Porcine circoviruses, vaccines and diagnostic reagents

Abstract

The invention relates to new porcine circovirus strains isolated from pulmonary or ganglionic samples obtained from farms affected by the post-weaning multisystemic wasting syndrome (PMWS). It relates to purified preparations of these strains, convention

Description

The subject of the present invention is therefore the group II porcine circovirus, as defined above, isolated or in the form of a purified preparation.The invention relates to any porcine circovirus capable of being isolated from a physiological sample or from a tissue sample, especially lesions, from a diseased pig having the PMWS syndrome, especially following the method described in the examples, in particular type II circovirus.The subject of the present invention is more particularly purified preparations of five strains, which were deposited at the ECACC (European Collectionof Cell Cultures, Centre for Applied Microbiology &Research, Porton Down, Salisbury, Wiltshire SP4 OJG, United Kingdom) on Thursday 2 October 1997: _ accession No. V97100219 (called here Imp . 1008PCV) _ accession No. V9700218 (called here Imp . 1010PCV) .accession No. V97100217 (called here Imp . 999PCV),and, on Friday 16 January 1998:_ accession No. V98011608 (called here Imp. 1011-48285) _accession No . V98011609 (called here Imp. 1011-48121) . The invention aims to consider the porcine circoviruses isolated from a diseased pig and / or the circoviruses having a significant    serological similarity with the strains of the invention and / or the circoviruses having cross-hybridization with the strains of the invention under stringency conditions such that there is no hybridization with the PCV PK / 15 strain.The viral strains isolated from a physiological sample or from a tissue sample, especially a lesion, from a pig having the PMWS syndrome can be advantageously propagated on cell lines such as especially pig kidney cell lines, in particular PK / 15 cells free from contamination (in particular for PCV, as well as for pestiviruses, porcine adenoviruses and porcine parvoviruses) for their multiplication or specifically for the production of antigen, whole (e.g. virus) and / or subunits (e.g. polypeptides).Very remarkably and unexpectedly, these isolates have proved very productive in culture on PK / 15 cells, which have undeniable advantages for the production of virus or antigen, in particular for the production of inactivated vaccine.The subject of the present invention is also the preparations of circoviruses isolated after passages on cells, especially cell lines, e.g. PK / 15 cells, cultured in vitro while being infected with at least one of the circoviruses according to the invention or of any porcine circovirus capable of being isolated form a physiological sample or from a tissue sample, especially lesions, from a pig having the PMWS syndrome. Its subject is also the culture extract or supernatant, optionally purified by standard techniques, and in general any antigenic preparation obtained from in vitro cultures.The subject of the invention is also the immunogenic active ingredients and the vaccines containing at least one antigen as defined above.They may be immunogenic active ingredients based on attenuated live whole viruses, or vaccines prepared with these active ingredients, the attenuation being carried out according to the customary methods, e.g. by passage on cells, preferably by passage on pig cells, especially lines, such as PK / 15 cells (for example from 50 to 150, especially of the order of 100, passages). These vaccines comprise in general a vehicle or diluent acceptable from the veterinary point of view, optionally an adjuvant acceptable from the veterinary point of view, as well as optionally a freeze-drying stabilizer.These vaccines will preferably comprise from 103 to 106 TCID50.They may be immunogenic active ingredients or vaccines based on circovirus antigen according to the invention, in an inactivated state. The vaccine comprises, in addition, a vehicle or a diluent acceptable from the veterinary point of view, with optionally in addition an adjuvant acceptable from the veterinary point of view.The circoviruses according to the invention, with the fractions which may be present, are inactivated according to techniques known to persons skilled in the art. The inactivation will be preferably carried out by the chemical route, e.g. by exposing the antigen to a chemical agent such as formaldehyde (formalin), paraformaldehyde, P-propiolactone or ethyleneimine or its derivatives. The preferred method of inactivation will be herein the exposure to a chemical agent and in particular to ethyleneimine or to P-propiolactone.Preferably, the inactivated vaccines according to the invention will be supplemented with adjuvant, advantageously by being provided in the form of emulsions, for example water-in-oil or oil-in-water, according to techniques well known to persons skilled in the art. It will be possible for the adjuvant character to also come from the incorporation of a customary adjuvant compound into the active ingredient.Among the adjuvants which may be used, there may be mentioned by way of example aluminium hydroxide, the saponines (e.g. Quillaja saponin or Quil A; see Vaccine Design, The Subunit and Adjuvant Approach, 1995, edited by Michael F. Powel and Mark J. Newman, Plennum Press, New-York and London, p.210), Avridine® (Vaccine Design p. 148), DDA (Dimethyldioctadecylammonium bromide, Vaccine Design p. 157), Polyphosphazene (Vaccine Design p. 204), or alternatively oil-in-water emulsions based on mineral oil, squalene (e.g. SPT emulsion, Vaccine Design p. 147), squalene (e.g. MF59, Vaccine Design p. 183), or water-in-oil emulsions based on metabolizable oil (preferably according to WO-A-94 20071) as well as the emulsions described in US-A-5,422,109. It is also possible to choose combinations of adjuvants, for example Avridine® or DDA combined with an emulsion.These vaccines will preferably comprise from 106 to 108 TCID50.The live vaccine adjuvants can be selected from those given for the inactivated vaccine. The emulsions are preferred. To those indicated for the inactivated vaccine, there may be added those described in WO-A-9416681.As freeze-drying stabilizer, there may be mentioned by way of example SPGA (Bovarnik et al., J. Bacteriology 59,   509,   950), carbohydrates such assorbitol,   mannitol, starch,   sucrose,   dextran or5 glucose,   proteins   such as albumin   or casein,derivatives of these compounds, or buffers such as alkali metal phosphates.The applicant has, in addition, obtained the genome of four of the isolates, identified SEQ ID NO: 1 to 4 and optionally 6.The subject of the present invention is therefore a DNA fragment containing all or part of one of these sequences. It goes without saying that the invention automatically covers the equivalent sequences, that is to say the sequences which do not change the functionality or the strain-specificity of the sequence described or of the polypeptides encoded by this sequence. There will of course be included the sequences differing by degeneracy of the code.The invention also covers the equivalent sequences in the sense that they are capable of hybridizing with the above sequence under high stringency conditions and / or have a high homology with the strains of the invention and belong to group II defined above.These sequences and their fragments can be advantageously used for the in vitro or in vivo expression of polypeptides with the aid of appropriate vectors .In particular, the open reading frames, forming DNA fragments according to the invention, which can be used to this effect have been identified on the genomic sequence of the type II circoviruses. The invention relates to any polypeptide containing at least one of these open reading frames (corresponding amino acid sequence). Preferably, the invention relates to a protein essentially consisting of ORF4 , ORF7, ORF10 or ORF13.For the expression of subunits in vitro, as a means of expression, E. coli or a baculovirus will be preferably used (US-A-4,745,051). The coding sequence(s) or their fragments are integrated into the baculovirus genome (e.g. the baculovirus Autographa californica Nuclear Polyhedrosis Virus AcNPV) and the latter is then propagated on insect cells, e.g. Spodoptera frugiperda Sf9 (deposit ATCC CRL 1711). The subunits can also be produced in eukaryotic cells such as yeasts (e.g. Saccharomyces cerevisiae) or mammalian cells (e.g. CHO, BHK).The subject of the invention is also the polypeptides which will be produced in vitro by these expression means, and then optionally purified according to conventional techniques. Its subject is also a subunit vaccine comprising at least one polypeptide as thus obtained, or fragment, in a vehicle or diluent acceptable from the veterinary point of view and optionally an adjuvant acceptable from the veterinary point of view.For the expression in vivo for the purpose of producing recombinant live vaccines, the coding sequence (s) or their fragments are inserted into an appropriate expression vector under conditions allowing the expression of the polypeptide(s). As appropriate vectors, there may be used live viruses, preferably capable of multiplying in pigs, nonpathogenic for pigs (naturally nonpathogenic or rendered as such), according to techniques well known to persons skilled in the art. There may be used in particular pig herpesviruses such as Aujeszky's disease virus, porcine adenovirus, poxviruses, especially vaccinia virus, avipox virus, canarypox virus, swinepox virus. Plasmid DNAs can also be used as vectors (WO-A-90 11092, WO-A-93 19813, WO-A-94 21797, WO-A-95 20660) .The subject of the invention is therefore also the vectors and the recombinant live vaccines or plasmid vaccines (polynucleotide or DNA vaccines) thus prepared, the vaccines comprising, in addition, a vehicle or diluent acceptable from the veterinary point of view.The vaccine according to the invention may comprise one or more active ingredients (antigens) of one or more (2 or 3) of the circoviruses according to the invention.The invention also provides for combining vaccination against the porcine circovirus with a vaccination against other pig pathogens, in particular those which can be associated with the PMSW syndrome. The vaccine according to the invention may therefore comprise another valency corresponding to another pig pathogen.Among these others porcine pathogens, one may cite preferably PRRS (Porcine Reproductory and Respiratory Syndrome) (WO-A-93 / 07898, WO-A-94 / 18311, FR-A-2 709 966; C. chareyre et al., Proceedings of the 15th IPVS Congress, Birmingham, England, 5-9 July 1998, p 139; incorporated therein by reference) and / or Mycoplasma hyopneumonia (EP-A-597 852, EP-A-550 477, EP-A-571 648 ; 0. Martinon et al. p 157, 284, 285 and G. Reynaud et al., p 150, all in the above-referenced Proceedings of the 15th IPVS Congress; incorporated therein by reference). Other interesting valencies are Actinobacillus pleuropneumoniae, E.coli, Atrophic Rhinitis and also Pseudorabies (Aujeszky disease), Hog cholera, Swine Influenza.The subject of the present invention is also a method which makes it possible to induce an immune response in pigs towards circoviruses according to the invention. Its subject is in particular a method of vaccination which is effective in pigs.This method provides for the administration to pigs, in one or more portions, of a vaccine above. It is also possible to combine several types of the above vaccines in the same vaccination protocol.This method provides not only for administration to adult pigs, but also to young pigs or to pregnant females. The vaccination of the latter makes it possible to confer passive immunity to the newborns (maternal antibodies).The invention also offers the possibility of diagnosing the presence of the circoviruses according to the invention in pigs. Its subject is therefore diagnostic tests and methods relating thereto using reagents which will be described below.Knowledge of the sequences of the different circoviruses makes it possible to define common sequences which makes it possible to produce reagents capable of recognizing all the porcine circoviruses known.Persons skilled in the art will also be able to select fragments of the sequences corresponding to regions exhibiting little or no homology with the corresponding PK / 15 circovirus sequence in order to carry out a specific diagnosis.Sequence alignments make it possible for persons skilled in the art to select a reagent in accordance with their wishes.A first reagent consists in the DNA sequences disclosed here and their fragments, which will in particular be used as probes or primers in well-known hybridization or PCR (Polymerase Chain Reaction) techniques .A second reagent consists in the polypeptides encoded by these sequences from the virus or expressed with the aid of a vector (see above), or synthesized by the chemical route according to conventional techniques for peptide synthesis.A third and fourth reagent consists in respectively polyclonal and monoclonal antibodies which may be produced according to the customary techniques from the virus, the polypeptides or fragments, extracted or encoded by the DNA sequences.These second, third and fourth reagents may be used in a diagnostic method, a subject of the invention, in which a test is carried out, on a sample of physiological fluid (blood, plasma, serum and the like) or a sample of tissue (ganglia, liver, lungs, kidneys and the like) obtained from a pig to be tested, for the presence of an antigen specific for a circovirus according to the invention, by seeking to detect either the antigen itself, or antibodies directed against this antigen.The antigens and antibodies according to the invention may be used in any known laboratory diagnostic technique.However, it will be preferable to use them in techniques which can be used directly in the field by the veterinary doctor, the breeder or the owner of the animal. Persons skilled in the art have available a range of laboratory and field techniques and are therefore in the perfect position to adapt the use of this antigen and / or antibodies as diagnostic reagent(s) .The diagnostic techniques which will be preferably used within the framework of the present invention are Western blotting, immunofluoroescence, ELISA and immunochromatography.As regards the use of immunochromatography methods, specialists can refer in particular to RobertF. Zurk et al., Clin. Chem. 31 / 7, 1144-1150 (1985) as well as to patents or patent applications WO-A-88 / 08 534, WO-A-91 / 12528, EP-A-291 176, EP-A-299 428, EP-A-291 194, EP-A-284 232, US-A-5 120 643, US-A-5 030 558, US-A-5 266 497, US-A-4 740 468, US-A-5 266 497, US-A-4 855 240, US-A-5 451 504, US-A-5 141 850, US-A-5 232 835 and US-A-5 238 652 . Accordingly, it is preferably sought to detect specific antibodies in the sample by an indirect test, by competition or by displacement. To do this, the antigen itself is used as diagnostic reagent, or a fragment of this antigen, conserving recognition of the antibodies. The labelling may be advantageously a labelling with peroxidase or a special labelling, preferably with colloidal gold.It may also be desired to detect the antigen itself in the sample with the aid of a labelled antibody specific for this antigen. The labelling is advantageously as described above.By antibody specific for the antigen which can be used in particular in competition or displacement or for the detection of the antigen itself, there is understood monoclonal or polyclonal antibodies specific for the antigen, fragments of these antibodies, preferably Fab or F(ab)'2 fragments.Another feature of the invention is theproduction of polyclonalor monoclonal antibodiesspecific for the antigen in accordance with the invention, it being possible for these antibodies to then be used in particular as diagnostic reagent for the detection of the antigen in a sample of physiological fluid or in a tissue sample, or even for the detection of antibodies present in such a sample or specimen. The invention also includes the immunologically functional fragments of these antibodies, in particular the F(ab) and F(ab)'z fragments .Antibodies can be prepared by the customary techniques. Reference may be made in particular to Antibodies, A Laboratory Manual, 1988, Cold Spring Harbor Laboratory, USA or to J.W. Coding, Monoclonal Antibodies: Principles and Practice, Academic Press Inc., whose contents are incorporated herein by reference .It will be possible in particular, as is known per se, to carry out the fusion of spleen cells of mice, immunized with the antigen or with at least one of its fragments, with suitable myelomatous cells.The subject of the invention is also a preparation, preferably pure or partially pure, or even crude, of monoclonal or polyclonal antibodies specific for the antigen, especially mouse or rabbit antibodies.The present invention also makes it possible to determine epitopes of interest especially on the basis of the DNA sequences described here, whether epitopes of vaccinal interest or epitopes of interest in diagnosis. From the DNA sequence of the genome of the circovirus according to the invention, persons skilled in the art are in a position to determine epitopes according to known methods, for example an appropriate computer program or PEPSCAN. Epitopes are immunodominant regions of proteins and are as such regions exposed at the surface of the proteins. They can therefore be recognized by antibodies and thus be particularly used in the field of diagnosis either for the preparation of antibodies for diagnostic purposes or for the production of corresponding peptides which can be used as diagnostic reagents.At the very least, an epitope is a peptide having from 8 to 9 amino acids. A minimum of 13 to 25 amino acids is generally preferred.Persons skilled in the art are therefore in a position, using one or more of these techniques as well as the other available techniques, to find epitopes for using peptides or antibodies for diagnostic purposes.The subject of the invention is also a diagnostic kit comprising this antigen and / or polyclonal or monoclonal antibodies specific for this antigen. These are in particular diagnostic kits corresponding to the diagnostic techniques described above.The invention will now be described in greater detail with the aid of nonlimiting exemplary embodiments, taken with reference to the drawing, in which:Figure 1: DNA sequence of the genome of the Imp. 1011-48121 strainFigure 2: DNA sequence of the genome of the Imp. 1011-48285 strainFigure 3: DNA sequence of the genome of the Imp. 999 strainFigure 4: DNA sequence of the genome of the Imp. 1010 strainFigure 5: Alignment of  the 4  sequences according  toFigures 1 to 4 with the sequence of the PCVPK / 15 strainFigure 6: DNA sequence of the genome of the Imp.  999strain as defined in the first filing in France on 3 October 1997Figure 7: Alignments of the sequence of Figure 6 with the sequence of the PK / 15 strainSequence listing SEQ IDSEQ ID No: 1 DNA Imp . sequence 1011-48121 of stra the iin genome of the SEQ ID No: 2 DNA sequence of the genome of the Imp . 1011-48285 strain SEQ ID No: 3 DNA sequence of the genome of the Imp . 999 strain SEQ ID No: 4 DNA sequence of the genome of the Imp . 1010 strain SEQ ID No: 5 DNA sequence of the : genome of the PK / 15 strainSEQ ID No: 6 DNA sequence of the genome of the Imp. 999 strain as defined in the first filing in France on 3 October 1997.EXAMPLESExample 1: Culture and isolation of the porcine circovirus strains:Tissue samples were collected in France, Canada and the USA from lung and lymph nodes of piglets. These piglets exhibited clinical signs typical of the postweaning multisystemic wasting syndrome. To facilitate the isolation of the viruses, the tissue samples were frozen at -70°C immediately after autopsy.For the viral isolation, suspensions containing about 15% tissue sample were prepared in a minimum medium containing Earle's salts (EMEM, BioWhittaker UK Ltd., Wokingham, UK), penicillin (100 lU / ml) and streptomycin (100 pg / ml) (MEM-SA medium), by grinding tissues with sterile sand using a sterile mortar and pestle. This ground preparation was then taken up in MEM-SA, and then centrifuged at 3000 g for 30 minutes at +4°C in order to harvest the supernatant.Prior to the inoculation of the cell cultures, a volume of 100 pl of chloroform was added to 2 ml of each supernatant and mixed continuously for 10 minutes at room temperature. This mixture was then transferred to a microcentrifuge tube, centrifuged at 3000 g for 10 minutes, and then the supernatant was harvested. This supernatant was then used as inoculum for the viral isolation experiments.All the viral isolation studies were carried out on PK / 15 cell cultures, known to be uncontaminated with the porcine circovirus (PCV), pestiviruses, porcine adenoviruses and porcine parvoviruses (Allan G. et al Pathogenesis of porcine circovirus experimental infections of colostrum-deprived piglets and examination of pig foetal material. Vet. Microbiol. 1995, 44, 49-64) .The isolation of the porcine circoviruses was carried out according to the following technique:Monolayers of PK / 15 cells were dissociated by trypsinization (with a trypsin-versene mixture) from confluent cultures, and taken up in MEM-SA medium containing 15% foetal calf serum not contaminated by pestivirus (= MEM-G medium) in a final concentration of about 400,000 cells per ml. 10 ml aliquot fractions of this cell suspension were then mixed with 2 ml aliquot fractions of the inocula described above, and the final mixtures were aliquoted in 6 ml volumes in two Falcon flasks of 25 cm2. These cultures were then incubated at+ 37°C for 18 hours under an atmosphere containing 10% co2. After incubation, the culture medium of the semi-confluent monolayers were treated with 300 mM D-glucosamine (Cat #  G48175, Sigma-Aldrich Company Limited, Poole, UK) (Tischr I. et al., Arch. Virol., 1987 96 39-57) , then incubation was continued for an additional period of 48-72 hours at +37°C. Following this last incubation, one of the two Falcons of each inoculum was subjected to 3 successive freeze / thaw cycles. The PK / 15 cells of the remaining Falcon were treated with a trypsin-versene solution, resuspended in 20 ml of MEM-G medium, and then inoculated into 75 cm2 Falcons at a concentration of 400,000 cells / ml. The freshly inoculated flasks were then "superinfected" by addition of 5 ml of the corresponding lysate obtained after the freeze / thaw cycles.Example 2: Preparation of the samples of cell culture for the detection of porcine circoviruses by immunofluorescence or by in situ hybridizationA volume of 5 ml of the "superinfected" suspension was collected and inoculated into a Petri dish 55 mm in diameter containing a sterile and fat-free glass coverslip. The cultures in the flasks and on glass coverslips were incubated at + 37°C and treated with glucosamine as described in Example 1. The cultures on glass coverslips were harvested from 24 to 48 hours after the treatment with glucosamine and fixed, either with acetone for 10 minutes at room temperature, or with 10% buffered formaldehyde for 4 hours. Following this fixing, all the glass coverslipswere stored at -70°C, on silica gel , before their use for the in situ hybridization studies and the immunocytochemical labelling studies. Example 3: Techniques for the detection of PCV sequences by in situ hybridization In situ hybridization was carried out on tissues collected from diseased pigs and fixed with formaldehyde and also on the preparations of cell cultures inoculated for the viral isolation (see Example 2) and fixed on glass coverslips.Complete genomic probes corresponding to the PK / 15 porcine circoviruses (PCV) and to the infectious chicken anaemia virus (CAV) were used. The plasmid pPCVl, containing the replicative form of the PCV genome, cloned in the form of a single 1.7 kilo base pair (kbp) insert (Meehan B. et al. Sequence of porcine circovirus DNA: affinities with plant circoviruses, J. Gen. Virol. 1997, 78, 221-227), was used as specific viral DNA source for PCV. An analogous plasmid, pCAAl, containing the 2.3 kbp replicative form of the avian circovirus CAV was used as negative control. The respective glycerol stocks of the two plasmids were used for the production and purification of the plasmids according to the alkaline lysis technique (Sambrook J. et al. Molecular cloning: A Laboratory Manual. 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989) so that they are then used as templates for the preparation of the probes. The circovirus probes representative of the complete genomes of PCV and of CAV were produced from the purified plasmids described above (1 pg for each probe) and from hexanucleotide primers at random using a commercial nonradioactive labelling kit ("DIG DNA labelling kit", Boehringer Mannheim, Lewes, UK) according to the supplier's recommendations.The digoxigenin-labelled probes were taken up in a volume of 50-100 pl of sterile water before being used for the in situ hybridization.The diseased pig tissue samples, enclosed in paraffin and fixed with formaldehyde, as well as the preparations of infected cell cultures, fixed with formaldehyde, were prepared for the detection of the PCV nucleic acids according to the following technique:Sections 5 pm thick were cut from tissue blocks enclosed in paraffin, rendered paraffin free, and then rehydrated in successive solutions of alcohol in decreasing concentrations. The tissue sections and the cell cultures fixed with formaldehyde were incubated for 15 minutes and 5 minutes respectively at +37°C in a 0.5% proteinase K solution in 0.05 M Tris-HCl buffer containing 5 mM EDTA (pH 7.6) . The slides were then placed in a 1% glycine solution in autoclaved distilled water, for 30 seconds, washed twice with 0.01 M PBS buffer (phosphate buffered saline) (pH 7.2), and finally washed for 5 minutes in sterile distilled water. They were finally dried in the open air and placed in contact with the probes.Each tissue / probe preparation was covered with a clean and fat-free glass coverslip, and then placed in an oven at +90°C for 10 minutes, and then placed in contact with an ice block for 1 minute, and finally incubated for 18 hours at +37°C. The preparations were then briefly immersed in a 2X sodium citrate salt (SSC) buffer (pH 7.0) in order to remove the protective glass coverslips, and then washed twice for 5 minutes in 2X SSC buffer and finally washed twice for 5 minutes in PBS buffer.After these washes, the preparations were immersed in a solution of 0.1 M maleic acid, 0.15 M NaCl (pH 7.5) (maleic buffer) for 10 minutes, and then incubated in a 1% solution of blocking reagent (Cat # 1096176, Boehringer Mannheim UK, Lewis, East Sussex, UK) in maleic buffer for 20 minutes at +37°C.The preparations were then incubated with a 1 / 250 solution of an anti-digoxigenin monoclonal antibody (Boehringer Mannheim), diluted in blocking buffer, for 1 hour at +37°C, washed in PBS and finally incubated with a biotinylated anti-mouse immunoglobulin antibody for 30 minutes at +37°C. The preparations were washed in PBS and the endogenous peroxidase activity was blocked by treatment with a 0.5% hydrogen peroxide solution in PBS for 20 minutes at room temperature. The preparations were again washed in PBS and treated with a 3-amino-9-diethylcarbazole (AEC) substrate (Cambridge Bioscience, Cambridge, UK) prepared immediately before use .After a final wash with tap water, the preparations were counterstained with hematoxylin, "blued" under tap water, and mounted on microscope glass coverslips with a mounting fluid (GVA Mount, Cambridge Bioscience, Cambridge, UK) . The experimental controls included the use of a nonpertinent negative probe (CAV) and of a positive probe (PCV) on samples obtained from diseased pigs and from nondiseased pigs.Example 4: Technique for the detection of PCV by immunofluorescenceThe initial screening of all the cell culture preparations fixed with acetone was carried out by an indirect immunofluorescence technique (IIF) using a 1 / 100 dilution of a pool of adult pig sera. This pool of sera comprises sera from 25 adult sows from Northern Ireland and is known to contain antibodies against a wide variety of porcine viruses, including PCV: porcine parvovirus, porcine adenovirus, and PRRS virus. The IIF technique was carried out by bringing the serum (diluted in PBS) into contact with the cell cultures for one hour at +37°C, followed by two washes in PBS. The cell cultures were then stained with a 1 / 80 dilution in PBS of a rabbit anti-pig immunoglobulin antibody conjugated with fluorescein isothiocyanate for one hour, and then washed with PBS and mounted in glycerol buffer prior to the microscopic observation under ultraviolet light.Example 5: Results of the in situ hybridization on diseased pig tissuesThe in situ hybridization, using a PCV genomic probe, prepared from tissues collected from French, Canadian and Californian piglets having multisystemic wasting lesions and fixed with formaldehyde, showed the presence of PCV nucleic acids associated with the lesions, in several of the lesions studied. No signal was observed when the PCV genomic probe was used on tissues collected from nondiseased pigs or when the CAV probe was used on the diseased pig tissues. The presence of PCV nucleic acid was identified in the cytoplasm and the nucleus of numerous mononuclear cells infiltrating the lesions in the lungs of the Californian piglets. The presence of PCV nucleic acid was also demonstrated in the pneumocytes, the bronchial and bronchiolar epithelial cells; and in the endothelial cells of the arterioles, the veinlets and lymphatic vessels.In diseased French pigs, the presence of PCV nucleic acid was detected in the cytoplasm of numerous follicular lymphocytes and in the intrasinusoidal mononuclear cells of the lymph nodes. The PCV nucleic acid was also detected in occasional syncytia. Depending on these detection results, samples of Californian pig lungs, French pig mesenteric lymph nodes, and Canadian pig organs were selected for the purpose of isolating new porcine circovirus strains.Example 6: Results of the cell culture of the new porcine circovirus strains and detection by immunofluorescenceNo cytopathic effect (CPE) was observed in the cell cultures inoculated with the samples collected from French piglets (Imp.1008 strain), Californian piglets (Imp.999 strain) and Canadian piglets (Imp.1010 strain) showing clinical signs of multisystemic wasting syndrome. However, immunolabelling of the preparations obtained from the inoculated cell cultures, after fixing using acetone and with a pool of pig polyclonal sera, revealed nuclear fluorescence in numerous cells in the cultures inoculated using the lungs of Californian piglets (Imp.999 strain), using the mediastinal lymph nodes of French piglets (Imp.1008 strain), and using organs of Canadian piglets (Imp.1010 strain).Example 7: Extraction of the genomic DNA of the porcine circovirusesThe replicative forms of the new strains of porcine circoviruses (PCV) were prepared using infected PK / 15 cell cultures (see Example 1) (10 Falcons of 75 cm2) harvested after 72-76 hours of incubation and treated with glucosamine, as described for the cloning of the replicative form of CAV (Todd. D. et al. Dot blot hybridization assay for chicken anaemia agent using a cloned DNA probe. J. Clin. Microbiol. 1991, 29, 933-939). The double-stranded DNA of these replicative forms was extracted according to a modification of the Hirt technique (Hirt B. Selective extraction of polyoma virus DNA from infected cell cultures, J. Mol. Biol. 1967, 36, 365-369), as described by Molitor (Molitor T.W. et al. Porcine parvovirus DNA: characterization of the genomic and replicative form DNA of two virus isolates, Virology, 1984, 137, 241-254).Example 8: Restriction map of the replicative form of the genome of the porcine circovirus Imp.999 strain.The DNA (1-5 pg) extracted according to the Hirt technique was treated with SI nuclease (Amersham) according to the supplier's recommendations, and then this DNA was digested with various restriction enzymes (Boehringer Mannheim, Lewis, East Sussex, UK) and the products of digestion were separated by electrophoresis on a 1.5% agarose gel in the presence of ethidium bromide as described by Todd et al. (Purification and biochemical characterization of chicken anemia agent. J. Gen. Virol. 1990, 71, 819-823). The DNA extracted from the cultures of the Imp.999 strain possess a unique EcoRI site, 2 SacI sites and do not possess any PstI site. This restriction profile is therefore different from the restriction profile shown by the PCV PK / 15 strain (Meehan B. et al. Sequence of porcine circovirus DNA; affinities with plant circoviruses, 1997 78, 221-227) which possess in contrast a PstI site and do not possess any EcoRI site.Example 9: Cloning of the genome of the porcine circovirus Imp.999 strainThe restriction fragment of about 1.8 kbp generated by digestion of the double-stranded replicative form of the PCV Imp. 999 strain with the restriction enzyme EcoRI was isolated after electrophoresis on a 1.5% agarose gel (see Example 3) using a Qiagen commercial kit (QIAEXII Gel Extraction Kit, Cat # 20021, QIAGEN Ltd., Crawley, West Sussex, UK). This EcoRI-EcoRI restriction fragment was then ligated with the vector pGEM-7 (Promega, Medical Supply Company, Dublin, Ireland), previously digested with the same restriction enzymes and dephosphorylated, according to standard cloning techniques (Sambrook J. et al. Molecular cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989) . The plasmids obtained were transformed into an Escherichia coli JM109 host strain (Stratagene, La Jolla, USA) according to standard techniques. The EcoRI-EcoRI restriction fragment of the PCV Imp. 999 strain was also cloned into the EcoRI site of the vector pBlueScript SK+ (Stratagene Inc. La Jolla, USA) . Among the clones obtained for each host strain, at least 2 clones containing the fragments of the expected size were selected. The clones obtained were then cultured and the plasmids containing the complete genome of the Imp.999 strain were purified in a small volume (2 ml) or in a large volume (250 ml) according to standard plasmid preparation and purification techniques.Example 10: Sequencing of a genomic DNA (doublestranded replicative form) of the PCV Imp.999 strain.The nucleotide sequence of 2 EcoRI Imp.999 clones (clones pGEM-7 / 2 and pGEM-7 / 8) was determined according to Sanger's dideoxynucleotide technique using the sequencing kit "AmpliTaq DNA polymerase FS" (Cat # 402079 PE Applied Biosystems, Warrington, UK) and an Applied BioSystems AB1373A automatic sequencing apparatus according to the supplier's recommendations. The initial sequencing reactions were carried out with the M13 "forward" and "reverse" universal primers. The following sequencing reactions were generated according to the "DNA walking" technique. The oligonucleotides necessary for these subsequent sequencings were synthesized by Life Technologies (Inchinnan Business Park, Paisley, UK).The sequences generated were assembled and analysed by means of the MacDNASIS version 3.2 software (Cat # 22020101, Appligene, Durham, UK) . The various open reading frames were analysed by means of the BLAST algorithm available on the "National Center forBiotechnology Information" (NCBI, Bethesda,MD, USA)server.Theobtainedcomplete sequence initially from 6) is presented in after the G of the(SEQ ID No:arbitrarilya- few uncertainties from the(EcoRI-EcoRI theFigureEcoRIpointcloneNo .siteof6.fragment) pGEM-7 / 8 It startsand exhibitsview ofthenucleotides .TheSEQ ID No: 3 this strain,beginning ofthe first nucleotide.sequencing was then optimized and (Figure 3) gives the total sequence which was made to start arbitrarily at the EcoRI site, thattheoftheis to say the G asThe procedure manner for obtaining isolates according to 2 and 4 and Figures 1,The size ofwas carriedthe sequencethe invention2 and 4).the genome ofout in a similarof the other three(see SEQ IDthese fourNo: 1,strainsis : Imp. 1011-48121 1767 Imp. 1011-48285 1767 Imp. 999 1768 Imp. 1010 1768 nucleotidesnucleotidesnucleotidesnucleotidesExample 11: Analysis of the sequence of the PCV Imp.999 strain.When the sequence generated from the Imp.999 strain was used to test for homology with respect to the sequences contained in the GenBank databank, the only significant homology which was detected is a homology of about 7 6% (at nucleic acid level) with the sequence of the PK / 15 strain (accession numbers Y09921 and U49186) (see Figure No. 5).At amino acid level, the test for homology in the translation of the sequences in the 6 phases with the databanks (BLAST X algorithm on the NCBI server) made it possible to demonstrate a 94% homology with the open reading frame corresponding to the theoretical replicase of the BBTV virus similar to the circoviruses of plants (GenBank identification number 1841515) encoded by the GenBank U49186 sequence.No other sequence contained in the databanks show significant homology with the sequence generated from the PCV Imp.999 strain.Analysis of the sequences obtained from the Imp.999 strain cultured using lesions collected from Californian piglets having clinical signs of the multisystemic wasting syndrome shows clearly that this viral isolate is a new porcine circovirus strain.Example 12: Comparative analysis of the sequencesThe alignment of the nucleotide sequences of the 4 new PCV strains was made with the sequence of the PCV PK / 15 strain (Figure 5) . A homology matrix taking into account the four new strains and the previous PK / 15 strain was established. The results are the following:1 Imp . 1011-48121 2 Imp . 1011-48285 3 Imp. 999 4 Imp . 1010 5: PK / 15 1             2              3             4             51 1.0000 0.9977 0.9615 0.9621 0.7600 2 1.0000 0.9621 0.9632 0.7594 3 1.0000 0.9949 0.7560 4 1.0000 0.7566 5 1.0000 The homology between the two French strains Imp. 1011-48121 and Imp. 1011-48285 is greater than 99% (0.9977).The homology between the two North American strains Imp. 999 and Imp. 1010 is also greater than 99% (0.9949). The homology between the French strains and the North American strains is slightly greater than 96%.The homology between all these strains and PK / 15 falls at a value between 75 and 76%.It is deduced therefrom that the strains according to the invention are representative of a new type of porcine circovirus, distinct from the type represented by the PK / 15 strain. This new type, isolated from pigs exhibiting the PMWS syndrome, is called type II porcine circovirus, PK / 15 representing type I. The strains belonging to this type II exhibit remarkable nucleotide sequence homogeneity, although they have in fact been isolated from very distant geographical regions.Example 13: Analysis of the proteins encoded by the genome of the new PCV strains.The nucleotide sequence of the Imp. 1010 isolate was considered to be representative of the other circovirus strains associated with the multi-systemic wasting syndrome. This sequence was analysed in greater detail with the aid of the BLASTX algorithm (Altschul et al. J. Mol. Biol. 1990. 215. 403-410) and of a combination of programs from the set of MacVector 6.0 software (Oxford Molecular Group, Oxford 0X4 4GA, UK) . It was possible to detect 13 open reading frames (or ORFs) of a size greater than 20 amino acids on this sequence (circular genome). These 13 ORFs are the following:Name Start End Strand Size of the ORF (nucleotides (nt) ) Protein size (amino acids (aa) ) ORF1 103 210 sense 108 nt 3 5 aa ORF2 1180 1317 sense 138 nt 4 5 aa ORF3 1363 1524 sense 162 nt 53 aa ORF4 398 1342 sense 945 nt 314 aa ORF5 900 1079 sense 180 nt 5 9 aa ORF6 1254 1334 sense 81 nt 26 aa ORF7 1018 704 antisense 315 nt 104 aa ORF8 439 311 antisense 129 nt 42 aa ORF9 190 101 antisense 90 nt 29 aa ORF10 912 733 antisense 180 nt 59 aa ORF11 645 565 antisense 81 nt 26 aa ORF12 1100 1035 antisense 66 nt 21 aa ORF13 314 1381 antisense 702 nt 213 aa The positions of the start and end of each ORF refer to the sequence presented in Figure No. 4 (SEQ ID No. 4), of the genome of strain 1010. The limits of ORFs 1 to 13 are identical for strain 999. They are also identical for strains 1011-48121 and 1011-48285, except for the ORFs 3 and 13: ORF3 1432-1539, sense, 108 nt, 35aaORF13 314-1377, antisense, 705 nt, 234 aa.Among these 13 ORFs, 4 have a significant homology with analogous ORFs situated on the genome of the cloned virus PCV PK-15. Each of the open reading frames present on the genome of all the circovirus isolates associated with the multisystemic wasting syndrome was analysed. These 4 ORFs are the following:Name Start End Strand Size of the ORF Protein size Molecular (nt) (aa) mass ORF4 398 1342 sense 94 5 nt 314 aa 37.7 kDa ORF7 1018 704 antisense 315 nt 104 aa 11.8 kDa ORF10 912 733 antisense 180 nt 59 aa 6.5 kDa ORF13 314 1381 antisense 702 nt 233 aa 27.8 kDa The positions of the start and end of each ORF refer to the sequence presented in Figure No. 4 (SEQ ID No. 4) . The size of the ORF (in nucleotides = nt) includes the stop codon.The comparison between the genomic organization of the PCV Imp. 1010 and PCV PK-15 isolates allowed the identification of 4 ORFs preserved in the genome of the two viruses. The table below presents the degrees of homology observed:ORF Imp. 1010 / ORF PVC PK-15 Percentage homology ORF4 / ORF1 86% ORF13 / ORF2 66.4% ORF7 / ORF3 61.5% (at the level of the overlap (104 aa)) ORF10 / ORF4 83% (at the level of the overlap (59 aa)) The greatest sequence identity was observed between ORF4 Imp. 1010 and ORF1 PK-15 (86% homology). This was expected since this protein is probably involved in the replication of the viral DNA and is essential for the viral replication (Meehan et al. J. Gen. Virol. 1997. 78. 221-227; Mankertz et al. J. Gen. Virol. 1998. 79. 381-384) .The sequence identity between ORF13 Imp. 1010 and ORF2 PK-15 is less strong. (66.4% homology), but each of these two ORFs indeed exhibits a highly conserved N-terminal basic region which is identical to the N-terminal region of the major structural protein of the CAV avian circovirus (Meehan et al. Arch. Virol. 1992. 124. 301-319). Furthermore, large differences are observed between ORF7 Imp. 1010 and ORF3 PK-15 and between ORFIO Imp. 1010 and ORF4 PK-15. In each case, there is a deletion of the C-terminal region of the ORF7 and ORFIO of the Imp. 1010 isolate when they are compared with ORF3 and ORF4 of PCV PK-15. The greatest sequence homology is observed at the level of the N-terminal regions of ORF7 / ORF3 (61.5% homology at the level of the overlap) and of ORF10 / ORF4 (83% homology at the level of the overlap).It appears that the genomic organization of the porcine circovirus is quite complex as a consequence of the extreme compactness of its genome. The major structural protein is probably derived from splicing between several reading frames situated on the same strand of the porcine circovirus genome. It can therefore be considered that any open reading frame (ORF1 to ORF13) as described in the table above can represent all or part of an antigenic protein encoded by the type II porcine circovirus and is therefore potentially an antigen which can be used for specific diagnosis and / or for vaccination. The invention therefore relates to any protein comprising at least one of these ORFs. Preferably, the invention relates to a protein essentially consisting of ORF4, ORF7, ORFIO or ORF13.Example 14: Infectious character of the PCV genome cloned from the new strains.The plasmid pGEM-7 / 8 containing the complete genome (replicative form) of the Imp.999 isolate was transfected into PK / 15 cells according to the technique described by Meehan B. et al. (Characterization of viral DNAs from cells infected with chicken anemia agent: sequence analysis of the cloned replicative form and transfection capabilities of cloned genome fragments. Arch. Virol. 1992, 124, 301-319). Immunofluorescence analysis (see Example 4) carried outon   the first passage   after   transfection   onnoncontaminated PK / 15 cells have shown that the plasmid of  the  clone pGEM7 / 8 was  capable  of inducing  theproduction of infectious PCV virus. The availability of a clone containing an infectious PCV genetic material allows any useful manipulation on the viral genome in order to produce modified PCV viruses (either attenuated in pigs, or defective) which can be used for the production of attenuated or recombinant vaccines, or for the production of antigens for diagnostic kits.Example 15: Production of PCV antigens by in vitro cultureThe culture of the noncontaminated PK / 15 cells and the viral multiplication were carried out according to the same methods as in Example 1. The infected cells are harvested after trypsinization after 4 days of incubation at 37°C and enumerated. The next passage is inoculated with 400,000 infected cells per ml.Example 16: Inactivation of the viral antigensAt the end of the viral culture, the infected cells are harvested and lysed using ultrasound (Branson Sonifier) or with the aid of a rotor-stator type colloid mill (UltraTurrax, IKA). The suspension is then centrifuged at 3700 g for 30 minutes. The viral suspension is inactivated with 0.1% ethyleneimine for 18 hours at +37°C or with 0.5% beta-propiolactone for 24 hours at +28°C. If the virus titre before inactivation is inadequate, the viral suspension is concentrated by ultrafiltration using a membrane with a 300 kDa cut-off (Millipore PTMK300). The inactivated viral suspension is stored at +5°C.Example 17: Preparation of the vaccine in the form of an emulsion based on mineral oil.The vaccine is prepared according to the following formula:- suspension of inactivated porcinecircovirus:                             250 ml- Montanide® ISA 70 (SEPPIC):            750 mlThe aqueous phase and the oily phase are sterilized separately by filtration. The emulsion is prepared by mixing and homogenizing the ingredients with the aid of a Silverson turbine emulsifier.One vaccine dose contains about 107,5 TCID50.The volume of one vaccine dose is 0.5 ml for administration by the intradermal route, and 2 ml for administration by the intramuscular route.Example 18: Preparation of the vaccine in the form of a metabolizable oil-based emulsion.The vaccine is prepared according to the following formula:- suspension of inactivated porcinecircovirus: 200 ml Dehymuls HRE 7 (Henkel): 60 ml Radia 7204 (Oleofina): 740 ml The aqueous phase and the oily phase are sterilized separately by filtration. The emulsion is prepared by mixing and homogenizing the ingredients with the aid of a Silverson turbine emulsifier.One vaccine dose contains about 107'5 TCID50.The volume of one vaccine dose is 2 ml foradministration by the intramuscular route.Example 19: The indirect immunofluorescence results in relation to the US and French PCV virus strains and to the PK / 15 contaminant with a hyperimmune serum (PCV-T), a panel of monoclonal antibodies F99 prepared from PK / 15 and a hyperimmune serum prepared from the Canadian strain (PCV-C)VIRUS PK / 15 USA France PCV-T antiserum > 6400 200 800 PCV-C antiserum 200 > 6.400 > 6.400 F99 1H4 > 10 000 <100 100 F99 4B10 > 10 000 <100 <100 F99 2B7 > 10 000 100 <100 F99 2E12 > 10 000 <100 <100 F99 1C9 > 10 000 <100 100 F99 2E1 > 10 000 <100 <100 F99 1H4 > 10 000 100 <100 * Reciprocal of the last dilution of the serum or of the monoclonal antibody which gives a positive reaction in indirect immunofluorescence.Sequence of the PCV ImplOl 1-48121 isolate (SEQ ID No.AATTCAACCT TAACCTTTCT TATTCTGTAG TATTCAAAGG GCACAGAGCG GGGGTTTGAG CCCCCTCCTG GGGGAAGAAA GTCATTAATA TTGAATCTC^ TCATGTCCAC CGCCCAGGAG GGCGTTCTGA CTGTGGTTCG CTTGACAGTA TATCCGAAGG TGCGGGAGAG GCGGGTGTTG AAGATGCCAT TTTTCCTTCT CCAGCGGTAA CGGTGGCGGG GGTGGACGAG CCAGGGGCGG CGGCGGAGGA TCTGGCCAAG ATGGCTGCGG GGGCGGTGTC TTCTTCTCCG GTAACGCCTC CTTGGATACG TCATATCTGA AAACGAAAGA AGTGCGCTGT AAGTATTACC AGCGCACTTC GGCAGCGGCA GCACCTCGGC AGCACCTCAG CAGCAACATG CCGAGCAAGA AGAATGGAAG AAGCGGACCC CAACCCCATA AAAGGTGGGT GTTCACTCTG AATAATCCTT CCGAAGACGA GCGCAAGAAA ATACGGGATC TTCCAATATC CCTATTTGAT TATTTTATTG TTGGCGAGGA GGGTAATGAG GAAGGACGAA CACCTCACCT CCAGGGGTTC GCTAATTTTG TGAAGAAGCA GACTTTTAAT AAAGTGAAGT' GGTATTTGGG TGCCCGCTGC CACATCGAGA AAGCGAAAGG AACAGATCAG CAGAATAAAG AATACTGCAG TAAAGAAGGC AACTTACTGA TGGAGTGTGG AGCTCCTAGA TCTCAGGGAC AACGGAGTGA CCTGTCTACT GCTGTGAGTA CCTTGTTGGA GAGCGGGAGT CTGGTGACCG TTGCAGAGCA GCACCCTGTA ACGTTTGTCA GAAATTTCCG CGGGCTGGCT GAACTTTTGA AAGTGAGCGG GAAAATGCAG AAGCGTGATT GGAAGACTAA TGTacACGTC ATTGTGGGGC CACCTGGGTG TGGTAAAAGC AAATGGGCTG CTAATTTTGC AGACCCGGAA ACCACATACT GGAAACCACC TAGAAACAAG (continuation and end)TGGTGGGATG GTTACCATGG TGAAGAAGTG GTTGTTATTG ATGACTTTTA TGGCTGGCTG CCCTGGGATG ATCTACTGAG ACTGTGTGAT CGATATCCAT TGACTGTAGA GACTAAAGGT GGAACTGTAC CTTTTTTGGC CCGCAGTATT CTGATTACCA GCAATCAGAC CCCGTTGGAA TGGTACTCCT CAACTGCTGT CCCAGCTGTA GAAGCTCTTT ATCGGAGGAT TACTTCCTTG GTATTTTGGA AGAATGCTAC AGAACAATCC ACGGAGGAAG GGGGCCAGTT CGTCACCCTT TCCCCCCCAT GCCCTGAATT TCCATATGAA ATAAATTACT GAGTCTTTTT TATCACTTCG TAATGGTTTT TATTATTCAT TAAGGGTTAA GTGGGGGGTC TTTAAGATTA AATTCTCTGA ATTGTACATA CATGGTTACA CGGATATTGT ATTCCTGGTC GTATATACTG TTTTCGAACG CAGTGCCGAG GCCTACGTGG TCtACATTTC CAGCAGTTTG TAGTCTCAGC CACAGCTGGT TTCTTTTGTT GTTTGGTTGG AAGTAATCAA TAGTGGAATC TAGGACAGGT TTGGGGGTAA AGTAGCGGGA GTGGTAGGAG AAGGGCTGGG TTATGGTATG GCGGGAGGAG TAGTTTACAT AGGGGTCATA GGTGAGGGCT GTGGCCTTTG TTACAAAGTT ATCATCTAGA ATAACAGCAC TGGAGCCCAC TCCCCTGTCA CCCTGGGTGA TCGGGGAGCA GGGCCAG Sequence of the PCV ImplOl1-48285 isolate (SEQ ID No. 2)AATTCAACCT TAACCTTTCT TATTCTGTAG TATTCAAAGG GCACAGAGCG GGGGTTTGAG CCCCCTCCTG GGGGAAGAAA GTCATTAATA TTGAATCTCA TCATGTCCAC CGCCCAGGAG GGCGTTTTGA CTGTGGTTCG CTTGACAGTA TATCCGAAGG TGCGGGAGAG GCGGGTGTTG AAGATGCCAT TTTTCCTTCT CCAGCGGTAA CGGTGGCGGG GGTGGACGAG CCAGGGGCGG CGGCGGAGGA TCTGGCCAAG ATGGCTGCGG GGGCGGTGTC TTCTTCTCCG TGAACGCCTC CTTGGATACG TCATATCTGA AAACGAAAGA AGTGCGCTGT AAGTATTACC AGCGCACTTC GGCAGCGGCA GCACCTCGGC AGCACCTCAG CAGCAACATG CCCAGCAAGA AGAATGGAAG AAGCGGACCC CAACCCCATA AAAGGTGGGT GTTCACTCTG AATAATCCTT CCGAAGACGA GCGCAAGAAA ATACGGGATC TTCCAATATC CCTATTTGAT TATTTTATTG TTGGCGAGGA GGGTAATGAG GAAGGACGAA CACCTCACCT CCAGGGGTTC GCTAATTTTG TGAAGAAGCA GACTTTTAAT AAAGTGAAGT GGTATTTGGG TGCCCGCTGC CACATCGAGA AAGCGAAAGG AACAGATCAG CAGAATAAAG AATACTGCAG TAAAGAAGGC AACTTACTGA TGGAGTGTGG AGCTCCTAgA TCTCAgGGAC AACGGAGTGA CCTGTCTACT GCTGTGAGTA CCTTGTTGGA GAGCGGGAGT CTGGTGACCG TTGCAGAGCA GCACCCTGTA ACGTTTGTCA GAAATTTCCG CGGGCTGGCT GAACTTTTGA AAGTGAGCGG GAAAATGCAG AAGCGTGATT GGAAGACTAA TGTACACGTC ATTGTGGGGC CACCTGGGTG TGGTAAAAGC AAATGGGCTG CTAATTTTGC AGACCCGGAA ACCACATACT GGAAACCACC TAGAAACAAG MERIALTHE QUEEN’S UNIVERSITY OF BELFAST UNIVERSITY OF SASKATCHEWAN(Applicants)(continuation and end)TGGTGGGATG TGGCTGGCTG TGACTGTAGA CTGATTACCA CCCAGCTGTA AGAATGCTAC TCCCCCCCAT TATCACTTCG TTTAAGATTA ATTCCTGGTC TCTACATTTC GTTTGGTTGG AGTAGCGGGA TAGTTTACAT ATCATCTAGA TCGGGGAGCAGTTACCATGG TGAAGAAGTG GTTGTTATTG ATGACTTTTA CCCTGGGATG ATCTACTGAG ACTGTGTGAT CGATATCCAT GACTAAAGGT GGAACTGTAC CTTTTTTGGC CCGCAGTATT GCAATCAGAC CCCGTTGGAA TGGTACTCCT CAACTGCTGT GAAGCTCTTT ATCGGAGGAT TACTTCCTTG GTATTTTGGA AGAACAATCC ACGGAGGAAG GGGGCCAGTT CGTCACCCTT GCCCTGAATT TCCATATGAA ATAAATTACT GAGTCTTTTT TAATGGTTTT TATTATTCAT TAAGGGTTAA GTGGGGGGTC AATTCTCTGA ATTGTACATA CATGGTTACA CGGATATTGT GTATATACTG TTTTCGAACG CAGTGCCGAG GCCTACGTGG CAGTAGTTTG TAGTCTCAGC CACAGCTGAT TTCTTTTGTT AAGTAATCAA TAGTGGAATC TAGGACAGGT TTGGGGGTAA GTGGTAGGAG AAGGGCTGGG TTATGGTATG GCGGGAgGAG AGGGGTCATA GGTGAgGGCT GTGGCCTTTG TTACAAAGTT ATAACAGCAC TGGAGCCCAC TCCCCTGTCA CCCTGGGTGA GGGCCAG Sequence of the PCV Imp999 isolate (SEQ ID No. 3)AATTCAACCT TAACCTTTTT TATTCTGTAG TATTCAAAGG GTATAGAGAT TTTGTTGGTC CCCCCTCCCG GGGGAACAAA GTCGTCAATA TTAAATCTCA TCATGTCCAC CGCCCAGGAG GGCGTTCTGA CTGTGGTAGC CTTGACAGTA TATCCGAAGG TGCGGGAGAG GCGGGTGTTG AAGATGCCAT TTTTCCTTCT CCAACGGTAG CGGTGGCGGG GGTGGACGAG CCAGGGGCGG CGGCGGAGGA TCTGGCCAAG ATGGCTGCGG GGGCGGTGTC TTCTTCTGCG GTAACGCCTC CTTGGATACG TCATAGCTGA AAACGAAAGA AGTGCGCTGT AAGTATTACC AGCGCACTTC GGCAGCGGCA GCACCTCGGC AGCACCTCAG CAGCAACATG CCCAGCAAGA AGAATGGAAG AAGCGGACCC CAACCACATA AAAGGTGGGT GTTCACGCTG AATAATCCTT CCGAAGACGA GCGCAAGAAA ATACGGGAGC TCCCAATCTC CCTATTTGAT TATTTTATTG TTGGCGAGGA GGGTAATGAG GAAGGACGAA CACCTCACCT CCAGGGGTTC GCTAATTTTG TGAAGAAGCA AACTTTTAAT AAAGTGAAGT GGTATTTGGG TGCCCGCTGC CACATCGAGA AAGCCAAAGG AACTGATCAG CAGAATAAAG AATATTGCAG TAAAGAAGGC AACTTACTTA TTGAATGTGG AGCTCCTCGA TCTCAAGGAC AACGGAGTGA CCTGTCTACT GCTGTGAGTA CCTTGTTGGA GAGCGGGAGT CTGGTGACCG TTGCAGAGCA GCACCCTGTA ACGTTTGTCA GAAATTTCCG CGGGCTGGCT GAACTTTTGA AAGTGAGCGG GAAAATGCAG AAGCGTGATT GGAAGACCAA TGTACACGTC ATTGTGGGGC CACCTGGGTG TGGTAAAAGC AAATGGGCTG CTAATTTTGC AGACCCGGAA ACCACATACT GGAAACCACC TAGAAACAAG (continuation and end)TGGTGGGATG TGGCTGGCTG TGACTGTAGA CTGATTACCA CCCAGCTGTA AGAATGCTAC TCCCCCCCAT TATCACTTCG CTTTAAGATT TAGTCCTGGT GTCCACATTT TATTTGGTTG AAGTAACGGG GTAGTTTACA TATCATCTAG ATGGGGGAGC GTTACCATGG CCGTGGGATG GACTAAAGGT GCAATCAGAC GAAGCTCTCT AGAACAATCC GCCCTGAATT TAATGGTTTT AAATTCTCTG CGTATATACT CTAGAGGTTT GAAGTAATCA AGTGGTAGGA TATGGGTCAT AATAACAGCA AGGGCCAG TGAAgAAGTG ATCTACTGAG GGAACTGTAC CCCGTTGGAA ATCGGAGGAT ACGGAGGAAG TCCATATGAA TATTATTCAT AATTGTACAT GTTTTCGAAC GTAGCCTCAG ATAGTGGAGT GAAGGGTTGG AGGTTAGGGC GTGGAGCCCA GTTGTTATTG ACTGTGTGAT CTTTTTTGGC TGGTACTCCT TACTTCCTTG GGGGCCAGTT ATAAATTACT TTAGGGTTTA ACATGGTTAC GCAGTGCCGA CCAAAGCTGA CAAGAACAGG GGGATTGTAT TGTGGCCTTT CTCCCCTATC ATGACTTTTA CGATATCCAT CCGCAGTATT CAACTGCTGT GTATTTTGGA CGTCACCCTT GAGTCTTTTT AGTGGGGGGT ACGGATATTG GGCCTACGTC TTCCTTTTGT TTTGGGTGTG GGCGGGAGGA GTTACAAAGT ACCCTGGGTGMERIALTHE QUEEN’S UNIVERSITY OF BELFAST UNIVERSITY OF SASKATCHEWAN (Applicants)Sequence of the PCV ImplOlO isolate (SEQ ID No. 4)AATTCAACCT TAACCTTTCT TATTCTGTAG TATTCAAAGG GTATAGAGAT TTTGTTGGTC CCCCCTCCCG GGGGAACAAA GTCGTCAATT TTAAATCTCA TCATGTCCAC CGCCCAGGAG GGCGTTGTGA CTGTGGTACG CTTGACAGTA TATCCGAAGG TGCGGGAGAG GCGGGTGTTG AAGATGCCAT TTTTCCTTCT CCAACGGTAG CGGTGGCGGG GGTGGACGAG CCAGGGGCGG CGGCGGAGGA TCTGGCCAAG ATGGCTGCGG GGGCGGTGTC TTCTTCTGCG GTAACGCCTC CTTGGATACG TCATAGCTGA AAACGAAAGA AGTGCGCTGT AAGTATTACC AGCGCACTTC GGCAGCGGCA GCACCTCGGC AGCACCTCAG CAGCAACATG CCCAGCAAGA AGAATGGAAG AAGCGGACCC CAACCACATA AAAGGTGGGT GTTCACGCTG AATAATCCTT CCGAAGACGA GCGCAAGAAA ATACGGGAGC TCCCAATCTC CCTATTTGAT TATTTTATTG TTGGCGAGGA GGGTAATGAG GAAGGACGAA CACCTCACCT CCAGGGGTTC GCTAATTTTG TGAAGAAGCA AACTTTTAAT AAAGTGAAGT GGTATTTGGG TGCCCGCTGC CACATCGAGA AAGCCAAAGG AACTGATCAG CAGAATAAAG AATATTGCAG TAAAGAAGGC AACTTACTTA TTGAATGTGG AGCTCCTCGA TCTCAAGGAC AACGGAGTGA CCTGTCTACT GCTGTGAGTA CCTTGTTGGA GAGCGGGAGT CTGGTGACCG TTGCAGAGCA GCACCCTGTA ACGTTTGTCA GAAATTTCCG CGGGCTGGCT GAACTTTTGA AAGTGAGCGG GAAAATGCAG AAGCGTGATT GGAAGACCAA TGTACACGTC ATTGTGGGGC CACCTGGGTG TGGTAAAAGC AAATGGGCTG CTAATTTTGC AGACCCGGAA ACCACATACT GGAAACCACC TAGAAACAAG (continuation and end)TGGTGGGATG GTTACCATGG TGAAGAAGTG GTTGTTATTG ATGACTTTTA TGGCTGGCTG CCGTGGGATG ATCTACTGAG ACTGTGTGAT CGATATCCAT TGACTGTAGA GACTAAAGGT GGAACTGTAC CTTTTTTGGC CCGCAGTATT CTGATTACCA GCAATCAGAC CCCGTTGGAA TGGTACTCCT CAACTGCTGT CCCAGCTGTA GAAGCTCTCT ATCGGAGGAT TACTTCCTTG GTATTTTGGA AGAATGCTAC AGAACAATCC ACGGAGGAAG GGGGCCAGTT CGTCACCCTT TCCCCCCCAT GCCCTGAATT TCCATATGAA ATAAATTACT GAGTCTTTTT TATCACTTCG TAATGGTTTT TATTATTCAT TTAGGGTTTA AGTGGGGGGT CTTTAAGATT AAATTCTCTG AATTGTACAT ACATGGTTAC ACGGATATTG TAGTCCTGGT CGTATTTACT GTTTTCGAAC GCAGCGCCGA GGCCTACGTG GTCCACATTT CCAGAGGTTT GTAGTCTCAG CCAAAGCTGA TTCCTTTTGT TATTTGGTTG GAAGTAATCA ATAGTGGAGT CAAGAACAGG TTTGGGTGTG AAGTAACGGG AGTGGTAGGA GAAGGGTTGG GGGATTGTAT GGCGGGAGGA GTAGTTTACA TATGGGTCAT AGGTTAGGGC TGTGGCCTTT GTTACAAAGT TATCATCTAG AATAACAGCA GTGGAGCCCA CTCCCCTATC ACCCTGGGTG ATGGGGGAGC AGGGCCAG CLUSTAL W multiple sequence alignmentPCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48aattcatatttagcctttctaatacggtagtattggaaaggtaggggtagggggttggtg aattcaaccttaaccttttttattctgtagtattcaaagggtatagagattttgttggtc AATTCAACCTTAACCTTTCTTATTCTGTAGTATTCAAAGGGTATAGAGATTTTGTTGGTC AATTCAACCTTAACCTTTCTTATTCTGTAGTATTCAAAGGGCACAGAGCGGGGGTTTGAG AATTCAACCTTAACCTTTCTTATTCTGTAGTATTCAAAGGGCACAGAGCGGGGGTTTGAG ****** *** ***** * ** * ******** ** ** * * *** *PCVPK-15 IMP999-ECO IMP1010-ST IMP1011-48IMP1011-48CCGCCTGAGGGGGGGAGGAACTGGCCGATGTTGAATTTGAGGTAGTTAACATTCCAAGAT CCCCCTCCCGGGGGAACAAAGTCGTCAATATTAAATCTCATCATGTCCACCGCCCAGGAG CCCCCTCCCGGGGGAACAAAGTCGTCAATTTTAAATCTCATCATGTCCACCGCCCAGGAG CCCCCTCCTGGGGGAAGAAAGTCATTAATATTGAATCTCATCATGTCCACCGCCCAGGAG CCCCCTCCTGGGGGAAGAAAGTCATTAATATTGAATCTCATCATGTCCACCGCCCAGGAG ** *** ***** * ** * ** ** *** * * ** ** *** **PCVPK-15IMP999-ECOIMP1O1O-STIMP1011-48IMP1011-48GGC—TGCGAGTATCCTCCTTTT-ATGGTGAGTACAAATTCTGTAGAAAGGCGGGAATTG GGCGTTCTGACTGTGGTAGCCTTGACAGTATATCCGAAGGTGCGGGAGAGGCGGGTGTTG GGCGTTGTGACTGTGGTACGCTTGACAGTATATCCGAAGGTGCGGGAGAGGCGGGTGTTG GGCGTTCTGACTGTGGTTCGCTTGACAGTATATCCGAAGGTGCGGGAGAGGCGGGTGTTG GGCGTTTTGACTGTGGTTCGCTTGACAGTATATCCGAAGGTGCGGGAGAGGCGGGTGTTGPCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48AAGATACCCGTCTTTCGGCGCCATCTGTAACGGTTTCTGAAGGCGGGGTGTGCCAAATAT AAGATGCCATTTTTCCTTCTCCAACGGTAGCGGTGGC-GGGGGTGGA-CGAGCCAGGGGC AAGATGCCATTTTTCCTTCTCCAACGGTAGCGGTGGC-GGGGGTGGA-CGAGCCAGGGGC AAGATGCCATTTTTCCTTCTCCAGCGGTAACGGTGGC-GGGGGTGGA-CGAGCCAGGGGC AAGATGCCATTTTTCCTTCTCCAGCGGTAACGGTGGC-GGGGGTGGA-CGAGCCAGGGGC ***** ** ★ ★★ ★ * *** ★ *★★ **★★ * * ★* ★★ * **★*PCVPK-15 IMP999-ECO IMP1O1O-ST IMP1011-48 IMP1011-48GGTCTTCTCCGGAGGATGTTTCCAAGATGGCTGCGGGGGCGGGTCCTTCTTCTGCGGTAA GG----CGGCGGAGGATCTGGCCAAGATGGCTGCGGGGGCGGTGTCTTCTTCTGCGGTAA GG-----CGGCGGAGGATCTGGCCAAGATGGCTGCGGGGGCGGTGTCTTCTTCTGCGGTAA GG----CGGCGGAGGATCTGGCCAAGATGGCTGCGGGGGCGGTGTCTTCTTCTCCGGTAA GG----CGGCGGAGGATCTGGCCAAGATGGCTGCGGGGGCGGTGTCTTCTTCTCCGGTAAPCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48CGCCTCCTTGGCCACGTCATCCTATAAAAGTGAAAGAAGTGCGCTGCTGTAGTATTACCA CGCCTCCTTGGATACGTCATAGC-TGAAAACGAAAGAAGTGCGCTGTA—AGTATTACCA CGCCTCCTTGGATACGTCATAGC-TGAAAACGAAAGAAGTGCGCTGTA—AGTATTACCA CGCCTCCTTGGATACGTCATATC-TGAAAACGAAAGAAGTGCGCTGTA—AGTATTACCA CGCCTCCTTGGATACGTCATATC-TGAAAACGAAAGAAGTGCGCTGTA—AGTATTACCA *********** ******* * *** *************** **********By:MERIALTHE QUEEN’S UNIVERSITY OF BELFAST UNIVERSITY OF SASKATCHEWAN (Applicants)PCVPK-15IMP999-ECOIMP1010-ST IMP1011-48 IMP1011-48GCGCACTTCGGCAGCGGCAGCACCTCGGCAGCG—TCAGTG—AAAATGCCAAGCAAGAA GCGCACTTCGGCAGCGGCAGCACCTCGGCAGCACCTCAGCAGCAACATGCCCAGCAAGAA GCGCACTTCGGCAGCGGCAGCACCTCGGCAGCACCTCAGCAGCAACATGCCCAGCAAGAA GCGCACTTCGGCAGCGGCAGCACCTCGGCAGCACCTCAGCAGCAACATGCCGAGCAAGAA GCGCACTTCGGCAGCGGCAGCACCTCGGCAGCACCTCAGCAGCAACATGCCCAGCAAGAA ******************************** *** ** ***** ********PCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48---------AAGCGGCCCGCAACCCCATAAGAGGTGGGTGTTCACCCTTAATAATCCTTC GAATGGAAGAAGCGGACCCCAACCACATAAAAGGTGGGTGTTCACGCTGAATAATCCTTC GAATGGAAGAAGCGGACCCCAACCACATAAAAGGTGGGTGTTCACGCTGAATAATCCTTC GAATGGAAGAAGCGGACCCCAACCCCATAAAAGGTGGGTGTTCACTCTGAATAATCCTTC GAATGGAAGAAGCGGACCCCAACCCCATAAAAGGTGGGTGTTCACTCTGAATAATCCTTCPCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48CGAGGAGGAGAAAAACAAAATACGGGAGCTTCCAATCTCCCTTTTTGATTATTTTGTTTG CGAAGACGAGCGCAAGAAAATACGGGAGCTCCCAATCTCCCTATTTGATTATTTTATTGT CGAAGACGAGCGCAAGAAAATACGGGAGCTCCCAATCTCCCTATTTGATTATTTTATTGT CGAAGACGAGCGCAAGAAAATACGGGATCTTCCAATATCCCTATTTGATTATTTTATTGT CGAAGACGAGCGCAAGAAAATACGGGATCTTCCAATATCCCTATTTGATTATTTTATTGT *** ★* *** ** *********** ** ***** ***** ************ **PCVPK-15IMP999-ECOIMP1O1O-STIMP1011-48IMP1011-48CGGAGAGGAAGGTTTGGAAGAGGGTAGAACTCCTCACCTCCAGGGGTTTGCGAATTTTGC TGGCGAGGAGGGTAATGAGGAAGGACGAACACCTCACCTCCAGGGGTTCGCTAATTTTGT TGGCGAGGAGGGTAATGAGGAAGGACGAACACCTCACCTCCAGGGGTTCGCTAATTTTGT TGGCGAGGAGGGTAATGAGGAAGGACGAACACCTCACCTCCAGGGGTTCGCTAATTTTGTTGGCGAGGAGGGTAATGAGGAAGGACGAACACCTCACCTCCAGGGGTTCGCTAATTTTGT★ *** * * * * * * * * * ★ ★ •it * * * * *★ *******PCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48TAAGAAGCAGACTTTTAACAAGGTGAAGTGGTATTTTGGTGCCCGCTGCCACATCGAGAA GAAGAAGCAAACTTTTAATAAAGTGAAGTGGTATTTGGGTGCCCGCTGCCACATCGAGAA GAAGAAGCAAACTTTTAATAAAGTGAAGTGGTATTTGGGTGCCCGCTGCCACATCGAGAA GAAGAAGCAGACTTTTAATAAAGTGAAGTGGTATTTGGGTGCCCGCTGCCACATCGAGAA GAAGAAGCAGACTTTTAATAAAGTGAAGTGGTATTTGGGTGCCCGCTGCCACATCGAGAA ********* ******** ** ************** ***********************PCVPK-15IMP999-ECOIMP1010-ST IMP1011-48 IMP1011-48AGCGAAAGGTkACCGACCAGCAGAATAAAGAATACTGCAGTAAAGAAGGCCACATACTTAT AGCCAAAGGAACTGATCAGCAGAATAAAGAATATTGCAGTAAAGAAGGCAACTTACTTAT AGCCAAAGGAACTGATCAGCAGAATAAAGAATATTGCAGTAAAGAAGGCAACTTACTTAT AGCGAAAGGAACAGATCAGCAGAATAAAGAATACTGCAGTAAAGAAGGCAACTTACTGAT AGCGAAAGGAACAGATCAGCAGAATAAAGAATACTGCAGTAAAGAAGGCAACTTACTGAT *** ★*★★★*** *★ ★★★★****★*******★ ****★★*★★***★** ** it-ifiric **MERIALTHE QUEEN’S UNIVERSITY OF BELFAST UNIVERSITY OF SASKATCHEWAN (Applicants)PCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48CGAGTGTGGAGCTCCGCGGAACCAGGGGAAGCGCAGCGACCTGTCTACTGCTGTGAGTAC TGAATGTGGAGCTCCTCGATCTCAAGGACAACGGAGTGACCTGTCTACTGCTGTGAGTAC TGAATGTGGAGCTCCTCGATCTCAAGGACAACGGAGTGACCTGTCTACTGCTGTGAGTAC GGAGTGTGGAGCTCCTAGATCTCAGGGACAACGGAGTGACCTGTCTACTGCTGTGAGTAC GGAGTGTGGAGCTCCTAGATCTCAGGGACAACGGAGTGACCTGTCTACTGCTGTGAGTAC ★* *********** * *★ ★★ * ★* *★ ***********************PCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48CCTTTTGGAGACGGGGTCTTTGGTGACTGTAGCCGAGCAGTTCCCTGTAACGTATGTGAG cttgttggagagcgggagtctggtgaccgttgcagagcaggaccctgtaacgtttgtcag CTTGTTGGAGAGCGGGAGTCTGGTGACCGTTGCAGAGCAGCACCCTGTAACGTTTGTCAG CTTGTTGGAGAGCGGGAGTCTGGTGACCGTTGCAGAGCAGCACCCTGTAACGTTTGTCAG CTTGTTGGAGAGCGGGAGTCTGGTGACCGTTGCAGAGCAGCACCCTGTAACGTTTGTCAGPCVPK-15 IMP999-ECO IMP1O1O-ST IMP1011-48IMP1011-48AAATTTCCGCGGGCTGGCTGAACTTTTGAAAGTGAGCGGGAAGATGCAGCAGCGTGATTG AAATTTCCGCGGGCTGGCTGAACTTTTGAAAGTGAGCGGGAAAATGCAGAAGCGTGATTG aaatttccgcgggctggctgaacttttgaaagtgagcgggaaaatgcagaagcgtgattg AAATTTCCGCGGGCTGGCTGAACTTTTGAAAGTGAGCGGGAAAATGCAGAAGCGTGATTG AAATTTCCGCGGGCTGGCTGAACTTTTGAAAGTGAGCGGGAAAATGCAGAAGCGTGATTG ****************************************** **********PCVPK-15IMP999-ECOIMP1010-ST IMP1011-48 IMP1011-48GAAGACAGCTGTACACGTCATAGTGGGCCCGCCCGGTTGTGGGAAGAGCCAGTGGGCCCG GAAGACCAATGTACACGTCATTGTGGGGCCACCTGGGTGTGGTAAAAGCAAATGGGCTGC GAAGACCAATGTACACGTCATTGTGGGGCCACCTGGGTGTGGTAAAAGCAAATGGGCTGC GAAGACTAATGTACACGTCATTGTGGGGCCACCTGGGTGTGGTAAAAGCAAATGGGCTGC GAAGACTAATGTACACGTCATTGTGGGGCCACCTGGGTGTGGTAAAAGCAAATGGGCTGC ★ ************ ★ *r ** ***** * * * * * *PCVPK-15 IMP999-ECO IMP1O1O-STIMP1011-48IMP1011-48TAATTTTGCTGAGCCTAGGGACACCTACTGGAAGCCTAGTAGAAATAAGTGGTGGGATGG TAATTTTGCAGACCCGGAAACCACATACTGGAAACCACCTAGAAACAAGTGGTGGGATGG TAATTTTGCAGACCCGGAAACCACATACTGGAAACCACCTAGAAACAAGTGGTGGGATGG TAATTTTGCAGACCCGGAAACCACATACTGGAAACCACCTAGAAACAAGTGGTGGGATGG TAATTTTGCAGACCCGGAAACCACATACTGGAAACCACCTAGAAACAAGTGGTGGGATGG **★★★★*** ** ★* **★ ★*★*★*** -it W * * * *PCVPK-15IMP999-ECOIMP1O1O-STIMP1011-48IMP1011-48ATATCATGGAGAAGAAGTTGTTGTTTTGGATGATTTTTATGGCTGGTTACCTTGGGATGA TTACCATGGTGAAGAAGTGGTTGTTATTGATGACTTTTATGGCTGGCTGCCGTGGGATGA TTACCATGGTGAAGAAGTGGTTGTTATTGATGACTTTTATGGCTGGCTGCCGTGGGATGA TTACCATGGTGAAGAAGTGGTTGTTATTGATGACTTTTATGGCTGGCTGCCGTGGGATGA TTACCATGGTGAAGAAGTGGTTGTTATTGATGACTTTTATGGCTGGCTGCCGTGGGATGA ** ***** ******** ****** * ***** ************ * ** ********PCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48PCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48PCVPK-15 IMP999-ECO IMP1010-STIMP1011-48IMP1011-48PCVPK-15IMP999-ECOIMP1O1O-ST IMP1011-48IMP1011-48PCVPK-15IMP999-ECOIMP1O1O-STIMP1011-48IMP1011-48PCVPK-15IMP999-ECOIMP1O1O-STIMP1011-48IMP1011-48TCTACTGAGACTGTGTGACCGGTATCCATTGACTGTAGAGACTAAAGGGGGTACTGTTCC TCTACTGAGACTGTGTGATCGATATCCATTGACTGTAGAGACTAAAGGTGGAACTGTACC TCTACTGAGACTGTGTGATCGATATCCATTGACTGTAGAGACTAAAGGTGGAACTGTACC TCTACTGAGACTGTGTGATCGATATCCATTGACTGTAGAGACTAAAGGTGGAACTGTACC TCTACTGAGACTGTGTGATCGATATCCATTGACTGTAGAGACTAAAGGTGGAACTGTACC ****************** ** ************************** *★ ***** **TTTTTTGGCCCGCAGTATTTTGATTACCAGCAATCAGGCCCCCCAGGAATGGTACTCCTC TTTTTTGGCCCGCAGTATTCTGATTACCAGCAATCAGACCCCGTTGGAATGGTACTCCTC ttttttggcccgcagtattctgattaccagcaatcagaccccgttggaatggtactcctc TTTTTTGGCCCGCAGTATTCTGATTACCAGCAATCAGACCCCGTTGGAATGGTACTCCTC TTTTTTGGCCCGCAGTATTCTGATTACCAGCAATCAGACCCCGTTGGAATGGTACTCCTC ******************* ***************** ★ * ★ ★ ***************AACTGCTGTCCCAGCTGTAGAAGCTCTCTATCGGAGGATTACTACTTTGCAATTTTGGAA AACTGCTGTCCCAGCTGTAGAAGCTCTCTATCGGAGGATTACTTCCTTGGTATTTTGGAA AACTGCTGTCCCAGCTGTAGAAGCTCTCTATCGGAGGATTACTTCCTTGGTATTTTGGAA AACTGCTGTCCCAGCTGTAGAAGCTCTTTATCGGAGGATTACTTCCTTGGTATTTTGGAA AACTGCTGTCCCAGCTGTAGAAGCTCTTTATCGGAGGATTACTTCCTTGGTATTTTGGAA ★ ★ ★★★ ★ * ★ ★ ★ ★ ★ ★ ★GACTGCTGGAGAACAATCCACGGAGGTACCCGAAGGCCGATTTGAAGCAGTGGACCCACC GAATGCTACAGAACAATCCACGGAGGAA---GGGGGCCAGTTCGTCACCCTTTCCCCCCC GAATGCTACAGAACAATCCACGGAGGAA---GGGGGCCAGTTCGTCACCCTTTCCCCCCC GAATGCTACAGAACAATCCACGGAGGAA---GGGGGCCAGTTCGTCACCCTTTCCCCCCC GAATGCTACAGAACAATCCACGGAGGAA---GGGGGCCAGTTCGTCACCCTTTCCCCCCC★ ★ ★★★★ ★ *r ★★★★ ★★ ★ ★ •* ★★★ ★★CTGTGCCCTTTTCCCATATAAAATAAATTACTGAGTCTTTTTTGTTATCACATCGTAATG ATGCCCTGAATTTCCATATGAAATAAATTACTGAGTCTTTTT---TATCACTTCGTAATGATGCCCTGAATTTCCATATGAAATAAATTACTGAGTCTTTTT---TATCACTTCGTAATGATGCCCTGAATTTCCATATGAAATAAATTACTGAGTCTTTTT---TATCACTTCGTAATGATGCCCTGAATTTCCATATGAAATAAATTACTGAGTCTTTTT---TATCACTTCGTAATGGTTTTTATT-TTTATTTA---TTTA----GAGGGTCTTTTAGGATAAATTCTCTGAATTG GTTTTTATTATTCATTTAGGGTTTAAGTGGGGGGTCTTTAAGATTAAATTCTCTGAATTG GTTTTTATTATTCATTTAGGGTTTAAGTGGGGGGTCTTTAAGATTAAATTCTCTGAATTG GTTTTTATTATTCATTAAGGGTT-AAGTGGGGGGTCTTTAAGATTAAATTCTCTGAATTG GTTTTTATTATTCATTAAGGGTT-AAGTGGGGGGTCTTTAAGATTAAATTCTCTGAATTGPCVPK-15IMP999-ECOIMP1010-STIMP1011-48IMP1011-48PCVPK-15 IMP999-ECO IMP1O1O-ST IMP1011-48 IMP1011-48TACATAAATAGTCAGCCTTACCACATAATTTTGGGCTGTGGCTGC-ATTTTGGAGCGCAT TACATACATGGTTACACGGATATTGTAGTCCTGG-TCGTATATACTGTTTTCGAACGCAG TACATACATGGTTACACGGATATTGTAGTCCTGG-TCGTATTTACTGTTTTCGAACGCAG TACATACATGGTTACACGGATATTGTATTCCTGG-TCGTATATACTGTTTTCGAACGCAG TACATACATGGTTACACGGATATTGTATTCCTGG-TCGTATATACTGTTTTCGAACGCAG ****** ** ** * * * ** * *** *★ * **** ** ****AGCCGAGGCCTGTGTGCTCGACATTGGTGTGGGTATTTAAATGGAGCCACAGCTGGTTTC TGCCGAGGCCTACGTGGTCCACATTTCTAGAGGTTTGTAGCCTCAGCCAAAGCTGATTCC CGCCGAGGCCTACGTGGTCCACATTTCCAGAGGTTTGTAGTCTCAGCCAAAGCTGATTCC TGCCGAGGCCTACGTGGTCTACATTTCCAGCAGTTTGTAGTCTCAGCCACAGCTGGTTTC TGCCGAGGCCTACGTGGTCTACATTTCCAGTAGTTTGTAGTCTCAGCCACAGCTGATTTC ********** *** ** ***** ** * ** ***** ***** ** *PCVPK-15 TTTTATTATTTGGGTGGAACCAATCAATTGTTTGGTCCAGCTCAGGTTTGGGGGTGAAGT IMP999-ECO TTTTGTTATTTGGTTGGAAGTAATCAATAGTGGAGTCAAGAACAGGTTTGGGTGTGAAGT IMP1O1O-ST TTTTGTTATTTGGTTGGAAGTAATCAATAGTGGAGTCAAGAACAGGTTTGGGTGTGAAGT IMP1011-48 TTTTGTTGTTTGGTTGGAAGTAATCAATAGTGGAATCTAGGACAGGTTTGGGGGTAAAGT IMP1011-48 TTTTGTTGTTTGGTTGGAAGTAATCAATAGTGGAATCTAGGACAGGTTTGGGGGTAAAGTPCVPK-15 IMP999-ECO IMP1O1O-STIMP1011-48IMP1011-48PCVPK-15 IMP999-ECO IMP1O1O-ST IMP1011-48 IMP1011-48PCVPK-15IMP999-ECOIMP1O1O-STIMP1011-48IMP1011-48ACCTGGAGTGGTAGGTAAAGGGCTGCCTTATGGTGTGGCGGGAGGAGTAGTTAATATAGG AACGGGAGTGGTAGGAGAAGGGTTGGGGGATTGTATGGCGGGAGGAGTAGTTTACATATG AACGGGAGTGGTAGGAGAAGGGTTGGGGGATTGTATGGCGGGAGGAGTAGTTTACATATG AGCGGGAGTGGTAGGAGAAGGGCTGGGTTATGGTATGGCGGGAGGAGTAGTTTACATAGG AGCGGGAGTGGTAGGAGAAGGGCTGGGTTATGGTATGGCGGGAGGAGTAGTTTACATAGG★ ★ ★★★★★★★*★★* ★ ★ ★ *r *r *•★★★★★★★★★★★*•★★★★ ★ ★GGTCATAGGCCAAGTTGGTGGAGGGGGTTACAAAGTTGGCATCCAAGATAACAACAGTGG GGTCATAGGTTAGGGCTGTGGCCTTTGTTACAAAGTTATCATCTAGAATAACAGCAGTGG GGTCATAGGTTAGGGCTGTGGCCTTTGTTACAAAGTTATCATCTAGAATAACAGCAGTGG GGTCATAGGTGAGGGCTGTGGCCTTTGTTACAAAGTTATCATCTAGAATAACAGCACTGG GGTCATAGGTGAGGGCTGTGGCCTTTGTTACAAAGTTATCATCTAGAATAACAGCACTGG ★★***★**★ * ★ **** *★★*★★*★*★★ *★★★ * ★★***★ *★ ***ACCCAACACCTCTTTGATTAGAGGTGATGGGGTCTCTGGGGTAA AGCCCACTCCCCTATCACCCTGGGTGATGGGGGAGCAGGGCCAG AGCCCACTCCCCTATCACCCTGGGTGATGGGGGAGCAGGGCCAG AGCCCACTCCCCTGTCACCCTGGGTGATCGGGGAGCAGGGCCAG AGCCCACTCCCCTGTCACCCTGGGTGATCGGGGAGCAGGGCCAGMERIALTHE QUEEN’S UNIVERSITY OF BELFAST UNIVERSITY OF SASKATCHEWAN (Applicants)GAATTCAACC TTAACCTTTT TTATTCTGTA gTATTCAAAG GGTATAaAgA TTTTGTTGGT CCCCCCTCCC GGGGGAACAA AGTCgTCAAT ATTAAATCTC ATCATGTCCA CCGCCCAGGA GGGCGTTCTG ACTGTGGTAg CCTTGACAgT ATATCCGAAG GTGCGGGAGA rGCGGGTGTT GAAAATGCCA TTTTTCCTTC TCCAACGGTA GCGGTGGCGG GGGTGGACmA nCCAcgGGCG GCGGCGGAwG ATCTGGCCAA GATGGCTGCG GGGGCGGTGT CTTCTTCTGC GGTAACGCCT CCTTGGATAC GTCATAgCTG AAAACGAAAG AAGTGCGCTG TAaGTATTAC CAGCGCACTT CGGCAGCGGC AGCACCTCGG CAGCaCCTCA GCAGCAACAT GCCCAGCAAG AAGAATGGAA GAAGCGGACC CCAACCACAT AAAAGGTGGG TGTTCACGCT GAATAATCCT TCCGAAGACG AGCGCAAGAA AATACGGGAG CTCCCaATCT CCCTATTTGA TTATTTTATT GTTGGCGAGG AGGGTwwTGA gCAAnGACgA ACACCTCACC TCCAGGGGTT CGCtAATTTT GTGAAGAAgC aaACTTtTAA TAAAGTGAAG TGGTATTTGG GTGCCCGCTG CCACATCGAG AAAGCCAaAG GAACTGATCA GCAGAATAAA GAATATTGCA GTAAAgAAGG CAACTTACTT ATTGAATGTG GAGCTCCTCG ATCTCAAGGA CAACGGAGTG ACCTGTCTAC TGCTGTGAGT ACCTTGTTGG AGAGCGGGAG TCTGGTGACC GTTGCAGAGC AGCACCCTGT AACGTTTGTC AGAAATTTCC GCGGGCTGGC TGAACTTTTG AAAGTGAGCG GGAAAATGCA GAAGCGTGAT TGGAAGACCA ATGTACACGT CATTGTGGGG CCACCTGGGT GTGGTAAAAG CAAATGGGCT GCTAATTTTG CAGACCCGGA AACCACATAC TGGAAACCAC CTAGAAACAA GTGGTGGGAT GGTTACCATG GTGAAGAAGT GGTTGTTATT GATGACTTTT ATGGCTGGCT GCCGTGGGAT GATCTACTGA GACTGTGTGA TCGATATCCA TTGACTGTAG AGACTAAAGG TGGAACTGTA CNNNNNNNGG CCCGCAGTAT TCTGATTACC AGCAATCAGA CCCCGTtGGA ATGGTACTCC TCAACTGCTG TCCCAGCtGT AGAAGCTCTC TATCGGAGGA ttACTTCCTT GGTATTTtGG AaGAATGCTA CAGAACAATC CACGGAGGAA GGGGGCCAGT TnGTCACCCT TTCCCCCCCA TGCCcTGAAT TTCCATaTGA AATAAATTAC TGAGTCTTTT TTATCACTTC GTAATGGTTT TTATTATTCA TTTAGGGTTT AAGTGGGGGG TCTTTAAGAT TAAATTCTCT GAATTGTACA TACATGGTTA CACGGATATT GTAGTCCTGG TCGTATATAC TGTTTTCGAA CGCAGTGCCG AGGCCTACGT GGTCCACATT TCTAGAGGTT tGTAGCCTCA gCCAAAGCtG ATTCCTTTTG TTATTTGGTT GGAAGTAATC AATAGTGGAG TCAAGAACAG GTTTGGGTGT GAAGTAACGG GAGTGGTAGG AGAAGGGTTG GGGGATTGTA TGGCGGGAGG AGTAGTTTAC ATATGGGTCA TAGGTTAGGG CTGTGGCCTT TGTTACAAAG TTATCATcTA GAATAACAGC AGTGGAGCCC ACTCCCCTAT CACCCTGGGT GATGGGGGAG CAGGGCCA 8con.s = sequence clone pGEM-7 / 8 pcveco = sequence strain PCV PK / 15SCORES Initl: 2517 Initn: 3774 Opt: 401075.8% identity in 1785 bp overlap1769      1759      1749      1739      1729      17198 con.s GAATTCTGGCCCTGCTCCCCCATCACCCAGGGTGATAGGGGAGTGGGCTCCACTGCTGTTpcveco GAATTTTACCCCAGAGACCCCATCACCTCTAATCAAAGAGGTGTTGGGTCCACTGTTGTT10         20         30         40         50         601709      1699      1689      1679      1669      16598 con.s ATTCTAGATGATAACTTTGTAACAAAGGCCACAGCCCTAACCTATGACCCATATGTAAACpcveco ATCTTGGATGCCAACTTTGTAACCCCCTCCACCAACTTGGCCTATGACCCCTATATTAAC70         80         90        100        110        1201649      1639      1629      1619      1609      15998 con.s TACTCCTCCCGCCATACAATCCCCCAACCCTTCTCCTACCACTCCCGTTACTTCACACCCpcveco TACTCCTCCCGCCACACCATAAGGCAGCCCTTTACCTACCACTCCAGGTACTTCACCCCC130       140       150       160       170       1801589      1579      1569      1559      1549      15398con.s AAACCTGTTCTTGACTCCACTATTGATTACTTCCAACCAAATAACAAAAGGAATCAGCTTpcveco AAACCTGAGCTGGACCAAACAATTGATTGGTTCCACCCAAATAATAAAAGAAACCAGCTG190       200       210       220       230       240MERIALTHE QUEEN’S UNIVERSITY OF BELFAST UNIVERSITY OF SASKATCHEWAN (Applicants)1529      1519      1509      1499      1489      14798con.s TGGCTGAGGCTACAAACCTCTAGAAATGTGGACCACGTAGGCCTCGGCACTGCGTTCGAApcve co TGGCTCCATTTAAATACCCACACCAATGTCGAGCACACAGGCCTCGGCTATGCGCTCCAA250       260       270       280       290       3001469       1459      1449      1439      1429      14198 con.s AACAGTATATAC-GACCAGGACTACAATATCCGTGTAACCATGTATGTACAATTCAGAGApcveco AA-TGCAGCCACAGCCCAAAATTATGTGGTAAGGCTGACTATTTATGTACAATTCAGAGA310       320       330       340       3501409      1399      1389      1379      1369      13598con.S ATTTAATCTTAAAGACCCCCCACTTAAACCCTAAATGAATAATAAAAACCATTACGAAGTpcveco ATTTATCCTAAAAGACCCTC----TAAA---TAAAT-AAAAATAAAAACCATTACGATGT360       370           380           390       400       4101349      1339      1329      1319      1309      12998con.s GAT---AAAAAAGACTCAGTAATTTATTTCATATGGAAATTCAGGGCATGGGGGGGAAAGpcveco GATAACAAAAAAGACTCAGTAATTTATTTTATATGGGAAAAGGGCACAGGGTGGGTCCAC8 con.s GGTGACNAACTGGCCCCC---TTCCTCCGTGGATTGTTCTGTAGCATTCTTCCAAAATACpcveco TGCTTCAAATCGGCCTTCGGGTACCTCCGTGGATTGTTCTCCAGCAGTCTTCCAAAATTG480       490       500       510       520       5301239      1219      1219      1209      1199      11898con.s CAAGGAAGTAATCCTCCGATAGAGAGCTTCTACAGCTGGGACAGCAGTTGAGGAGTACCA III I IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIII pcveco CAAAGTAGTAATCCTCCGATAGAGAGCTTCTACAGCTGGGACAGCAGTTGAGGAGTACCA8con.s TTCCAACGGGGTCTGATTGCTGGTAATCAGAATACTGCGGGCCNNNNNNNGTACAGTTCCIlli Illi II111111111111111 1111111111111^:-:---1 Hill II pcveco TTCCTGGGGGGCCTGATTGCTGGTAATCAAAATACTGCGGGCCAAAAAAGGAACAGTACC8con.s ACCTTTAGTCTCTACAGTCAATGGATATCGATCACACAGTCTCAGTAGATCATCCCACGGII I I I I I I I I H I I I I I II I I I I I I I H 1 H I I I I IH I I I I I 1 H I I I 1 Illi IIpcveco CCCTTTAGTCTCTACAGTCAATGGATACCGGTCACACAGTCTCAGTAGATCATCCCAAGG8con.s CAGCCAGCCATAAAAGTCATCAATAACAACCACTTCTTCACCATGGTAACCATCCCACCApcveco TAACCAGCCATAAAAATCATCCAAAACAACAACTTCTTCTCCATGATATCCATCCCACCA720       730       740       750       760       770999        989        979        969        959        9498 con.s CTTGTTTCTAGGTGGTTTCCAGTATGTGGTTTCCGGGTCTGCAAAATTAGCAGCCCATTT in mm ii iiiiim hi ii ii iiiiiiiii mu i pcveco CTTATTTCTACTAGGCTTCCAGTAGGTGTCCCTAGGCTCAGCAAAATTACGGGCCCACTG8 con.S GCTTTTACCACACCCAGGTGGCCCCACAATGACGTGTACATTGGTCTTCCAATCACGCTTpcveco GCTCTTCCCACAACCGGGCGGGCCCACTATGACGTGTACAGCTGTCTTCCAATCACGCTG8 con.s CTGCATTTTCCCGCTCACTTTCAAAAGTTCAGCCAGCCCGCGGAAATTTCTGACAAACGT IHIII I IIIIIIHIIII lllllllllllllllllllllllllllllll III Illi pcveco CTGCATCTTCCCGCTCACTTTCAAAAGTTCAGCCAGCCCGCGGAAATTTCTCACATACGT8 con.s TACAGGGTGCTGCTCTGCAACGGTCACCAGACTCCCGCTCTCCAACAAGGTACTCACAGC mim mm ii ii limn i in mini i miimim pcveco TACAGGGAACTGCTCGGCTACAGTCACCAAAGACCCCGTCTCCAAAAGGGTACTCACAGC960 970 980 990 1000      1010 759 749 739 729 719 709 8 con.s AGTAGACAGGTCACTCCGTTGTCCTTGAGATCGAGGAGCTCCACATTCAATAAGTAAGTTpcveco AGTAGACAGGTCGCTGCGCTTCCCCTGGTTCCGCGGAGCTCCACACTCGATAAGTATGTG1020      1030      1040      1050      1060      1070699        689        679        669        659        649Scon.s GCCTTCTTTACTGCAATATTCTTTATTCTGCTGATCAGTTCCTTTGGCTTTCTCGATGTGpcveco GCCTTCTTTACTGCAGTATTCTTTATTCTGCTGGTCGGTTCCTTTCGCTTTCTCGATGTG1080      1090      1100      1110      1120      1130639        629        619        609        599       5898con.s GCAGCGGGCACCCAAATACCACTTCACTTTATTAAAAGTTTGCTTCTTCACAAAATTAGCpcveco GCAGCGGGCACCAAAATACCACTTCACCTTGTTAAAAGTCTGCTTCTTAGCAAAATTCGC1140      1150      1160      1170      1180      1190579       569       559       549       539       5298 con.s GAACCCCTGGAGGTGAGGTGTTCGTCNTTCCTCAWWACCCTCCTCGCCAACAATAAAATApcveco AAACCCCTGGAGGTGAGGAGTTCTACCCTCTTCCAAACCTTCCTCTCCGCAAACAAAATA 1200      1210      1220      1230      1240      1250519       509       499       489       479       4698 con.s ATCAAATAGGGAGATTGGGAGCTCCCGTATTTTCTTGCGCTCGTCTTCGGAAGGATTATTpcveco ATCAAAAAGGGAGATTGGAAGCTCCCGTATTTTGTTTTTCTCCTCCTCGGAAGGATTATT1260       1270      1280      1290      1300      1310459        449        439        429        419        4098con.s CAGCGTGAACACCCACCTTTTATGTGGTTGGGGTCCGCTTCTTCCATTCTTCTTGCTGGGpcveco AAGGGTGAACACCCACCTCTTATGGGGTTGCGGGCCGCTT---------TTCTTGCTTGG399       389       379       369       359       3498con.s CATGTTGCTGCTGAGGTGCTGCCGAGGTGCTGCCGCTGCCGAAGTGCGCTGGTAATACT-pcveco CATTTT—CACTGA—CGCTGCCGAGGTGCTGCCGCTGCCGAAGTGCGCTGGTAATACTA1370        1380      1390      1400      1410339       329        319       309       299       2898 con.s -TACAGCGCACTTCTTTC-GTTTTCAGCTATGACGTATCCAAGGAGGCGTTACCGCAGAA Hit lllllllllll IIH IIIHII H111111111111111111H pcveco CAGCAGCGCACTTCTTTCACTTTTATAGGATGACGTGGCCAAGGAGGCGTTACCGCAGAA1420      1430      1440      1450      1460      1470279       269       259       249       239       2298 con.S GAAGACACCGCCCCCGCAGCCATCTTGGCCAGATCWTCCGCCGCCGCCCGTGGNTKGTCCpcveco GAAGGACCCGCCCCCGCAGCCATCTTGGAAACATCCTCCGGAGAAGACCATATTTGGCAC1480      1490 1500 1510 1520 1530 219 209 199 189 179 8con.s ACCCCCGCC----- —ACCGCTACCGTTGGAGAAGGAAAAATGGCATTTTCAACACCCGC 1 lllllll III! III I 1 1 1 1 1 II 1 II II Hill Hill pcveco A-CCCCGCCTTCAGAAACCGTTACAGATGGCGCCGAAAGACGGGTATCTTCAATTCCCGC8con.s YTCTCCCGCACCTTCGGATATACTGTCAAGGCTACCACAGTCAGAACGCCCTCCTGGGCG I II II I I II I II I I I I II I III II III pcveco CTTTCTACAGAATTTGTACTCACCATAAAAG-GAGGATACTCGCA—GCCATCTTGGAAT1600      1610      1620       1630      1640        1650INTELLECTUALPROPERTY PH'UPPINE'109         99         89         79         69        59® AUG 21 P4 8.f8con. s pcveco8con. spcvecoGTGGACATGATGAGATTTAATATTGACGACTTTGTTCCCCCGGGAGGGGGGACCAACAAAii h ii in ii ii i i i ii i iiiii in ii imnGTTAACTACCTCAAATTCAACATCGGCCAGTTCCTCCCCCCCTCAGGCGGCACCAACCC^gggjy1660      1670      1680      1690      1700      1710           / 49         39         29         19          9ATCTTTATACCCTTTGAATACTACAGAATAAAAAAGGTTAAGGTTI Illi II llllllll I II I IIIII III ICTACCCCTACCTTTCCAATACTACCGTATTAGAAAGGCTAAATAT1720      1730      1740      1750<160> NUMBER OF SEQ ID NOSs S<210> SEQ ID NO 1<211> LENGTH: 1767<212> TYPE: DNA<213> ORGANISM: Porcine circovirus<400> SEQUENCE: 1aattcaacct taacctttct tattctgtag tattcaaagg ccccctcctg ggggaagaaa gtcattaata ttgaatctca ggcgttctga ctgtggttcg cttgacagta tatccgaagg aagatgccat ttttccttct ccagcggtaa cggtggcggg cggcggagga tctggccaag atggctgcgg gggcggtgtc cttggatacg tcatatctga aaacgaaaga agtgcgctgt ggcagcggca gcacctcggc agcacctcag cagcaacatg aagcggaccc caaccccata aaaggtgggt gttcactctg gcgcaagaaa atacgggatc ttccaatatc cctatt-tgat gggtaatgag gaaggacgaa cacctcacct ccaggggttc gacttttaat aaagtgaagt ggtatttggg tgcccgctgc aacagatcag cagaataaag aatactgcag taaagaaggc agctcctaga tctcagggac aacggagtga cctgtctact gagcgggagt ctggtgaccg ttgcagagca gcaccctgta cgggctggct gaacttttga aagtgagegg gaaaatgeag tgtacacgtc attgtggggc cacctgggtg tggtaaaagc agacccggaa accacatact ggaaaccacc tagaaacaag tgaagaagtg gttgttattg atgactttta tggctggctg actgtgtgat cgatatccat tgactgtaga gactaaaggt ccgcagtatt ctgattacca gcaatcagac cccgttggaa cccagctgta gaagetettt ateggaggat tacttccttg agaacaatcc aeggaggaag ggggccagtt cgtcaccctt. tccatatgaa ataaattact gagtcttttt tatcacttcg taagggttaa gtggggggtc tttaagatta aattctctga eggatattgt attcctggtc gtatatactg ttttcgaacg tctacatttc cagcagtttg tagtctcagc cacagctggt aagtaatcaa tagtggaatc taggacaggt ttgggggtaa aagggctggg ttatggtatg gegggaggag tagtttacat gtggcctttg ttacaaagtt atca-tctaga ataacagcac ccctgggtga tcggggagca gggccaggcacagagcg ! ggggtttgag 60 tcatgtccac cgcccaggag 120 8 AUG 21 tgcgggagag gcgggtgttg 180 ggtggacgag ccaggggcgg 240 OSCEnTiraz. ttcttctccg gtaacgcctc 300 aagtattacc agcgcacttc 360 ccgagcaaga agaatggaag 420 aataatcctt ccgaagacga 48^ - tattttattg ttggcgagga 540 gctaattttg tgaagaagca 600 cacatcgaga aagegaaagg 660 aacttactga tggagtgtgg 720 gctgtgagta ccttgttgga 780 acgtttgtca gaaattteeg 840 aageg-tgatt ggaagactaa 900 aaatgggctg ctaattttgc 960 tggtgggatg gttaccatgg 1020 ccctgggatg atetaetgag 1080 ggaactgtac cttttttggc 1140 tggtactcct caactgctgt 1200 gtattttgga agaatgctac 1260 tcccccccat gcccrtgaatt 1320 taatggtttt tattattcat 1380 attgtacata catggttaca 1440 cagtgccgag gcctacgtgg 1500 ttcttttgtt gtttggttgg 1560 agtagcggga gtggtaggag 1620 agggg-tcata ggtgagggct 1680 tggagcccac tcccctgtca 1740 <400> SEQUENCE: 2aattcaacct taacctttct -tattctgtag tattcaaagg gcacagagcg ggggtttgag     60ccccctcctg ggggaagaaa gtcattaata ttgaatctca tcatgtccac cgcccaggag    120ggcgttttga ctgtggttcg cttgacagta tatccgaagg tgcgggagag gcgggtgttg    180aagatgccat ttttccttct ccagcggtaa cggtggcggg ggtggacgag ccaggggcgg    240cggcggagga tctggccaag atggctgcgg gggcggtgtc ttcttctccg gtaacgcctc    300cttggatacg tcatatctga aaacgaaaga agtgcgctgt aagtattacc agcgcacttc    360ggcagcggca gcacctcggc agcacctcag cagcaacatg cccagcaaga agaatggaag   420aagcggaccc caaccccata aaaggtgggt gttcactctg aataatcctt ccgaagacga    480gcgcaagaaa atacgggatc ttccaatatc cctatttgat tattttattg ttggcgagga    540gggtaatgag gaaggacgaa cacctcacct ccaggggttc gctaattttg tgaagaagca    600gacttttaat aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagcgaaagg    660aacaga-tcag cagaataaag aatactgcag taaagaaggc aacttactga tggagtgtgg    720agctcc-taga tctcagggac aacggagtga cctgtctact gctgtgagta ccttgttgga    780gagcgggagt ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg    840cgggctggct gaacttttga aagtgagcgg gaaaatgcag aagcgtgatt ggaagactaa    900tgtacacgtc attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc    960agacccggaa accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg   1020tgaagaagtg gttgttattg atgactttta tggctggctg ccctgggatg atctactgag   1080actgtgtgat cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttggc   1140ccgcag-tatt ctgattacca gcaatcagac cccgttggaa tggtactcct caactgc-tgt   1200cccagctgta gaagctcttt atcggaggat tacttccttg gtattttgga agaa-tgctac   1260agaacaatcc acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt   1320tccatatgaa ataaattact gagtcttttt tatcacttcg taatggtttt tattattcat   1380taagggttaa gtgggggg-tc tttaagatta aattctctga attgtacata catggttaca   1440cggatattgt attcctggtc gtatatactg ttttcgaacg cagtgccgag gcctacgtgg   1500tctacatttc cagtagtttg tagtctcagc cacagctgat ttcttttgtt gtttggttgg   1560aagtaatcaa tagtggaatc taggacaggt ttgggggtaa agtagcggga gtggtaggag   1620aagggctggg ttatggtatg gcgggaggag tagtttacat aggggtcata ggtgagggct   1680gtggcctttg ttacaaagtt atcatctaga ataacagcac tggagcccac tcccctgtca 1740 ccctgggtga tcggggagca gggccag                                       1767<400> SEQUENCES 3aattcaacct taaccttttt tattctgtag tattcaaagg gtatagagat tttgttggtc     60ccccctcccg ggggaacaaa gtcgtcaata ttaaatctca tcatgtccac cgcccaggag    120ggcgttctga ctgtggtagc cttgacagta tatccgaagg tgcgggagag gcgggtgttg    180aagatgccat ttttccttct ccaacggtag cggtggcggg ggtggacgag ccaggggcgg    240cggcggagga tctggccaag atggctgcgg gggcggtgtc ttcttctgcg gtaacgcctc    300cttggatacg tcatagctga aaacgaaaga agtgcgctgt aagtattacc agcgcacttc    360ggcagcggca gcacctcggc agcacctcag cagcaacatg cccagcaaga agaatggaag    420aagcggaccc caaccacata aaaggtgggt gttcacgctg aataatcctt ccgaagacga    480gcgcaagaaa atacgggagc tcccaatctc cctatttgat tattttattg ttggcgagga    540gggtaatgag gaaggacgaa cacctcacct ccaggggttc gctaattttg tgaagaagca    600aacttttaat aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagccaaagg    660aactgatcag cagaataaag aatattgcag taaagaaggc aacttactta ttgaatgtgg    720agctcctcga tctcaaggac aacggagtga cctgtctact gctgtgagta ccttgttgga    780gagcgggagt ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg    840cgggctggct gaacttttga aagtgagcgg gaaaatgcag aagcgtgatt ggaagaccaa    900tgtacacgtc attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc    960agacccggaa accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg   1020tgaagaagtg gttgttattg atgactttta tggctggctg ccgtgggatg atctactgag   1080artgtgtgat cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttggc   1140ccgcagtatt ctgattacca gcaatcagac cccgttggaa tggtactcct caactgctgt   1200cccagctgta gaagctctct atcggaggat tacttccttg gtattttgga agaatgctac   1260agaacaatcc acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt   1320tccatatgaa ataaattact gagtcttttt tatcacttcg taatggtttt tattattcat   1380ttagggttta agtggggggt ctttaagatt aaattctctg aattgtacat acatggttac   1440acggatattg tagtcctggt cgtatatact gttttcgaac gcagtgccga ggcctacgtg   1500gtccacattt ctagaggttt gtagcctcag ccaaagctga ttccttttgt tatttggttg   1560gaagtaatca atagtggagt caagaacagg tttgggtgtg aagtaacggg agtggtagga   1620gaagggttgg gggattgtat ggcgggagga gtagtttaca tatgggtcat aggttagggc   1680tgtggccttt gttacaaagt tatcatctag aataacagca gtggagccca ctcccctatc   1740<400> SEQUENCE: 4aattcaacct taacctttct -tat-tctgtag tattcaaagg gtatagagat t-ttgttggtc     60ccccc-tcccg ggggaacaaa gtcgtcaatt ttaaatctca tcatgtccac cgcccaggag    120ggcgttgtga ctgtggtacg cttgacagta tatccgaagg tgcgggagag gcgggtgttg    180aagatgccat ttttccttct ccaacggtag cggtggcggg ggtggacgag ccaggggcgg   240cggcggagga tctggccaag atggctgcgg gggcggtgtc ttcttctgcg gtaacgcctc    300cttggatacg tcatagctga aaacgaaaga agtgcgctgt aagtattacc agcgcacttc    360ggcagcggca gcacctcggc agcacctcag cagcaacatg cccagcaaga agaatggaag    420aagcggaccc caaccacata aaaggtgggt gttcacgctg aataatcctt ccgaagacga    480gcgcaagaaa a-tacgggagc tcccaatctc cctatttgat tattttattg ttggcgagga    54 0gggtaatgag gaaggacgaa cacctcacct ccaggggttc gctaattttg tgaagaagca    600aacttttaat aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagccaaagg    660aactgatcag cagaataaag aatattgcag taaagaaggc aacttactta ttgaatgtgg    720agctcctcga tctcaaggac aacggagtga cctgtctact gctgtgagta ccttgttgga    780gagcgggagt ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg    840cgggctggct gaacttttga aagtgagcgg gaaaatgcag aagcgtgatt ggaagaccaa    900tgtacacg-tc attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc    960agacccggaa accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg   1020tgaagaagtg gttgttattg atgactttta tggctggctg ccgtgggatg atctactgag   1080actgtgtgat cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttggc   1140ccgcagtatt ctgattacca gcaatcagac cccgttggaa tggtactcct caactgctgt   1200cccagctgta gaagctctct atcggaggat tacttccttg gtattttgga agaatgctac   1260agaacaatcc acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt   1320tccatatgaa ataaattact gagtcttttt tatcacttcg taatggtttt tattattcat   1380ttagggttta agtggggggt ctttaagatt aaattctctg aattgtacat acatggttac   1440acggatattg tagtcctggt cgtatttact gttttcgaac gcagcgccga ggcctacgtg   1500gtccacattt ccagaggttt gtagtctcag ccaaagctga ttccttttgt tatttggttg   1560gaagtaatca atagtggagt caagaacagg tttgggtgtg aagtaacggg agtggtagga   1620gaagggttgg gggattgtat ggcgggagga gtagtttaca tatgggtcat aggttagggc   1680tgtggccttt gttacaaagt tatcatctag aataacagca gtggagccca ctcccctatc 1740 accctgggtg atgggggagc agggccag                                     1768<400> SEQUENCE: 5aattcatatt tagcctttct aatacggtag tattggaaag gtaggggtag ggggttggtg     60ccgcctgagg gggggaggaa ctggccgatg ttgaatttga ggtagttaac attccaagat    120ggctgcgagt atcctccttt tatggtgagt acaaattctg tagaaaggcg ggaattgaag    180atacccgtct ttcggcgcca tctgtaacgg tttctgaagg cggggtgtgc caaatatggt    240cttctccgga ggatgtttcc aagatggctg cgggggcggg tccttcttct gcggtaacgc    300ctccttggcc acgtcatcct ataaaagtga aagaagtgcg ctgctgtagt attaccagcg    360cacttcggca gcggcagcac ctcggcagcg tcagtgaaaa tgccaagcaa gaaaagcggc    420ccgcaacccc ataagaggtg ggtgttcacc cttaataatc cttccgagga ggagaaaaac    480aaaatacggg agcttccaat ctcccttttt gattattttg tttgcggaga ggaaggtttg   540gaagagggta gaactcctca cctccagggg tttgcgaatt ttgctaagaa gcagactttt    600aacaaggtga agtggtattt tggtgcccgc tgccacatcg agaaagcgaa aggaaccgac    660cagcagaata aagaatactg cagtaaagaa ggccacatac ttatcgagtg tggagctccg    720cggaaccagg ggaagcgcag cgacctgtct actgctgtga gtaccctttt ggagacgggg    780tctttggtga ctgtagccga gcagttccct gtaacgtatg tgagaaattt ccgcgggctg    840gctgaacttt tgaaagtgag cgggaagatg cagcagcgtg attggaagac agctgtacac    900gtcatagtgg gcccgcccgg ttgtgggaag agccagtggg cccgtaattt tgctgagcct    960agggacacct actggaagcc tagtagaaat aagtggtggg atggatatca tggagaagaa   1020gttgttgttt tggatgattt ttatggctgg ttaccttggg atgatctact gagactgtgt   1080gaccggtatc cattgactgt agagactaaa gggggtactg ttcctttttt ggcccgcagt   1140attttgatta ccagcaatca ggccccccag gaatggtact cctcaactgc tgtcccagct   1200gtagaagctc tctatcggag gattactact ttgcaatttt ggaagactgc tggagaacaa   1260tccacggagg tacccgaagg ccgatttgaa gcagtggacc caccctgtgc ccttttccca   1320tataaaataa attactgagt cttttttgtt atcacatcgt aatggttttt atttttattt   1380atttagaggg tcttttagga taaattctct gaattgtaca taaatagtca gccttaccac   1440ataattttgg gctgtggctg cattttggag cgcatagccg aggcctgtgt gctcgacatt   1500ggtgtgggta tttaaatgga gccacagctg gtttctttta ttatttgggt ggaaccaatc   1560aattgtttgg tccagctcag gtttgggggt gaagtacctg gagtggtagg taaagggctg   1620ccttatggtg tggcgggagg agtagttaat ataggggtca taggccaagt tggtggaggg   1680ggttacaaag ttggcatcca agataacaac agtggaccca acacctcttt gattagaggt   1740<210> SEQ ID NO 6<211> LENGTH: 1768<212> TYPE: DNA<213> ORGANISM: Porcine circovirus<220> FEATURE:<221> NAME / KEY: variation<222> LOCATION: (1)..(1768)<223> OTHER INFORMATION: N represents A or C or G or T<400> SEQUENCE: 6gaattcaacc ttaacctttt ttattctgta gtattcaaag ggtataaaga ttttgttggt     60cccccctccc gggggaacaa agtcgtcaat attaaatctc atcatgtcca ccgcccagga    120gggcgttctg actgtggtag ccttgacagt atatccgaag gtgcgggaga rgcgggtgtt    180gaaaatgcca tttttccttc tccaacggta gcggtggcgg gggtggacma nccacgggcg    240gcggcggawg atctggccaa gatggctgcg ggggcggtgt cttcttctgc ggtaacgcct    300ccttggatac gtcatagctg aaaacgaaag aagtgcgctg taagtattac cagcgcactt    360cggcagcggc agcacctcgg cagcacctca gcagcaacat gcccagcaag aagaatggaa    420gaagcggacc ccaaccacat aaaaggtggg tgttcacgct gaataatcct tccgaagacg    480agcgcaagaa aatacgggag ctcccaatct ccctatttga ttattttatt gttggcgagg    540agggtwwtga ggaangacga acacctcacc tccaggggtt cgctaatttt gtgaagaagc    600aaacttttaa taaagtgaag tggtatttgg gtgcccgctg ccacatcgag aaagccaaag    660gaactgatca gcagaataaa gaatattgca gtaaagaagg caacttactt attgaatgtg    720gagctcctcg atctcaagga caacggagtg acctgtctac tgctgtgagt accttgttgg    780agagcgggag tctggtgacc gttgcagagc agcaccctgt aacgtttgtc agaaatttcc    840gcgggctggc tgaacttttg aaagtgagcg ggaaaatgca gaagcgtgat tggaagacca    900atgtacacgt cattgtgggg ccacctgggt gtggtaaaag caaatgggct gctaattttg    960cagacccgga aaccacatac tggaaaccac ctagaaacaa gtggtgggat ggttaccatg   1020gtgaagaagt ggttgttatt gatgactttt atggctggct gccgtgggat gatctactga   1080gactgtgtga tcgatatcca ttgactgtag agactaaagg tggaactgta cnnnnnnngg   1140cccgcagtat tctgattacc agcaatcaga ccccgttgga atggtactcc tcaactgctg   1200tcccagctgt agaagctctc tatcggagga ttacttcctt ggtattttgg aagaatgcta   1260cagaacaatc cacggaggaa gggggccagt tngtcaccct ttccccccca tgccctgaat   1320ttccatatga aataaattac tgagtctttt ttatcacttc gtaatggttt ttattattca   1380tttagggttt aagtgggggg tctttaagat taaattctct gaattgtaca tacatggtta   1440cacggatatt gtagtcctgg tcgtatatac tgttttcgaa cgcagtgccg aggcctacgt   1500ggtccacatt tctagaggtt tgtagcctca gccaaagctg attccttttg ttatttggtt   1560ggaagtaatc aatagtggag tcaagaacag gtttgggtgt gaagtaacgg gagtggtagg   1620agaagggttg ggggattgta tggcgggagg agtagtttac atatgggtca taggttaggg   1680ctgtggcctt tgttacaaag ttatcatcta gaataacagc agtggagccc actcccctat   1740

Claims

CLAIMSCLAIMSA vectorINTELLECTUALcomprising an isolated           ^cuV^^’2.3.5.7.8.9.comprisingconsistinga sequenceof SEQ ID NO:The vector of claim 1comprises SEQ ID NO: 1.The vector of claim 1comprises SEQ ID NO: 2.The vector of claim 1comprises SEQ ID NO: 3.The vector of claim 1comprises SEQ ID NO: 4.The vector of claim 1comprises SEQ ID NO: 6.The vectormolecule isThe vectormolecule isA vectorcomprisingconsistingtype II.of claimexpressedof claimexpressedbybyselected from1,2,3,4 and 6.whereinwhereinwhereinwhereinwhereinwhereinthethethethethethethe vector inwherein thethe vector incomprising an isolatedDNADNADNADNAmoleculemoleculemoleculemoleculeisolated DNAvivo.isolated DNAvitro.DNA moleculea sequence selected from the groupof ORFs 1 to 13 of porcine circovirus10.The vector of claim 9 wherein in the ORF comprisesORF 4.11.12.13.The vector of claim 9 wherein in the ORF comprises ORF 7. The vector of claim 9 wherein in the ORF comprises ORF 10. The vector of claim 9 wherein in the ORF comprises 14 .ORF 13.The vector of claim 9 wherein the isolated DNA15.16.17.18.19.molecule is expressed by the vector in vivo.The vector of claim 9 wherein the isolated DNA molecule is expressed by the vector in vitro.The vector of anyone claims 1-6 and 9-13 wherein the vector is a virus.The vector of claim 16 wherein the virus is selected from the group consisting of pig herpes virus, porcine adenovirus, and poxvirus.An immunogenic composition comprising a vector as claimed in claim 17.The vector of claim 17 wherein the virus is selected from the group consisting of Auj esky's disease virus, vaccinia virus, avipox virus, andswinepox virus.20.An immunogenic composition comprising a vector asclaimed in claim 19.21.The vector of claim 19 wherein the virus is acanarypox virus.22.An immunogenic composition comprising a vector asclaimed in claim 21.23.24.25.26.27.28.29.30.The vector of any one of claims 1,9,2-6, and 10-13 wherein the vector comprises a DNA plasmid.An immunogenic composition comprising a vector as claimed in claim 23.An immunogenic composition comprising a vector as claimed in any one of claims 1,9,2-6, and 10-13.An isolated DNA molecule comprising a sequence selected from the group consisting of SEQ ID NO:1,2,3,4 AND 6.The isolated DNA molecule of claim 26 wherein theDNA molecule comprising SEQ ID NO: 1.The isolated DNA molecule of claim 26 wherein theDNA molecule comprising SEQ ID NO: 2.The isolated DNA molecule of claim 26 wherein theDNA molecule comprising SEQ ID NO: 3.The isolated DNA molecule of claim 26 wherein theDNA molecule comprising SEQ ID NO: 4.

31. The isolated DNA molecule of claim 26 wherein the DNA molecule comprising SEQ ID NO: 6.

32. An isolated DNA molecule comprising a nucleotide sequence encoding an epitope which is specific to PCV-2 and not specific to PCV-1.

33. A vector comprising an isolated DNA molecule as claimed in claim 32.

34. The vector  according to  claim 33,  wherein theisolated DNA molecule is expressed in vivo.

35. The vector according to  claim 33,  wherein theisolated DNA molecule is expressed in vitro.The present invention relates to new porcine circovirus (PCV for Porcine CircoVirus) strains allowing their detection, to methods of vaccination and to vaccines, as well as to methods of producing reagents and vaccines .PCV was originally detected as a noncy^fg^y^enR / contaminant in pig kidney cell lines PK / 15>_JThis vmis was classified among the Circoviridae with the chic7o?n~ anaemia virus (CAV for Chicken Anaemia Virus) and the PBFDV virus (Pscittacine Beak and Feather Disease Virus) . It is a small nonenveloped virus (from 15 to 24 nm) whose common characteristic is to contain a genome in the form of a circular single-stranded DNA of 1.7 6 to 2.31 kb. It was first thought that this genome encoded a polypeptide of about 30 kDa (Todd et al., Arch Virol 1991, 117; 129-135). Recent work has however shown a more complex transcription (Meehan B. M. et al., 1997, 78; 221-227). Moreover, no significant homologies in nucleotide sequence or in common antigenic determinants are known between the three types of circoviruses known.The PCVderived fromthePK / 15cells isconsidered not to be pathogenic. Its sequence is known from B.M. Meehan et al., J. Gen. Virol 1997  (78)221-227. It is only very recently that some authors have thought that strains of PCV could be pathogenic and associated with the PMWS syndrome (Gupi P.S. Nayar et al., Can. Vet. J, vol. 38, 1997: 385-387 and Clark E.G., Proc. Am. Assoc. Swine Prac. 1997; 499-501). Nayar et al. have detected PCV DNA in pigs having the PMWS syndrome using PCR techniques. No wild-type PCV strain has however been isolated and purified so far.The PMWSsyndrome detected in Canada, theUnited States and France is clinically characterized by a gradual loss of weight and by manifestations such astachypnea, dyspnea and jaundice. From the pathological point of view, it is manifested by lymphocytic or granulomateus infiltrations, lymphadenopathies and, more rarely, by hepatitis and lymphocytic or granulomateus nephritis (Clark E.G., Proc. Am. Assoc. Swine Prac. 1997;  499-501; La Semaine VeterinaireNo. 26, supplement to La Semaine Veterinaire 1996 (834); La Semaine Veterinaire 1997 (857): 54; Gupi P.S. Nayar et al., Can. Vet. J, vol. 38, 1997; 385-387).The applicant has succeeded in isolating five new PCV strains from pulmonary or ganglionic samples obtained from farms situated in Canada, the United States (California) and France (Brittany), hereinafter called circoviruses according to the invention. These viruses have been detected in lesions in pigs with the PMWS syndrome, but not in healthy pigs.The applicant has, in addition, sequenced the genome of four of these strains, namely the strains obtained from Canada and the United States as well as two French strains. The strains exhibit a very strong homology with each other at the nucleotide level, exceeding 96% and much weaker with the PK / 15 strain, about 76%. The new strains can thus be considered as being representative of a new type of porcine circovirus, called here type II, type I being represented by PK / 15.