s) may be located at any position(s) of a nucleic acid such that the function of the nucleic acid is not substantially decreased. An alteration may also be a 5’-or 3’-terminal alteration. In some embodiments, the polynucleotide includes an alteration at the 3’-terminus. The nucleic acid may contain from about 1% to about 100% alternative nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U, or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100% from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of a canonical nucleotide (e.g., A, G, U, or C). Nucleic acids may contain at a minimum zero and at a maximum 100% alternative nucleotides, or any intervening percentages, such as at least 5% alternative nucleotides, at least 10% alternative nucleotides, at least 25% alternative nucleotides, at least 50% alternative nucleotides, at least 80% alternative nucleotides, or at least 90% alternative nucleotides. In some embodiments, nucleic acids may comprise an alternative pyrimidine such as an alternative uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in a polynucleotide is replaced with an alternative uracil (e.g., a 5-substituted uracil). The alternative uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some instances, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the polynucleotide may be replaced with an alternative cytosine (e.g., a 5- substituted cytosine). The alternative cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). ARD-00925 In some embodiments, a nucleic acid molecule, formula, composition or method associated therewith comprises one or more polynucleotides comprising features as described in WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009 / 127230, WO2006 / 122828, WO2008 / 083949, WO2010 / 088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 016376, WO2006 / 024518, WO2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, WO2011 / 069586, WO2011 / 026641, WO2011 / 144358, WO2012 / 019780, WO2012 / 013326, WO2012 / 089338, WO2012 / 113513, WO2012 / 116811, WO2012 / 116810, WO2013 / 113502, WO2013 / 113501, WO2013 / 113736, WO2013 / 143698, WO2013 / 143699, WO2013 / 143700, WO2013 / 120626, WO2013 / 120627, WO2013 / 120628, WO2013 / 120629, WO2013 / 174409, WO2014 / 127917, WO2015 / 024669, WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015 / 058069, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416, WO2015 / 164674, and 2020 / 160397, each of which is incorporated by reference herein. Nucleic acids useful in the disclosure typically include a first region of linked nucleosides encoding a polypeptide of interest (e.g., a coding region), a first flanking region located at the 5’ terminus of the first region (e.g., a 5’ UTR), a second flanking region located at the 3’ terminus of the first region (e.g., a 3’ UTR) at least one 5’cap region, and a 3’ stabilizing region. In some embodiments, a nucleic acid further comprises a polyA region (e.g., in the 3’ UTR) or a Kozak sequence (e.g., in the 5’ UTR). In some embodiments, a polynucleotide or nucleic acid (e.g., an mRNA) may include a 5’ cap structure, a chain terminating nucleotide, a stem loop, a polyA sequence, and / or a polyadenylation signal. Any one of the regions of a nucleic acid may include one or more alternative components (e.g., an alternative nucleoside). In some embodiments, the 3’-stabilizing region may contain an alternative nucleoside such as an L-nucleoside, an inverted thymidine, or a 2’-O-methyl nucleoside and / or the coding region, 5;-UTR, 3’-UTR, or cap region may include an alternative nucleoside such as a 5-substituted uridine (e.g., 5 -methoxy uridine), a 1- substituted pseudouridine (e.g., -methyl-pseudouridine), and / or a 5-substituted cytidine (e.g., 5- methyl- cytidine). Accordingly, mRNA vaccines may comprise synthetic mRNA molecules that direct the production of the antigen that will generate an immune response. In vitro-transcribed (IVT) mRNA mimics the structure of endogenous mRNA, with five sections, from 5ʹ to 3ʹ: 5ʹ cap, 5ʹ untranslated region (UTR), an open reading frame that encodes the antigen, 3ʹ UTR and a polyA tail (see Fig.1). A variation on IVT mRNA, self-amplifying mRNA, also contains replicase genes that encode RNA-dependent RNA polymerase. The virus-derived polymerase amplifies ARD-00925 mRNA transcripts intracellularly, enabling the expression of large amounts of antigen with reduced mRNA doses. 5’ cap structure The 5′ cap structure, like that of natural eukaryotic mRNAs, contains a 7- methylguanosine nucleoside linked through a triphosphate bridge to the 5′ end of mRNA. As in mammals, the first or second nucleotide from the 5′ end is methylated on the 2′ hydroxyl of the ribose (2′-O-methylation), which prevents recognition by cytosolic sensors of viral RNA, and hence prevents unintended immune responses. Further, the 5′ cap protects the mRNA sterically from degradation by exonucleases, and it works synergistically with the polyA tail at the 3′ end, polyA binding proteins and translation initiation factor proteins to circularize mRNA and recruit ribosomes for initiating translation. The length of the polyA tail indirectly regulates both mRNA translation and half-life. A sufficiently long tail (100–150bp) is necessary to interact with polyA binding proteins that form complexes necessary for initiating translation and protecting the cap from degradation by decapping enzymes. A nucleic acid molecule (e.g., an mRNA) may include a 5’ cap structure. The 5’ cap structure of a nucleic acid is involved in nuclear export and increasing nucleic acid stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for nucleic acid stability in the cell and translation competency through the association of CBP with polyA binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5’ proximal introns during mRNA splicing. Endogenous nucleic acid molecules may be 5’-end capped generating a 5'-ppp-5 '- triphosphate linkage between a terminal guanosine cap residue and the 5’-terminal transcribed sense nucleotide of the nucleic acid molecule. This 5'-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5' end of the polynucleotide may optionally also be 2'-O- methylated.5’-decapping through hydrolysis and cleavage of the guanylate cap structure may target a nucleic acid molecule, such as an mRNA molecule, for degradation. Alterations to polynucleotides may generate a non-hydrolyzable cap structure preventing decapping and thus increasing polynucleotide half-life. Because cap structure hydrolysis requires cleavage of 5'-ppp-5' phosphorodiester linkages, alternative nucleotides may be used during the capping reaction. In some embodiments, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) may be used with a-thio-guanosine nucleotides according to the manufacturer’s instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap. Additional alternative guanosine nucleotides may be used such as α-methyl-phosphonate and seleno- phosphate nucleotides. ARD-00925 Additional alterations include, but are not limited to, 2'-O-methylation of the ribose sugars of 5 '-terminal and / or 5 '-anteterminal nucleotides of the nucleic acid molecules on the 2'- hydroxy group of the sugar. Multiple distinct 5’ cap structures can be used to generate the 5’ cap of a polynucleotide, such as an mRNA molecule. 5’ cap structures include those described in International Patent Publication Nos. WO2008 / 127688, WO 2008 / 016473, and WO 2011 / 015347, the cap structures of each of which are incorporated herein by reference. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (e.g., endogenous, wild-type, or physiological) 5’ caps in their chemical structure, while retaining cap function. Cap analogs may be chemically (i.e., non-enzymatically) or enzymatically synthesized and / linked to a polynucleotide. For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanosines linked by a 5'-5'-triphosphate group, wherein one guanosine contains an N7-methyl group as well as a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7G- 3'mppp-G, which may equivalently be designated 3' O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other, unaltered, guanosine becomes linked to the 5 '-terminal nucleotide of the capped polynucleotide (e.g., an mRNA). The N7- and 3'-O-methylated guanosine provides the terminal moiety of the capped polynucleotide (e.g., mRNA). Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O- methyl group on guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp- G). A cap may be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog may be modified at different phosphate positions with a boranophosphate group or a phophoroselenoate group such as the dinucleotide cap analogs described in US Patent No. 8,519,110, the cap structures of which are herein incorporated by reference. Alternatively, a cap analog may be a N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4- chlorophenoxy ethyl) substituted dinucleotide cap analogs include aN7-(4-chlorophenoxyethyl)- G(5')ppp(5')G and a N7-(4-chlorophenoxyethyl)-m3'-OG(5 )ppp(5 ')G cap analog (see, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. (2013) Bioorganic & Medicinal Chemistry 21:4570-4574; the cap structures of which are herein incorporated by reference). In other instances, a cap analog useful in the nucleic acids of the present disclosure is a 4-chloro / bromophenoxy ethyl analog. ARD-00925 While cap analogs allow for the concomitant capping of a polynucleotide in an in vitro transcription reaction, up to 20% of transcripts remain uncapped. This, as well as the structural differences of a cap analog from endogenous 5 '-cap structures of polynucleotides produced by the endogenous, cellular transcription machinery, may lead to reduced translational competency and reduced cellular stability. Alternative polynucleotides may also be capped post-transcriptionally, using enzymes, in order to generate more authentic 5'-cap structures. As used herein, the phrase “more authentic” refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a“more authentic” feature is better representative of an endogenous, wild-type, natural or physiological cellular function, and / or structure as compared to synthetic features or analogs of the prior art, or which outperforms the corresponding endogenous, wild-type, natural, or physiological feature in one or more respects. Non-limiting examples of more authentic 5'-cap structures useful in the polynucleotides of the present disclosure are those which, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5'- endonucleases, and / or reduced 5'-decapping, as compared to synthetic 5'-cap structures known in the art (or to a wild-type, natural or physiological 5'-cap structure). In some embodiments, recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-O- methyltransferase enzyme can create a canonical 5'-5'- triphosphate linkage between the 5'- terminal nucleotide of a polynucleotide and a guanosine cap nucleotide wherein the cap guanosine contains an N7-methylation and the 5 '-terminal nucleotide of the polynucleotide contains a 2'-O-methyl. Such a structure is termed the Cap 1 structure. This cap results in a higher translational-competency, cellular stability, and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5' cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N1pN2p (Cap 0), 7mG(5')ppp(5')N1mpNp (Cap 1), 7mG(5')-ppp(5')N1mpN2mp (Cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (Cap 4). Because the alternative nucleic acid molecule may be capped post-transcriptionally, and because this process is more efficient, nearly 100% of the alternative polynucleotides may be capped. This is in contrast to -80% when a cap analog is linked to a polynucleotide in the course of an in vitro transcription reaction. 5'-terminal caps may include endogenous caps or cap analogs. A 5 '-terminal cap may include a guanosine analog. Useful guanosine analogs include inosine, N1-methyl- guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine. ARD-00925 In some cases, a nucleic acid molecule contains a modified 5'-cap. A modification on the 5 '-cap may increase the stability of polynucleotide, increase the half-life of the polynucleotide, and could increase the polynucleotide translational efficiency. The modified 5 '-cap may include, but is not limited to, one or more of the following modifications: modification at the 2'- and / or 3'-position of a capped guanosine triphosphate (GTP), a replacement of the sugar ring oxygen (that produced the carbocyclic ring) with a methylene moiety (CH2), a modification at the triphosphate bridge moiety of the cap structure, or a modification at the nucleobase (G) moiety. 5’ UTR, 3’ UTR, and Translation Enhancer Elements (TEEs) The 5′ and 3′ UTRs flanking the coding region regulate mRNA translation, half-life and subcellular localization. Naturally occurring UTRs from highly expressed genes, such as the α- and β-globin genes, are preferred for synthetic mRNA. However, because UTR performance can vary by cell type, alternative UTR sequences may be used that have been optimized for the desired application and intended cell target. These engineered UTR sequences minimize mRNA degradation by excluding miRNA-binding sites and AU rich regions in the 3′ UTR. Furthermore, they minimize regions that prevent ribosomes from scanning the mRNA transcript, such as sequences with secondary and tertiary structure (for example, hairpins) in the 5′ UTR. The open reading frame of the mRNA vaccine is the most crucial component because it contains the coding sequence that is translated into protein. Although the open reading frame is not as malleable as the non-coding regions, it can be optimized to increase translation without altering the protein sequence by replacing rarely used codons with more frequently occurring codons that encode the same amino acid residue. Although replacement of rare codons is an attractive optimization strategy, it must be used judiciously. This is because, in the case of some proteins, the slower translation rate of rare codons is necessary for proper protein folding. Natural 5'UTRs bear features which play roles in translation initiation. They harbor signatures like Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another 'G'.5 'UTR also have been known to form secondary structures which are involved in elongation factor binding. By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of the polynucleotides of the invention. For example, use of 5' UTR from other tissue- specific mRNA to improve expression in that tissue is possible for muscle (MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (Tie-1, CD36), and for lung epithelial cells (SP-A / B / C / D). Such 5’ UTRs are ARD-00925 especially useful for intramuscular, intradermal, and nasal administration of the vaccines of the present disclosure. A 5'-UTR may be provided as a flanking region to polynucleotides (e.g, mRNAs). A 5'- UTR may be homologous or heterologous to the coding region found in a polynucleotide. Multiple 5 '-UTRs may be included in the flanking region and may be the same or of different sequences. Any portion of the flanking regions, including none, may be codon optimized and any may independently contain one or more different structural or chemical alterations, before and / or after codon optimization. Shown in Table 21 in US Provisional Application No 61 / 775,509, and in Table 21 and in Table 22 in US Provisional Application No.61 / 829,372, of which are incorporated herein by reference, is a listing of the start and stop site of alternative polynucleotides (e.g., mRNA). In Table 21, each 5'-UTR (5'-UTR-005 to 5'-UTR 68511) is identified by its start and stop site relative to its native or wild type (homologous) transcript (ENST; the identifier used in the ENSEMBL database). To alter one or more properties of a polynucleotide (e.g, mRNA), 5 '-UTRs which are heterologous to the coding region of an alternative polynucleotide (e.g, mRNA) may be engineered. The polynucleotides (e.g, mRNA) may then be administered to cells, tissue or organisms and outcomes such as protein level, localization, and / or half-life may be measured to evaluate the beneficial effects the heterologous 5'-UTR may have on the alternative polynucleotides (mRNA). Variants of the 5 '-UTRs may be utilized wherein one or more nucleotides are added or removed to the termini, including A, T, C or G.5 '-UTRs may also be codon-optimized, or altered in any manner described herein. The 5'-UTR of a polynucleotides (e.g, mRNA) may include at least one translation enhancer element. The term“translational enhancer element” refers to sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE may be located between the transcription promoter and the start codon. The polynucleotides (e.g, mRNA) with at least one TEE in the 5'-UTR may include a cap at the 5 - UTR. Further, at least one TEE may be located in the 5 -UTR of polynucleotides (e.g, mRNA) undergoing cap-dependent or cap-independent translation. In some aspects, TEEs are conserved elements in the UTR which can promote translational activity of a polynucleotide such as, but not limited to, cap-dependent or cap- independent translation. The conservation of these sequences has been previously shown by Panek et al. (Nucleic Acids Research, 2013, 1-10) across 14 species. ARD-00925 In some embodiments, the TEEs known may be in the 5-leader of the Gtx homeodomain protein (Chappell et al, Proc. Natl. Acad. Sci. USA 101 :9590-9594, 2004, the TEEs of which are incorporated herein by reference). In other embodiments, TEEs are disclosed in US Patent Publication Nos.2009 / 0226470 and 2013 / 0177581, International Patent Publication Nos. W02009 / 075886, WO2012 / 009644, and WO1999 / 024595, US Patent Nos.6,310,197, and 6,849,405, the TEE sequences of each of which are incorporated herein by reference. In yet other embodiments, the TEE may be an internal ribosome entry site (IRES), HCV- IRES or an IRES element such as, but not limited to, those described in US Patent No. 7,468,275, US Patent Publication Nos.2007 / 0048776 and 2011 / 0124100 and International Patent Publication Nos. W02007 / 025008 and WO2001 / 055369, the IRES sequences of each of which are incorporated herein by reference. The IRES elements may include, but are not limited to, the Gtx sequences (e.g., Gtx9-nt, Gtx8-nt, Gtx7-nt) described by Chappell et al. (Proc. Natl. Acad. Sci. USA 101 :9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005) and in US Patent Publication Nos.2007 / 0048776 and 2011 / 0124100 and International Patent Publication No. WO2007 / 025008, the IRES sequences of each of which are incorporated herein by reference. “Translational enhancer polynucleotides” are polynucleotides which include one or more of the specific TEE exemplified herein and / or disclosed in the art (see e.g., U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, U.S. Patent Publication Nos.2009 / 226470, 2007 / 0048776, 2011 / 0124100, 2009 / 0093049, 2013 / 0177581, International Patent Publication Nos. WO2009 / 075886, WO2007 / 025008, WO2012 / 009644, WO2001 / 055371, WO 1999 / 024595, and European Patent Nos.2610341 and 2610340; the TEE sequences of each of which are incorporated herein by reference) or their variants, homologs or functional derivatives. One or multiple copies of a specific TEE can be present in a polynucleotide (e.g., mRNA). The TEEs in the translational enhancer polynucleotides can be organized in one or more sequence segments. A sequence segment can harbor one or more of the specific TEEs exemplified herein, with each TEE being present in one or more copies. When multiple sequence segments are present in a translational enhancer polynucleotide, they can be homogenous or heterogeneous. Thus, the multiple sequence segments in a translational enhancer polynucleotide can harbor identical or different types of the specific TEEs exemplified herein, identical or different number of copies of each of the specific TEEs, and / or identical or different organization of the TEEs within each sequence segment. A polynucleotide (e.g., mRNA) may include at least one TEE that is described in International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, ARD-00925 WO2007 / 025008, WO1999 / 024595, European Patent Publication Nos.2610341 and 2610340, US Patent Nos.6,310,197, 6,849,405, 7,456,273, 7,183,395, and US Patent Publication Nos. 2009 / 0226470, 2011 / 0124100, 2007 / 0048776, 2009 / 0093049, and 2013 / 0177581 the TEE sequences of each of which are incorporated herein by reference. The TEE may be located in the 5'-UTR of the polynucleotides (e.g., mRNA). A polynucleotide (e.g., mRNA) may include at least one TEE that has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity with the TEEs described in US Patent Publication Nos.2009 / 0226470, 2007 / 0048776, 2013 / 0177581 and 2011 / 0124100, International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886 and WO2007 / 025008, European Patent Publication Nos.2610341 and 2610340, US Patent Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, the TEE sequences of each of which are incorporated herein by reference. The 5'-UTR of a polynucleotide (e.g, mRNA) may include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. The TEE sequences in the 5'-UTR of a polynucleotide (e.g, mRNA) may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variants thereof, repeated once, twice, or more than three times. In these patterns, each letter, A, B, or C represent a different TEE sequence at the nucleotide level. In some cases, the 5-UTR may comprise a spacer to separate two TEE sequences. As a non-limiting example, the spacer may be a 15 nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 5' -UTR may include a TEE sequence-spacer module repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the 5'- UTR. In other instances, the spacer separating two TEE sequences may include other sequences known in the art which may regulate the translation of the polynucleotides (e.g., mRNA) of the present disclosure such as, but not limited to, miR sequences (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate two TEE sequences may comprise a different miR sequence or component of a miR sequence (e.g., miR seed sequence). ARD-00925 In some instances, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) may include at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or more than 99% of the TEE sequences disclosed in US Patent Publication Nos.2009 / 0226470, 2007 / 0048776, 2013 / 0177581 and 2011 / 0124100, International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886 and WO2007 / 025008, European Patent Publication Nos. 2610341 and 2610340, and US Patent Nos.6,310,197, 6,849,405, 7,456,273, and 7,183,395, the TEE sequences of each of which are incorporated herein by reference. In other embodiments, the TEE in the 5'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5- 15 nucleotide fragment, a 5-10 nucleotide fragment of the TEE sequences disclosed in US Patent Publication Nos.2009 / 0226470, 2007 / 0048776, 2013 / 0177581 and 2011 / 0124100, International Patent Publication Nos. WO 1999 / 024595, WO2012 / 009644, WO2009 / 075886, and WO2007 / 025008, European Patent Publication Nos.2610341 and 2610340, and US Patent Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395; the TEE sequences of each of which are incorporated herein by reference. In certain cases, the TEE in the 5'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may include at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or more than 99% of the TEE sequences disclosed in Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), in Supplemental Table 1 and in Supplemental Table 2 disclosed by Wellensiek et al (Nature Methods, 2013; DOI: 10.1038 / NMETH.2522); the TEE sequences of each of which are herein incorporated by reference. In other embodiments, the TEE in the 5'-UTR of the polynucleotides (e.g., mRNA) of the present disclosure may include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, a 5-10 nucleotide fragment of the TEE sequences disclosed in Chappell et al. (Proc. Natl. Acad. Sci. USA 101 :9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), in Supplemental Table 1 and in Supplemental Table 2 disclosed by Wellensiek et al (Nature Methods, 2013; DOI: 10.1038 / NMETH.2522); the TEE sequences of each of which is incorporated herein by reference. In some cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is an IRES sequence such as, but not limited to, those described in US Patent No.7,468,275 and ARD-00925 International Patent Publication No. WO2001 / 055369, the TEE sequences of each of which are incorporated herein by reference. In some instances, the TEEs used in the 5'-UTR of a polynucleotide (e.g., mRNA) may be identified by the methods described in US Patent Publication Nos.2007 / 0048776 and 2011 / 0124100 and International Patent Publication Nos. WO2007 / 025008 and WO2012 / 009644, the methods of each of which are incorporated herein by reference. In some cases, the TEEs used in the 5 -UTR of a polynucleotide (e.g. , mRNA) of the present disclosure may be a transcription regulatory element described in US Patent Nos. 7,456,273 and 7,183,395, US Patent Publication No.2009 / 0093049, and International Publication No. WO2001 / 055371, the TEE sequences of each of which is incorporated herein by reference. The transcription regulatory elements may be identified by methods known in the art, such as, but not limited to, the methods described in US Patent Nos.7,456,273 and 7,183,395, US Patent Publication No.2009 / 0093049, and International Publication No. WO2001 / 055371, the methods of each of which is incorporated herein by reference. In yet other instances, the TEE used in the 5 -UTR of a polynucleotide (e.g., mRNA) is a polynucleotide or portion thereof as described in US Patent Nos.7,456,273 and 7,183,395, US Patent Publication No.2009 / 0093049, and International Publication No. WO2001 / 055371, the TEE sequences of each of which are incorporated herein by reference. The 5’-UTR including at least one TEE described herein may be incorporated in a monocistronic sequence such as, but not limited to, a vector system or a polynucleotide vector. As a non-limiting example, the vector systems and polynucleotide vectors may include those described in US Patent Nos.7,456,273 and 7,183,395, US Patent Publication Nos. 2007 / 0048776, 2009 / 0093049 and 2011 / 0124100, and International Patent Publication Nos. WO2007 / 025008 and WO2001 / 055371, the TEE sequences of each of which are incorporated herein by reference. The TEEs described herein may be located in the 5’-UTR and / or the 3’-UTR of the polynucleotides (e.g., mRNA). The TEEs located in the 3'-UTR may be the same and / or different than the TEEs located in and / or described for incorporation in the 5' -UTR. In some cases, the 3'-UTR of a polynucleotide (e.g., mRNA) may include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. The TEE sequences in the 3' -UTR of the polynucleotides (e.g., mRNA) of the present disclosure may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, ARD-00925 AABBAABBAABB, or ABCABCABC, or variants thereof, repeated once, twice, or more than three times. In these patterns, each letter, A, B, or C represent a different TEE sequence at the nucleotide level. In one instance, the 3’-UTR may include a spacer to separate two TEE sequences. As a non-limiting example, the spacer may be a 15 nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 3'-UTR may include a TEE sequence-spacer module repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the 3' - UTR. In other cases, the spacer separating two TEE sequences may include other sequences known in the art which may regulate the translation of the polynucleotides (e.g., mRNA) of the present disclosure such as, but not limited to, miR sequences described herein (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate two TEE sequences may include a different miR sequence or component of a miR sequence (e.g., miR seed sequence). In some embodiments, a polyribonucleotide of the disclosure comprises a miR and / or TEE sequence. In some embodiments, the incorporation of a miR sequence and / or a TEE sequence into a polyribonucleotide of the disclosure can change the shape of the stem loop region, which can increase and / or decrease translation. See e.g., Kedde et al, Nature Cell Biology 201012(10): 1014-20, herein incorporated by reference in its entirety. Table 7B. Exemplary 5’ untranslated regions (UTRs) See SEQ ID NO: 12148 to SEQ ID NO: 12164 for the representative 5’ UTR sequences. SEQ ID NO: 16953 is a 5’ UTR sequence used in the BNT162b2 vaccine (BioNTech / Pfizer) and has the following nucleic acid sequence: GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC (*The above sequence includes RNA sequence in which T is replaced with U or any variant thereof) Table 7C. Exemplary 3’ untranslated regions (UTRs) See SEQ ID NO: 12165 to SEQ ID NO: 12181 for the representative 3’ UTR sequences. SEQ ID NO: 16954 is a 3’ UTR sequence used in the BNT162b2 vaccine (BioNTech / Pfizer) and has the following nucleic acid sequence: CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCC CGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACAC CTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGT GATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTG CCAGCCACACCCTGGAGCTAGC ARD-00925 (*The above sequence includes RNA sequence in which T is replaced with U or any variant thereof) * Included in Tables are RNA nucleic acid molecules (e.g., thymidine replaced with uridine), as well as DNA or RNA nucleic acid sequences or any variant thereof (a structural variant or a chemical variant (e.g., chemically modified nucleotide)) comprising a nucleic acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or more identity across their full length with the nucleic acid sequence of any SEQ ID NO listed in Tables, or a portion thereof. Such nucleic acid molecules can have a function of the full-length nucleic acid (e.g., for the intended function of inducing an immune response) as described further herein. Further included are orthologous nucleic acid sequences. A person of ordinary skill in the art understands how to determine the orthologous nucleic acid sequences (e.g., of subjects, of ruminants, of methanogens, etc.) described herein based on the sequence similarity (e.g., by BLAST search). Internal Ribosome Entry Sites Polynucleotides may contain an internal ribosome entry site (IRES). An IRES may act as the sole ribosome binding site, or may serve as one of multiple ribosome binding sites of an mRNA. A polynucleotide containing more than one functional ribosome binding site may encode several peptides or polypeptides that are translated independently by the ribosomes (e.g., multicistronic mRNA). When polynucleotides are provided with an IRES, further optionally provided is a second translatable region. Examples of IRES sequences that can be used according to the present disclosure include without limitation, those from picomaviruses (e.g., FMDV), pest viruses (CFFV), polio viruses (PV), encephalomyocarditis viruses (ECMV), foot- and-mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses (CSFV), murine leukemia virus (MLV), simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV). Nucleic acid sequence encoding the antigen In some embodiments, the nucleic acid sequences that encode at least one cell surface protein or a fragment thereof of at least one methanogen are present on multiple (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleic acid (e.g., mRNA) molecules. In other embodiments, the nucleic acid sequences that encode at least one cell surface protein or a fragment thereof of at least one methanogen is present on one nucleic acid (e.g., mRNA) molecule. In certain embodiments, nucleic acid sequences encoding multiple (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, or 10) polypeptides are in a nucleic acid (e.g., mRNA) molecule such that translation of the nucleic acid produces a concatemeric polypeptide, which comprises two or ARD-00925 more heterologous polypeptides that are translated as a single fusion polypeptide. In some embodiments, such polypeptides are fragments of one cell surface protein. In other embodiments, such polypeptides are fragments of multiple cell surface proteins. Any variation of the above is contemplated. In preferred embodiments, nucleic acid comprises sequences that encode multiple cell surface proteins or fragments thereof (e.g., antigenic fragment) to maximize the immune response against methanogens. Nucleoside modification To maximize translation, the mRNA sequence typically incorporates modified nucleosides, such as pseudouridine, N1-methylpseudouridine or other nucleoside analogues. Because all native mRNAs include modified nucleosides, the immune system has evolved to recognize unmodified single-stranded RNA, which is a hallmark of viral infection. Specifically, unmodified mRNA is recognized by pattern recognition receptors (PRRs), such as Toll-like receptor 3 (TLR3), TLR7 and TLR8, and the retinoic acid-inducible gene I (RIGI) receptor. TLR7 and TLR8 receptors bind to guanosine- or uridine-rich regions in mRNA and trigger the production of type I interferons, such as IFNα, that can block mRNA translation. The use of modified nucleosides, particularly modified uridine, prevents recognition by pattern recognition receptors, enabling sufficient levels of translation to produce prophylactic amounts of protein. Another strategy to avoid detection by pattern recognition receptors, pioneered by CureVac, uses sequence engineering and codon optimization to deplete uridines by boosting the GC content of the vaccine mRNA. In addition to improvements to the mRNA sequence, significant advances have also been made to streamline mRNA production. Clinically used synthetic mRNA is transcribed in vitro from a DNA plasmid by using the bacteriophage RNA polymerase T7 (T3 and SP6 polymerases can also be used). It is co-transcriptionally capped (e.g., CleanCap, developed by TriLink BioTechnologies) with a 2′-O-methylated cap and purified to remove double-stranded RNA (dsRNA) contaminants, reactants and incomplete transcripts. Other methods add the cap with a post-transcriptional reaction using capping and 2′- O-methyltransferase enzymes derived from the vaccinia virus. The polyA tail is encoded in the DNA template, which eliminates reaction steps and reduces overall production time and material loss. 1. Nucleobase alternatives The alternative nucleosides and nucleotides can comprise an alternative nucleobase. A nucleobase of a nucleic acid is an organic base such as a purine or pyrimidine or a derivative thereof. A nucleobase may be a canonical base (e.g., adenine, guanine, uracil, thymine, and cytosine). These nucleobases can be altered or wholly replaced to provide polynucleotide molecules having enhanced properties, e.g., increased stability such as resistance to nucleases. ARD-00925 Non-canonical or modified bases may comprise, for example, one or more substitutions or modifications including, but are not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and / or thio substitutions; one or more fused or open rings; oxidation; and / or reduction. Alternative nucleotide base pairing encompasses not only the standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and / or alternative nucleotides including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures. One example of such non-standard base pairing is the base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil. In some embodiments, the nucleobase is an alternative uracil. Exemplary nucleobases and nucleosides having an alternative uracil include, but are not limited to, pseudouridine (Ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza- uracil, 2-thio-uracil (s2U), 4-thio-uracil (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uracil (ho5U), 5- aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo- uracil), 3 -methyl-uracil (m3U), 5 -methoxy-uracil (mo5U), uracil 5-oxyacetic acid (cmo5U), uracil 5-oxyacetic acid methyl ester (mcmo5U), 5 -carboxy methyl-uracil (cm5U), 1-carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uracil (chm5U), 5- carboxyhydroxymethyl-uracil methyl ester (mchm5U), 5-methoxycarbonylmethyl-uracil (mcm5U), 5-methoxycarbonylmethyl-2-thio-uracil (mcm5s2U), 5-aminomethyl-2-thio-uracil (nm5s2U), 5-methylaminomethy 1-uracil (mnm5U), 5- methylaminomethyl-2-thio-uracil (mnm5s2U), 5-methylaminomethyl-2-seleno-uracil (mnm5se2U), 5-carbamoylmethy 1-uracil (ncm5U), 5-carboxymethylaminomethyl-uracil (cmnm5U), 5-carboxymethylaminomethyl-2- thio-uracil (cmnm5s2U), 5 -propyny 1-uracil, 1- propynyl-pseudouracil, 5-taurinomethy 1-uracil (xm5U), 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uracil(xm5s2U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m5U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m1Ψ), 5-methyl-2- thio-uracil (m5s2U), l-methyl-4-thio-pseudouridine (m1s4Ψ).4-thio-l-methyl-pseudouridine, 3- methyl-pseudouridine (m3Ψ), 2-thio-l -methyl-pseudouridine, 1 -methyl- 1-deaza-pseudouri dine, 2-thio-l -methyl- 1-deaza- pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6- dihydrouracil, 5-methyl- dihydrouracil (m5D), 2-thio-dihydrouracil, 2-thio- dihydropseudouridine, 2-methoxy-uracil, 2- methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, Nl- methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp3U), l-methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp3Ψ), 5- (isopentenylaminomethyl)uracil (inm5U), 5-(isopentenylaminomethyl)-2-thio-uracil (inm5s2U), 5, 2'-0-dimethy 1-uridine (m5Um), 2-thio- 2'-0_methyl-uridine (s2Um), 5- ARD-00925 methoxycarbonylmethyl-2'-0-methyl-uridine (mcm5Um), 5- carbamoylmethyl-2'-0-methyl- uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-0- methyl-uridine (cmnm5Um), 3, 2'-0- dimethy 1-uridine (m3Um), and 5- (isopentenylaminomethyl)-2'-0-methyl-uridine (inm5Um), 1 - thio-uracil, deoxythymidine, 5- (2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)- uracil, 5 -carbamoylmethy 1-2- thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl- uracil, 5-methoxy-2-thio-uracil, and 5-[3-(l-E-propenylamino)]uracil. In some embodiments, the nucleobase is an alternative cytosine. Exemplary nucleobases and nucleosides having an alternative cytosine include, but are not limited to, 5- aza-cytosine, 6- aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl- cytosine (ac4C), 5- formyl-cytosine (f5C), N4-methy 1-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl- pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4- thio-pseudoisocytidine, 4-thio-l-methyl-pseudoisocytidine, 4-thio-l-methyl-l-deaza- pseudoisocytidine, 1 -methyl-1-deaza-pseudoisocyti dine, zebularine, 5-aza- zebularine, 5- methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytosine, 2-methoxy- 5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-l-methyl- pseudoisocytidine, lysidine (k2C), 5,2'-0-dimethyl-cytidine (m5Cm), N4-acetyl-2'-0-methyl- cytidine (ac4Cm), N4,2'-0-dimethyl-cytidine (m4Cm), 5-formyl-2'-0-methyl-cytidine (f5Cm), N4,N4,2'-0- trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3- azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine. In some embodiments, the nucleobase is an alternative adenine. Exemplary nucleobases and nucleosides having an alternative adenine include, but are not limited to, 2- amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6- halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza- adenine, 7-deaza-8-aza- adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenine (mlA), 2- methyl-adenine (m2A), N6- methyl-adenine (m6A), 2-methylthio-N6-methy 1-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis- hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl- adenine (g6A), N6- threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl- adenine (m6t6A), 2- methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl- adenine (m62A), N6- hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acety 1-adenine (ac6A), 7-methy 1-adenine, 2-methylthio-adenine, 2- methoxy-adenine, N6,2'-0-dimethyl-adenosine (m6Am), N6,N6,2'-0- trimethyl-adenosine (m62Am), l,2'-0-dimethyl-adenosine (ml Am), 2-amino-N6-methy 1-purine, ARD-00925 1 -thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl- adenine, N6- formyl-adenine, and N6-hydroxymethyl-adenine. In some embodiments, the nucleobase is an alternative guanine. Exemplary nucleobases and nucleosides having an alternative guanine include, but are not limited to, inosine (I), 1- methyl-inosine (mlI), wyosine (imG), methylwyosine (mimG), 4-demethyl- wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxy wybutosine (OHyW), undermodified hydroxy wybutosine (OHyW*), 7-deaza- guanine, queuosine (Q), epoxy queuosine (oQ), galactosyl-queuosine (galQ), mannosyl- queuosine (manQ), 7-cyano-7- deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQl), archaeosine (G+), 7-deaza-8- aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methy 1- guanine (m7G), 6-thio-7-methy 1-guanine, 7-methyl- inosine, 6-methoxy -guanine, 1 -methyl- guanine (mlG), N2-methyl-guanine (m2G), N2,N2- dimethyl-guanine (m22G), N2, 7-dimethyl- guanine (m2,7G), N2, N2,7-dimethy 1-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo- guanine, 1 -methyl-6-thio-guanine, N2-methyl-6- thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-0-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-0-methyl-guanosine (m22Gm), l-methyl-2'-0-methyl-guanosine (mlGm), N2,7-dimethyl-2'-0-methyl-guanosine (m2,7Gm), 2'-0- methyl-inosine (Im), 1,2'-O-dimethyl-inosine (mllm), 1 -thio-guanine, and O-6-methyl-guanine. The alternative nucleobase of a nucleotide can be independently a purine, a pyrimidine, a purine or pyrimidine analog. In some embodiments, the nucleobase can be an alternative to adenine, cytosine, guanine, uracil, or hypoxanthine. In another embodiment, the nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including, but not limited to, pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6- azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5- halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7- methylguanine and 7- methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7- deazaguanine, 3- deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4- djpyrimidine, imidazo[l,5-a] 1,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5- d]pyrimidines, pyrazin-2-ones, 1,2,4-triazine, pyridazine; or 1,3,5 triazine. When the nucleotides are depicted using the shorthand A, G, C, T or U, each letter refers to the representative base and / or derivatives thereof, e.g., A includes adenine or adenine analogs, e.g., 7-deaza adenine). ARD-00925 Additional modifications of the nucleotides are taught by e.g., Tables 22, 23, and 25 of WO2015 / 164674, which is incorporated herein by reference. 2. Alteration on the sugar Nucleosides include a sugar molecule (e.g., a 5-carbon or 6-carbon sugar, such as pentose, ribose, arabinose, xylose, glucose, galactose, or a deoxy derivative thereol) in combination with a nucleobase, while nucleotides are nucleosides containing a nucleoside and a phosphate group or alternative group (e.g., boranophosphate, thiophosphate, selenophosphate, phosphonate, alkyl group, amidate, and glycerol). A nucleoside or nucleotide may be a canonical species, e.g., a nucleoside or nucleotide including a canonical nucleobase, sugar, and, in the case of nucleotides, a phosphate group, or may be an alternative nucleoside or nucleotide including one or more alternative components. In some embodiments, alternative nucleosides and nucleotides can be altered on the sugar of the nucleoside or nucleotide. In some embodiments, the alternative nucleosides or nucleotides include the structures described in WO2020 / 160397, which is incorporated herein by reference. In some embodiments, the 2'-hydroxy group (OH) can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, azido, halo (e.g., fluoro), optionally substituted Ci-6 alkyl (e.g., methyl); optionally substituted Ci-6 alkoxy (e.g., methoxy or ethoxy); optionally substituted C6-io aryloxy; optionally substituted C3-8 cycloalkyl; optionally substituted G,-in aryl-Ci-6 alkoxy, optionally substituted Ci-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH2CH2O)nCH2CH2OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20);“locked” nucleic acids (LNA) in which the 2'-hydroxy is connected by a Ci-6 alkylene or Ci-6 heteroalkylene bridge to the 4'-carbon of the same ribose sugar, where exemplary bridges included methylene, propylene, ether, or amino bridges; aminoalkyl, as defined herein; aminoalkoxy, as defined herein; amino as defined herein; and amino acid, as defined herein. Generally, RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (that also has a phosphoramidate ARD-00925 backbone)); multicyclic forms (e.g., tricyclo and “unlocked” forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with a-L- threofuranosyl-(3' 2')), and peptide nucleic acid (PNA, where 2-amino- ethyl-glycine linkages replace the ribose and phosphodiester backbone). In some embodiments, the sugar group contains one or more carbons that possess the opposite stereochemical configuration of the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides containing, e.g., arabinose or L-ribose, as the sugar. In some embodiments, the polynucleotide includes at least one nucleoside wherein the sugar is L-ribose, 2 '-O-methy l-ribose, 2'-fluoro-ribose, arabinose, hexitol, an LNA, or a PNA. 3. Alterations on the internucleoside linkage Alternative nucleotides can be altered on the intemucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases “phosphate” and“phosphodiester” are used interchangeably. Backbone phosphate groups can be altered by replacing one or more of the oxygen atoms with a different substituent. The alternative nucleotides can include the wholesale replacement of an unaltered phosphate moiety with another intemucleoside linkage as described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be altered by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene- phosphonates). The alternative nucleosides and nucleotides can include the replacement of one or more of the non-bridging oxygens with a borane moiety (BFE), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha (a), beta (b) or gamma (g) position) can be replaced with a sulfur (thio) and a methoxy. The replacement of one or more of the oxygen atoms at the a position of the phosphate moiety (e.g., a-thio phosphate) is provided to confer stability (such as against exonucleases and endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment. ARD-00925 Other intemucleoside linkages that may be employed according to the present disclosure, including intemucleoside linkages which do not contain a phosphorous atom, are described herein. Stemp loops Polynucleotides (e.g., mRNAs) may include a stem loop such as, but not limited to, a histone stem loop. The stem loop may be a nucleotide sequence that is about 25 or about 26 nucleotides in length such as, but not limited to, those as described in International Patent Publication No. WO2013 / 103659, which is incorporated herein by reference. The histone stem loop may be located 3'-relative to the coding region (e.g., at the 3'-terminus of the coding region). As a non-limiting example, the stem loop may be located at the 3'-end of a polynucleotide described herein. In some cases, a polynucleotide (e.g., an mRNA) includes more than one stem loop (e.g., two stem loops). Examples of stem loop sequences are described in International Patent Publication Nos. WO2012 / 019780 and WO2015 / 02667, the stem loop sequences of which are herein incorporated by reference. In some instances, a polynucleotide comprises the stem loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 71106). In others, a polynucleotide includes the stem loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 71107). A stem loop may be located in a second terminal region of a polynucleotide. As a non- limiting example, the stem loop may be located within an untranslated region (e.g., 3'- UTR) in a second terminal region. In some cases, a polynucleotide such as, but not limited to mRNA, which includes the histone stem loop may be stabilized by the addition of a 3'-stabilizing region (e.g., a 3'- stabilizing region including at least one chain terminating nucleoside). Not wishing to be bound by theory, the addition of at least one chain terminating nucleoside may slow the degradation of a polynucleotide and thus can increase the half-life of the polynucleotide. In other cases, a polynucleotide such as, but not limited to mRNA, which includes the histone stem loop may be stabilized by an alteration to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligio (U) (see e.g., International Patent Publication No. WO2013 / 103659). In yet other cases, a polynucleotide such as, but not limited to mRNA, which includes the histone stem loop may be stabilized by the addition of an oligonucleotide that terminates in a 3'-deoxynucleoside, 2',3'-dideoxynucleoside 3'-O-methylnucleosides, 3’-O-ethylnucleosides, 3'- arabinosides, and other alternative nucleosides known in the art and / or described herein. In some instances, the polynucleotides of the present disclosure may include a histone stem loop, a polyA region, and / or a 5'-cap structure. The histone stem loop may be before and / or ARD-00925 after the polyA region. The polynucleotides including the histone stem loop and a polyA region sequence may include a chain terminating nucleoside described herein. In other instances, the polynucleotides of the present disclosure may include a histone stem loop and a 5'-cap structure. The 5'-cap structure may include, but is not limited to, those described herein and / or known in the art. In certain instances, the conserved stem loop region may comprise a miR sequence described herein and may also comprise a TEE sequence. In some cases, the incorporation of a miR sequence and / or a TEE sequence changes the shape of the stem loop region which may increase and / or decrease translation. (See, e.g., Kedde et al. (2010) Nature Cell Biology, herein incorporated by reference in its entirety). Polynucleotides may comprise at least one histone stem-loop and a polyA region or polyadenylation signal. Non-limiting examples of polynucleotide sequences encoding for at least one histone stem loop and a polyA region or a polyadenylation signal are described in International Patent Publication No. WO2013 / 120497, WO2013 / 120629, WO2013 / 120500, WO2013 / 120627, WO2013 / 120498, WO2013 / 120626, WO2013 / 120499 and WO2013 / 120628, the sequences of each of which are incorporated herein by reference. PolyA tail Incorporating the polyA tail in the DNA plasmid also overcomes the tail length variability that arises from enzymatic polyadenylation using polyA polymerase. PolyA tails of >100 bp are optimal for therapeutic mRNAs; however, the DNA sequences that encode these long polyA stretches can destabilize the DNA plasmids used for transcription. A solution to overcome this stability issue is to include a short UGC linker in the polyA tail (US 2017 / 0166905, which is incorporated herein by reference). The Pfizer–BioNTech vaccine BNT162b2 against SARS-CoV-2 uses this strategy and contains a 10 bp UGC linker to produce the sequence A30(10 bp UGC linker)A70. Together, these innovations have overcome significant manufacturing bottlenecks and facilitated the development of a simple, cost-effective and scalable one-step mRNA synthesis process. A polynucleotide or nucleic acid (e.g., an mRNA) may include a polyA sequence and / or polyadenylation signal. A polyA sequence may be comprised entirely or mostly of adenine nucleotides or analogs or derivatives thereof. A polyA sequence may be a tail located adjacent to a 3’ untranslated region of a nucleic acid. During RNA processing, a long chain of adenosine nucleotides (polyA region) is normally added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3'-end of the transcript is cleaved to free a 3'- hydroxy. Then ARD-00925 polyA polymerase adds a chain of adenosine nucleotides to the RNA. The process, called polyadenylation, adds a polyA region that is between 100 and 250 residues long. Unique polyA region lengths may provide certain advantages to the alternative polynucleotides of the present disclosure. Generally, the length of a polyA region of the present disclosure is at least 30 nucleotides in length. In another embodiment, the polyA region is at least 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In some instances, the polyA region may be 80 nucleotides, 120 nucleotides, 160 nucleotides in length on an alternative polynucleotide molecule described herein. In other instances, the polyA region may be 20, 40, 80, 100, 120, 140 or 160 nucleotides in length on an alternative polynucleotide molecule described herein. ARD-00925 In some cases, the polyA region is designed relative to the length of the overall alternative polynucleotide. This design may be based on the length of the coding region of the alternative polynucleotide, the length of a particular feature or region of the alternative polynucleotide (such as mRNA), or based on the length of the ultimate product expressed from the alternative polynucleotide. When relative to any feature of the alternative polynucleotide (e.g., other than the mRNA portion which includes the poly-A region) the polyA region may be 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% greater in length than the additional feature. The polyA region may also be designed as a fraction of the alternative polynucleotide to which it belongs. In this context, the polyA region may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct or the total length of the construct minus the polyA region. In certain cases, engineered binding sites and / or the conjugation of polynucleotides (e.g., mRNA) for polyA binding protein may be used to enhance expression. The engineered binding sites may be sensor sequences which can operate as binding sites for ligands of the local microenvironment of the polynucleotides (e.g., mRNA). As a non- limiting example, the polynucleotides (e.g., mRNA) may include at least one engineered binding site to alter the binding affinity of polyA binding protein (PABP) and analogs thereof. The incorporation of at least one engineered binding site may increase the binding affinity of the PABP and analogs thereof. Additionally, multiple distinct polynucleotides (e.g., mRNA) may be linked together to the PABP (polyA binding protein) through the 3'-end using alternative nucleotides at the 3'- terminus of the polyA region. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 hours, 72 hours, and day 7 post-transfection. As a non-limiting example, the transfection experiments may be used to evaluate the effect on PABP or analogs thereof binding affinity as a result of the addition of at least one engineered binding site. In certain cases, a polyA region may be used to modulate translation initiation. While not wishing to be bound by theory, the polyA region recruits PABP which in turn can interact with translation initiation complex and thus may be essential for protein synthesis. In some cases, a polyA region may also be used in the present disclosure to protect against 3'-5'-exonuclease digestion. In some instances, a polynucleotide (e.g., mRNA) may include a polyA-G Quartet. The G-quartet is a cyclic hydrogen bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In such embodiments, the G-quartet is incorporated at the end of the polyA region. The resultant polynucleotides (e.g., mRNA) may be assayed for stability, protein production and other parameters including half- life at various time points. It ARD-00925 has been discovered that the polyA-G quartet results in protein production equivalent to at least 75% of that seen using a polyA region of 120 nucleotides alone. In some cases, a polynucleotide (e.g., mRNA) may include a polyA region and may be stabilized by the addition of a 3 '-stabilizing region. The polynucleotides (e.g., mRNA) with a poly-A region may further include a 5 '-cap structure. In other cases, a polynucleotide (e.g., mRNA) may include a poly-A-G Quartet. The polynucleotides (e.g., mRNA) with a poly-A-G Quartet may further include a 5 '-cap structure. In some cases, the 3 '-stabilizing region which may be used to stabilize a polynucleotide (e.g., mRNA) including a polyA region or poly-A-G Quartet may be, but is not limited to, those described in International Patent Publication No. WO2013 / 103659, the polyA regions and poly- A-G Quartets of which are incorporated herein by reference. In other cases, the 3'-stabilizing region which may be used with the present disclosure include a chain termination nucleoside such as 3'-deoxyadenosine (cordycepin), 3 '-deoxyuridine, 3'- deoxycytosine, 3'- deoxyguanosine, 3 '-deoxythymine, 2',3'-dideoxynucleosides, such as 2', 3'- dideoxyadenosine, 2',3'-dideoxyuridine, 2', 3 '-dideoxycytosine, 2', 3'- dideoxyguanosine, 2 ',3 '-dideoxythymine, a 2'-deoxynucleoside, or an O-methylnucleoside. In other cases, a polynucleotide such as, but not limited to mRNA, which includes a polyA region or a poly-A-G Quartet may be stabilized by an alteration to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligio (U) (see e.g., International Patent Publication No. WO2013 / 103659). In yet other instances, a polynucleotide such as, but not limited to mRNA, which includes a polyA region or a poly-A-G Quartet may be stabilized by the addition of an oligonucleotide that terminates in a 3'-deoxynucleoside, 2',3'-dideoxynucleoside 3 -O- methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other alternative nucleosides known in the art and / or described herein. Chain Terminating Nucleosides A nucleic acid may include a chain terminating nucleoside. In some embodiments, a chain terminating nucleoside may include those nucleosides deoxy genated at the 2’ and / or 3’ positions of their sugar group. Such species may include 3'-deoxyadenosine (cordycepin), 3 '- deoxy uridine, 3'-deoxy cytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2',3'- dideoxynucleosides, such as 2',3’-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxy cytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine. An exemplary utility of a chain terminating nucleoside is described in e.g., US20140342402, which is incorporated herein by reference. For example, a chain terminating nucleoside incorporated at the 3’ end of an mRNA comprising a histone loop stabilizes said ARD-00925 mRNA. Specifically, the chain-terminating nucleoside blocks the addition of a 3’-terminal oligo(U) sequence to the mRNA containing the histone stem-loop. When the 3’-terminal oligo(U) sequence cannot be added, degradation of the mRNA is retarded. The mRNA then remains available to the translational machinery for a longer time, resulting in higher levels of protein synthesis. NUCLEIC ACID VACCINE EXPRESSION In certain aspects, a nucleic acid vaccine of the present disclosure (e.g., a vaccine comprising DNA, RNA, or any variant thereof) may present at least one antigen (e.g., methanogen antigen, cell surface protein of a methanogen or a fragment thereof) as a free antigen, as a secreted antigen, or as a membrane-tethered antigen. In some embodiments, a nucleic acid vaccine presents at least one antigen as a free antigen. In some such embodiments, the nucleic acid vaccine comprises a sequence encoding at least one antigen, but does not comprise a signal peptide sequence or a transmembrane domain sequence. In some embodiments, a polypeptide encoded by such a nucleic acid vaccine may reside in the cell cytoplasm. In some embodiments, a nucleic acid vaccine presents at least one antigen as a secreted antigen. In some such embodiments, the nucleic acid vaccine comprises a sequence encoding at least one antigen and a signal peptide sequence, but does not comprise a transmembrane domain sequence. In some embodiments, a polypeptide encoded by such a nucleic acid vaccine is secreted from a cell. In some embodiments, a nucleic acid vaccine presents at least one antigen as a membrane-tethered antigen. In some such embodiments, the nucleic acid vaccine comprises a sequence encoding at least one antigen, a signal peptide sequence, and a transmembrane domain sequence. In some embodiments, a polypeptide encoded by such a nucleic acid vaccine is tethered to a cell membrane. In preferred embodiments, a polypeptide encoded by such a nucleic acid vaccine is tethered to a cell cytoplasmic membrane. In certain aspects, any signal peptide sequence can be used in a nucleic acid vaccine of the present disclosure. In some embodiments, a signal peptide sequence is of bos taurus (cow). Signal peptide sequences are known in the art. For example, signal peptide sequences of various mammals (e.g., ruminants) are available at World Wide Web at signalpeptide.de and uniprot.org. Representative sequences are shown in Table 7D. In some embodiments, a signal peptide sequence is from any one of the mRNA vaccines that are known in the art. For example, in some embodiments, a signal peptide sequence is from a COVID-19 mRNA vaccine. In some embodiments, a signal peptide sequence is from the ARD-00925 BNT162b2 vaccine (BioNTech / Pfizer). In some embodiments, a signal peptide sequence is from the mRNA-1273 vaccine (Moderna). In some embodiments, a signal peptide sequence of the BNT162b2 SARS CoV2 spike- encoding mRNA vaccine (BioNTech / Pfizer) is used for the nucleic acid vaccine of the present disclosure. An exemplary sequence is shown in Table 7F. Said sequence is also described at World Wide Web at github.com / NAalytics / Assemblies-of-putative-SARS-CoV2-spike- encoding-mRNA-sequences-for-vaccines-BNT-162b2-and-mRNA-1273 / . In certain aspects, any transmembrane domain sequence can be used in a nucleic acid vaccine of the present disclosure. In some embodiments, a transmembrane domain sequence is from any one of the mRNA vaccines that are known in the art. For example, in some embodiments, a transmembrane domain sequence is from a COVID-19 mRNA vaccine. In some embodiments, a transmembrane domain sequence is from the BNT162b2 vaccine (BioNTech / Pfizer). In some embodiments, a transmembrane domain sequence is from the mRNA-1273 vaccine (Moderna). In some embodiments, a transmembrane domain sequence is of bos taurus (cow). Comprehensive signal peptide sequences are known in the art. For example, transmembrane domain sequences of various mammals (e.g., ruminants) are available at World Wide Web at membranome.org and also described in Lomize et al., (2017) Nucleic Acids Research 45:250- 255, which is incorporated herein by reference. Representative sequences are shown in Table 7E. In some embodiments, a transmembrane domain sequence of the BNT162b2 SARS CoV2 spike-encoding mRNA vaccine (BioNTech / Pfizer) is used for the nucleic acid vaccine of the present disclosure. An exemplary sequence is shown in Table 7F. In some embodiments, a cytoplasmic domain sequence of the BNT162b2 SARS CoV2 spike-encoding mRNA vaccine (BioNTech / Pfizer) is used for the nucleic acid vaccine of the present disclosure. In some embodiments, both the transmembrane domain and cytoplasmic domain sequences of the BNT162b2 SARS CoV2 spike-encoding mRNA vaccine (BioNTech / Pfizer) are used for the nucleic acid vaccine of the present disclosure. An exemplary sequence is shown in Table 7F. Such transmembrane domain and cytoplasmic domain sequences are available at World Wide Web at github.com / NAalytics / Assemblies-of-putative-SARS-CoV2-spike-encoding-mRNA- sequences-for-vaccines-BNT-162b2-and-mRNA-1273 / . Table 7D. Representative signal peptide sequences of Bos Taurus (cow) See SEQ ID NO: 12182 to SEQ ID NO: 12361 for the representative signal peptide sequences of Bos Taurus (cow). ARD-00925 Table 7E. Representative transmembrane (TM) sequences of Bos Taurus (cow) genome See SEQ ID NO: 12362 to SEQ ID NO: 16672 for the representative transmembrane sequences of Bos Taurus (cow). See also SEQ ID NOS 77649-81956 for representative transmembrane sequences. Table 7F. Exemplary signal peptide sequence, transmembrane (TM) domain sequence, and cytoplasmic domain sequence of the BNT162b2 SARS CoV2 spike-encoding mRNA vaccine PHARMACEUTICAL COMPOSITION Vaccines, antibodies, milk, animal feed, agents (e.g., an agent that reduces methane production in a subject, a probiotic bacterial strain, etc.), or other compositions of the present disclosure may be in a pharmaceutical composition, and thus further comprise at least one excipient and / or carrier described herein or those known in the art. The vaccine of the present disclosure (e.g., protein vaccine, nucleic acid vaccine (e.g., DNA vaccine, RNA vaccine, etc.) may comprise at least one excipient that (1) increases stability; (2) increases cell transfection; (3) permits the sustained or delayed release (e.g., from a depot formulation); (4) alters the biodistribution (e.g., target to specific tissues or cell types); (5) increases the translation of encoded protein in vivo; and / or (6) alter the release profile of encoded protein (antigen) in vivo. In addition to traditional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active...
Claims
ARD-00925 What is claimed is:
1. A vaccine composition comprising at least one nucleic acid encoding at least one cell surface protein or a fragment thereof (e.g., an antigenic fragment, e.g., a fragment comprising an epitope, e.g., a fragment comprising an extracellular domain or a portion thereof) of at least one methanogen.
2. The vaccine composition of claim 1, wherein (a) the at least one methanogen is of a family Methanobacteriaceae; (b) the at least one methanogen is of a genus selected from: Methanobrevibacter, Methanosphaera, Methanomicrobium, Methanobacterium, Methanocorpusulum, Methanosaeta, Methanoculleus, Methanosarcina, and Thermoplasmatales, optionally Methanobrevibacter, Methanomicrobium, and Methanosarcina; and / or (c) the at least one methanogen comprises Methanobacterium formicicum, Methanobacterium bryantii, Methanobrevibacter ruminantium, Methanobrevibacter millerae, Methanobrevibacter olleyae, Methanomicrobium mobile, Methanoculleus olentangyi, Methanosarcina barkeri, Methanobrevibacter boviskoreani, Methanobacterium beijingense, Methanoculleus marisnigri, Methanoculleus bourgensis, Methanosarcina mazei, Thermoplasmatales archaeon BRNA1, Methanobrevibacter gottschalkii, Methanobrevibacter thaueri, Methanobrevibacter smithii, Methanosphaera stadtmanae, Methanococcoides burtonii, Methanolobus psychrophilus R15, Methanobacterium paludism, Methanohalobium evestigatum, Methanomethylovorans hollandica, Methanothrix soehngenii, Methanocaldococcus vulcanius, Methanosalsum zhilinae, Methanocorpusculum labreanum, Methanoregula formicica, Methanoculleus marisnigri, Methanocella arvoryzae, Methanoculleus bourgensis, Methanolacinia petrolearia, Methanospirillum hungatei, Methanoplanus limicola, Methanohalophilus mahii, Methanococcus aeolicus, Methanosphaerula palustris, Methanocaldococcus fervens, Methanocaldococcus jannaschii, Methanocaldococcus sp. FS406- 22, Methanoregula boonei, Methanobrevibacter sp. AbM4, Methanobrevibacter ruminantium, Methanosphaera, Methanobacterium formicicum, Methanocaldococcus villosus, Methanosarcina barkeri, Methanobacterium lacus, Methanotorris igneus, Methanotorris formicicus, Methanocaldococcus infernus, Methanofollis liminatans, Methanothermococcus okinawensis, Methanobrevibacter smithii, Methanobrevibacter, Methanocella conradii, Methanothermococcus thermolithotrophicus, Methanococcus maripaludis, Methanococcus maripaludis, Methanococcus vannielii, Methanothermus fervidus, Methanosarcina acetivorans, Methanosarcina mazei, Methanosaeta harundinacea 6Ac, Methanococcus maripaludis,ARD-00925 Methanococcus voltae, Methanolinea tarda, Methanolobus psychrophilus, Methanosaeta harundinacea, or any combination thereof.
3. The vaccine composition of claim 1 or 2, wherein the at least one methanogen comprises Methanobrevibacter gottschalkii and / or Methanobrevibacter ruminantium.
4. The vaccine composition of any one of claims 1-3, wherein the vaccine composition is monovalent.
5. The vaccine composition of any one of claims 1-3, wherein the vaccine composition is multivalent, optionally wherein the at least one methanogen comprises at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 methanogens.
6. The vaccine composition of claim 5, wherein (a) the vaccine composition comprises at least one nucleic acid encoding at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 polypeptides (e.g., of one cell surface protein or of multiple cell surface proteins; or fragments thereof); or (b) the vaccine composition comprises at least one nucleic acid encoding at least 15, 20, 30, 40, 50, or 100 polypeptides (e.g., of one cell surface protein or of multiple cell surface proteins; or fragments thereof).
7. The vaccine composition any one of claims 1-8, wherein at least one nucleic acid encodes a concatemeric polypeptide.
8. The vaccine composition of any one of claims 1-7, wherein the at least one cell surface protein or a fragment thereof comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to an amino acid sequence of the present disclosure, optionally wherein the at least one cell surface protein or a fragment thereof comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to an amino acid sequence set forth in any one of Tables C, 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A-6F, 17A, and 19-21, or a fragment thereof.
9. The vaccine composition of any one of claims 1-8, wherein the at least one cell surface protein or a fragment thereof comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to an amino acid sequence encoded by at least oneARD-00925 nucleic acid of the present disclosure, optionally wherein the at least one nucleic acid comprises the nucleotide sequence set forth in any one of Tables C, 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A-6F, 17A, and 19-21, or a fragment thereof.
10. The vaccine composition of any one of claims 1-9, wherein the at least one nucleic acid comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to a nucleotide sequence of the present disclosure, optionally wherein the at least one nucleic acid comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99%, or 100% sequence identity to a nucleotide sequence set forth in Tables C, 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A, 5B, 6A-6F, 17A, and 19-21, or a fragment thereof.
11. The vaccine composition of any one of claims 1-10, wherein the at least one nucleic acid encodes at least one fragment of the at least one cell surface protein.
12. The vaccine composition of claim 11, wherein the at least one fragment: (a) comprises an extracellular domain or a portion thereof; (b) lacks a signal peptide, optionally a native signal peptide; and / or (c) lacks a transmembrane domain, optionally a native transmembrane domain.
13. The vaccine composition of claim 11 or 12, wherein the at least one fragment lacks at least, about, or no more than 1, 5, 10, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100 amino acids, optionally from the N-terminus and / or the C-terminus.
14. The vaccine composition of any one of claims 1-13, wherein the at least one cell surface protein or a fragment thereof comprises an adhesin-like protein; adhesin-like protein with cysteine protease domain; tetrahydromethanopterin S-methyltransferase subunit; ATP- processing protein; cell wall biosynthesis protein; cofactor biosynthesis protein; CRISPR protein; energy metabolism protein; enzyme; fatty acid synthesis protein; general metabolism protein; membrane protein; metal-binding protein; methanogenesis protein; Mtr protein; MtrE protein; phage-related protein; proteolysis protein; transcription regulation protein; ribosomal protein; substrate binding protein; transcription protein; transport protein; protein whose expression changes in response to lauric acid stress; a fragment thereof; and / or any combination thereof (optionally those listed in e.g., Table 6F).ARD-00925 15. The vaccine composition of any one of claims 1-14, wherein the at least one nucleic acid is codon-optimized for expression in a ruminant, a canine, a feline, or a human, optionally codon-optimized for expression in Bos taurus.
16. The vaccine composition of any one of claims 1-15, wherein the at least one nucleic acid is a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA).
17. The vaccine composition of any one of claims 1-16, wherein the at least one nucleic acid is DNA.
18. The vaccine composition of claim 17, wherein the DNA comprises coding and non- coding sequences.
19. The vaccine composition of claim 17 or 18, wherein the DNA is operably linked to a promoter.
20. The vaccine composition of claim 19, wherein the promoter is selected form CMV promoter, CAG promoter, SCP promoter, CMVe-SCP, CMVmax, JET, PGK, EF-1a, AHSP promoter, MND promoter, Wiskott-Aldrich promoter, and PKLR promoter.
21. The vaccine composition of any one of claims 17-20, wherein the DNA comprises: (a) a transcription regulatory element (e.g., an enhancer, a transcription termination sequence, a proximal promoter element, a locus control region); and / or (b) a translation regulatory element (e.g., Kozak sequence, an untranslated region (5’ UTR or 3’ UTR), a polyadenylation signal sequence).
22. The vaccine composition of any one of claims 17-21, wherein the DNA further comprises (a) a sequence encoding a signal peptide (e.g., Table 7D and Table 7F); and / or (b) a sequence encoding a transmembrane domain, optionally further comprising a cytoplasmic domain (e.g., Table 7E and Table 7F).
23. The vaccine composition of any one of claims 17-22, wherein the DNA is linear or circular.ARD-00925 24. The vaccine composition of any one of claims 17-23, wherein the DNA is double- stranded or single-stranded.
25. The vaccine composition of any one of claims 17-24, wherein the DNA is single- stranded and comprises at least one hairpin.
26. The vaccine composition of any one of claims 17-24, wherein the DNA is double- stranded and comprises a telomeric sequence (e.g., a closed linear DNA, e.g., dbDNA™).
27. The vaccine composition of any one of claims 17-26, wherein the DNA comprises at least one chemical modification.
28. The vaccine composition of claim 27, wherein the at least one chemical modification is a terminal modification, which is present at 5’ end and / or 3’ end.
29. The vaccine composition of claim 27 or 28, wherein the at least one chemical modification comprises phosphorothioate, triethylene glycol (TEG), Locked Nucleic Acid (LNA, a 2’-oxygen-4’-carbon methylene linkage), hexaethylene glycol (Sp18), 1,3-propanediol (SpC3), 2’-O-methoxyethyl (MOE) ribonucleotides, 2’-O-methyl ribonucleotides (2’-OMe), 2’- fluoro (2’-F) nucleotides, or any combination thereof.
30. The vaccine composition of claim 29, wherein the at least one chemical modification comprises at least five consecutive phosphorothioate bonds.
31. The vaccine composition of claim 29 or 30, wherein the at least one chemical modification comprises at least three consecutive 2’-O-methyl nucleosides and / or 2’-O- methoxyethyl nucleosides.
32. The vaccine composition of any one of claims 17-31, wherein the DNA is in a vector.
33. The vaccine composition of claim 32, wherein the vector is a plasmid.
34. The vaccine composition of any one of claims 17-33, wherein the DNA is packaged in a virus, e.g., AAV, e.g., bovine AAV (e.g., for transduction to a subject).ARD-00925 35. The vaccine composition of any one of claims 1-16, wherein the at least one nucleic acid is RNA (e.g., mRNA).
36. The vaccine composition of claim 35, wherein the RNA comprises a 5’ cap.
37. The vaccine composition of claim 35 or 36, wherein the RNA comprises the 5’ cap with at least one chemical modification.
38. The vaccine composition of any one of claims 35-37, wherein the 5’ terminal cap is selected from: (a) (Cap 0) m7G(5’)pppN1pN2p; (b) (Cap 1) m7G(5’)pppN1mpNp; (c) (Cap 2) m7G(5’)pppN1mpN2mp; (d) (Cap 4) m7Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up; and (e) Anti-reverse Cap Analog (ARCA).
39. The vaccine composition of any one of claims 35-38, wherein the RNA comprises 5’ UTR.
40. The vaccine composition of claim 39, wherein the 5’ UTR comprises a secondary structure.
41. The vaccine composition of claim 39, wherein the 5’ UTR does not comprise a secondary structure.
42. The vaccine composition of any one of claims 39-41, wherein the 5’ UTR comprises a Kozak sequence and / or at least one translational enhancer element (TEE).
43. The vaccine composition of claim 42, wherein the TEE comprises internal ribosome entry site (IRES).
44. The vaccine composition of any one of claims 39-43, wherein the 5’ UTR comprises a nucleic acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to:ARD-00925 (a) the 5’ UTR or a fragment thereof of a gene that is highly expressed in muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), endothelial cells (e.g., Tie-1, CD36), or lung epithelial cells (e.g., SP-A / B / C / D); and / or (b) any one of the 5’ UTRs or a fragment thereof listed in Table 7B.
45. The vaccine composition of any one of claims 35-44, wherein the RNA comprises a 3’ UTR.
46. The vaccine composition of claim 45, wherein the 3’ UTR comprises a secondary structure.
47. The vaccine composition of claim 45, wherein the 3’ UTR does not comprise a secondary structure.
48. The vaccine composition of any one of claims 45-47, wherein the 3’ UTR comprises at least one translational enhancer element (TEE) and / or a stem loop (e.g., a histone stem loop).
49. The vaccine composition of any one of claims 45-48, wherein the 3’ UTR comprises a nucleic acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to any one of the 3’ UTRs listed in Table 7C.
50. The vaccine composition of any one of claims 35-49, wherein the RNA comprises a polyA tail or a polyadenylation signal.
51. The vaccine composition of claim 50, wherein the polyA tail is at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 bps long.
52. The vaccine composition of claim 50 or 51, wherein the polyA tail is about 100-150 bps long.
53. The vaccine composition of any one of claims 50-52, wherein the polyA tail comprises a linker (e.g., that disrupts the polyA tail).
54. The vaccine composition of claim 53, wherein the linker comprises the sequence UGC or a plurality thereof (e.g., multiple copies of the UGC linker).ARD-00925 55. The vaccine composition of any one of claims 35-54, wherein the RNA comprises a sequence encoding a signal peptide, optionally wherein the sequence encodes a signal peptide selected from the signal peptides listed in Table 7D and Table 7F.
56. The vaccine composition of any one of claims 35-55, wherein the RNA comprises a sequence encoding a transmembrane (TM) domain and / or a sequence encoding cytoplasmic domain, optionally wherein the sequence encodes a transmembrane domain and / or a cytoplasmic domain selected from those listed in Table 7E and Table 7F.
57. The vaccine composition of any one of claims 35-56, wherein the RNA comprises: (a) a 5’ cap, a 5’ untranslated region (UTR), a sequence encoding at least one cell surface protein or a fragment thereof of at least one methanogen, a 3’ UTR, and a polyA tail; (b) a 5’ cap, a 5’ UTR, a sequence encoding a signal peptide, a sequence encoding at least one cell surface protein or a fragment thereof of at least one methanogen, a 3’ UTR, and a poly A tail; or (c) a 5’ cap, a 5’ UTR, a sequence encoding a signal peptide, a sequence encoding at least one cell surface protein or a fragment thereof of at least one methanogen, a sequence encoding a transmembrane domain, optionally further comprising a sequence encoding a cytoplasmic domain, 3’ UTR, and a poly A tail.
58. The vaccine composition of any one of claims 35-57, wherein the at least one cell surface protein or a fragment thereof of at least one methanogen is expressed as a cytoplasmic protein, as a secreted protein, or as a membrane-tethered protein.
59. The vaccine composition of any one of claims 35-58, wherein the RNA comprises at least one chemical modification.
60. The vaccine composition of claim 59, wherein the chemical modification is in the sequence encoding at least one cell surface protein or a fragment thereof of at least one methanogen.
61. The vaccine composition of any one of claims 35-60, wherein the RNA comprises at least one chemical modification selected from pyridin-4-one ribonucleoside, 5-aza-uridine, 2- thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxyuridine,ARD-00925 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-propynyl- uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1- taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio- uridine, 5-methyl-uridine, 1-methyl- pseudouridine, 4-thio-l-methyl-pseudouridine, 2- thio- 1 -methyl-pseudouridine, 1 -methyl-1- deaza-pseudouridine, 2-thio- 1 -methyl- 1 -deaza- pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza- cytidine, pseudoisocytidine, 3- methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4- methylcytidine, 5- hydroxymethylcytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4- thio- 1 -methyl-pseudoisocytidine, 4-thio- 1 -methyl- 1 -deaza-pseudoisocytidine, 1 -methyl- 1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2- thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4- methoxy- pseudoisocytidine, 4-methoxy- 1 -methyl-pseudoisocytidine, 2-aminopurine, 2, 6- diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7- deaza-8- aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6- diaminopurine, 1 - methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6- (cis- hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6- glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2- methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7- methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine, inosine, 1 -methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7- deaza-8-aza-guanosine, 6-thio-guanosine, 6- thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza- guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methylinosine, 6-methoxy- guanosine, 1 -methylguanosine, N2- methylguanosine, N2,N2-dimethylguanosine, 8-oxo- guanosine, 7-methyl-8-oxo- guanosine, l-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2- dimethyl-6-thio-guanosine, and any combination thereof.
62. The vaccine composition of any one of claims 35-61, wherein the RNA comprises a chemical modification in at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% of the uracils in the sequence encoding at least one cell surface protein or a fragment thereof of at least one methanogen.
63. The vaccine composition of claim 62, wherein the chemical modification is in the 5- position of the uracil.ARD-00925 64. The vaccine composition of claim 62 or 63, wherein the at least one chemical modification is selected from the group consisting of pseudouridine, N1-methyl pseudouridine,’2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza- pseudouridine, 2-thio-l- methyl-pseudouridine, 2-thio-5-aza-uridine , 2-thio- dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio- pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-meth’xyuridine, and 2'-O-methyl uridine.
65. The vaccine composition of any one of claims 62-64, wherein the chemical modification comprises N1-methyl pseudouridine.
66. The vaccine composition of any one of claims 1-65, wherein in the vaccine composition is a pharmaceutical composition comprising at least one carrier and / or at least one excipient.
67. The vaccine composition of any one of claims 1-66, wherein the vaccine is formulated in lipid or saline.
68. The vaccine composition of any one of claims 1-67, wherein the vaccine is formulated in lipid.
69. The vaccine composition of any one of claims 1-68, wherein the nucleic acid (e.g., DNA or RNA) to total lipid ratio is at least about 0.05 (wt / wt).
70. The vaccine composition of any one of claims 1-69, wherein the vaccine is formulated in a liposome, a lipoplex, or a lipid nanoparticle.
71. The vaccine composition of claim 70, wherein the vaccine is formulated in a lipid nanoparticle.
72. The vaccine composition of claim 70 or 71, wherein the vaccine is formulated in a lipid nanoparticle comprising an ionizable lipid, a helper lipid, a PEGylated lipid, a structural lipid (e.g., sterol), or any combination thereof.
73. The vaccine composition of any one of claims 70-72, wherein the lipid nanoparticle comprises an ionizable lipid, a helper lipid, a PEGylated lipid, and a structural lipid (e.g., sterol).ARD-00925 74. The vaccine composition of claim 72 or 73, wherein: (a) the ionizable lipid is an ionizable cationic lipid; and / or (b) the helper lipid is a neutral lipid.
75. The vaccine composition of any one of claims 70-74, wherein the lipid nanoparticle has a molar ratio of about 20-60% ionizable lipid: about 5-25% helper lipid: about 25-55% structural lipid; and about 0.5-15% PEGylated lipid.
76. The vaccine composition of any one of claims 70-75, wherein the lipid nanoparticle has a molar ratio of about 50% ionizable lipid: about 10% helper lipid: about 38.5% structural lipid; and about 1.5% PEGylated lipid.
77. The vaccine composition of any one of claims 72-76, wherein the ionizable lipid comprises 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane (DLin-KC2- DMA), dilinoleyl- methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)- non-2-en-l-yl) 9-((4- (dimethylamino)butanoyl)oxy)heptadecanedioate (L319), 4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate (ALC-0315), SM-102, A18-Iso5-2DC18, A6, 306Oi10, or any combination thereof.
78. The vaccine composition of any one of claims 72-77, wherein the PEGylated lipid comprises (2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (PEG2000-DMA (also called ALC-0159)); and / or polyethylene glycol 2000 dimyristoyl glycerol (PEG2000-DMG).
79. The vaccine composition of any one of claims 72-78, wherein the helper lipid comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and / or 1,2-dioleoyl-sn- glycero-3- phosphoethanolamine (DOPE).
80. The vaccine composition of any one of claims 72-79, wherein the structural lipid comprises: cholesterol, β-Sitosterol, 20α-Hydroxycholesterol, sterol, or any combination thereof.
81. The vaccine composition of any one of claims 70-80, wherein the lipid nanoparticle comprises SM-102, polyethylene glycol 2000 dimyristoyl glycerol (PEG2000-DMG), 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), and cholesterol.ARD-00925 82. The vaccine composition of any one of claims 70-80, wherein the lipid nanoparticle comprises ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate, 2- (polyethylene glycol 2000)-N,N-ditetradecylacetamide (PEG2000-DMA), 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), and cholesterol 83. The vaccine composition of any one of claims 1-82, further comprising potassium chloride, monobasic potassium phosphate, sodium chloride, dibasic sodium phosphate dihydrate, sucrose, or any combination thereof.
84. The vaccine composition of any one of claims 1-82, further comprising tromethamine, tromethamine hydrochloride, sucrose, or any combination thereof.
85. The vaccine composition of any one of claims 70-84, wherein the nanoparticle has: (a) a mean diameter of about 50 nm to about 200 nm, optionally about 80 nm to about 100 nm; (b) a polydispersity index (PDI) of less than 0.4; and / or (c) a net neutral charge at a neutral pH.
86. The vaccine composition of any one of claims 1-85, further comprising at least one adjuvant.
87. The vaccine composition of claim 86, wherein the at least one adjuvant comprises (a) inorganic salts, preferably aluminum and calcium salts; (b) an oil emulsion; (c) saponins; (d) lipid or liposomes (e) an immune-stimulating complex; (f) a bacterial product or derivatives thereof (e.g., bacterial toxins, lipopolysaccharide, etc.); (g) a cytokine; or (h) any combination of two or more selected from (a)-(g).
88. The vaccine composition of claim 86 or 87, wherein the at least one adjuvant comprises Complete Freund’s adjuvant, Incomplete Freund’s adjuvant, Montanide ISA70, Montanide ISA61, Saponin, chitosan thermogel, lipid (e.g., monophosphoryl lipid A), a lipidARD-00925 nanoparticle / cationic liposome adjuvant, Emulsigen-D, Emulsigen, Emulsigen-P, Polygen, ENABL 06, Montainde ISA 201, Montanide Gel 02, or any combination of two or more thereof.
89. The vaccine composition of any one of claims 1-88, further comprising a transfection facilitating compound.
90. The vaccine composition of claim 89, wherein the transfection facilitating compound comprises (±)-N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide) (DMRIE).
91. A method of treating a disease in a subject, the method comprising administering to the subject a vaccine composition of any one of claims 1-90.
92. The method of claim 91, wherein the disease is a periodontal disease, Inflammatory Bowel Disease (IBD), irritable bowel syndrome (ISB), ISB-C, small instestinal bacterial overgrowth (SIBO), colorectal cancer, obesity, metabolic syndrome, diverticulosis and diverticulitis, liver abscess, gingivitis, and / or bloat.
93. The method of claim 91 or 92, wherein the disease is associated with elevated, increased, or severe lactic acidosis.
94. A method of inducing an immune response against at least one methanogen in a subject, the method comprising administering to the subject the vaccine composition of any one of claims 1-90.
95. The method of claim 95, wherein the immune response comprises a B cell response and / or a T cell response, preferably a B cell response.
96. A method of reducing lactate in a digestive tract and / or increasing pH in a digestive stract in a subject, the method comprising administering to the subject the vaccine of any one of claims 1-90.
97. A method of reducing the activity, number, and / or type of methanogens in a digestive tract of a subject, the method comprising administering to the subject the vaccine composition of any one of claims 1-90.ARD-00925 98. The method of claim 96 or 97, wherein the digestive track comprises rumen, reticulum, omasum, abomasum, stomach, small intestine, large intestine, and / or rectum, preferably rumen.
99. A method of reducing the amount of methane (CH4) and / or hydrogen (H2) emitted by a subject, preferably eructated and / or exhaled, the method comprising administering to the subject the vaccine composition of any one of claims 1-90.
100. The method of claim 99, wherein the amount of methane (CH4) and / or hydrogen (H2) is reduced by about 5-100%, preferably by about 10-100%, compared to a control, optionally wherein the amount of methane (CH4) and / or hydrogen (H2) is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control.
101. The method of claim 99 or 100, wherein the amount of methane (CH4) and / or hydrogen (H2) is reduced by about 20-100%, preferably by about 30-100%, compared to a control.
102. The method of any one of claims 99-101, wherein the amount of methane (CH4) is reduced by (a) about 1 kg – about 50 kg within 8 weeks from the time of first vaccination, or (b) about 5 kg – about 300 kg within a year from the time of first vaccination, compared to a control.
103. The method of any one of claims 99-102, wherein the amount of methane (CH4) normalized to an amount of CO2emitted by the subject (i.e., CH4 / CO2) is reduced by about 5- 100%, preferably by about 10-100%, compared to a control, optionally wherein the amount of methane (CH4) normalized to the amount of CO2 is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control.
104. The method of claim 103, wherein the amount of methane (CH4) normalized to the amount of CO2is reduced by about 20-100%, preferably by about 30-100%, compared to a control.ARD-00925 105. The method of any one of claims 99-104, wherein the amount of hydrogen (H2) is reduced by (a) about 10 g – about 500 g within 8 weeks from the time of first vaccination, or (b) about 50 g – about 3 kg within a year from the time of first vaccination, compared to a control.
106. A method of increasing the amount of carbon dioxide (CO2) emitted by a subject, preferably eructated and / or exhaled, the method comprising administering to the subject the vaccine composition of any one of claims 1-90.
107. The method of claim 106, wherein the amount of carbon dioxide (CO2) is increased by about 1-100%, preferably by about 1-20%, compared to a control, optionally wherein the amount of CO2is increased by at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control.
108. The method of claim 106 or 107, wherein the amount of carbon dioxide (CO2) is increased by about 3-10%, preferably by about 3-20%, compared to a control.
109. The method of any one of claims 106-108, wherein the amount of carbon dioxide (CO2) is increased by (a) about 29.8 kg – about 1,490 kg within 8 weeks from the time of first vaccination, or (b) about 149 kg – about 8,940 kg within a year from the time of first vaccination, compared to a control.
110. The method of any one of claims 100-109, wherein the control is: (a) an accepted reference; (b) the amount of methane, CO2-normalized methane, hydrogen, or carbon dioxide emitted by an unvaccinated subject; or (c) the amount of methane, CO2-normalized methane, hydrogen, or carbon dioxide emitted by the vaccinated subject prior to vaccination.
111. The method of any one of claims 91-110, wherein the subject produces an antibody against at least one methanogen, optionally wherein the antibody is an IgG, IgM, or an IgA, preferably an IgA or IgM.
112. The method of claim 111, wherein the antibody is produced in an amount sufficient to: (a) be detectable in the digestive tract;ARD-00925 (b) reduce the number and / or alter the relative abundances of methanogens in the digestive tract; (c) reduce the amount of methane, the CO2-normalized methane, and / or hydrogen emitted by the subject; and / or (d) increase the amount of CO2 emitted by the subject.
113. The method of any one of claims 91-112, wherein the vaccine or the pharmaceutical composition is administered to the subject via a route selected from intramuscular administration, intradermal administration, subcutaneous administration, and nasal administration.
114. The method of any one of claims 91-113, wherein the subject is administered with at least one dose of the vaccine composition.
115. The method of any one of claims 91-114, wherein the subject is administered with at least one or two repeat doses of the vaccine composition (e.g., booster dose).
116. The method of claim 114 or 115, wherein the subject is administered with the vaccine composition at least 3 times per year.
117. The method of claim 115 or 116, wherein the at least one repeat dose comprises the same dose or a different dose (e.g., number or amount of cells and / or cell parts) compared to the preceding dose of the vaccine composition.
118. The method of any one of claims 115-117, wherein the at least one repeat dose comprises the same adjuvant or a different adjuvant compared to the preceding dose of the vaccine composition.
119. The method of any one of claims 115-118, wherein the subject is administered with the repeat dose of the vaccine composition after at least about 2 weeks, about 3 weeks, about 1 month, about 6 months, or about 12 months from the time the subject is administered with the preceding dose of the vaccine composition.
120. The method of any one of claims 115-119, wherein the subject is administered with the repeat dose of the vaccine composition no later than about 1 month, about 2 months, about 3ARD-00925 months, 6 months, 12 months, 18 months, or 24 months from the time the subject is administered with the preceding dose of the vaccine composition.
121. The method of any one of claims 115-120, wherein the subject receives the repeat dose of the vaccine after at least about 2 weeks and no more than about 18 months from the time the subject is administered with the preceding dose of the vaccine.
122. The method of any one of claims 115-121, wherein the subject is administered with at least two repeat doses of the vaccine composition, and the subject receives: (a) the first repeat dose (“boost 1”) after about 2 weeks to about 4 weeks from the time the subject is administered with the initial vaccine dose (“prime”); and / or (b) the second repeat dose (“boost 2”) after about 3 months to about 6 months from the time the subject is administered with the initial vaccine dose (“prime”).
123. The method of any one of claims 91-122, wherein the subject is administered with a dosage of between 1 ug / kg and 400 ug / kg (ug nucleic acid / kg of the subject).
124. The method of any one of claims 91-123, wherein the subject is administered with a dosage of the nucleic acid comprising at least about 25 ug, 50 ug, 100 ug, 150 ug, 200 ug, 250 ug, or 300 ug of the RNA, optionally 100 ug, 200 ug, or 300 ug.
125. The method of any one of claims 91-124, further comprising administering to the subject (a) at least one agent that reduces the level of methane (CH4) and / or hydrogen (H2) produced in the subject; and / or (b) at least one agent that increases production efficiency (e.g., Monensin).
126. The method of claim 125, wherein the at least one agent is administered to a subject concomitant with, prior to, or after the vaccination.
127. The method of claim 125 or 126, wherein the at least one agent is administered to a subject after the vaccination.
128. The method of any one of claims 125-127, wherein the at least one agent is administered to a subject daily, semiweekly, weekly, biweekly (every two weeks), or monthly.ARD-00925 129. The method of any one of claims 125-128, wherein the at least one agent is administered to a subject for a duration of at least 1 week but no more than 1 month.
130. The method of any one of claims 125-129, wherein the at least one agent comprises (a) an agent selected from the the agents listed in Tables 8B, 8C, 9, 10, and 11; (b) 3-Nitrooxypropanol (3NOP), ethyl-3NOP, 2-bromoethanesulfonate (BES), 2- chloroethanesulfonate (CES), 3-bromopropanesulfonate (BPS), bromochloromethane (BCM), bromoform, bromodichloromethane, dibromochloromethane, carbon tetrachloride, trichloroacetamide, trichloroethyladipate, lumazin (2,4-pteridinedione), p-aminobenzoic acid, lovastatin, mevastatin, pravastatin, diallyl disulfide, garlic oil, saponins, tannins, flavonoids, nitrate, nitroethane, -nitro-propionate, 2-nitropropanol, 2-nitroethanol, malate, acrylate, oxaloacetate, fumarate, propynoic acid, 3-butenoic acid, 2-butynoic acid, ethyl 2-butynoate, monensin, lasalocid, bovicin HC5, nisin, or any combination thereof; and / or (c) Monensin (Rumensin®), Optigrid® 45 (ractopamine hydrochloride), Amprolium (Corid), Bacitracin (Albac, BMD), Bambermycin (GainPro), Decoquinate (Deccox), Fenbendazole (Safe-Guard), Laidlomycin (Cattlyst), Lasalocid (Bovetec), Melengestrol Acetate (MGA), Methoprene (Altosid), Morantel (Rumatel), Poloxalene (Bloat Guard), Ractopamine (Optaflexx, Actogain), Tetraclovinphos (Rabon), or any combination thereof.
131. The method of any one of claims 125-139, wherein the at least one agent is 3NOP or ethyl-3NOP.
132. The method of claim 131, wherein the subject is administered with (a) at least about 0.5 g but no more than 25 g of 3NOP per day; (b) at least about 1 g but no more than 5 g of 3NOP per day; or (c) about 2.5 g of 3NOP per day.
133. The method of claim 131 or 132, wherein the subject is administered with 3NOP for a duration of at least 1 week but no more than 1 month.
134. The method of any one of claims 125-133, wherein the at least one agent is formulated in animal feed.ARD-00925 135. The method of claim 125, wherein the at least one agent is a composition comprising one or more small molecules that reduce the production of one or more deleterious atmospheric gases and / or precursors thereof and one or more agriculturally suitable carriers.
136. The method of claim 135, wherein the one or more agriculturally suitable carriers comprises a solid carrier.
137. The method of claim 136, wherein the one or more solid carriers comprises attapulgite, kaolinite, fuller’s earth, calcium carbonate, perlite, diatomaceous earth, calcium silicate, fly ash, a polysaccharide, a disaccharide, a monosaccharide, a gum, a natural or synthetic derivative thereof, or a combination thereof.
138. The method of claim 136, wherein the one or more solid carriers comprises attapulgite, kaolinite, fuller’s earth, calcium carbonate, perlite, diatomaceous earth, calcium silicate, fly ash, a polysaccharide, a disaccharide, a monosaccharide, a gum, silica, propylene glycol, hemp protein, biochar, montmorillonite, activated charcoal, lignin, wood flour, hemp protein, pea protein, soy protein, gelatin, casein, chotsan, talc, calcium phosphate, arginine, lysine, calcium carbonate, carbon black, glutamine, betaine, bismuth phosphate, bismuth citrate, iron phosphate, or any combination thereof.
139. The method of any one of claims 136-138, wherein the one or more solid carriers comprises a saccharide comprising cellulose, xanthan gum, karaya gum, ethylcellulose, inositol, galactose, arabinose, lactose, lactulose, mannitol, mannose, sorbose, turanose, platinose, or a combination thereof.
140. The method of any one of claims 136-138, wherein the one or more solid carriers comprises a saccharide comprising cellulose, xanthan gum, karaya gum, ethylcellulose, inositol, galactose, arabinose, lactose, lactulose, mannitol, mannose, sorbose, turanose, platinose, carrageenan, cellulose acetate, hydroxypropyl cellulose, cellulose acteate phthalate, maltrodextran, dextran, inulin, corn starch, amylopectin, sodium startch glycolate, pentaerthritol, cyclodextrin, or a combination thereof.
141. The method of any one of claims 136-140, wherein the solid carrier comprises silica and ethylcellulose.ARD-00925 142. The method of claim 137, wherein the carrier comprises about 10% to about 50% by weight of the silica and about 50 to about 90% by weight of the ethylcelluose.
143. The method of any one of claims 135-140, wherein the carrier comprises silica and activated charcoal.
144. The method of any one of claims 135-140, wherein the carrier comprises about 10% to about 90% by weight of the silica and about 10% to about 90% by weight of the activated charcoal.
145. The method of any one of claims 144, wherein the carrier further comprises arginine, lysine, or both arginine and lysine.
146. The method of any one of claims 135-140, wherein the carrier comprises activated charcoal and ethylcellulose.
147. The method of claim 146, wherein the carrier comprises about 10% to about 50% by weight of the activated charcoal and about 40 to about 90% by weight of the ethylcellulose.
148. The method of claim 146 or 147, wherien the carrier further comprises about 1 to about 10% by weight of sodium lignosulfate or about 1 to about 10% by weight of hydroxyethyl cellulose.
149. The method of any one of claims 135-148, wherein the carrier comprises arginine and polycaprolactone.
150. The method of claim 149, wherein the carrier comprises about 10 to about 60% by weight of the arginine and about 30 to about 90% by weight of the polycaprolactone.
151. The method of any one of claims 135-148, wherein the carrier comprises silica and polycaprolactone.
152. The method of claim 150, wherein the carrier comprises about 10 to about 60% by weight of the silica and about 30 to about 90% by weight of the polycaprolactone.ARD-00925 153. The method of any one of claims 136-152, wherein the one or more solid carriers is inert.
154. The method of any one of claims 136-153, wherein the one or more solid carriers is water soluble.
155. The method of any one of claims 135-154, further comprising one or more additives with a density greater than water and / or one or more additives that reduces the rate of dissolution of the composition in water.
156. The method of claim 155, wherein the composition has a density of at least 1.1, preferably about 1.1 mg / mL to about 3 mg / mL, about 1.5 to about 3 mg / mL, about 1.5 to about 2.5 mg / mL, or about 1.5 to about 2 mg / mL.
157. The method of claim 155 or 156, wherein the one or more additives with a density greater than water comprises silica, attapulgite, kaolinite, fuller’s earth, calcium carbonate, perlite, diatomaceous earth, calcium silicate, fly ash, or any combination thereof.
158. The method of any one of claims 155-157, wherein the one or more additives that reduces the rate of dissolution of the composition further reduces a rate of release of the one or more small molecules into water.
159. The method of claim 158, wherein the composition dissolves over at least about 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, 91, 98, 105, 112, 119, 126, 133, 140, and / or nor more than about 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, 91, 98, 105, 112, 119, 126, 133, 140, or 147 days, about 1 to about 147 days, more preferably 7-63 days, more preferably about 7-42 days, even more preferably 14-42 days yet even more preferably 14-28 days.
160. The method of any one of claims 135-159, wherein about 40 to about 80% of the small molecules that reduce the production of one or more deleterious atmospheric gases and / or precursors is thereof is released in water after 15 days.
161. The method of any one of claims 135-160, wherein the composition comprises particles having a uniform size distribution.ARD-00925 162. The method of any one of claims 135-161, wherein the composition comprises particles having a non-uniform size distribution.
163. The method of claim 161 or 162, wherein the particles comprise a spherical-, square-, rectangular-, capsular-, cylindrical-, conical-, ovular-, triangular-, diamond-, or disk-like shape.
164. The method of any one of claims 135-163, wherein the particles have a size ranging from about 1 mm to about 20 mm, about 1 to about 15 mm, about 1 to about 10 mm, about 5 to about 20 mm, about 5 to about 15 mm, or about 5 to about 10 mm.
165. The method of any one of claims 135-164, wherein the particles further comprises a coating.
166. The method of claim 165, wherein the coating comprises at least two layers.
167. The method of claim 165 or 166, wherein the coating is selected from cellulose acetate phlalate, ethyl cellulose, hydroxypropyl cellulose, polycaprolactone,alginate, chitosan, polyethylene glycol, cellulose actate, triacetin, propylene glycol, n-methyl-2-pyrollidone, and any combination thereof.
168. The method of claim 165 or 166, wherein the coating comprises two or more polyelectrolytes.
169. The method of claim 168, wherein the polyelelctrolytes comprise polystyrene sulfonate, polyethyleneimine, sodium lignosulfate, polyglutamic acid and poly-L-lysine, poly-L-arginine, polyallylamine hydrochloride, polyacrylic acid, or any combination thereof.
170. The method of claim 169, wherein the polyelectrolytes comprise polyallylamine hydrochloride and sodium lignosulfate.
171. The method of claim 169, wherein the polyelectrolytes comprise polyallylamine hydrochloride and polystyrene suylfonate.
172. The method of claim 169, wherein the polyelectrolytes comprise sodium lignosulfate and one of polyglutamic acid and poly-L-lysine, or poly-L-arginine, and sodium lignosulfate.ARD-00925 173. The method of claim 169, wherein the polyelectrolytes comprise polystyrene sulfonate and one of polyglutamic acid and poly-L-lysine, or poly-L-arginine.
174. The method of any one of claims 168-173, wherein the two or more polyelectrolytes are crosslinked.
175. The method of any one of claims 135-174, wherein the one or more small molecules comprise a molecule that interferes with the uptake and / or conversion of acetate, H2, CO2, methanol, monomethylamine, dimethylamine, trimethylamine, nitric oxide, or a combination thereof.
176. The method of any one of claims 135-175, wherein the one or more small molecules that reduce the production of one or more deleterious atmospheric gases and / or precursors interact with an enzyme selected from the group consisting of 3-(methylthio)propanoate:coenzyme M methyltransferase, acetate kinase, acetyl-CoA decarbonylase, acetyl-CoA decarbonylase / synthase complex α2ε2, acetyl-CoA decarbonylase / synthase complex β, acetyl- CoA decarbonylase / synthase complex γδ, acetyl-CoA synthase, carbon monoxide dehydrogenase, carbonic anhydrase, Co-methyltransferase, coenzyme M reductase, cyclohydrolase, dehydrogenase, dimethylamine--[corrinoid protein] Co-methyltransferase, F420- dependent methylene-H4MPT reductase, F420-dependent methylene-H4SPT dehydrogenase, formylmethanofuran dehydrogenase, formylmethanofuran:H4MPT formyltransferase, formylmethanofuran:H4SPT formyltransferase, formyltransferase, H2-forming methylene- H4MPT dehydrogenase, methanol-5-hydroxybenzimidazolylcobamide Co-methyltransferase, methenyl-H4MPT cyclohydrolase, methyl-coenzyme M reductase, methyl-H4SPT:CoM methyltransferase, methylated [methylamine-specific corrinoid protein]:coenzyme M methyltransferase, methylcobamide:CoM methyltransferase, methylthiol:coenzyme M methyltransferase, methyltransferase, MtaC protein:coenzyme M methyltransferase, phosphotransacetylase, tetrahydromethanopterin S-methyltransferase, tetramethylammonium methyltransferase, trimethylamine--corrinoid protein Co-methyltransferase, and any combination thereof.
177. The method of claim 176, wherein the one or more small molecules that reduce the production of one or more deleterious atmospheric gases and / or precursors interact with methyl- coenzyme M reductase (MCR).ARD-00925 178. The method of any one of claims 135-177, wherein the one or more small molecules that reduce the production of one or more deleterious atmospheric gases and / or precursors comprise a compound having the formula R1-[CH2]n-ONO2wherein n is an integer from 1 to 15; R1is selected from the group consisting of H, C1-C6alkyl, phenyl, —OH, —NH2, —CN, —COOH, —O(C═O)R3, —NHC(═O)R3, SO2NHR3, or —ONO2, —SH and R3is C1-C6alkyl, phenyl, pyridyl; with the proviso that when n is >3 the hydrocarbon chain may be interrupted by —O— or — NH—.
179. The method of claim 178, wherein the one or more small molecules that reduce the production of one or more deleterious atmospheric gases and / or precursors is selected from 3- nitrooxypropanol, 9-nitrooxynonanol, 5-nitrooxy pentanoic acid, 6-nitrooxy hexanoic acid, bis(2-hydroxyethyl)amine dinitrate, 1,4-bis-nitrooxybutane, 1,5-bis-nitrooxypentane, and any combination thereof.
180. The method of claim 178, wherein the one or more small molecules that reduce the production of one or more deleterious atmospheric gases and / or precursors comprises 3- nitrooxypropanol (3NOP).
181. The method of any one of claims 135-180, wherein the composition comprises about 1 to about 25% by weight of the small molecule, about 5 to about 20% by weight of the small molecule, or about 5 to about 15% by weight of the small molecule.
182. The method of any one of claims 135-181, wherein the composition comprises a plurality of populations of particles, wherein each population or particles comprises a different formulation, a different shape, and / or a different size distribution.
183. The method of claim 182, wherein the plurality of populations of particles comprises a first population and a second population.ARD-00925 184. The method of claim 183, wherein the population of granular particles further comprises at least 1, 2, 3, 4, 5, 5, 6, 8, or 9 and / or no more than 4, 5, 6, 7, 8, 9, or 10 additional populations, for example 3-10 additional populations, preferably 3-7 additional populations, more preferably 3-5 additional populations.
185. The method of claim 183 or 184, wherein the first population comprises an immediate release formulation.
186. The method of any one of claims 183-185, wherein the second population comprises a delayed release formulation.
187. The method of any one of claims 184-186, wherein each additional population comprises a delayed release formulation, wherein each population dissolves and / or releases the one or more small molecules that reduce the production of one or more deleterious atmospheric gases and / or precursors at a different time than each of the other populations.
188. An antibody produced by the method of any one of claims 91-187, or a fragment thereof.
189. The antibody of claim 188, wherein the antibody is a monoclonal antibody.
190. The antibody of claim 188 or 189, wherein the antibody is an IgM, IgG, or an IgA, preferably an IgA or IgM.
191. The antibody of any one of claims 188-190, wherein the antibody is lyophilized.
192. The antibody of any one of claims 188-191, wherein the antibody is in a pharmaceutical composition comprising at least one excipient and / or carrier.
193. Milk and / or a derivative thereof produced by the subject of any one of claims 91-187.
194. The milk and / or a derivative thereof of claim 193, wherein the milk and / or derivatives thereof comprises an antibody that binds at least one methanogen.
195. The milk and / or a derivative thereof of claim 193 or 194, wherein the milk and / or derivatives thereof is pasteurized and / or homogenized.ARD-00925 196. The milk and / or a derivative thereof of any one of claims 193-195, wherein the milk and / or derivatives thereof is lyophilized or evaporated to form dry milk powder (e.g., boiling at low pressure at low temperature).
197. The milk and / or a derivative thereof of any one of claims 193-196, further comprising at least one agent that reduces methane production in a subject, optionally wherein the at least one agent is selected from the agents in Tables 8B, 8C, 9, 10, and 11.
198. An animal feed comprising: (a) the antibody of any one of claims 188-192; (b) at least one agent that reduces methane production in a subject, optionally wherein the at least one agent is selected from the agents in Tables 8B, 8C, 9, 10, and 11; (c) the milk and / or derivative thereof of any one of claims 193-197; or (d) any combination of two or more of (a)-(c).
199. The animal feed of claim 198, wherein the animal feed is liquid (e.g., drinking water, milk) or solid (e.g., fodder).
200. The animal feed of claim 198 or 199, wherein the animal feed comprises fat and / or fatty acid, optionally wherein the animal feed comprises fat and / or fatty acid that is at least about 1%, 2%, 3%, 4%, 5%, or 6% of the diet.
201. A method of reducing methane and / or hydrogen production or increasing CO2production in a subject, the method comprising orally administering to and / or feeding the subject the antibody of any one of claims 188-192, the milk and / or a derivative thereof of any one of claims 193-197, the animal feed of any one of claims 198-200, or any combination of two or more thereof.
202. The method of claim 201, further comprising administering at least one agent that reduces methane and / or hydrogen production in a subject, optionally wherein the at least one agent is selected from the agents in Tables 8B, 8C, 9, 10, and 11.
203. The method of claim 201 or 202, further comprising administering the subject with the vaccine composition of any one of claims 1-90.ARD-00925 204. The method of any one of claims 91-187 and 201-203, wherein the subject is a mammal, a ruminant, a canine, a feline, or a human; optionally wherein the ruminant is selected from a cow, cattle, a bull, a bison, a yak, a buffalo, an antelope, a goat, a sheep, a deer, a giraffe, a caribou, a gazelle, a macropod, a llama, a camel, and an alpaca, optionally a pregnant cow, heifer, bull, and steer.
205. The method of any one of claims 91-187 and 201-204, wherein the subject is (a) an adult subject; (b) a young subject (e.g., before weaning or below 2 years of age); (c) a pregnant female subject; or (d) an offspring (e.g., calf, baby) of the vaccinated female subject that received the milk comprising an antibody that binds at least one methanogen.
206. The method of any one of claims 91-187 and 201-205, wherein the subject is a young cattle selected from: (a) a newborn calf and a pre-weaned calf that is about 0 month to about 3 months old; and (b) a weaned cow that is about 3 months to 8 months old.
207. The method of any one of claims 91-187 and 201-205, wherein the subject is adult cattle selected from: (a) a cow that is about 6-8 months to about 2-7 years old; (a) a beef adult that is about 1.5 years to about 2.5 years old; and (b) a dairy adult that is about 4 years to 7 years old.
208. The method of any one of claims 91-187 and 201-207, wherein the vaccine is administered to a subject as a part of a pre-existing vaccination program to which the subject is subject (e.g., Table 8A).
209. The method of any one of claims 91-187 and 201-208, wherein the vaccine is administered to a subject when the subject is subject to or receives at least one other vaccine, wherein the at least one other vaccine is against against infectious bovine rhinotracheitis (IBR), bovine virus diarrhea (BVD), parainfluenza-3 (PI3), bovine respiratory syncytial virus (BRSV),ARD-00925 clostridia, E. Coli mastitis, leptospirosis, mannheimia hemolytica, brucella, vibriosis, campylobacter, trichomonas, trichomoniasis, rotavirus, coronavirus, and / or respiratory disease.
210. The method of any one of claims 91-187 and 201-209, wherein the vacciine is administered to a subject when the subject changes in hands and / or a changes in environment.
211. The method of any one of claims 91-187 and 201-210, wherien the vaccine reduces methane and / or hydrogen production in the lower intestinal track (lower bowel) of the subject.
212. The method of claim 205, wherein the method results in at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% reduction in the level of methane and / or hydrogen produced by the subject, optionally wherein the reduction in the level of methane and / or hydrogen is compared to an untreated subject.
213. A method of treating a subject afflicted with a disease, the method comprising administering to the subject: (a) the vaccine composition of any one of claims 1-90; (b) the antibody of any one of claims 188-192; (c) the milk and / or derivative thereof of any one of claims 193-197; (d) the animal feed of any one of claims 198-200; (e) at least one agent that reduces methane and / or hydrogen production in a subject, optionally wherein the at least one agent is selected from the agents in Tables 8B, 8C, 9, 10, and 11; or (f) any combination of two or more thereof.
214. The method of claim 213, wherein the subject is selected from a mammal, ruminant, a canine, a feline, and a human, optionally wherein the ruminant is selected from a cow, cattle, a bull, a bison, a yak, a buffalo, an antelope, a goat, a sheep, a deer, a giraffe, a caribou, a gazelle, a macropod, a llama, a camel, and an alpaca.
215. A kit comprising the vaccine composition of any one of claims 1-90.
216. The kit of claim 215, wherein the kit comprises about or at least about 1, 2, 3, 4, 5, 10, 20, 50, 100, 250, 500, 1000, 1500, 2000, 2500, or 3000 doses of the vaccine composition.ARD-00925 217. The kit of claim 216, wherein (a) all doses are in a single container; (b) each dose is in an individual container; or (c) about or at least about 2, 3, 4, 5, 10, 25, 50, or 100 doses are pooled in a single container.
218. The kit of any one of claims 215-217, further comprising at least one adjuvant.
219. The kit of claim 218, wherein the vaccine composition and the at least one adjuvant are in separate containers.
220. The kit of any one of claims 215-219, wherein the kit comprises at least about 1, 2, 3, 4, 5, 10, 20, 50, 100, 250, 500, 1000, 1500, 2000, 2500, or 3000 doses; and (a) all doses are in a single container, and the at least one adjuvant for all doses are in a separate single container; (b) each dose is in an individual container, and the at least one adjuvant for all doses are in a separate single container; (c) each dose is in an individual container, and the at least one adjuvant for each dose is in a separate individual container; or (d) about or at least about 2, 3, 4, 5, 10, 25, 50, or 100 doses are pooled in a single container, and the pooled amount of at least one adjuvant for the pooled doses are in a separate single container.
221. The kit of any one of claims 215-220, wherein the kit comprises at least two adjuvants that are different.
222. A method of reducing CH4 emissions in a ruminant comprising administering to the ruminant a vaccine composition comprising at least one nucleic acid encoding at least one cell surface protein or a fragment thereof (e.g., an antigenic fragment, e.g., a fragment comprising an epitope, e.g., a fragment comprising an extracellular domain or a portion thereof) of at least one methanogen, wherein the CH4emissions are reduced by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% as compared to an untreated control ruminant.
223. A method of reducing H2emissions in a ruminant comprising administering to the ruminant a vaccine composition comprising at least one nucleic acid encoding at least one cell surface protein or a fragment thereof (e.g., an antigenic fragment, e.g., a fragment comprising anARD-00925 epitope, e.g., a fragment comprising an extracellular domain or a portion thereof) of at least one methanogen, wherein the H2 emissions are reduced by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50% as compared to an untreated control ruminant.
224. A method of increasing the productivity of a ruminant comprising administering to the ruminant a vaccine composition comprising at least one nucleic acid encoding at least one cell surface protein or a fragment thereof (e.g., an antigenic fragment, e.g., a fragment comprising an epitope, e.g., a fragment comprising an extracellular domain or a portion thereof) of at least one methanogen, wherein the productivity is increased by at least about 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, or 15% as compared to an untreated control ruminant.
225. The method of any one of claims 222-224, wherein the vaccine composition comprises the vaccine composition of any one of claims 1-90.
226. The method of any one of claims 222-225, wherein the ruminant is cattle.
227. An animal injected subcutaneously with the vaccine composition of any one of claims 1- 90, wherein the vaccine composition comprises about a dosage of between 1 ug / kg and 400 ug / kg (ug of nucleic acid / kg of the animal).
228. A method of producing a low carbon animal product, the method comprising: (a) administering to an animal (e.g., a mammal, a ruminant) a vaccine composition of any one of claims 1-90; (b) determining an amount of emissions of at least one greenhouse gas (e.g., CO2, CH4, N2O, and / or H2) from the animal of (a) following administration until animal product harvesting; (c) determining a first carbon intensity as a ratio of a first amount of emissions from the vaccinated animal in (b) and the amount of harvested animal product; (d) determining a second carbon intensity as a ratio of a second amount of carbon emissions from an untreated animal and the same amount of harvested animal product; andARD-00925 (e) determining the difference between the first carbon intensity and the second carbon intensity.
229. The method of claim 228, wherein determining the amount of emissions comprises measuring the emissions using a GreenFeed system.
230. The method of claim 228, wherein the animal product is selected from the group consisting of meat, milk, and wool.
231. The method of claim 228, further comprising administering to the animal at least one agent that reduces methane and / or hydrogen production.
232. The method of claim 228, further comprising certifying the animal product as a low carbon intensity product based on the determined difference between the first carbon intensity and the second carbon intensity.