Inhibitors of expression and / or function

PT4388099TActive Publication Date: 2026-06-01TANGRAM THERAPEUTICS PLC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
PT · PT
Patent Type
Patents
Current Assignee / Owner
TANGRAM THERAPEUTICS PLC
Filing Date
2023-06-01
Publication Date
2026-06-01

AI Technical Summary

Technical Problem

There is a need for effective inhibitors, particularly oligonucleoside/oligonucleotide compounds, to prevent and treat diseases such as type 2 diabetes, as traditional small organic compounds are inadequate in inhibiting protein function linked to these conditions.

Method used

Development of siRNA oligomers conjugated to ligand moieties, specifically GalNAc ligands, which target and inhibit the expression and function of B4GALT1, an enzyme associated with post-translational glycosylation, to treat diabetes.

Benefits of technology

The siRNA oligomers effectively reduce plasma levels of LDL cholesterol, fasting glucose, and fibrinogen, suggesting potential prevention and treatment of type 2 diabetes by inhibiting B4GALT1 expression.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

FIELD

[0001] The present invention provides inhibitors, such as nucleic acid compounds, such as siRNA, suitable for therapeutic use. Additionally, the present disclosure provides methods of making these compounds, as well as methods of using such compounds for the treatment of various diseases and conditions.BACKGROUND OF THE INVENTION

[0002] Inhibitors, such as oligonucleoside / oligonucleotide compounds which are inhibitors of gene expression and / or expression or function of other targets such as LNCRNAs, can have important therapeutic applications in medicine. Oligonucleotides / oligonucleosides can be used to silence genes that are responsible for a particular disease. Gene-silencing prevents formation of a protein by inhibiting translation. Importantly, gene-silencing agents are a promising alternative to traditional small, organic compounds that inhibit the function of the protein linked to the disease. siRNA, antisense RNA, and micro-RNA are oligonucleoside / oligonucleotides that prevent the formation of proteins by gene-silencing.

[0003] A number of modified siRNA compounds in particular have been developed in the last two decades for diagnostic and therapeutic purposes, including siRNA / RNAi therapeutic agents for the treatment of various diseases including central-nervous-system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and ocular diseases.

[0004] The present invention relates to inhibitors, such as oligomers e.g. nucleic acids, e.g. oligonucleoside / oligonucleotide compounds, and their use in the treatment and / or prevention of disease.

[0005] In particular, suitable inhibitors are still needed to help in the prevention and or treatment of diseases such as type 2 diabetes.

[0006] A mutation in the B4GALT1 gene resulting in a serine at the position corresponding to position 352 of the full length / mature B4GALT1 polypeptide has been identified as being associated with a reduced risk of coronary artery disease (see WO2018226560, and Montasser et al., Science 374, 1221-1227 (2021) 3 December 2021). The use of an siRNA that hybridizes to a sequence within the endogenous B4GALT1 gene and decreases expression of B4GALT1 polypeptide in a cell in a subject has been proposed as a means to treat a subject with, or susceptible to, developing cardiovascular conditions.STATEMENTS OF INVENTION

[0007] The invention is as defined in the claims. The following aspects are useful for understanding the invention but are not part of the claimed invention in their entirety. In one aspect, the disclosure relates to an inhibitor of post-translational glycosylation, such as an inhibitor of expression and / or function of B4GALT1, wherein said inhibitor is conjugated to one or more ligand moieties.

[0008] In a further aspect, the invention relates to an inhibitor according to the invention, wherein said inhibitor comprises an siRNA oligomer conjugated to one or more ligand moieties.

[0009] In a further aspect, the invention relates to an inhibitor according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligands.

[0010] In a further aspect, the invention relates to an inhibitor according to the invention, wherein said one or more ligand moieties comprise one more GalNAc ligand derivatives.

[0011] In another aspect, the disclosure relates to an inhibitor of post-translational glycosylation for use in the treatment of diabetes, such as an inhibitor of expression and / or function of B4GALT1.

[0012] In another aspect, the invention relates to an inhibitor of expression and / or, disclosed herein, function of B4GALT1 for use in the treatment of diabetes.

[0013] In a further aspect, the invention relates to an inhibitor for use according to the invention, which is an siRNA oligomer, typically conjugated to one or more ligand moieties.

[0014] In a further aspect, the invention relates to an inhibitor for use according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligands, and / or one or more GalNAc ligand derivatives.

[0015] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the target of the inhibitor is selected from B4GALT1.

[0016] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA oligomer having a first and a second strand wherein: i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides.

[0017] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed internucleoside linkage.

[0018] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the second strand comprises: i 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii 2, or more than 2, abasic nucleosides in either the 5' or 3' terminal region of the second strand; and / or iii 2, or more than 2, abasic nucleosides in either the 5' or 3' terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / or v 2, or more than 2, consecutive abasic nucleosides in either the 5' or 3' terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5' or 3' terminal region of the second strand; and / or vi a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5' or 3' terminal region of the second strand; and / or viii an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or ix abasic nucleosides as the 2 terminal nucleosides connected via a 5'-3' linkage when reading the strand in the direction towards that terminus; x abasic nucleosides as the 2 terminal nucleosides connected via a 3'-5' linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; xi abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5' reversed linkage or a 3'-3' reversed linkage; xii abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either (1) the reversed linkage is a 5-5' reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3'5' when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or (2) the reversed linkage is a 3-3' reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5'3' when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.

[0019] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the reversed internucleoside linkage is at a terminal region which is distal to the 5' terminal region of the second strand, or at a terminal region which is distal to the 3' terminal region of the second strand.

[0020] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the reversed internucleoside linkage is a 3'3 reversed linkage.

[0021] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the reversed internucleoside linkage is a 5'5 reversed linkage.

[0022] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides.

[0023] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the modification is a modification at the 2'-OH group of the ribose sugar, optionally selected from 2'-Me or 2'-F modifications.

[0024] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the first strand comprises a 2'-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand.

[0025] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the second strand comprises a 2'-F modification at position 7 and / or 9, and / or 11 and / or 13, counting from position 1 of said second strand.

[0026] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the first and second strand each comprise 2'-Me and 2'-F modifications.

[0027] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA, wherein the siRNA comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid.

[0028] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the siRNA comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand.

[0029] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA, wherein the siRNA comprises 3 or more 2'-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 7 2'-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand.

[0030] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA, wherein said second strand comprises at least 3, such as 4, 5 or 6, 2'-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.

[0031] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA, wherein said first strand comprises at least 5 2'-Me consecutive modifications at the 3' terminal region, preferably including the terminal nucleoside at the 3' terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3' terminal region.

[0032] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, which is an siRNA wherein said first strand comprises 7 2'-Me consecutive modifications at the 3' terminal region, preferably including the terminal nucleoside at the 3' terminal region.

[0033] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the siRNA oligomer further comprises one or more phosphorothioate internucleoside linkages.

[0034] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein said one or more phosphorothioate internucleoside linkages are respectively between at least three consecutive positions in a 5' or 3' near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located as defined herein.

[0035] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein said one or more phosphorothioate internucleoside linkages are respectively between at least three consecutive positions in a 5' and / or 3' terminal region of the first strand, whereby preferably a terminal position at the 5' and / or 3' terminal region of said first strand is attached to its adjacent position by a phosphorothioate internucleoside linkage.

[0036] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the oligomer is an siRNA and the second strand of the siRNA is conjugated directly or indirectly to one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3' terminal region thereof.

[0037] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said SiRNA through a linker.

[0038] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5' or 3' terminal region of the second strand of the siRNA oligomer, preferably at the 3' terminal region thereof.

[0039] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, wherein the ligand moiety comprises

[0040] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, having the structure: wherein: R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; R 2 is selected from the group consisting of hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halo and nitro; X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; and (ii) s, t and v cannot all be 0 at the same time; Z is an oligomer

[0041] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, having the structure wherein: r and s are independently an integer selected from 1 to 16; and Z is an oligomer.

[0042] In a further aspect, the invention relates to an inhibitor or an inhibitor for use according to the invention, formulated as a pharmaceutical composition with an excipient and / or carrier.

[0043] In another aspect, the invention relates to a pharmaceutical composition comprising an inhibitor according to the invention, in combination with a pharmaceutically acceptable excipient or carrier.

[0044] In a further aspect, the invention relates to a pharmaceutical composition comprising an inhibitor according to the invention, in combination with a pharmaceutically acceptable excipient or carrier, for use in the treatment of diabetes.

[0045] In another aspect, the invention relates to a use of B4GALT1 as a target for identifying one or more therapeutic agents for the treatment of diabetes.

[0046] In another aspect, the disclosure relates to a method of treating or preventing diabetes, which comprises administering to a patient an inhibitor of post-translational glycosylation, such as an inhibitor of B4GALT1 such as an inhibitor as defined according to the invention. Said methods are not part of the claimed invention.

[0047] In another aspect, the invention relates to B4GALT1 for use as a biomarker of diabetes.

[0048] In another aspect, the disclosure relates to B4GALT1 for use in an in vivo method of predicting susceptibility to diabetes, typically by monitoring the sequence and / or level of expression and / or function of B4GALT1 in a sample obtained from a patient. Said methods are not part of the claimed invention.

[0049] In another aspect, the disclosure relates to a method of predicting susceptibility to diabetes, and optionally treating diabetes, in a patient, said method comprising: (a) obtaining a sample from the patient, (b) detecting the sequence and / or expression and / or function of B4GALT1 in said sample obtained from the patient, (c) predicting susceptibility to diabetes, based on the sequence and / or expression and / or function of B4GALT1 in said sample obtained from the patient, (d) preferably administering to the diagnosed patient an effective amount of an inhibitor of B4GALT1. Said methods are not part of the claimed invention.

[0050] In another aspect, the invention relates to a use of an inhibitor, or composition, according to the invention, in the preparation of a medicament for use in the treatment of diabetes.FIGURES

[0051] Figure 1a shows an exemplary linear configuration for a conjugate. Figure 1b shows an exemplary branched configuration for a conjugate. Figures 2-5 show preferred oligomer - linker - ligand constructs of the invention. Figure 6 shows the detail of the formulae described in Sentences 1-101 disclosed herein. Figure 7 shows the detail of formulae described in Clauses 1-56 disclosed herein. Figure 8 shows a two-dimensional representation of the network-enriched pathways. Each pathway is represented by a point and the proximity of the points is a measure of the similarity of the pathways. Pathways sharing common proteins and / or neighbors are closer together - they cluster into higher order processes. The "network" relationship between pathways is used to identify common biological themes. This provides the basis for further analysis to create focused network models of key biology. Figure 9 is a summary diagram showing on top the analysis carried out by the meta-analysis authors and on the bottom the further analysis carried out by the inventors. The 9 'seed' sets used for network construction on the right were derived from the categories of gene sets on the top. Figure 10 illustrates the increased sensitivity of the network aware approach in identifying relevant biological processes -the data analysed using the inventor's approach is shown across 3 different network construction techniques - the inventors were able to resolve known processes in type 2 diabetes risk. A similar analysis yielded the novel risk-associated glycosylation process on which the inventors focussed. Figure 11 is an illustration of the network model built with 3 key proteins highlighted by the inventor's analytics. Figure 12 shows a selection of active GalNAc-siRNAs with EC50 values less than 100nM. Dose-response in B4GALT1 gene knockdown in primary mouse hepatocytes was measured after 48hr incubation with GalNAc-siRNAs targeting mouse B4GALT1 at 10 serial dilutions from 1000nM . EC 50 values were determined by fitting data to a 4-parameter sigmoidal dose-response (variable slope) equation using GraphPad Prism. 4 active GalNAc-siRNAs, ETXM619, ETXM624, ETXM628 and ETXM633, were selected for in vivo pharmacology. Figure 13 is a summary of B4GALT1 mRNA knockdown effects of multiple dosing of GalNAc-siRNAs, ETXM619, ETXM624, ETXM628 and ETXM633 (10mg / kg) in mouse liver tissues. The y-axis values are the relative mRNA expression to the non-treated group (n=5). Each data point represents the relative mRNA expression as Mean ± SD from n=3 experiment. Red arrows on the top of the graph indicate the days test articles were administered. Figure 14 shows the effect of B4GALT1 mRNA knockdown in plasma LDL-c, glucose and fibrinogen levels. Plasma samples were collected on day 14 after three dosings of ETXMs (10mg / kg, s.c.) on day 0, day 3 and day 7. Compared to the non-treated group ( n=5), the ETXM treated group (n=12) shows significantly reduced levels of LDL-c, glucose and fibrinogen in normal C57BL / 6 mice. Data presented here are Mean± SD. DETAILED DESCRIPTION

[0052] The present invention provides, inter alia, inhibitors, for example oligomers such as nucleic acids, such as inhibitory RNA molecules (which may be referred to as iRNA or siRNA ), and compositions containing the same which can affect expression of a target, for example by binding to mRNA transcribed from a gene, or disclosed herein, by inhibiting the function of nucleic acids such as long non-coding RNAs (herein "LNCRNA"). The target may be within a cell, e.g. a cell within a subject, such as a human. The inhibitors can be used to prevent and / or treat medical conditions associated with the e.g. the expression of a target gene or presence / activity of a nucleic acid in a cell e.g. such as a long non-coding RNA.

[0053] In particular, the present disclosure identifies inhibitors of post translational glycosylation, such as an inhibitor of B4GALT1, as useful in the prevention and / or treatment of diabetes.

[0054] B4GALT1 is Beta-1,4-galactosyltransferase 1, an enzyme that in humans is encoded by the B4GALT1 gene (SEQ ID NO: 1).

[0055] Genomic DNA sequence comprising the B4GALT1 gene (SEQ ID NO:1)

[0056] In particular, in the present disclosure, a large GWAS meta-analysis (Mahajan et al., Nature Genetics, 2018, 50, p1505-1513) of 898,930 human individuals of which 9% were diabetic was assessed, and post-translational glycosylation was surprisingly found to be significantly associated with type 2 diabetes risk in both normal and obese individuals. Importantly, the link between type 2 diabetes and post-translational glycosylation was not identifiable by standard 'functional enrichment' approaches and was thus not identified by the original authors of the meta-analysis.

[0057] The computational prediction was confirmed in in vivo mouse studies (Example 9). In these studies, mice were treated with siRNAs that inhibit the expression of B4GALT1. In these mice, plasma levels of LDL cholesterol, fasting glucose, and fibrinogen were significantly lower than in untreated mice, suggesting that inhibition of B4GALT1 can result in the prevention and / or treatment of diabetes, in particular type 2 diabetes.

[0058] Therefore, the invention relates to inhibitors of targets within the post translational glycosylation pathways, such as enzymes involved in these pathways, such as B4GALT1. The inhibition may be of the gene or protein resulting from expression of the gene and reference to a gene, such as B4GALT1, hereby explicitly incorporates a reference to inhibition of the expression or function of the gene and, separately, of the protein product.

[0059] Post translational glycosylation preferably refers to the post translational glycosylation seen in vivo in a human or human cell.DEFINITIONS

[0060] The "first strand", also called the antisense strand or guide strand herein and which can be used interchangeably herein, refers to the nucleic acid strand, e.g. the strand of an siRNA, e.g. a dsiRNA, which includes a region that is substantially complementary to a target sequence, e.g. to an mRNA. As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. In some embodiments, a double stranded nucleic acid e.g. an siRNA agent of the invention includes a nucleotide mismatch in the antisense strand.

[0061] The "second strand" (also called the sense strand or passenger strand herein, and which can be used interchangeably herein), refers to the strand of a nucleic acid e.g. siRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

[0062] In the context of molecule comprising a nucleic acid provided with a ligand moiety, optionally also with a linker moiety, the nucleic acid of the invention may be referred to as an oligonucleotide moiety or oligonucleoside moiety

[0063] Oligonucleotides are short nucleic acid polymers. Whilst oligonucleotides contain phosphodiester bonds between the nucleoside component thereof (base plus sugar), the present invention is not limited to oligonucleotides always joined by such a phosphodiester bond between adjacent nucleosides, and other oligomers of nucleosides joined by bonds which are bonds other than a phosphate bond are contemplated. For example, a bond between nucleotides may be a phosphorothioate bond. Therefore, the term "oligonucleoside" herein covers both oligonucleotides and other oligomers of nucleosides. An oligonucleoside which is a nucleic acid having at least a portion which is an oligonucleotide is preferred according to the present invention. An oligonucleoside having one or more, or a majority of, phosphodiester backbone bonds between nucleosides is also preferred according to the present invention. An oligonucleoside having one or more, or a majority of, phosphodiester backbone bonds between nucleosides, and also having one or more phosphorothioate backbone bonds between nucleosides (typically in a terminal region of the first and / or second strands) is also preferred according to the present invention.

[0064] In some embodiments, a double stranded nucleic acid e.g. siRNA agent of the invention includes a nucleoside mismatch in the sense strand. In some embodiments, the nucleoside mismatch is, for example, within 5, 4, 3, 2, or 1 nucleosides from the 3 '-end of the nucleic acid e.g. siRNA.

[0065] In another embodiment, the nucleoside mismatch is, for example, in the 3'- terminal nucleoside of the nucleic acid e.g. siRNA.

[0066] A "target sequence" (which may be called a target RNA or a target mRNA) refers to a contiguous portion of the nucleoside sequence of an mRNA molecule formed during the transcription of a gene, including mRNA that is a product of RNA processing of a primary transcription product, or can be a contiguous portion of the nucleotide sequence of any RNA molecule such as a LNCRNA which it is desired to inhibit.

[0067] The target sequence may be from about 10-35 nucleosides in length, e.g., about 15-30 nucleosides in length. For example, the target sequence can be from about 15-30 nucleosides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18- 28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20- 21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0068] The term "ribonucleoside" or "nucleoside" can also refer to a modified nucleoside as further detailed below.

[0069] A nucleic acid can be a DNA or an RNA, and can comprise modified nucleosides. RNA is a preferred nucleic acid.

[0070] The terms "iRNA", "siRNA", "RNAi agent," and "iRNA agent," "RNA interference agent" as used interchangeably herein, refer to an agent that contains RNA, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. siRNA directs the sequence-specific degradation of mRNA through RNA interference (RNAi).

[0071] A double stranded RNA is referred to herein as a "double stranded siRNA (dsiRNA) agent", "double stranded siRNA (dsiRNA) molecule", "double stranded RNA (dsRNA) agent", "double stranded RNA (dsRNA) molecule", "dsiRNA agent", "dsiRNA molecule", or "dsiRNA", which refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations with respect to a target RNA. The majority of nucleosides of each strand of the nucleic acid, e.g. a dsiRNA molecule, are preferably ribonucleosides, but in that case each or both strands can also include one or more non-ribonucleosides, e.g., a deoxyribonucleoside or a modified ribonucleoside. In addition, as used in this specification, an "siRNA" may include ribonucleosides with chemical modifications.

[0072] The term "modified nucleoside" refers to a nucleoside having, independently, a modified sugar moiety, a modified internucleoside linkage, or modified nucleobase, or any combination thereof. Thus, the term modified nucleoside encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. Any such modifications, as used in a siRNA type molecule, are encompassed by "iRNA" or "RNAi agent" or "siRNA" or "siRNA agent" for the purposes of this specification and claims.

[0073] The duplex region of a nucleic acid of the invention e.g. a dsRNA may range from about 9 to 40 base pairs in length such as 9 to 36 base pairs in length, e.g., about 15- 30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18- 27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21- 30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length.

[0074] The two strands forming the duplex structure may be different portions of one larger molecule, or they may be separate molecules e.g. RNA molecules.

[0075] The term "nucleoside overhang" refers to at least one unpaired nucleoside that extends from the duplex structure of a double stranded nucleic acid. A ds nucleic acid can comprise an overhang of at least one nucleoside; alternatively the overhang can comprise at least two nucleosides, at least three nucleosides, at least four nucleosides, at least five nucleosides, or more. A nucleoside overhang can comprise or consist of a nucleoside analog, including a deoxynucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the / nucleoside(s) of an overhang can be present on the 5'-end, 3'-end, or both ends of either an antisense or sense strand.

[0076] In certain embodiments, the antisense strand has a 1-10 nucleoside, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleoside overhang at the 3'-end or the 5'-end.

[0077] "Blunt" or "blunt end" means that there are no unpaired nucleoside at that end of the double stranded nucleic acid, i.e., no nucleoside overhang. The nucleic acids of the invention include those with no nucleoside overhang at one end or with no nucleoside overhangs at either end.

[0078] Unless otherwise indicated, the term "complementary," when used to describe a first nucleoside sequence in relation to a second nucleoside sequence, refers to the ability of an oligonucleoside comprising the first nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleoside or polynucleoside comprising the second nucleoside sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press).

[0079] Complementary sequences within nucleic acid e.g. a dsiRNA, as described herein, include base-pairing of the oligonucleoside or polynucleoside comprising a first nucleoside sequence to an oligonucleoside or polynucleoside comprising a second nucleoside sequence over the entire length of one or both nucleoside sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" or "partially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more mismatched base pairs, such as 2, 4, or 5 mismatched base pairs, but preferably not more than 5, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g. , inhibition of gene expression via a RISC pathway. Overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a nucleic acid e.g. dsRNA comprising one oligonucleoside 17 nucleosides in length and another oligonucleoside 19 nucleosides in length, wherein the longer oligonucleoside comprises a sequence of 17 nucleosides that is fully complementary to the shorter oligonucleoside, can yet be referred to as "fully complementary".

[0080] "Complementary" sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleosides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.

[0081] The terms "complementary," "fully complementary" and "substantially / partially complementary" herein can be used with respect to the base matching between the sense strand and the antisense strand of a nucleic acid e.g. dsiRNA, or between the antisense strand of a double stranded nucleic acid e.g. siRNA agent and a target sequence.

[0082] Within the present invention, the second strand of the nucleic acid according to the invention, in particular a dsiRNA for inhibiting B4GALT1, is at least partially complementary to the first strand of said nucleic acid. In certain embodiments, a first and second strand of a nucleic acid according to the invention are partially complementary if they form a duplex region having a length of at least 17 base pairs and comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs.

[0083] In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 19 base pairs and comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 21 base pairs comprising not more than 1, 2, 3, 4, or 5 mismatched base pairs.

[0084] Alternatively, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of at least 17 base pairs, wherein at least 14, 15, 16 or 17 of said base pairs are complementary base pairs, in particular Watson-Crick base pairs.

[0085] In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 19 base pairs, wherein at least 14, 15, 16, 17, 18 or all 19 base pairs are complementary base pairs, in particular Watson-Crick base pairs. In certain embodiments, a first and second strand of the nucleic acid according to the invention are partially complementary if they form a duplex region having a length of 21 base pairs, wherein at least 16, 17, 18, 19, 20 or all 21 base pairs are complementary base pairs, in particular Watson-Crick base pairs.

[0086] As used herein, a nucleic acid that is "substantially complementary" or "partially complementary" to at least part of a messenger RNA (mRNA) refers to a polynucleoside that is substantially or partially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a gene). In certain embodiments, the contiguous portion of the mRNA is a sequence as listed in Table 1, i.e., any one of SEQ ID NOs:2-21 or 102-201. For example, a polynucleoside is complementary to at least a part of an mRNA of a gene of interest if the sequence is substantially or partially complementary to a non-interrupted portion of an mRNA encoding that gene.

[0087] Accordingly, in some preferred embodiments, the antisense oligonucleosides as disclosed herein are fully complementary to the target gene sequence.

[0088] In other embodiments, the antisense oligonucleosides disclosed herein are substantially or partially complementary to a target RNA sequence and comprise a contiguous nucleoside sequence which is at least about 80% complementary over its entire length to the equivalent region of the target RNA sequence, such as at least about 85%, 86%, 87%, 88%, 89%, about 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary or 100% complementary.

[0089] In certain embodiments, the first (antisense) strand of a nucleic acid according to the invention is partially or fully complementary to a contiguous portion of RNA transcribed from the B4GALT1 gene. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of at least 17 nucleosides of the B4GALT1 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 17, 18, 19, 20, 21, 22 or 23 nucleosides of the B4GALT1 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 17, 18 or 19 nucleosides of any one of the sequences as listed in Table 1, i.e., any one of SEQ ID NOs: 2-21 or 102-201. In certain embodiments, the first strand of the nucleic acid according to the invention is partially or fully complementary to a contiguous portion of 19, 20, 21, 22 or 23 nucleosides of any one of SEQ ID NOs: 102-201.

[0090] In certain embodiments, the first (antisense) strand of the nucleic acid according to the invention is partially complementary to a contiguous portion of the B4GALT1 mRNA if it comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16 or 17 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of the B4GALT1 mRNA. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16 or 17 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2-21 or 102-201. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 19 nucleosides, wherein at least 14, 15, 16, 17, 18 or all 19 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 2-21 or 102-201. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 21 nucleosides, wherein at least 16, 17, 18, 19, 20 or all 21 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of SEQ ID NOs: 102-201. In certain embodiments, the first strand of the nucleic acid according to the invention comprises a contiguous nucleoside sequence of 23 nucleosides, wherein at least 18, 19, 20, 21, 22 or all 23 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of SEQ ID NOs: 102-201.

[0091] In some embodiments, a nucleic acid e.g. an siRNA of the invention includes a sense strand that is substantially or partially complementary to an antisense polynucleoside which, in turn, is complementary to a target gene sequence and comprises a contiguous nucleoside sequence which is at least about 80% complementary over its entire length to the equivalent region of the nucleoside sequence of the antisense strand, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary.

[0092] In some embodiments, a nucleic acid e.g. an siRNA of the invention includes an antisense strand that is substantially or partially complementary to the target sequence and comprises a contiguous nucleoside sequence which is at least 80% complementary over its entire length to the target sequence such as about 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary.

[0093] As used herein, a "subject" is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g., a monkey, and a chimpanzee), or a non-primate or a bird that expresses the target gene, either endogenously or heterologously, when the target gene sequence has sufficient complementarity to the nucleic acid e.g. iRNA agent to promote target knockdown. In certain preferred embodiments, the subject is a human.

[0094] The terms "treating" or "treatment" refer to a beneficial or desired result including, but not limited to, alleviation or amelioration of one or more symptoms associated with gene expression. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. Treatment can include prevention of development of co-morbidities, e.g. reduced liver damage in a subject with a hepatic infection.

[0095] "Therapeutically effective amount," as used herein, is intended to include the amount of a nucleic acid e.g. an iRNA that, when administered to a patient for treating a subject having disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease or its related comorbidities).

[0096] The phrase "pharmaceutically acceptable" is employed herein to refer to compounds, materials, compositions, or dosage forms which are suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0097] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated.

[0098] Where a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

[0099] The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article.

[0100] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

[0101] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. For example, "sense strand or antisense strand" is understood as "sense strand or antisense strand or sense strand and antisense strand."

[0102] The term "about" is used herein to mean within the typical ranges of tolerances in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that "about" can modify each of the numbers in the series or range.

[0103] The term "at least" prior to a number or series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleosides of a 21 nucleoside nucleic acid molecule" means that 18, 19, 20, or 21 nucleosides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range.

[0104] As used herein, "no more than" or "less than" is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of "no more than 2 nucleosides" has a 2, 1, or 0 nucleoside overhang. When "no more than" is present before a series of numbers or a range, it is understood that "no more than" can modify each of the numbers in the series or range.

[0105] The terminal region of a strand is the last 5 nucleotides from the 5' or the 3' end.

[0106] A nucleobase sequence is the sequence of the bases of the nucleic acid in an oligomer.

[0107] Various embodiments of the invention can be combined as determined appropriate by one of skill in the art.TARGET

[0108] A target for inhibition disclosed herein may be, without limitation, an mRNA, LNCRNA, polypeptide, protein, or gene.

[0109] The target herein is a target involved in the post translational glycosylation pathway for proteins. These are preferably a target the inhibition of which helps in the prevention or treatment of diabetes. A preferred target for inhibition is B4GALT1, and inhibition may be effected by inhibition of expression or function of the gene or protein or both.

[0110] In one aspect the target is a mRNA expressed from a gene or disclosed herein a long non-coding RNA (LNCRNA).

[0111] In a preferred embodiment, the target is an mRNA that is the result of expression of the B4GALT1 gene. Exemplary target sequences on the B4GALT1 mRNA are listed below in Table 1. Table 1SEQ ID NOOligonucleoside mRNA target sequence 5' → 3'Starting position on NM_001497.4SEQ ID NO: 2CUUGAAUUUCCUAUGUAUU2210SEQ ID NO: 3AAUGGAUUUCCUAAUAAUU1068SEQ ID NO: 4UCAGUAUUUUGGAGGUGUC1016SEQ ID NO: 5UGGAUUUCCUAAUAAUUAU1070SEQ ID NO: 6UGAAUUUCCUAUGUAUUUU2212SEQ ID NO: 7GCUGGAUGUACAGAGAUAC1301SEQ ID NO: 8CCAAAGUGCCUUAAAAGAA3448SEQ ID NO: 9UAUGUAAACUUGAAUUUCC2202SEQ ID NO: 10GGCACAUUUCCGUUGCAAU967SEQ ID NO: 11AUGUAAACUUGAAUUUCCU2203SEQ ID NO: 12AUGGAUUUCCUAAUAAUUA1069SEQ ID NO: 13UGUCUCUGCUCUAAGUAAA1031SEQ ID NO: 14CAAAGUGCCUUAAAAGAAA3449SEQ ID NO: 15UGAAUGUGCCUUUUAAUUA2822SEQ ID NO: 16ACUUGAAUUUCCUAUGUAU2209SEQ ID NO: 17CUGACUUUUCCAAAGUGCC3439SEQ ID NO: 18CAAUGGAUUUCCUAAUAAU1067SEQ ID NO: 19UUCAGUAUUUUGGAGGUGU1015SEQ ID NO: 20CCUGACUUUUCCAAAGUGC3438SEQ ID NO: 21GGAUUUCCUAAUAAUUAUU1071SEQ ID NO: 102GUAAACUUGAAUUUCCUAUGUAU2209SEQ ID NO: 103GCUAUGUAAACUUGAAUUUCCUA2204SEQ ID NO: 104UAUGUAAACUUGAAUUUCCUAUG2206SEQ ID NO: 105AACUUGAAUUUCCUAUGUAUUUU2212SEQ ID NO: 106AAACUUGAAUUUCCUAUGUAUUU2211SEQ ID NO: 107CUAUGUAAACUUGAAUUUCCUAU2205SEQ ID NO: 108GCAUGCUAUGUAAACUUGAAUUU2200SEQ ID NO: 109UGUCUGAUUUCUGAAUGUAAAGU2035SEQ ID NO: 110UGUAAACUUGAAUUUCCUAUGUA2208SEQ ID NO: 111UCAAUGGAUUUCCUAAUAAUUAU1070SEQ ID NO: 112CAAUGGAUUUCCUAAUAAUUAUU1071SEQ ID NO: 113GGCAUGCUAUGUAAACUUGAAUU2199SEQ ID NO: 114UUUUGGAGGUGUCUCUGCUCUAA1026SEQ ID NO: 115AAUCCUCAGAGGUUUGACCGAAU1225SEQ ID NO: 116AUCAAUGGAUUUCCUAAUAAUUA1069SEQ ID NO: 117GACUUUUCCAAAGUGCCUUAAAA3445SEQ ID NO: 118CAUGCUAUGUAAACUUGAAUUUC2201SEQ ID NO: 119CCAUCAAUGGAUUUCCUAAUAAU1067SEQ ID NO: 120UAAACUUGAAUUUCCUAUGUAUU2210SEQ ID NO: 121UCUGCUCUAAGUAAACAACAGUU1039SEQ ID NO: 122AUGCUAUGUAAACUUGAAUUUCC2202SEQ ID NO: 123GAGGUGUCUCUGCUCUAAGUAAA1031SEQ ID NO: 124AGCAUGAAUGUGCCUUUUAAUUA2822SEQ ID NO: 125GGAGGUGUCUCUGCUCUAAGUAA1030SEQ ID NO: 126UUUCCAAAGUGCCUUAAAAGAAA3449SEQ ID NO: 127UGCUAUGUAAACUUGAAUUUCCU2203SEQ ID NO: 128UUCAGUAUUUUGGAGGUGUCUCU1019SEQ ID NO: 129CCAGCAUGAAUGUGCCUUUUAAU2820SEQ ID NO: 130AGGUGUCUCUGCUCUAAGUAAAC1032SEQ ID NO: 131GGAGGAGAAGAUGAUGACAUUUU1102SEQ ID NO: 132UUGGAGGUGUCUCUGCUCUAAGU1028SEQ ID NO: 133UUGUCUGAUUUCUGAAUGUAAAG2034SEQ ID NO: 134CCACGGCACAUUUCCGUUGCAAU967SEQ ID NO: 135UGGAUUUCCUAAUAAUUAUUGGG1074SEQ ID NO: 136UGUUCAGUAUUUUGGAGGUGUCU1017SEQ ID NO: 137CAUCAAUGGAUUUCCUAAUAAUU1068SEQ ID NO: 138CAAUCCUCAGAGGUUUGACCGAA1224SEQ ID NO: 139GAUGGUUUGAACUCACUCACCUA1276SEQ ID NO: 140UUUUCCAAAGUGCCUUAAAAGAA3448SEQ ID NO: 141ACUUUUCCAAAGUGCCUUAAAAG3446SEQ ID NO: 142GGUGUCUCUGCUCUAAGUAAACA1033SEQ ID NO: 143AUCCUGACUUUUCCAAAGUGCCU3440SEQ ID NO: 144GUAUUUUGGAGGUGUCUCUGCUC1023SEQ ID NO: 145AUGGUUUGAACUCACUCACCUAC1277SEQ ID NO: 146AUUUUGGAGGUGUCUCUGCUCUA1025SEQ ID NO: 147UGUCUCUGCUCUAAGUAAACAAC1035SEQ ID NO: 148CGGCACAUUUCCGUUGCAAUGGA970SEQ ID NO: 149GCAUGAAUGUGCCUUUUAAUUAG2823SEQ ID NO: 150CACGGCACAUUUCCGUUGCAAUG968SEQ ID NO: 151UAUACCCAAAUCACAGUGGACAU1330SEQ ID NO: 152AUCACAGUGGACAUCGGGACACC1339SEQ ID NO: 153GUGUCUCUGCUCUAAGUAAACAA1034SEQ ID NO: 154CAGAUCCUGACUUUUCCAAAGUG3437SEQ ID NO: 155CAGCAUGAAUGUGCCUUUUAAUU2821SEQ ID NO: 156CUUAUGUUCAGUAUUUUGGAGGU1013SEQ ID NO: 157AAUGGAUUUCCUAAUAAUUAUUG1072SEQ ID NO: 158UGGAGGUGUCUCUGCUCUAAGUA1029SEQ ID NO: 159AGGUGCUGGAUGUACAGAGAUAC1301SEQ ID NO: 160CUGCUCUAAGUAAACAACAGUUU1040SEQ ID NO: 161UCUCUGCUCUAAGUAAACAACAG1037SEQ ID NO: 162UAUGUUCAGUAUUUUGGAGGUGU1015SEQ ID NO: 163UAUUUUGGAGGUGUCUCUGCUCU1024SEQ ID NO: 164ACCCAAAUCACAGUGGACAUCGG1333SEQ ID NO: 165CUCUGCUCUAAGUAAACAACAGU1038SEQ ID NO: 166UUUGGAGGUGUCUCUGCUCUAAG1027SEQ ID NO: 167CUUUUCCAAAGUGCCUUAAAAGA3447SEQ ID NO: 168GGUGCUGGAUGUACAGAGAUACC1302SEQ ID NO: 169GAUCCUGACUUUUCCAAAGUGCC3439SEQ ID NO: 170CUGCGUCUCUCCUCACAAGGUGG684SEQ ID NO: 171AUGGAUUUCCUAAUAAUUAUUGG1073SEQ ID NO: 172ACGGCACAUUUCCGUUGCAAUGG969SEQ ID NO: 173UGUAUACCCAAAUCACAGUGGAC1328SEQ ID NO: 174GUUCAGUAUUUUGGAGGUGUCUC1018SEQ ID NO: 175GGCUUUCAAGAAGCCUUGAAGGA862SEQ ID NO: 176AAUUAUUGGGGCUGGGGAGGAGA1087SEQ ID NO: 177GGACAUCGGGACACCGAGCUAGC1347SEQ ID NO: 178AGAUCCUGACUUUUCCAAAGUGC3438SEQ ID NO: 179GUAUACCCAAAUCACAGUGGACA1329SEQ ID NO: 180CCAUUCCGCAACCGGCAGGAGCA718SEQ ID NO: 181GUGCUGGAUGUACAGAGAUACCC1303SEQ ID NO: 182GACUGCGUCUCUCCUCACAAGGU682SEQ ID NO: 183CAAAUCACAGUGGACAUCGGGAC1336SEQ ID NO: 184GUCUCUGCUCUAAGUAAACAACA1036SEQ ID NO: 185AUGUUCAGUAUUUUGGAGGUGUC1016SEQ ID NO: 186AUUAUUGGGGCUGGGGAGGAGAA1088SEQ ID NO: 187CCUUAUGUUCAGUAUUUUGGAGG1012SEQ ID NO: 188AUACCCAAAUCACAGUGGACAUC1331SEQ ID NO: 189GGAUUUCCUAAUAAUUAUUGGGG1075SEQ ID NO: 190UCACAGUGGACAUCGGGACACCG1340SEQ ID NO: 191UUGUAUACCCAAAUCACAGUGGA1327SEQ ID NO: 192AUUGGGGCUGGGGAGGAGAAGAU1091SEQ ID NO: 193UUAUGUUCAGUAUUUUGGAGGUG1014SEQ ID NO: 194UGGACAUCGGGACACCGAGCUAG1346SEQ ID NO: 195ACAGUGGACAUCGGGACACCGAG1342SEQ ID NO: 196UAAUUAUUGGGGCUGGGGAGGAG1086SEQ ID NO: 197UUGGGGCUGGGGAGGAGAAGAUG1092SEQ ID NO: 198GGACUGCGUCUCUCCUCACAAGG681SEQ ID NO: 199CUAAUAAUUAUUGGGGCUGGGGA1082SEQ ID NO: 200AAUCACAGUGGACAUCGGGACAC1338SEQ ID NO: 201ACUGCGUCUCUCCUCACAAGGUG683

[0112] It is to be understood that SEQ ID NOs: 2 to 21 and 102 to 201 relate to human (Homo sapiens) mRNA sequences.DISEASE / CONDITIONS

[0113] The invention relates to an inhibitor suitable for use, or for use, in treatment of diabetes, such as type 1 or type 2 diabetes, preferably type 2 diabetes.INHIBITORS

[0114] Inhibitors of the disclosure include nucleic acids such as siRNAs, antibodies and antigen binding fragments thereof, e.g., monoclonal antibodies, polypeptides, antibody-drug conjugates, and small molecules.

[0115] Certain preferred features of inhibitors of the invention, where these are oligonucelosides such as siRNA, are given below.

[0116] In certain embodiments, the nucleic acid comprises a first strand comprising a sequence that is at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene (SEQ ID NO: 1). In a preferred embodiment, the nucleic acid comprises a first strand comprising a sequence that is at least partially complementary to a B4GALT1 mRNA (NM_001497.4).

[0117] In certain embodiments, the nucleic acid for inhibiting expression of B4GALT1 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:22-41 or 202-301.

[0118] In certain embodiments, the first strand comprises nucleosides 2-18 of any one of the sequences set forth in SEQ ID NO:22-41 or 202-301.

[0119] In certain embodiments, the nucleic acid for inhibiting expression of B4GALT1 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene, and (ii) comprises at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 202-301.

[0120] In certain embodiments, the first strand comprises nucleosides 2-22 of any one of the sequences set forth in SEQ ID NO: 202-301.

[0121] In certain embodiments, the first strand comprises any one of SEQ ID NO:22-41 or 202-301.

[0122] In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:42-61 or 302-401; wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.

[0123] In certain embodiments, the second strand comprises a nucleoside sequence of at least 19 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 302-401; wherein the second strand has a region of at least 85% complementarity over the 19 contiguous nucleosides to the first strand.

[0124] In certain embodiments, the second strand comprises a nucleoside sequence of at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 302-401; wherein the second strand has a region of at least 85% complementarity over the 21 contiguous nucleosides to the first strand.

[0125] In certain embodiments, the second strand comprises any one of SEQ ID NO:42-61 or 302-401.

[0126] In certain embodiments, the nucleic acid comprises a first strand that comprises, consists of, or consists essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:22-41 or 202-301; and a second strand that comprises, consists of, or consists essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:42-61 or 302-401. It is preferred herein that the duplex region is formed between a first (antisense) strand and a complementary second (sense) strand. Exemplary pairs of complementary antisense and sense strands are listed in Table 2 below: Table 2 SEQ ID NO (AS)First (Antisense) Strand Base Sequence 5' → 3' (Shown as an Unmodified Nucleoside Sequence)SEQ ID NO (SS)Second (Sense) Strand Base Sequence 5' → 3' (Shown as an Unmodified Nucleoside Sequence)Corresponding positions on NM_001497.4SEQ ID NO: 22SEQ ID NO: 422210-2229SEQ ID NO: 23SEQ ID NO: 431068-1087SEQ ID NO: 24SEQ ID NO: 441016-1035SEQ ID NO: 25SEQ ID NO: 451070-1089SEQ ID NO: 26SEQ ID NO: 462212-2231SEQ ID NO: 27SEQ ID NO: 471301-1320SEQ ID NO: 28SEQ ID NO: 483448-3467SEQ ID NO: 29SEQ ID NO: 492202-2221SEQ ID NO: 30SEQ ID NO: 50967-986SEQ ID NO: 31SEQ ID NO: 512203-2222SEQ ID NO: 32SEQ ID NO: 521069-1088SEQ ID NO: 33SEQ ID NO: 531031-1050SEQ ID NO: 34SEQ ID NO: 543449-3468SEQ ID NO: 35SEQ ID NO: 552822-2841SEQ ID NO: 36SEQ ID NO: 562209-2228SEQ ID NO: 37SEQ ID NO: 573439-3458SEQ ID NO: 38SEQ ID NO: 581067-1086SEQ ID NO: 39SEQ ID NO: 591015-1034SEQ ID NO: 40SEQ ID NO: 603438-3457SEQ ID NO: 41SEQ ID NO: 611071-1090SEQ ID NO: 202SEQ ID NO: 3022209-2230SEQ ID NO: 203SEQ ID NO: 3032204-2225SEQ ID NO: 204SEQ ID NO: 3042206-2227SEQ ID NO: 205SEQ ID NO: 3052212-2233SEQ ID NO: 206SEQ ID NO: 3062211-2232SEQ ID NO: 207SEQ ID NO: 3072205-2226SEQ ID NO: 208SEQ ID NO: 3082200-2221SEQ ID NO: 209SEQ ID NO: 3092035-2056SEQ ID NO: 210SEQ ID NO: 3102208-2229SEQ ID NO: 211SEQ ID NO: 3111070-1091SEQ ID NO: 212SEQ ID NO: 3121071-1092SEQ ID NO: 213SEQ ID NO: 3132199-2220SEQ ID NO: 214SEQ ID NO: 3141026-1047SEQ ID NO: 215SEQ ID NO: 3151225-1246SEQ ID NO: 216SEQ ID NO: 3161069-1090SEQ ID NO: 217SEQ ID NO: 3173445-3466SEQ ID NO: 218SEQ ID NO: 3182201-2222SEQ ID NO: 219SEQ ID NO: 3191067-1088SEQ ID NO: 220SEQ ID NO: 3202210-2231SEQ ID NO: 221SEQ ID NO: 3211039-1060SEQ ID NO: 222SEQ ID NO: 3222202-2223SEQ ID NO: 223SEQ ID NO: 3231031-1052SEQ ID NO: 224SEQ ID NO: 3242822-2843SEQ ID NO: 225SEQ ID NO: 3251030-1051SEQ ID NO: 226SEQ ID NO: 3263449-3470SEQ ID NO: 227SEQ ID NO: 3272203-2224SEQ ID NO: 228SEQ ID NO: 3281019-1040SEQ ID NO: 229SEQ ID NO: 3292820-2841SEQ ID NO: 230SEQ ID NO: 3301032-1053SEQ ID NO: 231SEQ ID NO: 3311102-1123SEQ ID NO: 232SEQ ID NO: 3321028-1049SEQ ID NO: 233SEQ ID NO: 3332034-2055SEQ ID NO: 234SEQ ID NO: 334967-988SEQ ID NO: 235SEQ ID NO: 3351074-1095SEQ ID NO: 236SEQ ID NO: 3361017-1038SEQ ID NO: 237SEQ ID NO: 3371068-1089SEQ ID NO: 238SEQ ID NO: 3381224-1245SEQ ID NO: 239SEQ ID NO: 3391276-1297SEQ ID NO: 240SEQ ID NO: 3403448-3469SEQ ID NO: 241SEQ ID NO: 3413446-3467SEQ ID NO: 242SEQ ID NO: 3421033-1054SEQ ID NO: 243SEQ ID NO: 3433440-3461SEQ ID NO: 244SEQ ID NO: 3441023-1044SEQ ID NO: 245SEQ ID NO: 3451277-1298SEQ ID NO: 246SEQ ID NO: 3461025-1046SEQ ID NO: 247SEQ ID NO: 3471035-1056SEQ ID NO: 248SEQ ID NO: 348970-991SEQ ID NO: 249SEQ ID NO: 3492823-2844SEQ ID NO: 250SEQ ID NO: 350968-989SEQ ID NO: 251SEQ ID NO: 3511330-1351SEQ ID NO: 252SEQ ID NO: 3521339-1360SEQ ID NO: 253SEQ ID NO: 3531034-1055SEQ ID NO: 254SEQ ID NO: 3543437-3458SEQ ID NO: 255SEQ ID NO: 3552821-2842SEQ ID NO: 256SEQ ID NO: 3561013-1034SEQ ID NO: 257SEQ ID NO: 3571072-1093SEQ ID NO: 258SEQ ID NO: 3581029-1050SEQ ID NO: 259SEQ ID NO: 3591301-1322SEQ ID NO: 260SEQ ID NO: 3601040-1061SEQ ID NO: 261SEQ ID NO: 3611037-1058SEQ ID NO: 262SEQ ID NO: 3621015-1036SEQ ID NO: 263SEQ ID NO: 3631024-1045SEQ ID NO: 264SEQ ID NO: 3641333-1354SEQ ID NO: 265SEQ ID NO: 3651038-1059SEQ ID NO: 266SEQ ID NO: 3661027-1048SEQ ID NO: 267SEQ ID NO: 3673447-3468SEQ ID NO: 268SEQ ID NO: 3681302-1323SEQ ID NO: 269SEQ ID NO: 3693439-3460SEQ ID NO: 270SEQ ID NO: 370684-705SEQ ID NO: 271SEQ ID NO: 3711073-1094SEQ ID NO: 272SEQ ID NO: 372969-990SEQ ID NO: 273SEQ ID NO: 3731328-1349SEQ ID NO: 274SEQ ID NO: 3741018-1039SEQ ID NO: 275SEQ ID NO: 375862-883SEQ ID NO: 276SEQ ID NO: 3761087-1108SEQ ID NO: 277SEQ ID NO: 3771347-1368SEQ ID NO: 278SEQ ID NO: 3783438-3459SEQ ID NO: 279SEQ ID NO: 3791329-1350SEQ ID NO: 280SEQ ID NO: 380718-739SEQ ID NO: 281SEQ ID NO: 3811303-1324SEQ ID NO: 282SEQ ID NO: 382682-703SEQ ID NO: 283SEQ ID NO: 3831336-1357SEQ ID NO: 284SEQ ID NO: 3841036-1057SEQ ID NO: 285SEQ ID NO: 3851016-1037SEQ ID NO: 286SEQ ID NO: 3861088-1109SEQ ID NO: 287SEQ ID NO: 3871012-1033SEQ ID NO: 288SEQ ID NO: 3881331-1352SEQ ID NO: 289SEQ ID NO: 3891075-1096SEQ ID NO: 290SEQ ID NO: 3901340-1361SEQ ID NO: 291SEQ ID NO: 3911327-1348SEQ ID NO: 292SEQ ID NO: 3921091-1112SEQ ID NO: 293SEQ ID NO: 3931014-1035SEQ ID NO: 294SEQ ID NO: 3941346-1367SEQ ID NO: 295SEQ ID NO: 3951342-1363SEQ ID NO: 296SEQ ID NO: 3961086-1107SEQ ID NO: 297SEQ ID NO: 3971092-1113SEQ ID NO: 298SEQ ID NO: 398681-702SEQ ID NO: 299SEQ ID NO: 3991082-1103SEQ ID NO: 300SEQ ID NO: 4001338-1359SEQ ID NO: 301SEQ ID NO: 401683-704

[0127] In a particular embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Unmodified first strandUnmodified second strandSEQ ID NO: 202SEQ ID NO: 302SEQ ID NO: 205SEQ ID NO: 305SEQ ID NO: 217SEQ ID NO: 317SEQ ID NO: 228SEQ ID NO: 328

[0128] In certain embodiments, the nucleic acid for inhibiting expression of B4GALT1 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene, and (ii) comprises at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:62-81 or 402-513.

[0129] In certain embodiments, the first strand comprises nucleosides 2-18 of any one of the sequences set forth in SEQ ID NO:62-81 or 402-513.

[0130] In certain embodiments, the nucleic acid for inhibiting expression of B4GALT1 comprises a duplex region that comprises a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is: (i) at least partially complementary to a portion of RNA transcribed from the B4GALT1 gene, and (ii) comprises at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 402-513.

[0131] In certain embodiments, the first strand comprises nucleosides 2-22 of any one of the sequences set forth in SEQ ID NO: 402-513.

[0132] In certain embodiments, the first strand comprises any one of SEQ ID NO:62-81 or 402-513.

[0133] The modification pattern of the nucleic acids as set forth in SEQ ID NO:62-81 and 402-513 is summarized in Table 3 below: Table 3 Antisense strand IDModified First (Antisense) Strand 5' → 3'SEQ ID NO (AS - mod)Underlying Base Sequence 5' → 3' (Shown as an Unmodified Nucleoside Sequence)SEQ ID NO (AS - unmod)ETXS1238SEQ ID NO: 62SEQ ID NO: 22ETXS1240SEQ ID NO: 63SEQ ID NO: 23ETXS1242SEQ ID NO: 64SEQ ID NO: 24ETXS1244SEQ ID NO: 65SEQ ID NO: 25ETXS1246SEQ ID NO: 66SEQ ID NO: 26ETXS1248SEQ ID NO: 67SEQ ID NO: 27ETXS1250SEQ ID NO: 68SEQ ID NO: 28ETXS1252SEQ ID NO: 69SEQ ID NO: 29ETXS1254SEQ ID NO: 70SEQ ID NO: 30ETXS1256SEQ ID NO: 71SEQ ID NO: 31ETXS1258SEQ ID NO: 72SEQ ID NO: 32ETXS1260SEQ ID NO: 73SEQ ID NO: 33ETXS1262SEQ ID NO: 74SEQ ID NO: 34ETXS1264SEQ ID NO: 75SEQ ID NO: 35ETXS1266SEQ ID NO: 76SEQ ID NO: 36ETXS1268SEQ ID NO: 77SEQ ID NO: 37ETXS1270SEQ ID NO: 78SEQ ID NO: 38ETXS1272SEQ ID NO: 79SEQ ID NO: 39ETXS1274SEQ ID NO: 80SEQ ID NO: 40ETXS1276SEQ ID NO: 81SEQ ID NO: 41ETXS1038SEQ ID NO: 402SEQ ID NO: 220ETXS1040SEQ ID NO: 403SEQ ID NO: 237ETXS1042SEQ ID NO: 404SEQ ID NO: 285ETXS1044SEQ ID NO: 405SEQ ID NO: 211ETXS1046SEQ ID NO: 406SEQ ID NO: 205ETXS1048SEQ ID NO: 407SEQ ID NO: 259ETXS1050SEQ ID NO: 408SEQ ID NO: 240ETXS1052SEQ ID NO: 409SEQ ID NO: 222ETXS1054SEQ ID NO: 410SEQ ID NO: 234ETXS1056SEQ ID NO: 411SEQ ID NO: 227ETXS1058SEQ ID NO: 412SEQ ID NO: 216ETXS1060SEQ ID NO: 413SEQ ID NO: 223ETXS1062SEQ ID NO: 414SEQ ID NO: 226ETXS1064SEQ ID NO: 415SEQ ID NO: 224ETXS1066SEQ ID NO: 416SEQ ID NO: 202ETXS1068SEQ ID NO: 417SEQ ID NO: 269ETXS1070SEQ ID NO: 418SEQ ID NO: 219ETXS1072SEQ ID NO: 419SEQ ID NO: 262ETXS1074SEQ ID NO: 420SEQ ID NO: 278ETXS1076SEQ ID NO: 421SEQ ID NO: 212ETXS1078SEQ ID NO: 422SEQ ID NO: 229ETXS1080SEQ ID NO: 423SEQ ID NO: 242ETXS1082SEQ ID NO: 424SEQ ID NO: 293ETXS1084SEQ ID NO: 425SEQ ID NO: 254ETXS1086SEQ ID NO: 426SEQ ID NO: 208ETXS1088SEQ ID NO: 427SEQ ID NO: 260ETXS1090SEQ ID NO: 428SEQ ID NO: 281ETXS1092SEQ ID NO: 429SEQ ID NO: 247ETXS1094SEQ ID NO: 430SEQ ID NO: 203ETXS1096SEQ ID NO: 431SEQ ID NO: 251ETXS1098SEQ ID NO: 432SEQ ID NO: 215ETXS1100SEQ ID NO: 433SEQ ID NO: 206ETXS1102SEQ ID NO: 434SEQ ID NO: 249ETXS1104SEQ ID NO: 435SEQ ID NO: 270ETXS1106SEQ ID NO: 436SEQ ID NO: 279ETXS1108SEQ ID NO: 437SEQ ID NO: 210ETXS1110SEQ ID NO: 438SEQ ID NO: 233ETXS1112SEQ ID NO: 439SEQ ID NO: 271ETXS1114SEQ ID NO: 440SEQ ID NO: 280ETXS1116SEQ ID NO: 441SEQ ID NO: 253ETXS1118SEQ ID NO: 442SEQ ID NO: 265ETXS1120SEQ ID NO: 443SEQ ID NO: 241ETXS1122SEQ ID NO: 444SEQ ID NO: 256ETXS1124SEQ ID NO: 445SEQ ID NO: 290ETXS1126SEQ ID NO: 446SEQ ID NO: 289ETXS1128SEQ ID NO: 447SEQ ID NO: 288ETXS1130SEQ ID NO: 448SEQ ID NO: 246ETXS1132SEQ ID NO: 449SEQ ID NO: 264ETXS1134SEQ ID NO: 450SEQ ID NO: 267ETXS1136SEQ ID NO: 451SEQ ID NO: 235ETXS1138SEQ ID NO: 452SEQ ID NO: 273ETXS1140SEQ ID NO: 453SEQ ID NO: 245ETXS1142SEQ ID NO: 454SEQ ID NO: 232ETXS1144SEQ ID NO: 455SEQ ID NO: 301ETXS1146SEQ ID NO: 456SEQ ID NO: 231ETXS1148SEQ ID NO: 457SEQ ID NO: 266ETXS1150SEQ ID NO: 458SEQ ID NO: 276ETXS1152SEQ ID NO: 459SEQ ID NO: 243ETXS1154SEQ ID NO: 460SEQ ID NO: 272ETXS1156SEQ ID NO: 461SEQ ID NO: 221ETXS1158SEQ ID NO: 462SEQ ID NO: 214ETXS1160SEQ ID NO: 463SEQ ID NO: 218ETXS1162SEQ ID NO: 464SEQ ID NO: 257ETXS1164SEQ ID NO: 465SEQ ID NO: 296ETXS1166SEQ ID NO: 466SEQ ID NO: 217ETXS1168SEQ ID NO: 467SEQ ID NO: 286ETXS1170SEQ ID NO: 468SEQ ID NO: 294ETXS1172SEQ ID NO: 469SEQ ID NO: 236ETXS1174SEQ ID NO: 470SEQ ID NO: 258ETXS1176SEQ ID NO: 471SEQ ID NO: 239ETXS1178SEQ ID NO: 472SEQ ID NO: 209ETXS1180SEQ ID NO: 473SEQ ID NO: 204ETXS1182SEQ ID NO: 474SEQ ID NO: 230ETXS1184SEQ ID NO: 475SEQ ID NO: 282ETXS1186SEQ ID NO: 476SEQ ID NO: 287ETXS1188SEQ ID NO: 477SEQ ID NO: 252ETXS1190SEQ ID NO: 478SEQ ID NO: 261ETXS1192SEQ ID NO: 479SEQ ID NO: 250ETXS1194SEQ ID NO: 480SEQ ID NO: 274ETXS1196SEQ ID NO: 481SEQ ID NO: 248ETXS1198SEQ ID NO: 482SEQ ID NO: 213ETXS1200SEQ ID NO: 483SEQ ID NO: 238ETXS1202SEQ ID NO: 484SEQ ID NO: 300ETXS1204SEQ ID NO: 485SEQ ID NO: 275ETXS1206SEQ ID NO: 486SEQ ID NO: 225ETXS1208SEQ ID NO: 487SEQ ID NO: 263ETXS1210SEQ ID NO: 488SEQ ID NO: 255ETXS1212SEQ ID NO: 489SEQ ID NO: 277ETXS1214SEQ ID NO: 490SEQ ID NO: 298ETXS1216SEQ ID NO: 491SEQ ID NO: 291ETXS1218SEQ ID NO: 492SEQ ID NO: 268ETXS1220SEQ ID NO: 493SEQ ID NO: 207ETXS1222SEQ ID NO: 494SEQ ID NO: 297ETXS1224SEQ ID NO: 495SEQ ID NO: 284ETXS1226SEQ ID NO: 496SEQ ID NO: 292ETXS1228SEQ ID NO: 497SEQ ID NO: 283ETXS1230SEQ ID NO: 498SEQ ID NO: 295ETXS1232SEQ ID NO: 499SEQ ID NO: 299ETXS1234SEQ ID NO: 500SEQ ID NO: 228ETXS1236SEQ ID NO: 501SEQ ID NO: 244ETXS2400SEQ ID NO: 502SEQ ID NO: 202ETXS2402SEQ ID NO: 503SEQ ID NO: 202ETXS2406SEQ ID NO: 504SEQ ID NO: 205ETXS2408SEQ ID NO: 505SEQ ID NO: 205ETXS2424SEQ ID NO: 506SEQ ID NO: 217ETXS2426SEQ ID NO: 507SEQ ID NO: 217ETXS2430SEQ ID NO: 508SEQ ID NO: 228ETXS2432SEQ ID NO: 509SEQ ID NO: 228ETXS2434SEQ ID NO: 510SEQ ID NO: 202ETXS2436SEQ ID NO: 511SEQ ID NO: 205ETXS2438SEQ ID NO: 512SEQ ID NO: 217ETXS2440SEQ ID NO: 513SEQ ID NO: 228

[0134] In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO:82-101 or 514-621; wherein the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides to the first strand.

[0135] In certain embodiments, the second strand comprises a nucleoside sequence of at least 19 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 514-621; wherein the second strand has a region of at least 85% complementarity over the 19 contiguous nucleosides to the first strand.

[0136] In certain embodiments, the second strand comprises a nucleoside sequence of at least 21 contiguous nucleosides differing by 0 or 1 nucleosides from any one of SEQ ID NO: 514-621; wherein the second strand has a region of at least 85% complementarity over the 21 contiguous nucleosides to the first strand.

[0137] In certain embodiments, the second strand comprises any one of SEQ ID NO:82-101 or 514-621.

[0138] The modification pattern of the nucleic acids as set forth in SEQ ID NO:82-101 and 514-621 is summarized in Table 4 below: Table 4 Sense strand IDModified Second (Sense) Strand 5' → 3'SEQ ID NO (SS - mod)Underlying Base Sequence 5' → 3' (Shown as an Unmodified Nucleoside Sequence)SEQ ID NO (SS - unmod)ETXS1237SEQ ID NO: 82SEQ ID NO: 42ETXS1239SEQ ID NO: 83SEQ ID NO: 43ETXS1241SEQ ID NO: 84SEQ ID NO: 44ETXS1243SEQ ID NO: 85SEQ ID NO: 45ETXS1245SEQ ID NO: 86SEQ ID NO: 46ETXS1247SEQ ID NO: 87SEQ ID NO: 47ETXS1249SEQ ID NO: 88SEQ ID NO: 48ETXS1251SEQ ID NO: 89SEQ ID NO: 49ETXS1253SEQ ID NO: 90SEQ ID NO: 50ETXS1255SEQ ID NO: 91SEQ ID NO: 51ETXS1257SEQ ID NO: 92SEQ ID NO: 52ETXS1259SEQ ID NO: 93SEQ ID NO: 53ETXS1261SEQ ID NO: 94SEQ ID NO: 54ETXS1263SEQ ID NO: 95SEQ ID NO: 55ETXS1265SEQ ID NO: 96SEQ ID NO: 56ETXS1267SEQ ID NO: 97SEQ ID NO: 57ETXS1269SEQ ID NO: 98SEQ ID NO: 58ETXS1271SEQ ID NO: 99SEQ ID NO: 59ETXS1273SEQ ID NO: 100SEQ ID NO: 60ETXS1275SEQ ID NO: 101SEQ ID NO: 61ETXS1037SEQ ID NO: 618SEQ ID NO: 320ETXS1039SEQ ID NO: 619SEQ ID NO: 337ETXS1041SEQ ID NO: 620SEQ ID NO: 385ETXS1043SEQ ID NO: 621SEQ ID NO: 311ETXS1045SEQ ID NO: 514SEQ ID NO: 305ETXS1047SEQ ID NO: 515SEQ ID NO: 359ETXS1049SEQ ID NO: 516SEQ ID NO: 340ETXS1051SEQ ID NO: 517SEQ ID NO: 322ETXS1053SEQ ID NO: 518SEQ ID NO: 334ETXS1055SEQ ID NO: 519SEQ ID NO: 327ETXS1057SEQ ID NO: 520SEQ ID NO: 316ETXS1059SEQ ID NO: 521SEQ ID NO: 323ETXS1061SEQ ID NO: 522SEQ ID NO: 326ETXS1063SEQ ID NO: 523SEQ ID NO: 324ETXS1065SEQ ID NO: 524SEQ ID NO: 302ETXS1067SEQ ID NO: 525SEQ ID NO: 369ETXS1069SEQ ID NO: 526SEQ ID NO: 319ETXS1071SEQ ID NO: 527SEQ ID NO: 362ETXS1073SEQ ID NO: 528SEQ ID NO: 378ETXS1075SEQ ID NO: 529SEQ ID NO: 312ETXS1077SEQ ID NO: 530SEQ ID NO: 329ETXS1079SEQ ID NO: 531SEQ ID NO: 342ETXS1081SEQ ID NO: 532SEQ ID NO: 393ETXS1083SEQ ID NO: 533SEQ ID NO: 354ETXS1085SEQ ID NO: 534SEQ ID NO: 308ETXS1087SEQ ID NO: 535SEQ ID NO: 360ETXS1089SEQ ID NO: 536SEQ ID NO: 381ETXS1091SEQ ID NO: 537SEQ ID NO: 347ETXS1093SEQ ID NO: 538SEQ ID NO: 303ETXS1095SEQ ID NO: 539SEQ ID NO: 351ETXS1097SEQ ID NO: 540SEQ ID NO: 315ETXS1099SEQ ID NO: 541SEQ ID NO: 306ETXS1101SEQ ID NO: 542SEQ ID NO: 349ETXS1103SEQ ID NO: 543SEQ ID NO: 370ETXS1105SEQ ID NO: 544SEQ ID NO: 379ETXS1107SEQ ID NO: 545SEQ ID NO: 310ETXS1109SEQ ID NO: 546SEQ ID NO: 333ETXS1111SEQ ID NO: 547SEQ ID NO: 371ETXS1113SEQ ID NO: 548SEQ ID NO: 380ETXS1115SEQ ID NO: 549SEQ ID NO: 353ETXS1117SEQ ID NO: 550SEQ ID NO: 365ETXS1119SEQ ID NO: 551SEQ ID NO: 341ETXS1121SEQ ID NO: 552SEQ ID NO: 356ETXS1123SEQ ID NO: 553SEQ ID NO: 390ETXS1125SEQ ID NO: 554SEQ ID NO: 389ETXS1127SEQ ID NO: 555SEQ ID NO: 388ETXS1129SEQ ID NO: 556SEQ ID NO: 346ETXS1131SEQ ID NO: 557SEQ ID NO: 364ETXS1133SEQ ID NO: 558SEQ ID NO: 367ETXS1135SEQ ID NO: 559SEQ ID NO: 335ETXS1137SEQ ID NO: 560SEQ ID NO: 373ETXS1139SEQ ID NO: 561SEQ ID NO: 345ETXS1141SEQ ID NO: 562SEQ ID NO: 332ETXS1143SEQ ID NO: 563SEQ ID NO: 401ETXS1145SEQ ID NO: 564SEQ ID NO: 331ETXS1147SEQ ID NO: 565SEQ ID NO: 366ETXS1149SEQ ID NO: 566SEQ ID NO: 376ETXS1151SEQ ID NO: 567SEQ ID NO: 343ETXS1153SEQ ID NO: 568SEQ ID NO: 372ETXS1155SEQ ID NO: 569SEQ ID NO: 321ETXS1157SEQ ID NO: 570SEQ ID NO: 314ETXS1159SEQ ID NO: 571SEQ ID NO: 318ETXS1161SEQ ID NO: 572SEQ ID NO: 357ETXS1163SEQ ID NO: 573SEQ ID NO: 396ETXS1165SEQ ID NO: 574SEQ ID NO: 317ETXS1167SEQ ID NO: 575SEQ ID NO: 386ETXS1169SEQ ID NO: 576SEQ ID NO: 394ETXS1171SEQ ID NO: 577SEQ ID NO: 336ETXS1173SEQ ID NO: 578SEQ ID NO: 358ETXS1175SEQ ID NO: 579SEQ ID NO: 339ETXS1177SEQ ID NO: 580SEQ ID NO: 309ETXS1179SEQ ID NO: 581SEQ ID NO: 304ETXS1181SEQ ID NO: 582SEQ ID NO: 330ETXS1183SEQ ID NO: 583SEQ ID NO: 382ETXS1185SEQ ID NO: 584SEQ ID NO: 387ETXS1187SEQ ID NO: 585SEQ ID NO: 352ETXS1189SEQ ID NO: 586SEQ ID NO: 361ETXS1191SEQ ID NO: 587SEQ ID NO: 350ETXS1193SEQ ID NO: 588SEQ ID NO: 374ETXS1195SEQ ID NO: 589SEQ ID NO: 348ETXS1197SEQ ID NO: 590SEQ ID NO: 313ETXS1199SEQ ID NO: 591SEQ ID NO: 338ETXS1201SEQ ID NO: 592SEQ ID NO: 400ETXS1203SEQ ID NO: 593SEQ ID NO: 375ETXS1205SEQ ID NO: 594SEQ ID NO: 325ETXS1207SEQ ID NO: 595SEQ ID NO: 363ETXS1209SEQ ID NO: 596SEQ ID NO: 355ETXS1211SEQ ID NO: 597SEQ ID NO: 377ETXS1213SEQ ID NO: 598SEQ ID NO: 398ETXS1215SEQ ID NO: 599SEQ ID NO: 391ETXS1217SEQ ID NO: 600SEQ ID NO: 368ETXS1219SEQ ID NO: 601SEQ ID NO: 307ETXS1221SEQ ID NO: 602SEQ ID NO: 397ETXS1223SEQ ID NO: 603SEQ ID NO: 384ETXS1225SEQ ID NO: 604SEQ ID NO: 392ETXS1227SEQ ID NO: 605SEQ ID NO: 383ETXS1229SEQ ID NO: 606SEQ ID NO: 395ETXS1231SEQ ID NO: 607SEQ ID NO: 399ETXS1233SEQ ID NO: 608SEQ ID NO: 328ETXS1235SEQ ID NO: 609SEQ ID NO: 344ETXS2399SEQ ID NO: 610SEQ ID NO: 302ETXS2401SEQ ID NO: 611SEQ ID NO: 302ETXS2405SEQ ID NO: 612SEQ ID NO: 305ETXS2407SEQ ID NO: 613SEQ ID NO: 305ETXS2423SEQ ID NO: 614SEQ ID NO: 317ETXS2425SEQ ID NO: 615SEQ ID NO: 317ETXS2429SEQ ID NO: 616SEQ ID NO: 328ETXS2431SEQ ID NO: 617SEQ ID NO: 328

[0139] As used herein, and in particular in Tables 3 and 4, the following abbreviations are used for modified nucleosides: Am stands for 2'-O-methyl-adenosine, Cm stands for 2'-O-methyl-cytidine, Gm stands for 2'-O-methyl-guanosine, Um stands for 2'-O-methyl-uridine, Af stands for 2'-Fluoro-adenosine, Cf stands for 2'-Fluoro-cytidine, Gf stands for 2'-Fluoro-guanosine and Uf stands for 2'-Fluoro-uridine.

[0140] Furthermore, the letter "s" is used as abbreviation for a phosphorothioate linkage between two consecutive (modified) nucleosides. For example, the abbreviation "AmsAm" is used for two consecutive 2'-O-methyl-adenosine nucleosides that are linked via a 3'-5' phosphorothioate linkage. No abbreviation is used for nucleosides that are linked via a standard 3'-5' phosphodiester linkage. For example, the abbreviation "AmAm" is used for two consecutive 2'-O-methyl-adenosine nucleosides that are linked via a 3'-5' phosphodiester linkage.

[0141] In certain embodiments, the nucleic acid comprises a first strand that comprises, consists of, or consists essentially of a (modified) nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:62-81 or 402-513; and a second strand that comprises, consists of, or consists essentially of a (modified) nucleoside sequence differing by 0 or 1 nucleosides from any one of SEQ ID NO:82-101 or 514-621.

[0142] Preferred combinations of complementary modified antisense (first) and sense (second) strands are listed below in Table 5: Table 5 Duplex IDFirst (Antisense) strand IDSecond (Sense) strand IDETXM619ETXS1238ETXS1237ETXM620ETXS1240ETXS1239ETXM621ETXS1242ETXS1241ETXM622ETXS1244ETXS1243ETXM623ETXS1246ETXS1245ETXM624ETXS1248ETXS1247ETXM625ETXS1250ETXS1249ETXM626ETXS1252ETXS1251ETXM627ETXS1254ETXS1253ETXM628ETXS1256ETXS1255ETXM629ETXS1258ETXS1257ETXM630ETXS1260ETXS1259ETXM631ETXS1262ETXS1261ETXM632ETXS1264ETXS1263ETXM633ETXS1266ETXS1265ETXM634ETXS1268ETXS1267ETXM635ETXS1270ETXS1269ETXM636ETXS1272ETXS1271ETXM637ETXS1274ETXS1273ETXM638ETXS1276ETXS1275ETXM519ETXS1038ETXS1037ETXM520ETXS1040ETXS1039ETXM521ETXS1042ETXS1041ETXM522ETXS1044ETXS1043ETXM523ETXS1046ETXS1045ETXM524ETXS1048ETXS1047ETXM525ETXS1050ETXS1049ETXM526ETXS1052ETXS1051ETXM527ETXS1054ETXS1053ETXM528ETXS1056ETXS1055ETXM529ETXS1058ETXS1057ETXM530ETXS1060ETXS1059ETXM531ETXS1062ETXS1061ETXM532ETXS1064ETXS1063ETXM533ETXS1066ETXS1065ETXM534ETXS1068ETXS1067ETXM535ETXS1070ETXS1069ETXM536ETXS1072ETXS1071ETXM537ETXS1074ETXS1073ETXM538ETXS1076ETXS1075ETXM539ETXS1078ETXS1077ETXM540ETXS1080ETXS1079ETXM541ETXS1082ETXS1081ETXM542ETXS1084ETXS1083ETXM543ETXS1086ETXS1085ETXM544ETXS1088ETXS1087ETXM545ETXS1090ETXS1089ETXM546ETXS1092ETXS1091ETXM547ETXS1094ETXS1093ETXM548ETXS1096ETXS1095ETXM549ETXS1098ETXS1097ETXM550ETXS1100ETXS1099ETXM551ETXS1102ETXS1101ETXM552ETXS1104ETXS1103ETXM553ETXS1106ETXS1105ETXM554ETXS1108ETXS1107ETXM555ETXS1110ETXS1109ETXM556ETXS1112ETXS1111ETXM557ETXS1114ETXS1113ETXM558ETXS1116ETXS1115ETXM559ETXS1118ETXS1117ETXM560ETXS1120ETXS1119ETXM561ETXS1122ETXS1121ETXM562ETXS1124ETXS1123ETXM563ETXS1126ETXS1125ETXM564ETXS1128ETXS1127ETXM565ETXS1130ETXS1129ETXM566ETXS1132ETXS1131ETXM567ETXS1134ETXS1133ETXM568ETXS1136ETXS1135ETXM569ETXS1138ETXS1137ETXM570ETXS1140ETXS1139ETXM571ETXS1142ETXS1141ETXM572ETXS1144ETXS1143ETXM573ETXS1146ETXS1145ETXM574ETXS1148ETXS1147ETXM575ETXS1150ETXS1149ETXM576ETXS1152ETXS1151ETXM577ETXS1154ETXS1153ETXM578ETXS1156ETXS1155ETXM579ETXS1158ETXS1157ETXM580ETXS1160ETXS1159ETXM581ETXS1162ETXS1161ETXM582ETXS1164ETXS1163ETXM583ETXS1166ETXS1165ETXM584ETXS1168ETXS1167ETXM585ETXS1170ETXS1169ETXM586ETXS1172ETXS1171ETXM587ETXS1174ETXS1173ETXM588ETXS1176ETXS1175ETXM589ETXS1178ETXS1177ETXM590ETXS1180ETXS1179ETXM591ETXS1182ETXS1181ETXM592ETXS1184ETXS1183ETXM593ETXS1186ETXS1185ETXM594ETXS1188ETXS1187ETXM595ETXS1190ETXS1189ETXM596ETXS1192ETXS1191ETXM597ETXS1194ETXS1193ETXM598ETXS1196ETXS1195ETXM599ETXS1198ETXS1197ETXM600ETXS1200ETXS1199ETXM601ETXS1202ETXS1201ETXM602ETXS1204ETXS1203ETXM603ETXS1206ETXS1205ETXM604ETXS1208ETXS1207ETXM605ETXS1210ETXS1209ETXM606ETXS1212ETXS1211ETXM607ETXS1214ETXS1213ETXM608ETXS1216ETXS1215ETXM609ETXS1218ETXS1217ETXM610ETXS1220ETXS1219ETXM611ETXS1222ETXS1221ETXM612ETXS1224ETXS1223ETXM613ETXS1226ETXS1225ETXM614ETXS1228ETXS1227ETXM615ETXS1230ETXS1229ETXM616ETXS1232ETXS1231ETXM617ETXS1234ETXS1233ETXM618ETXS1236ETXS1235ETXM1200ETXS2400ETXS2399ETXM1201ETXS2402ETXS2401ETXM1203ETXS2406ETXS2405ETXM1204ETXS2408ETXS2407ETXM1212ETXS2424ETXS2423ETXM1213ETXS2426ETXS2425ETXM1215ETXS2430ETXS2429ETXM1216ETXS2432ETXS2431ETXM1217ETXS2434ETXS2401ETXM1218ETXS2436ETXS2407ETXM1219ETXS2438ETXS2425ETXM1220ETXS2440ETXS2431

[0143] In a particularly preferred embodiment, the invention relates to a nucleic acid comprising first and second strands that comprise, consist of, or consist essentially of a nucleoside sequence differing by 0 or 1 nucleosides from any one of the following first and second sequences: Modified first strandModified second strandSEQ ID NO: 502 (ETXS2400)SEQ ID NO: 610 (ETXS2399)SEQ ID NO: 503 (ETXS2402)SEQ ID NO: 611 (ETXS2401)SEQ ID NO: 504 (ETXS2406)SEQ ID NO: 612 (ETXS2405)SEQ ID NO: 505 (ETXS2408)SEQ ID NO: 613 (ETXS2407)SEQ ID NO: 506 (ETXS2424)SEQ ID NO: 614 (ETXS2423)SEQ ID NO: 507 (ETXS2426)SEQ ID NO: 615 (ETXS2425)SEQ ID NO: 508 (ETXS2430)SEQ ID NO: 616 (ETXS2429)SEQ ID NO: 509 (ETXS2432)SEQ ID NO: 617 (ETXS2431)SEQ ID NO: 510 (ETXS2434)SEQ ID NO: 611 (ETXS2401)SEQ ID NO: 511 (ETXS2436)SEQ ID NO: 613 (ETXS2407)SEQ ID NO: 512 (ETXS2438)SEQ ID NO: 615 (ETXS2425)SEQ ID NO: 513 (ETXS2440)SEQ ID NO: 617 (ETXS2431)

[0144] In case of ambiguity between the sequences in this specification and the sequences in the attached sequence listing, the sequences provided herein are considered to be the correct sequences.ABASIC NUCLEOTIDES

[0145] In certain embodiments, there are 1, e.g. 2, e.g. 3, e.g. 4 or more abasic nucleosides present in nucleic acids according to the invention. Abasic nucleosides are modified nucleosides because they lack the base normally seen at position 1 of the sugar moiety. Typically, there will be a hydrogen at position 1 of the sugar moiety of the abasic nucleosides present in a nucleic acid according to the present invention.

[0146] The abasic nucleosides are in the terminal region of the second strand, preferably located within the terminal 5 nucleosides of the end of the strand. The terminal region may be the terminal 5 nucleosides, which includes abasic nucleosides.

[0147] The second strand may comprise, as preferred features (which are all specifically contemplated in combination unless mutually exclusive): 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or 2, or more than 2, abasic nucleosides in either the 5' or 3' terminal region of the second strand; and / or 2, or more than 2, abasic nucleosides in either the 5' or 3' terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleosides is a terminal nucleosides; and / or 2, or more than 2, consecutive abasic nucleosides in either the 5' or 3' terminal region of the second strand, wherein preferably one such abasic nucleosides is a terminal nucleosides in either the 5' or 3' terminal region of the second strand; and / or a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or a reversed internucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5' or 3' terminal region of the second strand; and / or an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or abasic nucleosides as the 2 terminal nucleosides connected via a 5'-3' linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; abasic nucleosides as the 2 terminal nucleosides connected via a 3'-5' linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5' reversed linkage or a 3'-3' reversed linkage; abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either (1) the reversed linkage is a 5-5' reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3'5' when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or (2) the reversed linkage is a 3-3' reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5'3' when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.

[0148] Preferably there is an abasic nucleoside at the terminus of the second strand.

[0149] Preferably there are 2 or at least 2 abasic nucleosides in the terminal region of the second strand, preferably at the terminal and penultimate positions.

[0150] Preferably 2 or more abasic nucleosides are consecutive, for example all abasic nucleosides may be consecutive. For example, the terminal 1 or terminal 2 or terminal 3 or terminal 4 nucelotides may be abasic nucleosides.

[0151] An abasic nucleoside may also be linked to an adjacent nucleoside through a 5'-3' phosphodiester linkage or reversed linkage unless there is only 1 abasic nucleoside at the terminus, in which case it will have a reversed linkage to the adjacent nucleoside.

[0152] A reversed linkage (which may also be referred to as an inverted linkage, which is also seen in the art), comprises either a 5'-5', a 3'-3', a 3'-2' or a 2'-3' phosphodiester linkage between the adjacent sugar moieties of the nucleosides.

[0153] Abasic nucleosides which are not terminal will have 2 phosphodiester bonds, one with each adjacent nucleoside, and these may be a reversed linkage or may be a 5'-3 phosphodiester bond or may be one of each.

[0154] A preferred embodiment comprises 2 abasic nucleosides at the terminal and penultimate positions of the second strand, and wherein the reversed internucleoside linkage is located between the penultimate (abasic) nucleoside and the antepenultimate nucleoside.

[0155] Preferably there are 2 abasic nucleosides at the terminal and penultimate positions of the second strand and the penultimate nucleoside is linked to the antepenultimate nucleoside through a reversed internucleoside linkage and is linked to the terminal nucleoside through a 5'-3' or 3'-5' phosphodiester linkage (reading in the direction of the terminus of the molecule).

[0156] Different preferred features are as follows: The reversed internucleoside linkage is a 3'-3' reversed linkage. The reversed internucleoside linkage is at a terminal region which is distal to the 5' terminal phosphate of the second strand.

[0157] The reversed internucleoside linkage is a 5'-5' reversed linkage. The reversed internucleoside linkage is at a terminal region which is distal to the 3' terminal hydroxide of the second strand.

[0158] In certain embodiments, the second strand comprises 2 consecutive abasic nucleosides in the 5' terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 5' terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 5' terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 5' near terminal region through a reversed internucleoside linkage; and (b) the reversed linkage is a 5-5' reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 3'-5' when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. More typically, (i) the first strand and the second strand each has a length of 19 or 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in said 5' near terminal region of the second strand, wherein a first phosphorothioate internucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 5' near terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 5' near terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in both 5' and 3' terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5' and 3' terminal regions of said first strand is each attached to a respective 5' and 3' adjacent penultimate nucleoside by a phosphorothioate internucleoside linkage, and each first 5' and 3' penultimate nucleoside is attached to a respective 5' and 3' adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3' terminal region of the second strand.

[0159] Alternatively the second strand comprises 2 consecutive abasic nucleosides preferably in an overhang in the 3' terminal region of the second strand, wherein one such abasic nucleoside is a terminal nucleoside at the 3' terminal region of the second strand and the other abasic nucleoside is a penultimate nucleoside at the 3' terminal region of the second strand, wherein: (a) said penultimate abasic nucleoside is connected to an adjacent first basic nucleoside in an adjacent 3' near terminal region through a reversed internucleoside linkage; and (b) the reversed linkage is a 3-3' reversed linkage; and (c) the linkage between the terminal and penultimate abasic nucleosides is 5'-3' when reading towards the terminus comprising the terminal and penultimate abasic nucleosides. More typically, (i) the first strand and the second strand each has a length of 19 or 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in said 3' near terminal region of the second strand, wherein a first phosphorothioate internucleoside linkage is present between said adjacent first basic nucleoside of (a) and an adjacent second basic nucleoside in said 3' near terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between said adjacent second basic nucleoside and an adjacent third basic nucleoside in said 3' near terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are respectively between three consecutive positions in both 5' and 3' terminal regions of the first strand, whereby a terminal nucleoside respectively at each of the 5' and 3' terminal regions of said first strand is each attached to a respective 5' and 3' adjacent penultimate nucleoside by a phosphorothioate internucleoside linkage, and each first 5' and 3' penultimate nucleoside is attached to a respective 5' and 3' adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage; and (iv) the second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 5' terminal region of the second strand.

[0160] Examples of the structures are as follows (where the specific RNA nucleosides shown are not limiting and could be any RNA nucleoside): A A 3'-3' reversed bond (and also showing the 5'-3 direction of the last phosphodiester bond between the two abasic molecules reading towards the terminus of the molecule) B Illustrating a 5'-5' reversed bond (and also showing the 3'-5' direction of the last phosphodiester bond between the two abasic molecules reading towards the terminus of the molecule)

[0161] The abasic nucleoside or abasic nucleosides present in the nucleic acid are provided in the presence of a reversed internucleoside linkage or linkages, namely a 5'-5' or a 3'-3' reversed internucleoside linkage. A reversed linkage occurs as a result of a change of orientation of an adjacent nucleoside sugar, such that the sugar will have a 3' - 5' orientation as opposed to the conventional 5' - 3' orientation (with reference to the numbering of ring atoms on the nucleoside sugars). The abasic nucleoside or nucleosides as present in the nucleic acids of the invention preferably include such inverted nucleoside sugars.

[0162] In the case of a terminal nucleoside having an inverted orientation, then this will result in an "inverted" end configuration for the overall nucleic acid. Whilst certain structures drawn and referenced herein are represented using conventional 5' - 3' direction (with reference to the numbering of ring atoms on the nucleoside sugars), it will be appreciated that the presence of a terminal nucleoside having a change of orientation and a proximal 3'-3' reversed linkage, will result in a nucleic acid having an overall 5'- 5' end structure (i.e. the conventional 3' end nucleoside becomes a 5' end nucleoside). Alternatively, it will be appreciated that the presence of a terminal nucleoside having a change of orientation and a proximal 5'-5' reversed linkage will result in a nucleic acid with an overall 3'- 3' end structure.

[0163] The proximal 3'-3' or 5'-5' reversed linkage as herein described, may comprise the reversed linkage being directly adjacent / attached to a terminal nucleoside having an inverted orientation, such as a single terminal nucleoside having an inverted orientation. Alternatively, the proximal 3'-3' or 5'-5' reversed linkage as herein described, may comprise the reversed linkage being adjacent 2, or more than 2, nucleosides having an inverted orientation, such as 2, or more than 2, terminal region nucleosides having an inverted orientation, such as the terminal and penultimate nucleosides. In this way, the reversed linkage may be attached to a penultimate nucleoside having an inverted orientation. While a skilled addressee will appreciate that inverted orientations as described above can result in nucleic acid molecules having overall 3' - 3' or 5'-5' end structures as described herein, it will also be appreciated that with the presence of one or more additional reversed linkages and / or nucleosides having an inverted orientation, then the overall nucleic acid may have 3' - 5' end structures corresponding to the conventionally positioned 5' / 3' ends.

[0164] In one aspect the nucleic acid may have a 3'-3' reversed linkage, and the terminal sugar moiety may comprise a 5' OH rather than a 5' phosphate group at the 5' position of that terminal sugar.

[0165] A skilled person would therefore clearly understand that 5'-5', 3'-3' and 3'-5' (reading in the direction of that terminus) end variants of the more conventional 5'- 3' structures (with reference to the numbering of ring atoms on the end nucleoside sugars) drawn herein are included in the scope of the disclosure, where a reversed linkage or linkages is / are present.

[0166] In the situation of e.g. a reversed internucleoside linkage and / or one or more nucleosides having an inverted orientation creating an inverted end, and where the relative position of a linkage (e.g. to a linker) or the location of an internal feature (such as a modified nucleoside) is defined relative to the 5' or 3' end of the nucleic acid, then the 5' or 3' end is the conventional 5' or 3' end which would have existed had a reversed linkage not been in place, and wherein the conventional 5' or 3' end is determined by consideration of the directionality of the majority of the internal nucleoside linkages and / or nucleoside orientation within the nucleic acid. It is possible to tell from these internal bonds and / or nucleoside orientation which ends of the nucleic acid would constitute the conventional 5' and 3' ends (with reference to the numbering of ring atoms on the end nucleoside sugars) of the molecule absent the reversed linkage.

[0167] For example, in the structure shown below there are abasic residues in the first 2 positions located at the "5'" end. Where the terminal nucleoside has an inverted orientation then the "5'" end indicated in the diagram below, which is the conventional 5' end, can in fact comprise a 3' OH in view of the inverted nucleoside at the terminal position. Nevertheless the majority of the molecule will comprise conventional internucleoside linkages that run from the 3' OH of the sugar to the 5' phosphate of the next sugar, when reading in the standard 5' [PO4] to 3' [OH] direction of a nucleic acid molecule (with reference to the numbering of ring atoms on the nucleoside sugars), which can be used to determine the conventional 5' and 3' ends that would be found absent the inverted end configuration. A 5' A-A-Me-Me-Me-Me-Me-Me-F-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me 3'

[0168] The reversed bond is preferably located at the end of the nucleic acid e.g. RNA which is distal to a ligand moiety, such as a GalNAc containing portion, of the molecule.

[0169] GalNAc-siRNA constructs with a 5'-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand.

[0170] GalNAc-siRNA constructs with a 3'-GalNAc on the sense strand can have a reversed linkage on the opposite end of the sense strand.NUCLEIC ACID LENGTHS

[0171] In one aspect the i) the first strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides; and / or ii) the second strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 nucleosides.

[0172] Typically, the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably is 19 or 21 nucleosides in length. Similarly, the region of complementarity between the first strand and the portion of RNA transcribed from the B4GALT1 gene is between 17 and 30 nucleosides in length.

[0173] In one aspect the i) the first strand of the nucleic acid has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; and / or ii) the second strand of the nucleic acid has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23.

[0174] Generally, the duplex structure of the nucleic acid e.g. an iRNA is about 15 to 30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0175] Similarly, the region of complementarity of an antisense sequence to a target sequence and / or the region of complementarity of an antisense sequence to a sense sequence is about 15 to 30 nucleosides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20- 24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

[0176] In certain preferred embodiments, the region of complementarity of an antisense sequence to a target sequence and / or the region of complementarity of an antisense sequence to a sense sequence is at least 17 nucleosides in length. For example, the region of complementarity between the antisense strand and the target is 19 to 21 nucleosides in length, for example, the region of complementarity is 21 nucleosides in length.

[0177] In preferred embodiments, each strand is no more than 30 nucleosides in length.

[0178] In certain embodiments, the duplex structure of the nucleic acid e.g. an siRNA is 19 base pairs in length. In particularly preferred embodiment, the duplex may have the following structure: or

[0179] A nucleic acid e.g. a dsRNA as described herein can further include one or more single-stranded nucleoside overhangs e.g., 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleosides. A nucleoside overhang can comprise or consist of a nucleoside / nucleoside analog, including a deoxynucleoside / nucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleoside(s) of an overhang can be present on the 5'-end, 3'- end, or both ends of an antisense or sense strand of a nucleic acid e.g. a dsRNA.

[0180] In certain preferred embodiments, at least one strand comprises a 3' overhang of at least 1 nucleoside, e.g., at least one strand comprises a 3' overhang of at least 2 nucleosides. The overhang is suitably on the antisense / guide strand and / or the sense / passenger strand.NUCLEIC ACID MODIFICATIONS

[0181] In certain embodiments, the nucleic acid e.g. an RNA of the invention e.g., a dsiRNA, does not comprise further modifications, e.g., chemical modifications or conjugations known in the art and described herein.

[0182] In other preferred embodiments, the nucleic acid e.g. RNA of the invention, e.g., a dsiRNA, is further chemically modified to enhance stability or other beneficial characteristics.

[0183] In certain embodiments of the invention, substantially all of the nucleosides are modified.

[0184] The nucleic acids featured in the invention can be synthesized or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA.

[0185] Modifications include, for example, end modifications, e.g., 5'-end modifications (phosphorylation, conjugation, inverted linkages) or 3 '-end modifications (conjugation, DNA nucleosides within an RNA, or RNA nucleosides within a DNA, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, conjugated bases; sugar modifications (e.g. , at the 2'-position or 4'- position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages.

[0186] Specific examples of nucleic acids such as siRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. Nucleic acids such as RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified nucleic acids e.g. RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified nucleic acid e.g. an siRNA will have a phosphorus atom in its internucleoside backbone.

[0187] Modified nucleic acid e.g. RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 5'-3' or 5'-2'. Various salts, mixed salts and free acid forms are also included.

[0188] Modified nucleic acids e.g. RNAs can also contain one or more substituted sugar moieties. The nucleic acids e.g. siRNAs, e.g., dsiRNAs, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted. 2' O-methyl and 2'-F are preferred modifications.

[0189] In certain preferred embodiments, the nucleic acid comprises at least one modified nucleoside.

[0190] The nucleic acid of the invention may comprise one or more modified nucleosides on the first strand and / or the second strand.

[0191] In some embodiments, substantially all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand comprise a modification.

[0192] In some embodiments, all of the nucleosides of the sense strand and substantially all of the nucleosides of the antisense strand comprise a modification.

[0193] In some embodiments, all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand comprise a modification.

[0194] In one embodiment, at least one of the modified nucleosides is selected from the group consisting of a deoxy- nucleoside, a 3'-terminal deoxy-thymine (dT) nucleoside, a 2'-O-methyl modified nucleoside (also called herein 2'-Me, where Me is a methoxy) , a 2'-fluoro modified nucleoside, a 2'-deoxy- modified nucleoside, a locked nucleoside, an unlocked nucleoside, a conformationally restricted nucleoside, a constrained ethyl nucleoside, an abasic nucleoside, a 2'-amino- modified nucleoside, a 2'-O-allyl- modified nucleoside, 2' -C-alkyl- modified nucleoside, 2'-hydroxly-modified nucleoside, a 2'- methoxyethyl modified nucleoside, a 2'-O-alkyl-modified nucleoside, a morpholino nucleoside, a phosphoramidate, a non-natural base comprising nucleoside, a tetrahydropyran modified nucleoside, a 1 ,5-anhydrohexitol modified nucleoside, a cyclohexenyl modified nucleoside, a nucleoside comprising a phosphorothioate group, a nucleoside comprising a methylphosphonate group, a nucleoside comprising a 5 '-phosphate, and a nucleoside comprising a 5 '-phosphate mimic. In another embodiment, the modified nucleosides comprise a short sequence of 3 '-terminal deoxy-thymine nucleosides (dT).

[0195] Modifications on the nucleosides may preferably be selected from the group including, but not limited to, LNA, HNA, CeNA, 2-methoxyethyl, 2'-O-alkyl, 2-O-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2'- hydroxyl, and combinations thereof. In another embodiment, the modifications on the nucleosides are 2'O-methyl ("2-Me") or 2'-fluoro modifications.

[0196] One preferred modification is a modification at the 2'-OH group of the ribose sugar, optionally selected from 2'-Me or 2'-F modifications.

[0197] Preferred nucleic acid comprise one or more nucleosides on the first strand and / or the second strand which are modified, to form modified nucleosides, as follows: A nucleic acid wherein the modification is a modification at the 2'-OH group of the ribose sugar, optionally selected from 2'-Me or 2'-F modifications.

[0198] A nucleic acid wherein the first strand comprises a 2'-F modification at any of position 2, position 6, position 14, or any combination thereof, counting from position 1 of said first strand.

[0199] A nucleic acid wherein the second strand comprises a 2'-F modification at any of position 7, position 9, position 11, or any combination thereof, counting from position 1 of said second strand.

[0200] A nucleic acid wherein the second strand comprises a 2'-F modification at position 7 and / or 9, and / or 11, and / or 13 , counting from position 1 of said second strand.

[0201] A nucleic acid wherein the second strand comprises a 2'-F modification at position 7 and 9 and 11 counting from position 1 of said second strand.

[0202] A nucleic acid wherein the first and second strand each comprise 2'-Me and 2'-F modifications.

[0203] A nucleic which comprises at least one thermally destabilizing modification, suitably at one or more of positions 1 to 9 of the first strand counting from position 1 of the first strand, and / or at one or more of positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid.

[0204] A nucleic acid wherein the nucleic acid comprises 3 or more 2'-F modifications at positions 7 to 13 of the second strand, such as 4, 5, 6 or 7 2'-F modifications at positions 7 to 13 of the second strand, counting from position 1 of said second strand.

[0205] A nucleic acid wherein said second strand comprises at least 3, such as 4, 5 or 6, 2'-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.

[0206] A nucleic acid wherein said first strand comprises at least 5 2'-Me consecutive modifications at the 3' terminal region, preferably including the terminal nucleoside at the 3' terminal region, or at least within 1 or 2 nucleosides from the terminal nucleoside at the 3' terminal region.

[0207] A nucleic acid wherein said first strand comprises 7 2'-Me consecutive modifications at the 3' terminal region, preferably including the terminal nucleoside at the 3' terminal region.

[0208] A nucleic acid which comprises at least one thermally destabilizing modification at position 7 of the first strand, counting from position 1 of the first strand.

[0209] A nucleic acid which is an siRNA oligonucleoside, wherein the siRNA oligonucleoside comprises at least 3 2'-F modifications at positions 6 to 12 of the second strand, counting from position 1 of said second strand.

[0210] A nucleic acid which is an siRNA oligonucleoside, wherein said second strand comprises at least 3 2'-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.

[0211] A nucleic acid which is an siRNA oligonucleoside, wherein each of the first and second strands comprises an alternating modification pattern, preferably a fully alternating modification pattern along the entire length of each of the first and second strands, wherein the nucleosides of the first strand are modified by (i) 2'Me modifications on the odd numbered nucleosides counting from position 1 of the first strand, and (ii) 2'F modifications on the even numbered nucleosides counting from position 1 of the first strand, and nucleosides of the second strand are modified by (i) 2'F modifications on the odd numbered nucleosides counting from position 1 of the second strand, and (ii) 2'Me modifications on the even numbered nucleosides counting from position 1 of the second strand. Typically, such fully alternating modification patterns are present in a blunt ended oligonucleoside, wherein each of the first and second strands are 19 or 23 nucleosides in length.

[0212] Position 1 of the first or the second strand is the nucleoside which is the closest to the end of the nucleic acid (ignoring any abasic nucleosides) and that is joined to an adjacent nucleoside (at Position 2) via a 3' to 5' internal bond, with reference to the bonds between the sugar moieties of the backbone, and reading in a direction away from that end of the molecule.

[0213] It can therefore be seen that "position 1 of the sense strand" is the 5' most nucleoside (not including abasic nucleosides) at the conventional 5' end of the sense strand. Typically, the nucleoside at this position 1 of the sense strand will be equivalent to the 5' nucleoside of the selected target nucleic acid sequence, and more generally the sense strand will have equivalent nucleosides to those of the target nucleic acid sequence starting from this position 1 of the sense strand, whilst also allowing for acceptable mismatches between the sequences.

[0214] As used herein, "position 1 of the antisense strand" is the 5' most nucleoside (not including abasic nucleosides) at the conventional 5' end of the antisense strand. As hereinbefore described, there will be a region of complementarity between the sense and antisense strands, and in this way the antisense strand will also have a region of complementarity to the target nucleic acid sequence as referred to above.

[0215] In certain embodiments, the nucleic acid e.g. RNAi agent further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage. For example the phosphorothioate or methylphosphonate internucleoside linkage can be at the 3 '-terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand.

[0216] In certain embodiments, the phosphorothioate or methylphosphonate internucleoside linkage is at the 5 'terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand.

[0217] In certain embodiments, a phosphorothioate or a methylphosphonate internucleoside linkage is at both the 5'- and 3 '-terminus or in the terminal region of one strand, i.e. , the sense strand or the antisense strand; or at the ends of both strands, the sense strand and the antisense strand.

[0218] Any nucleic acid may comprise one or more phosphorothioate (PS) modifications within the nucleic acid, such as at least two PS internucleoside bonds at the ends of a strand.

[0219] At least one of the oligoribonucleoside strands preferably comprises at least two consecutive phosphorothioate modifications in the last 3 nucleosides of the oligonucleoside.

[0220] The invention therefore also relates to: A nucleic acid disclosed herein which comprises phosphorothioate internucleoside linkages respectively between at least two or three consecutive positions, such as in a 5' and / or 3' terminal region and / or near terminal region of the second strand, whereby said near terminal region is preferably adjacent said terminal region wherein said one or more abasic nucleosides of said second strand is / are located.

[0221] A nucleic acid disclosed herein which comprises phosphorothioate internucleoside linkages respectively between at least two or three consecutive positions in a 5' and / or 3' terminal region of the first strand, whereby preferably the terminal position at the 5' and / or 3' terminal region of said first strand is attached to its adjacent position by a phosphorothioate internucleoside linkage.

[0222] The nucleic acid strand may be an RNA comprising a phosphorothioate internucleoside linkage between the three nucleosides contiguous with 2 terminally located abasic nucleosides.

[0223] A preferred nucleic acid is a double stranded RNA comprising 2 adjacent abasic nucleosides at the 5' terminus of the second strand and a ligand moiety comprising one or more GalNAc ligand moieties at the opposite 3' end of the second strand. Further preferred, the same nucleic acid may also comprise a phosphorothioate bond between nucelotides at positions 3-4 and 4-5 of the second strand, reading from the position 1 of the second strand. Further preferred, the same nucleic acid may also comprise a 2' F modification at positions 7, 9 and 11 of the second strand.

[0224] Preferred modifications of nucleic acids having the structure are as follows:

[0225] A nucleic acid wherein modified nucleosides of the first strand have a modification pattern according to (5'-3'): Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me.

[0226] A nucleic acid wherein modified nucleosides of said second strand have a modification pattern according to (5'-3'): F(s)Me(s)F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F, or F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F(s)Me(s)F; wherein (s) is a phosphorothioate internucleoside linkage.

[0227] A nucleic acid wherein modified nucleosides of the second strand have a modification pattern according to (5'-3'): F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F.

[0228] A nucleic acid wherein modified nucleosides of said second strand have a modification pattern according to (5'-3'): F(s)Me(s)F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F, or F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F(s)Me(s)F; wherein (s) is a phosphorothioate internucleoside linkage.

[0229] A nucleic acid wherein modified nucleosides of said second strand have a modification pattern according to (5'-3'): ia - ia - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F, or F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - ia - ia; wherein ia represents an inverted abasic nucleoside. In certain embodiments, the inverted abasic nucleosides as represented by ia - ia are present in a 2 nucleoside overhang.

[0230] A nucleic acid wherein modified nucleosides of said second strand have a modification pattern according to any one of the following (5'-3'): ia - ia - F(s)Me(s)F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F, or F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me - F - Me(s)F(s)ia - ia; wherein (s) is a phosphorothioate internucleoside linkage and ia represents an inverted abasic nucleoside. In certain embodiments, the inverted abasic nucleosides as represented by ia - ia are present in a 2 nucleoside overhang.

[0231] Preferred modifications of nucleic acids having the structure are as follows: A nucleic acid wherein modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5'-3'): Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, or Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me.

[0232] A nucleic acid wherein modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5'-3'): Me(s)Me(s)Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, or Me(s)Me(s)Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me(s)Me(s)Me - Me - Me - Me -F-Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F(s)Me(s)Me, or Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, or Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, wherein (s) is a phosphorothioate internucleoside linkage.

[0233] A nucleic acid wherein modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, or ia - ia - Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or ia - ia - Me - Me - Me - Me - Me - Me -F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or ia - ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, or ia - ia - Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me - ia - ia, or Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - ia - ia, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - ia - ia, or Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me - ia - ia, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me- ia - ia, wherein ia represents an inverted abasic nucleoside, and when the inverted abasic nucleosides as represented by ia - ia are present at the 3' terminus of the second strand, said inverted abasic nucleosides are present in a 2 nucleoside overhang.

[0234] A nucleic acid wherein modified nucleosides of said second strand comprise a modification pattern according to any one of the following (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, or ia - ia - Me(s)Me(s)Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or ia - ia - Me(s)Me(s)Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, or ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, or ia - ia - Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, or Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F(s)Me(s)Me - ia - ia, or Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia, or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia, or Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia , or Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia, wherein: (s) is a phosphorothioate internucleoside linkage, ia represents an inverted abasic nucleoside, and when the inverted abasic nucleosides as represented by ia - ia are present at the 3' terminus of the second strand, said inverted abasic nucleosides are present in a 2 nucleoside overhang.

[0235] A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 2: Second strand (5'-3'): Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 3: Second strand (5'-3'): Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me- Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 4: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me- Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 5: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 6: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me.

[0236] A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5'-3'): Me(s)Me(s)Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 2: Second strand (5'-3'): Me(s)Me(s)Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 3: Second strand (5'-3'): Me(s)Me(s)Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 4: Second strand (5'-3'): Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 5: Second strand (5'-3'): Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 6: Second strand (5'-3'): Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me wherein (s) is a phosphorothioate internucleoside linkage.

[0237] A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F(s)Me(s)Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 2: Second strand (5'-3'): Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 3: Second strand (5'-3'): Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 4: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 5: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 6: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me wherein (s) is a phosphorothioate internucleoside linkage.

[0238] A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 2: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 3: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 4: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 5: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 6: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me, wherein ia represents an inverted abasic nucleoside.

[0239] A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me - ia - ia, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 2: Second strand (5'-3'): Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - ia - ia, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 3: Second strand (5'-3'): Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - ia - ia, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 4: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - ia - ia, First strand (5'-3'): Me - F - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 5: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me - ia - ia, First strand (5'-3'): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me Or Modification pattern 6: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me - ia - ia,- First strand (5'-3'): Me - F - Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me, wherein ia represents an inverted abasic nucleoside, and when the inverted abasic nucleosides as represented by ia - ia are present at the 3' terminus of the second strand, said inverted abasic nucleosides are present in a 2 nucleoside overhang.

[0240] A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 2: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 3: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me -F-Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 4: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 5: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 6: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me wherein: (s) is a phosphorothioate internucleoside linkage, ia represents an inverted abasic nucleoside.

[0241] A nucleic acid wherein modified nucleosides comprise any one of the following modification patterns: Modification pattern 1: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - F - F - F - F - Me - Me - Me - Me - Me - Me - Me - F(s)Me(s)Me - ia - ia, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 2: Second strand (5'-3'): Me - Me - Me - Me - Me - F - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 3: Second strand (5'-3'): Me - Me - Me - Me - Me - Me -F- Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 4: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - F - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 5: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me Or Modification pattern 6: Second strand (5'-3'): Me - Me - Me - Me - Me - Me - F - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me(s)Me(s)Me - ia - ia, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me wherein: (s) is a phosphorothioate internucleoside linkage, ia represents an inverted abasic nucleoside, and when the inverted abasic nucleosides as represented by ia - ia are present at the 3' terminus of the second strand, said inverted abasic nucleosides are present in a 2 nucleoside overhang.

[0242] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, provided that the overall number of 2'F sugar modifications in the first strand does not consist of four, or six, 2'F modifications.

[0243] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, wherein the overall number of 2'F sugar modifications in the first strand consists of three, five or seven 2'F modifications.

[0244] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, wherein the overall number of 2'F sugar modifications in the first strand consists of three 2'F modifications.

[0245] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, wherein the overall number of 2'F sugar modifications in the first strand consists of five 2'F modifications.

[0246] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - Me - X 2 - Me - F - (Me) 7 - (F - Me) 2 - X 3 - Me - X 4 - (Me) 3 wherein X 2 , X 3 and X 4 are selected from 2'Me and 2'F sugar modifications, provided that for X 2 , X 3 and X 4 at least one is a 2'F sugar modification, and the other two sugar modifications are 2'Me sugar modifications.

[0247] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - Me - X 2 - Me - F - (Me) 7 - (F - Me) 2 - X 3 - Me - X 4 - (Me) 3 wherein X 2 is a 2'F sugar modification, and X 3 and X 4 are 2'Me sugar modifications.

[0248] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - Me - X 2 - Me - F - (Me) 7 - (F - Me) 2 - X 3 - Me - X 4 - (Me) 3 wherein X 3 is a 2'F sugar modification, and X 2 and X 4 are 2'Me sugar modifications.

[0249] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - Me - X 2 - Me - F - (Me) 7 - (F - Me) 2 - X 3 - Me - X 4 - (Me) 3 wherein X 4 is a 2'F sugar modification, and X 2 and X 3 are 2'Me sugar modifications.

[0250] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, wherein the overall number of 2'F sugar modifications in the first strand consists of seven 2'F modifications.

[0251] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - Me - X 2 - Me - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - X 3 - Me - X 4 - (Me) 3 wherein X 2 , X 3 and X 4 are selected from 2'Me and 2'F sugar modifications, provided that for X 2 , X 3 and X 4 at least one is a 2'F sugar modification, and the other two sugar modifications are 2'Me sugar modifications.

[0252] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - Me - X 2 - Me - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - X 3 - Me - X 4 - (Me) 3 wherein X 2 is a 2'F sugar modification, and X 3 and X 4 are 2'Me sugar modifications.

[0253] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - Me - X 2 - Me - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - X 3 - Me - X 4 - (Me) 3 wherein X 3 is a 2'F sugar modification, and X 2 and X 4 are 2'Me sugar modifications.

[0254] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - Me - X 2 - Me - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - X 3 - Me - X 4 - (Me) 3 wherein X 4 is a 2'F sugar modification, and X 2 and X 3 are 2'Me sugar modifications.

[0255] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - X 1 - (Me) 7 - F - Me - F - (Me) 7 wherein X 1 is a thermally destabilising modification.

[0256] A nucleic acid wherein the first strand comprises a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - X 1 - Me - (F) 2 - (Me) 4 - F - Me - F - (Me) 7 wherein X 1 is a thermally destabilising modification.

[0257] A nucleic acid wherein the second strand comprises a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 .

[0258] A nucleic acid wherein the second strand comprises a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, provided that the overall number of 2'F sugar modifications in the first strand does not consist of four, or six, 2'F modifications.

[0259] A nucleic acid wherein the second strand comprises a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, wherein the overall number of 2'F sugar modifications in the first strand consists of three, five or seven 2'F modifications.

[0260] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'): Me - F - (Me) 3 - X 1 - (Me) 7 - F - Me - F - (Me) 7 , wherein X 1 is a thermally destabilising modification.

[0261] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me - F) 3 - (Me) 7 - F - Me - F - (Me) 7 .

[0262] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - F - (Me) 7 - (F - Me) 2 - F - (Me) 5 .

[0263] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - F - (Me) 7 - F - Me - F - (Me) 3 - F - (Me) 3 .

[0264] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'): Me - F - (Me) 3 - X 1 - Me - (F) 2 - (Me) 4 - F - Me - F - (Me) 7 , wherein X 1 is a thermally destabilising modification.

[0265] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me - F) 3 - Me - (F) 2 - (Me) 4 - (F - Me) 2 - (Me) 6 .

[0266] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - F - (Me) 5 .

[0267] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me) 8 - (F) 3 - (Me) 10 , and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - (Me) 2 - F - (Me) 3 .

[0268] A nucleic acid wherein the second strand comprises a 2' sugar, and abasic modification pattern as follows (5'-3'):         ia-ia-(Me) 8 - (F) 3 - (Me) 10 wherein ia represents an inverted abasic nucleoside.

[0269] A nucleic acid wherein the second strand comprises a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, provided that the overall number of 2'F sugar modifications in the first strand does not consist of four, or six, 2'F modifications.

[0270] A nucleic acid wherein the second strand comprises a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, wherein the overall number of 2'F sugar modifications in the first strand consists of three, five or seven 2'F modifications.

[0271] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'): Me - F - (Me) 3 - X 1 - (Me) 7 - F - Me - F - (Me) 7 , wherein X 1 is a thermally destabilising modification.

[0272] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me - F) 3 - (Me) 7 - F - Me - F - (Me) 7 .

[0273] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - F - (Me) 7 - (F - Me) 2 - F - (Me) 5 .

[0274] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - F - (Me) 7 - F - Me - F - (Me) 3 - F - (Me) 3 .

[0275] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - X 1 - Me - (F) 2 - (Me) 4 - F - Me - F - (Me) 7 , wherein X 1 is a thermally destabilising modification.

[0276] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         (Me - F) 3 - Me - (F) 2 - (Me) 4 - (F - Me) 2 - (Me) 6 .

[0277] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - F - (Me) 5 .

[0278] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-(Me) 8 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside; and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me - F - (Me) 3 - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - (Me) 2 - F - (Me) 3 .

[0279] A nucleic acid wherein the second strand comprises a 2' sugar modification pattern as follows (5'-3'):         ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage.

[0280] A nucleic acid wherein the second strand comprises a 2' sugar modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage; and wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, provided that the overall number of 2'F sugar modifications in the first strand does not consist of four, or six, 2'F modifications.

[0281] A nucleic acid wherein the second strand comprises a 2' sugar modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage; and wherein the first strand comprises a 2' sugar modification pattern wherein said modifications are selected at least from 2'Me and 2'F sugar modifications, wherein the overall number of 2'F sugar modifications in the first strand consists of three, five or seven 2'F modifications.

[0282] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'): Me(s)F(s)(Me) 3 - X 1 - (Me) 7 - F - Me - F - (Me) 5 (s)Me(s)Me, wherein X 1 is a thermally destabilising modification.

[0283] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me(s)F(s)Me - F - Me - F - (Me) 7 - F - Me - F - (Me) 5 (s)Me(s)Me.

[0284] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me(s)F(s)(Me) 3 - F - (Me) 7 - (F - Me) 2 - F - (Me) 3 (s)Me(s)Me.

[0285] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me(s)F(s)(Me) 3 - F - (Me) 7 - F - Me - F - (Me) 3 - F - Me(s)Me(s)Me.

[0286] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'): Me(s)F(s)(Me) 3 - X 1 - Me - (F) 2 - (Me) 4 - F - Me - F - (Me) 5 (s)Me(s)Me, wherein X 1 is a thermally destabilising modification.

[0287] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me(s)F(s)Me - F - Me - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - (Me) 4 (s)Me(s)Me.

[0288] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me(s)F(s)(Me) 3 - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - F - (Me) 3 (s)Me(s)Me.

[0289] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein said first and second strands form a duplex region of at least 17 nucleosides in length, and wherein nucleosides of said second strand comprise a 2' sugar, and abasic modification pattern as follows (5'-3'): ia-ia-Me(s)Me(s) (Me) 6 - (F) 3 - (Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate linkage, and wherein nucleosides of said first strand comprise a 2' sugar modification pattern as follows (5'-3'):         Me(s)F(s)(Me) 3 - F - Me - (F) 2 - (Me) 4 - (F - Me) 2 - (Me) 2 - F - Me(s)Me(s)Me.

[0290] Preferred modifications are as follows: Modification pattern 1: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - X 1 - Me - Me - Me - Me - Me - Me - Me - F-Me - F - Me - Me - Me - Me - Me - Me - Me, wherein X 1 is a thermally destabilising modification; Or Modification pattern 2: Second strand (5'-3'): ia - ia -Me - Me -Me - Me - Me -Me- Me - Me - F -F -F -Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me; Or Modification pattern 3: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me -Me - Me - F - Me - Me - Me -Me - Me - Me - Me -F - Me - F - Me - F - Me - Me - Me - Me - Me; Or Modification pattern 4: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - F - Me - Me - Me; Or Modification pattern 5: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - X 1 - Me -F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me, wherein X 1 is a thermally destabilising modification; Or Modification pattern 6: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me; Or Modification pattern 7: Second strand (5'-3'): ia - ia - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - F - Me - Me - Me - Me - Me; Or Modification pattern 8: Second strand (5'-3'): ia - ia -Me - Me -Me - Me - Me -Me- Me - Me - F -F -F -Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me - F - Me - Me - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - F - Me - Me - Me.

[0291] Particularly preferred modifications are as follows: Modification pattern 1: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - X 1 - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me, wherein X 1 is a thermally destabilising modification; Or Modification pattern 2: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me; Or Modification pattern 3: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - F - Me - Me - Me(s)Me(s)Me; Or Modification pattern 4: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - Me - Me - Me - Me - Me - Me - F - Me - F - Me - Me - Me - F - Me(s)Me(s)Me; Or Modification pattern 5: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - X 1 - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me, wherein X 1 is a thermally destabilising modification; Or Modification pattern 6: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - F - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - Me - Me(s)Me(s)Me; Or Modification pattern 7: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - F - Me - Me - Me(s)Me(s)Me; Or Modification pattern 8: Second strand (5'-3'): ia - ia - Me(s)Me(s)Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me - Me, First strand (5'-3'): Me(s)F(s)Me - Me - Me - F - Me - F - F - Me - Me - Me - Me - F - Me - F - Me - Me - Me - F - Me(s)Me(s)Me; wherein (s) is a phosphorothioate internucleoside linkage. CONJUGATION OF NUCLEIC ACID TO LIGAND

[0292] Another modification of a nucleic acid e.g. RNA e.g. an siRNA of the invention involves linking the nucleic acid e.g. the siRNA to one or more ligand moieties e.g. to enhance the activity, cellular distribution, or cellular uptake of the nucleic acid e.g. siRNA e.g., into a cell.

[0293] In some embodiments, the ligand moiety described can be attached to a nucleic acid e.g. an siRNA oligonucleoside, via a linker that can be cleavable or non-cleavable. The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound.

[0294] The ligand can be attached to the 3' or 5' end of the sense strand.

[0295] The ligand is preferably conjugated to 3' end of the sense strand of the nucleic acid e.g. an siRNA agent.

[0296] The invention therefore relates in a further aspect to a conjugate for inhibiting expression of a target e.g. a target gene, in a cell, said conjugate comprising a nucleic acid portion and one or more ligand moieties, said nucleic acid portion comprising a nucleic acid as disclosed herein.

[0297] In one aspect the second strand of the nucleic acid is conjugated directly or indirectly (e.g. via a linker) to the one or more ligand moiety(s), wherein said ligand moiety is typically present at a terminal region of the second strand, preferably at the 3' terminal region thereof.

[0298] In certain embodiments, the ligand moiety comprises a GalNAc or GalNAc derivative attached to the nucleic acid e.g. dsiRNA through a linker.

[0299] Therefore, the invention relates to a conjugate wherein the ligand moiety comprises i) one or more GalNAc ligands; and / or ii) one or more GalNAc ligand derivatives; and / or iii) one or more GalNAc ligands conjugated to said nucleic acid through a linker.

[0300] Said GalNAc ligand may be conjugated directly or indirectly to the 5' or 3' terminal region of the second strand of the nucleic acid, preferably at the 3' terminal region thereof.

[0301] GalNAc ligands are well known in the art and described in, inter alia, EP3775207A1.

[0302] In some embodiments, the ligand moiety comprises one or more ligands.

[0303] In some embodiments, the ligand moiety comprises one or more carbohydrate ligands.

[0304] In some embodiments, the one or more carbohydrates can be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and / or polysaccharide.

[0305] In some embodiments, the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-AcetylGalactosamine moieties, and / or one or more mannose moieties.

[0306] In some embodiments, the one or more carbohydrates comprise one or more N-AcetylGalactosamine moieties.

[0307] In some embodiments, the compounds as described anywhere herein comprise two or three N-AcetylGalactosamine moieties.

[0308] In some embodiments, the one or more ligands are attached in a linear configuration, or in a branched configuration, for example each configuration being respectively attached to a branch point in an overall linker.

[0309] Exemplary linear configurations and Exemplary branched configurations are shown in Figures 1a and 1b: In Fig 1a, (linear), (a) and / or (b) can typically represent connecting bonds or groups, such as phosphate or phosphorothioate groups.

[0310] In Fig 1b, (branched), in some embodiments, the one or more ligands are attached as a biantennary or triantennary branched configuration. Typically, a triantennary branched configuration can be preferred, such as an N-AcetylGalactosamine triantennary branched configuration.Linker

[0311] Exemplary compounds of the invention comprise a 'linker moiety', such as that as depicted in Formula (I), that is part of an overall 'linker'. wherein: R 1 at each occurrence is independently selected from the group consisting of hydrogen, methyl and ethyl; R 2 is selected from the group consisting of hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halo and nitro; X 1 and X 2 at each occurrence are independently selected from the group consisting of methylene, oxygen and sulfur; m is an integer of from 1 to 6; n is an integer of from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; and (ii) s, t and v cannot all be 0 at the same time; Z is an oligonucleoside moiety.

[0312] As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleoside moiety and the ligand moiety of these compounds. The overall linker, thereby 'links' the oligonucleoside moiety and the ligand moiety to each other.

[0313] The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the 'linker moiety' as represented in Formula (I) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleoside moiety. The linker moiety as depicted in Formula (I) can also often be referred to as the 'ligand arm or arms' of the overall linker. There can also, but not always, be a further linker portion between the oligonucleoside moiety and the branch point, that is often referred to as the 'tether moiety' of the overall linker, 'tethering' the oligonucleoside moiety to the remainder of the conjugated compound. Such 'ligand arms' and / or 'linker moieties' and / or 'tether moieties' can be envisaged by reference to the linear and / or branched configurations as set out above.

[0314] As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleoside chemist.

[0315] The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a 'tether moiety' as hereinbefore described, wherein the 'tether moiety' is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety as depicted in Formula (I).Tether moiety of Formula I

[0316] In relation to Formula (I), the 'tether moiety' comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety.

[0317] In some embodiments, R 1 is hydrogen at each occurrence. In some embodiments, R 1 is methyl. In some embodiments, R 1 is ethyl.

[0318] In some embodiments, R 2 is hydroxy. In some embodiments, R 2 is halo. In some embodiments, R 2 is fluoro. In some embodiments, R 2 is chloro. In some embodiments, R 2 is bromo. In some embodiments, R 2 is iodo. In some embodiments, R 2 is nitro.

[0319] In some embodiments, X 1 is methylene. In some embodiments, X 1 is oxygen. In some embodiments, X 1 is sulfur.

[0320] In some embodiments, X 2 is methylene. In some embodiments, X 2 is oxygen. In some embodiments, X 2 is sulfur.

[0321] In some embodiments, m = 3.

[0322] In some embodiments, n = 6.

[0323] In some embodiments, X 1 is oxygen and X 2 is methylene. In some embodiments, both X 1 and X 2 are methylene.

[0324] In some embodiments, q = 1, r = 2, s = 1, t = 1, v = 1. In some embodiments, q = 1, r = 3, s = 1, t = 1, v = 1.

[0325] In some embodiments, R 1 is hydrogen at each occurrence, n = 6, m = 3, R 2 is fluoro, X 2 is methylene, v = 1, t = 1, s = 1, X 1 is methylene, q = 1 and r = 2.

[0326] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure:

[0327] In some embodiments, R 1 is hydrogen at each occurrence, n = 6, m = 3, R 2 is fluoro, X 2 is methylene, v = 1, t = 1, s = 1, X 1 is oxygen, q = 1 and r = 2.

[0328] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Alternative tether moieties

[0329] During the synthesis of compounds of the present invention, alternative tether moiety structures may arise. In some embodiments, alternative tether moieties have a change of one or more atoms in the tether moiety of the overall linker compared to tether moieties described anywhere herein.

[0330] In some embodiments, the alternative tether moiety is a compound of Formula (I) as described anywhere herein, wherein R 2 is hydroxy.

[0331] In some embodiments, R 1 is hydrogen at each occurrence, n = 6, m = 3, R 2 is hydroxy, X 2 is methylene, v = 1, t = 1, s = 1, X 1 is methylene, q = 1 and r = 2.

[0332] Thus, in some embodiments, compounds of the invention comprise the following structure:

[0333] In some embodiments, R 1 is hydrogen at each occurrence, n = 6, m = 3, R 2 is hydroxy, X 2 is methylene, v = 1, t = 1, s = 1, X 1 is oxygen, q = 1 and r = 2.

[0334] Thus, in some embodiments, compounds of the invention comprise the following structure: Linker moiety

[0335] In relation to Formula (I), the 'linker moiety' as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein.

[0336] In some embodiments: as depicted in Formula (I) as described anywhere herein is any of Formulae (VIa), (VIb) or (VIc), preferably Formula (VIa): wherein: A 1 is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; or wherein: A I is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and c and d are independently integers of 1 to 6; or wherein: A I is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10.

[0337] In some embodiments, the moiety: as depicted in Formula (I) is Formula (VIa): wherein: A I is hydrogen, or a suitable hydroxy protecting group; a is 3; and b is an integer of 3.

[0338] In some embodiments, the moiety: as depicted in Formula (I) as described anywhere herein is Formula (VII): wherein: A I is hydrogen; a is an integer of 2 or 3, preferably 3.

[0339] Other exemplary compounds of the invention comprise a 'linker moiety', as depicted in Formula (I*), that is part of an overall 'linker'.

[0340] Where: r and s are independently an integer selected from 1 to 16; and Z is an oligonucleoside moiety.

[0341] As will be further understood in the art, exemplary compounds of the invention comprise an overall linker that is located between the oligonucleoside moiety and the ligand moiety of these compounds. The overall linker, thereby 'links' the oligonucleoside moiety and the ligand moiety to each other.

[0342] The overall linker is often notionally envisaged as comprising one or more linker building blocks. For example, there is a linker portion that is depicted as the 'linker moiety' as represented in Formula (I*) positioned adjacent the ligand moiety and attaching the ligand moiety, typically via a branch point, directly or indirectly to the oligonucleoside moiety. The linker moiety as depicted in Formula (I*) can also often be referred to as the 'ligand arm or arms' of the overall linker. There can also, but not always, be a further linker portion between the oligonucleoside moiety and the branch point, that is often referred to as the 'tether moiety' of the overall linker, 'tethering' the oligonucleoside moiety to the remainder of the conjugated compound. Such 'ligand arms' and / or 'linker moieties' and / or 'tether moieties' can be envisaged by reference to the linear and / or branched configurations as set out above.

[0343] As can be seen from the claims, and the reminder of the patent specification, the scope of the present invention extends to linear or branched configurations, and with no limitation as to the number of individual ligands that might be present. Furthermore, the addressee will also be aware that there are many structures that could be used as the linker moiety, based on the state of the art and the expertise of an oligonucleoside chemist.

[0344] The remainder of the overall linker (other than the linker moiety) as set out in the claims, and the remainder of the patent specification, is shown by its chemical constituents in Formula (I), which the inventors consider to be particularly unique to the current invention. In more general terms, however, these chemical constituents could be described as a 'tether moiety' as hereinbefore described, wherein the 'tether moiety' is that portion of the overall linker which comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety as depicted in Formula (I).Tether moiety

[0345] In relation to Formula (I*), the 'tether moiety' comprises the group of atoms between Z, namely the oligonucleoside moiety, and the linker moiety.

[0346] In some embodiments, s is an integer selected from 4 to 12. In some embodiments, s is 6.

[0347] In some embodiments, r is an integer selected from 4 to 14. In some embodiments, r is 6. In some embodiments, r is 12.

[0348] In some embodiments, r is 12 and s is 6.

[0349] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure:

[0350] In some embodiments, r is 6 and s is 6.

[0351] Thus, in some embodiments, exemplary compounds of the invention comprise the following structure: Linker moiety

[0352] In relation to Formula (I*), the 'linker moiety' as depicted in Formula (I) comprises the group of atoms located between the tether moiety as described anywhere herein, and the ligand moiety as described anywhere herein.

[0353] In some embodiments, the moiety: as depicted in Formula (I*) as described anywhere herein is any of Formulae (IV*), (V*) or (VI*), preferably Formula (IV*): wherein: A I is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and b is an integer of 2 to 5; or wherein: A I is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and c and d are independently integers of 1 to 6; or wherein: A I is hydrogen, or a suitable hydroxy protecting group; a is an integer of 2 or 3; and e is an integer of 2 to 10.

[0354] In some embodiments, the moiety: as depicted in Formula (I) is Formula (VIa*): wherein: A I is hydrogen, or a suitable hydroxy protecting group; a is 3; and b is an integer of 3.

[0355] In some embodiments, the moiety: as depicted in Formula (I) as described anywhere herein is Formula (VII*): wherein: A I is hydrogen; a is an integer of 2 or 3.

[0356] In some embodiments, a = 2. In some embodiments, a = 3. In some embodiments, b = 3.VECTOR AND CELL

[0357] In one aspect, the disclosure provides a cell containing a nucleic acid, such as inhibitory RNA [RNAi] as described herein.

[0358] In one aspect, the disclosure provides a cell comprising a vector as described herein.

[0359] In one aspect the disclosure provides a vector comprising an oligonucleotide inhibitor, e.g.an iRNA e.g. siRNA.PHARMACEUTICALLY ACCEPTABLE COMPOSITIONS

[0360] In one aspect, the invention provides a pharmaceutical composition for inhibiting expression of a target gene, the composition comprising an inhibitor such as an oligomer such as a nucleic acid as disclosed herein.

[0361] The pharmaceutically acceptable composition may comprise an excipient and or carrier.

[0362] Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen- free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or poly anhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.

[0363] Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g. , magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g. , starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

[0364] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

[0365] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non- parenteral administration which do not deleteriously react with nucleic acids can be used.

[0366] In one embodiment, the nucleic acid or composition is administered in an unbuffered solution. In certain embodiments, the unbuffered solution is saline or water. In other embodiments, the nucleic acid e.g. RNAi agent is administered in a buffered solution. In such embodiments, the buffer solution can comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. For example, the buffer solution can be phosphate buffered saline (PBS).DOSAGES

[0367] The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a gene or disclosed herein modify the expression or function of a target such as an LNCRNA. In general, where the composition comprising a nucleic acid, a suitable dose of a nucleic acid e.g. an siRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of a nucleic acid e.g. an siRNA of the invention will be in the range of about 0.1 mg / kg to about 5.0 mg / kg, e.g., about 0.3 mg / kg and about 3.0 mg / kg.

[0368] A repeat-dose regimen may include administration of a therapeutic amount of a nucleic acid e.g. siRNA on a regular basis, such as every other day or once a year. In certain embodiments, the nucleic acid e.g. siRNA is administered about once per month to about once per quarter (i.e., about once every three months).

[0369] In various embodiments, the nucleic acid e.g. siRNA agent is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg. In some embodiments, the nucleic acid e.g. siRNA agent is administered at a dose of about 10 mg / kg to about 30 mg / kg. In certain embodiments, the nucleic acid e.g. siRNA agent is administered at a dose selected from about 0.5 mg / kg 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg. In certain embodiments, the nucleic acid e.g. siRNA agent is administered about once per week, once per month, once every other two months, or once a quarter (i.e., once every three months) at a dose of about 0.1 mg / kg to about 5.0 mg / kg. In certain embodiments, the nucleic acid e.g. siRNA agent is administered to the subject once a week. In certain embodiments, the nucleic acid e.g.

[0370] siRNA agent is administered to the subject once a month. In certain embodiments, the nucleic acid e.g. siRNA agent is administered once per quarter (i.e., every three months).

[0371] After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration weekly or biweekly for three months, administration can be repeated once per month, for six months, or a year; or longer.

[0372] The pharmaceutical composition can be administered once daily, or administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the nucleic acid e.g. siRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the nucleic acid e.g. siRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0373] In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per week. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered bimonthly. In certain embodiments, the siRNA is administered about once per month to about once per quarter (i.e., about once every three months), or even every 6 months or 12 months.

[0374] Estimates of effective dosages and in vivo half-lives for the individual nucleic acid e.g. siRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as known in the art.

[0375] The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g. , by intraparenchymal, intrathecal or intraventricular administration. In certain preferred embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection.

[0376] In one embodiment, the nucleic acid e.g. siRNA agent is administered to the subject subcutaneously.

[0377] The inhibitor e.g. nucleic acid e.g. siRNA can be delivered in a manner to target a particular tissue (e.g. in particular liver cells).METHODS FOR INHIBITING GENE EXPRESSION OR INHIBITION OF TARGET EXPRESSION OR FUNCTION

[0378] The present disclosure also provides methods of inhibiting expression of a gene in a cell and methods for inhibiting expression and / or function of other target molecules such as LNCRNA. The methods include contacting a cell with a nucleic acid of the invention e.g. siRNA agent, such as double stranded siRNA agent, in an amount effective to inhibit expression of the gene in the cell, thereby inhibiting expression of the gene in the cell. In a preferred embodiment, the gene encodes an enzyme that is involved in post-translational glycosylation. In a more preferred embodiment, the gene is B4GALT1. Said methods are not part of the claimed invention.

[0379] Contacting of a cell with the inhibitor e.g. the nucleic acid e.g. an siRNA, such as a double stranded siRNA agent, may be done in vitro or in vivo. Contacting a cell in vivo with the inhibitor nucleic acid e.g. siRNA includes contacting a cell or group of cells within a subject, e.g., a human subject, with the nucleic acid e.g. siRNA. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand moiety, including any ligand moiety described herein or known in the art. In preferred embodiments, the targeting ligand moiety is a carbohydrate moiety, e.g. a GalNAc3 ligand, or any other ligand moiety that directs the siRNA agent to a site of interest.

[0380] The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating", "suppressing", and other similar terms, and includes any level of inhibition.

[0381] In some embodiments of the methods of the disclosure, expression or activity of a gene or an inhibition target such as a LNCRNA is inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay, preferably when determined by qPCR as described herein and / or when the siRNA is introduced into the target cell by transfection. In certain embodiments, the methods include a clinically relevant inhibition of expression of a target gene e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of the gene and / or activity of the target.

[0382] In some embodiments, when transfected into the cells, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an IC50 value lower than 2500 pM, 2400 pM, 2300 pM, 2200 pM, 2100 pM, 2000 pM, 1900 pM, 1800 pM, 1700 pM, 1600 pM, 1500 pM, 1400 pM, 1300 pM, 1200 pM, 1100 pM, 1000 pM, 900 pM, 800 pM, 700 pM, 600 pM, 500 pM, 400 pM, 300 pM, 200 pM or 100 pM, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0383] In a preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an IC50 value lower than 2500 pM. In a more preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an IC50 value lower than 1000 pM. In an even more preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an IC50 value lower than 500 pM. In a most preferred embodiment, when transfected into the cells, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an IC50 value lower than 100 pM.

[0384] Inhibition of expression of the B4GALT1 gene may be quantified using the following method: Huh7 cells (human hepatocyte-derived cell line, obtained from JCRB Cell Bank) may be maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS at 37°C in an atmosphere of 5% CO2. Cells may then be transfected with siRNA duplexes targeting B4GALT1 mRNA or a negative control siRNA (siRNA-control; sense strand 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO:623), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO:622)) using 10x3-fold serial dilutions over a final duplex concentration range of 20 nM to 1 pM. Transfection may be carried out by adding 9.7 µL Opti-MEM (ThermoFisher) plus 0.3 µL Lipofectamine RNAiMAX (ThermoFisher) to 10 µL of each siRNA duplex. The mixture may be incubated at room temperature for 15 minutes before being added to 100 µL of complete growth medium containing 20,000 Huh7 cells. Cells may be incubated for 24 hours at 37°C / 5% CO2 prior to total RNA purification using a RNeasy 96 Kit (Qiagen). Each duplex may be tested by transfection in duplicate wells in a single experiment.

[0385] cDNA synthesis may be performed using FastQuant RT (with gDNase) Kit (Tiangen). Real-time quantitative PCR (qPCR) may be performed on an ABI Prism 7900HT or ABI QuantStudio 7 with primers specific for human B4GALT1 (Hs00155245_m1) and human GAPDH (Hs02786624_g1) using a TaqMan Gene Expression Assay Kit (ThermoFisher Scientific).

[0386] qPCR may be performed in duplicate on cDNA derived from each well and the mean cycle threshold (Ct) calculated. Relative B4GALT1 expression may be calculated from mean Ct values using the comparative Ct (ΔΔCt) method, normalised to GAPDH and relative to untreated cells. Maximum percent inhibition of B4GALT1 expression and IC50 values may be calculated using a four parameter (variable slope) model using GraphPad Prism 9.

[0387] Alternatively or in addition, the inhibitory potential of a nucleic acid of the invention may be quantified without prior transfection of a target cell with said nucleic acid.

[0388] Thus, in some embodiments, when cells are incubated with a nucleic acid of the invention, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an EC50 value lower than 1000 nM, 900 nM, 800 nM, 700 nM, 600 nM, 500 nM, 400 nM, 300 nM, 200 nM, or 100 nM, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0389] In a preferred embodiment, when cells are incubated with a nucleic acid of the invention, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an EC50 value lower than 1000 nM. In a more preferred embodiment, when cells are incubated with a nucleic acid of the invention, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an EC50 value lower than 500 nM. In an even more preferred embodiment, when cells are incubated with a nucleic acid of the invention, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an EC50 value lower than 200 nM. In a most preferred embodiment, when cells are incubated with a nucleic acid of the invention, the nucleic acid of the invention inhibits expression of the B4GALT1 gene with an EC50 value lower than 100 nM.

[0390] Inhibition of expression of the B4GALT1 gene in the presence of free nucleic acids may be quantified using the following method: Primary C57BL / 6 mouse hepatocytes (PMHs) may be isolated fresh by two-step collagenase liver perfusion. Cells may be maintained in DMEM (Gibco-11995-092) supplemented with FBS, Penicillin / Streptomycin, HEPES and L-glutamine. Cells may be cultured at 37°C in an atmosphere with 5% CO 2 in a humidified incubator. Within 2 hours post isolation, PMHs may be seeded at a density of 36,000 cells / well in regular 96-well tissue culture plates. Dose response analysis in PMHs may be done by direct incubation of cells in a gymnotic free uptake setting with final GalNAc-siRNA concentrations of 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9, 1.95 nM. In control wells, cells may be incubated without GalNAc-siRNA. After 48hr incubation, cells may be harvested for RNA extraction. Total RNA may be extracted using RNeasy Kit following the manufacturer's instructions (Qiagen, Shanghai, China). After reverse transcription, real-time quantitative PCR may be performed using an ABI Prism 7900HT to detect the relative abundance of B4GALT1 mRNA normalized to the housekeeping gene GAPDH. The expression of the target gene in each test sample may be determined by relative quantitation using the comparative Ct (ΔΔCt) method. This method measures the Ct differences (ΔCt) between target gene and housekeeping gene. The formula is as follows: ΔCt = average Ct of B4GALT1 -average Ct of GAPDH, ΔΔCt=ΔCt (sample) - average ΔCt (untreated control), relative expression of target gene mRNA = 2 -ΔΔCt< .

[0391] Alternatively or in addition, inhibition of expression of the B4GALT1 gene may be characterized by a reduction of mean relative expression of the B4GALT1 gene.

[0392] In some embodiments, when cells are transfected with 0.1 nM of the nucleic acid of the invention, the mean relative expression of B4GALT1 is below 1, 0.9, 0.8, 0.7, 0.6, 0.5, or 0.4, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0393] In some embodiments, when cells are transfected with 5 nM of the nucleic acid of the invention, the mean relative expression of B4GALT1 is below 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4 or 0.3, preferably when determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0394] Mean relative expression of the B4GALT1 gene may be quantified using the following method: Huh7 cells (human hepatocyte-derived cell line, obtained from JCRB Cell Bank) may be maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS at 37°C in at atmosphere of 5% CO 2 . Cells may be transfected with siRNA duplexes targeting B4GALT1 mRNA or a negative control siRNA (siRNA-control; sense strand 5'-UUCUCCGAACGUGUCACGUTT-3'(SEQ ID NO:623), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO:622)) at a final duplex concentration of 5 nM and 0.1 nM. Transfection may be carried out by adding 9.7 µL Opti-MEM (ThermoFisher) plus 0.3 µL Lipofectamine RNAiMAX (ThermoFisher) to 10 µL of each siRNA duplex. The mixture may be incubated at room temperature for 15 minutes before being added to 100 µL of complete growth medium containing 20,000 Huh7 cells. Cells may be incubated for 24 hours at 37°C / 5% CO 2 prior to total RNA purification using a RNeasy 96 Kit (Qiagen). Each duplex may be tested by transfection in duplicate wells in two independent experiments.

[0395] cDNA synthesis may be performed using FastQuant RT (with gDNase) Kit (Tiangen). Real-time quantitative PCR (qPCR) may be performed on an ABI Prism 7900HT or ABI QuantStudio 7 with primers specific for human B4GALT1 (Hs00155245_m1) and human GAPDH (Hs02786624_g1) using a TaqMan Gene Expression Assay Kit (ThermoFisher Scientific).

[0396] qPCR may be performed in duplicate on cDNA derived from each well and the mean Ct calculated. Relative B4GALT1 expression may be calculated from mean Ct values using the comparative Ct (ΔΔCt) method, normalised to GAPDH and relative to untreated cells Inhibition of the expression of a gene may be manifested by a reduction of the amount of mRNA of the target gene of interest in comparison to a suitable control. Inhibition of the function of a target may be manifested by a reduction of the activity of the target in comparison to a suitable control.

[0397] In other embodiments, inhibition of the expression of a gene or other target may be assessed in terms of a reduction of a parameter that is functionally linked to gene expression, e.g, protein expression or signalling pathways.METHODS OF TREATING OR PREVENTING DISEASES ASSOCIATED WITH GENE EXPRESSION / EXPRESSION OF FUNCTION OF A TARGET E.G. LCNRNA

[0398] The present disclosure also provides methods of using nucleic acid e.g. an siRNA of the invention or a composition containing nucleic acid e.g. an siRNA of the invention to reduce or inhibit gene expression in a cell or reduce expression or function of a target. The methods include contacting the cell with a nucleic acid e.g. dsiRNA of the invention and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of a gene, thereby inhibiting expression of the gene in the cell. Reduction in gene expression or function of a target can be assessed by any methods known in the art. In a preferred embodiment, the gene encodes an enzyme that is involved in post-translational glycosylation. In a more preferred embodiment, the gene is B4GALT1. Said methods are not part of the claimed invention.

[0399] In the methods of the disclosure the cell may be contacted in vitro or in vivo, i.e., the cell may be within a subject. Said methods are not part of the claimed invention.

[0400] A cell suitable for treatment using the methods of the disclosure may be any cell that expresses a gene of interest or target of interest associated with disease.

[0401] The in vivo methods of the disclosure may include administering to a subject a composition containing a nucleic acid of the invention e.g. an siRNA, where the nucleic acid e.g. siRNA includes a nucleoside sequence that is complementary to at least a part of an RNA transcript of the gene of the mammal to be treated, or complementary to another nucleic acid the expression and / or function of which is associated with diseases. Said methods are not part of the claimed invention.

[0402] The present disclosure further provides methods of treatment of a subject in need thereof. The treatment methods of the disclosure include administering a nucleic acid such as an siRNA of the invention to a subject, e.g., a subject that would benefit from a reduction or inhibition of the expression of a gene and / or expression and / or function of a target, in a therapeutically effective amount e.g. a nucleic acid such as an siRNA targeting a gene or a pharmaceutical composition comprising the nucleic acid targeting a gene. Said methods are not part of the claimed invention.

[0403] A nucleic acid e.g. siRNA of the invention may be administered as a "free" nucleic acid or "free" siRNA, administered in the absence of a pharmaceutical composition. The naked nucleic acid may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution can be adjusted such that it is suitable for administering to a subject.

[0404] Alternatively, a nucleic acid e.g. siRNA of the invention may be administered as a pharmaceutical composition, such as a dsiRNA liposomal formulation.

[0405] In one embodiment, the method includes administering a composition featured herein such that expression of the target gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours. In one embodiment, expression of the target gene is decreased for an extended duration, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or longer, e.g., about 1 month, 2 months, or 3 months.

[0406] Subjects can be administered a therapeutic amount of nucleic acid e.g. siRNA, such as about 0.01 mg / kg to about 200 mg / kg.

[0407] The nucleic acid e.g. siRNA can be administered by intravenous infusion over a period of time, on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. Administration of the siRNA can reduce gene product levels of a target gene , e.g., in a cell or tissue of the patient by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the level of detection of the assay method used. In certain embodiments, administration results in clinical stabilization or preferably clinically relevant reduction of at least one sign or symptom of a gene-associated disorder.

[0408] Alternatively, the nucleic acid e.g. siRNA can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver the desired daily dose of nucleic acid e.g. siRNA to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of nucleic acid on a regular basis, such as every other day or to once a year. In certain embodiments, the nucleic acid is administered about once per month to about once per quarter (i.e., about once every three months).EXAMPLES

[0409] The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art.EXAMPLE 1 - TARGET IDENTIFICATIONBackground

[0410] Genome-wide association (GWAS) studies aim to discover statistical associations between inherited variations in chromosomal DNA (genotypes) and the physical or functional characteristics of individuals (phenotypes). There are several kinds of genetic variability of which the most commonly studied in GWAS are single nucleotide polymorphisms (SNPs) where individual nucleotides in the background DNA sequence of the genome may vary between individuals. These SNPs can result in changes in gene or protein function. This can occur either directly (in the coding regions of genes) or indirectly (through effects on gene regulation). The mapping between SNPs and genes is not always 1: 1 but can be many to one or one to many. GWAS studies have been used in drug discovery to identify genes whose variation is correlated (either positively or negatively) with the risk of developing particular diseases such as type 2 diabetes, or atherosclerosis; or with particular outcomes consequent on those diseases e.g. stroke or myocardial infarction. Occasionally, where most of the risk is concentrated in a single variant, or where multiple variants map to a single gene, the identification of such a gene can yield a clinically useful drug target. But this is the exception rather than the rule.

[0411] In complex (multifactorial) diseases such as diabetes a more typical outcome of a GWAS analysis is a long list of genes estimated to be correlated with the disease under investigation but where each gene carries only a very small portion of the risk. How to use these long lists of weakly associated genes to elucidate biological mechanisms and drive drug target discovery is the core problem being addressed. In addition, there is typically considerable uncertainty around the mapping of the underlying weakly correlated SNPs to their associated gene or genes; and of the relationship between genes such that the underlying biology is consequently opaque. In such situations the identification of clinically viable drug targets is extremely challenging and usually fails.

[0412] The inventors have developed a proprietary computational approach to analysing such 'noisy' GWAS (and other 'omic) gene lists (that may contain hundreds of weakly correlated genes and many mapping errors) using network analysis approaches to identify the underlying biology driving complex disease risk and find drug targets that are otherwise undiscoverable by conventional methods.

[0413] To achieve this, the inventors employ proprietary network analysis approaches that allow them to allocate multiple genes to a smaller number of driver processes; and to mine these processes for impactful drug targets.

[0414] As stated above, the approach takes advantage of information that is usually ignored in standard analyses - the known and predicted (using proprietary methods) interactions between genes (and proteins) and the prediction of 'hidden players' - other genes with which the GWAS (or other 'omics) gene sets also interact.Process for identifying processes and targets

[0415] The first step is to hypothesise that the dysfunction that is correlated with 'disease' should not be viewed at the level of individual genes. Rather, each gene belongs to a set whose members collaborate in a co-ordinated network module of interacting proteins. The network gives rise to a biological process and it is dysfunction at the level of this process or network module that should be considered to be the driver of risk.

[0416] Each protein in the network that is impacted by the SNPs contributes a small component to the overall functional dysregulation of the network module that controls the biological process. And network modules can interact to produce dysfunction at even coarser levels of organisation.

[0417] For that, protein coding genes from a gene list were selected after fine mapping. Using an internally curated database of all possible protein-protein interactions (derived from external experimentation) and internal 'network construction' algorithms - a range of feasible networks were generated that include the maximum number of proteins from the list with the minimal number of imputed additional 'hidden player' proteins. The algorithms seek to find optimal ways to connect the protein coding genes, using paths that are constrained by the protein-protein interaction (PPI) data and imputing missing proteins according to a 'cost function'.

[0418] This process captures the relationships between protein-coding genes in the GWAS list and adds other proteins calculated to be involved in the same process ('Hidden Players').

[0419] In this way multiple small effects are integrated across a network or networks to generate larger effects.

[0420] The second step is to hypothesise that the pattern of connectivity within such networks is critical in determining the impact of gene dysfunction. This information is typically not easily available and is usually ignored in conventional analyses.

[0421] The networks obtained in the first step were used and a functional enrichment analysis was carried out. The functional enrichment analysis differs from the conventional approach because it incorporates information about imputed hidden players and the connectivity pattern of the proteins in addition to overlap. That is, the relationships between protein-coding genes in the GWAS list and 'Hidden Players' were used to identify pathways critical for the structure of the network.

[0422] For that, an internally curated pathway database was used that defines protein sets associated with a particular biological process. These proteins sets were then tested against the networks by measuring the 'structural impact' that removal of common proteins would have on the network and assigning an 'impact value' that is dependent on the specific wiring pattern of the network. Further statistical controls were performed to ensure that any bias in the statistical properties of the proteins in the GWAS set were controlled for.

[0423] The third step is to hypothesise that the gene list associated with a dysregulated function is incomplete due to the compounded errors and uncertainties outlined above; and additionally because variations in some key proteins may not be tolerated due to their potential severity. It is therefore necessary to 'impute' what is missing.

[0424] In a next step, pathways that are 'network enriched' by the above analysis were plotted in a 2 dimensional space where each pathway is represented by a point and the proximity of the points is a measure of the similarity of the pathways (see FIG.8). The pathway data were enhanced by a technique that uses a search algorithm and the PPI database above to add additional members that are 'nearby in network space' according to another cost function. This allowed pathways that may not share many proteins but which share 'neighbours' to be compared. Similar pathways were aggregated into clusters using an unsupervised machine learning approach. The biological function of such clusters (the processes associated with risk) were determined by expert interpretation of the pathway annotations and protein annotations.

[0425] In a further step, directed network models were reconstructed from selected clusters of pathway protein sets representing biological processes associated with disease risk using an internal proprietary database of protein-protein relationships that includes 'direction' of interaction. This directional information was derived from a range of public and internal databases supplemented by imputed direction from natural language processing of text from scientific publications. Network construction algorithms using these sources of information were used to build 'directed' models of the key biological processes.

[0426] Proprietary analytical techniques were then applied to the network models to identify pharmacologically viable targets from within the networks whose knockdown will have a significant influence on the network and by extension on the biological function being modeled. The algorithms make extensive use of directional information and hierarchical relationships to identify targets with a range of specific properties that will make them good siRNA targets. Targets were then further filtered by protein class and hepatocyte specificity according to requirements.Identification of key processes and siRNA drug targets in Type 2 diabetes

[0427] The inventors have used a network biology approach to create network models of Type 2 diabetes. The network models are designed to capture all of the important proteins involved in the process as well as their connections and, importantly, the direction of information flow between pairs of proteins.

[0428] The inventors have analysed these network models using proprietary analytical methods. These methods use the directional information to capture key 'target' properties such as whether a protein is an integrator of information, a key conduit of information to other parts of the network, an influencer of key proteins and the extent to which an influencer is influenced or influences other proteins (based on absolute and relative number and direction of inputs and outputs). The directional information also enables hierarchical relationships between proteins to be imputed. Proteins higher in the hierarchy and with certain properties may be preferred over others with otherwise similar properties. The relative specificity and magnitude of each property relative to the others made it possible for the inventors to score and rank proteins in terms of their target suitability.

[0429] The ability to characterise the properties of these targets in terms of network relationships enables judgements to be made on the selectivity and magnitude of effect in the chosen context and hence the suitability of each for a given indication.

[0430] This enabled the inventors to identify targets that will provide improved treatment of Type 2 diabetes. The analyses used for this purpose are specifically tailored to find novel and non-obvious targets whose knockdown by GalNAc-siRNA in hepatocytes will be beneficial in the treatment of diabetes.

[0431] For that, the inventors leveraged a large GWAS meta-analysis of 898,930 individuals of which 9% were diabetic (Mahajan et al., Nature Genetics, 2018, 50, p1505-1513).

[0432] From that GWAS-meta-analysis, the inventors took a list of 257 genes derived from 403 distinct association signals that were weakly correlated with risk of developing type 2 diabetes. The 257 genes were subdivided amongst the categories in FIG.9.

[0433] Using the proprietary network analysis approach described above, the inventors were able to identify a specific biological process: 'post-translational modification by glycosylation' which was significantly associated with type 2 diabetes risk in both normal and obese individuals. This process was not identifiable by standard 'functional enrichment' approaches and was not identified by the authors of the meta-analysis (Mahajan et al., Nature Genetics, 2018, 50, p1505-1513).

[0434] The inventors were also able to demonstrate recovery of known diabetic risk associated processes using their network aware technique and to demonstrate the increased sensitivity of this approach - see FIG.10.

[0435] Using a number of proprietary approaches, the inventors reconstructed a network model of this process and using their analytics ranked individual hepatocyte genes according to their predicted pharmacological impact and amenability to GalNAc-mediated siRNA knockdown to identify key target genes.

[0436] This approach has enabled the inventors to identify 3 hepatocyte expressed genes coding for secreted enzyme products, of which B4GALT1 is the most highly ranked hepatocyte-expressed target in the analysis. While a number of proteins ranked in the upper quartile, only 3 also passed the selection criteria of hepatocyte expression, secretion and being an enzyme (FIG.11).EXAMPLE 2: SYNTHESIS OF TETHER 1General Experimental conditions:

[0437] Thin layer chromatography (TLC) was performed on silica-coated aluminium plates with fluorescence indicator 254 nm from Macherey-Nagel. Compounds were visualized under UV light (254 nm), or after spraying with the 5% H 2 SO 4 in methanol (MeOH) or ninhydrin reagent according to Stahl (from Sigma-Aldrich), followed by heating. Flash chromatography was performed with a Biotage Isolera One flash chromatography instrument equipped with a dual variable UV wavelength detector (200-400 nm) using Biotage Sfär Silica 10, 25, 50 or 100 g columns (Uppsala, Sweden).

[0438] All moisture-sensitive reactions were carried out under anhydrous conditions using dry glassware, anhydrous solvents, and argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich and solvents from Carl Roth GmbH + Co. KG. D-Galactosamine pentaacetate was purchased from AK scientific.

[0439] HPLC / ESI-MS was performed on a Dionex UltiMate 3000 RS UHPLC system and Thermo Scientific MSQ Plus Mass spectrometer using an Acquity UPLC Protein BEH C4 column from Waters (300Å, 1.7 µm, 2.1 x 100 mm) at 60 °C. The solvent system consisted of solvent A with H 2 O containing 0.1% formic acid and solvent B with acetonitrile (ACN) containing 0.1% formic acid. A gradient from 5-100% of B over 15 min with a flow rate of 0.4 mL / min was employed. Detector and conditions: Corona ultra-charged aerosol detection (from esa). Nebulizer Temp.: 25 °C. N 2 pressure: 35.1 psi. Filter: Corona.

[0440] 1< H and 13< C NMR spectra were recorded at room temperature on a Varian spectrometer at 500 MHz ( 1< H NMR) and 125 MHz ( 13< C NMR). Chemical shifts are given in ppm referenced to the solvent residual peak (CDCl 3 - 1< H NMR: δ at 7.26 ppm and 13< C NMR δ at 77.2 ppm; DMSO-d 6 - 1H NMR: δ at 2.50 ppm and 13< C NMR δ at 39.5 ppm). Coupling constants are given in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t) or multiplet (m).Synthesis route for the conjugate building block TriGalNAc Tether1:

[0441]

[0442] Preparation of compound 2: D-Galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 eq.) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under argon and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 eq.) was added. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aq. NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na 2 SO 4 and concentrated to afford the title compound as yellow oil, which was purified by flash chromatography (gradient elution: 0-10% MeOH in DCM in 10 CV). The product was obtained as colourless oil (2.5 g, 98%, rf= 0.45 (2% MeOH in DCM)).

[0443] Preparation of compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 eq.) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 eq.) were dissolved in anhydrous DCM (40 mL) under argon and molecular sieves 3 Å (5 g) were added to the solution. The mixture was stirred at room temperature for 1 h. TMSOTf (0.77 g, 3.49 mmol, 0.5 eq.) was then added to the mixture and the reaction was stirred overnight. The molecular sieves were filtered, the filtrate was diluted with DCM (100 mL) and washed with cold saturated aq. NaHCO 3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na 2 SO 4 and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-3% MeOH in DCM in 10 CV) to afford the title product as light yellow oil (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)). MS: calculated for C 20 H 32 N 4 O 11 , 504.21. Found 505.4. 1< H NMR (500 MHz, CDCl 3 ) δ 6.21-6.14 (m, 1H), 5.30 (dd, J= 3.4, 1.1 Hz, 1H), 5.04 (dd, J= 11.2, 3.4 Hz,1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23-4.08 (m, 3H), 3.91-3.80 (m, 3H), 3.74-3.59 (m, 9H), 3.49-3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J= 4.2 Hz, 6H). 13< C NMR (125 MHz, CDCl 3 ) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH 2 ), 69.7 (CH 2 ), 68.5 (CH 2 ), 66.6 (CH 2 ), 61.5 (CH 2 ), 23.1 (CH 3 ), 20.7 (3xCH 3 ).

[0444] Preparation of compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 eq.) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL 1: 1 v / v) and Pd / C (100 mg) was added. The reaction mixture was degassed using vacuum / argon cycles (3x) and hydrogenated under balloon pressure overnight. The reaction mixture was filtered through celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to afford the title compound as colourless oil (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). The compound was used without further purification. MS: calculated for C 20 H 34 N 2 O 11 , 478.2. Found 479.4.

[0445] Preparation of compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq.) was dissolved in a mixture of DCM / water (40 mL 1: 1 v / v) and Na 2 CO 3 (0.18 g, 1.7 mmol, 0.25 eq.) was added while stirring vigorously. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq.) was added dropwise to the previous mixture and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH 2 Cl 2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na 2 SO 4 . The solvent was removed under reduced pressure and the resulting crude material was purified by flash chromatography (gradient elution: 0-10% EtOAc in cyclohexane in 12 CV) to afford the title compound as pale yellowish oil (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: calculated for C 33 H 53 NO 11 , 639.3. Found 640.9. 1< H NMR (500 MHz, DMSO-d 6 ) δ 7.38-7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13< C NMR (125 MHz, DMSO-d 6 ) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH 2 ), 66.8 (3xCH 2 ), 64.9 (C), 58.7 (CH 2 ), 35.8 (3xCH 2 ), 27.7 (9xCH 3 ).

[0446] Preparation of compound 8: Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 eq.) was dissolved in CH 2 Cl 2 (1 mL) under argon, trifluoroacetic acid (TFA, 1 mL) was added and the reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, the residue was co-evaporated 3 times with toluene (5 mL) and dried under high vacuum to get the compound as its TFA salt (0.183 g, 98%). The compound was used without further purification. MS: calculated for C 21 H 29 NO 11 , 471.6. Found 472.4.

[0447] Preparation of compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 eq.) and GalNAc-PEG3-NH 2 5 (3.56 g, 7.44 mmol, 5.0 eq.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then N,N,N',N'-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 eq.), 1-hydroxybenzotriazole hydrate (HOBt) (1.05 g, 7.44 mmol, 5.0 eq.) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 eq.) were added to the solution and the reaction was stirred for 72 h. The solvent was removed under reduced pressure, the residue was dissolved in DCM (100 mL) and washed with saturated aq. NaHCO 3 (100 mL). The organic layer was dried over Na 2 SO 4 , the solvent evaporated and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM in 14 CV). The product was obtained as pale yellowish oil (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: calculated for C 81 H 125 N 7 O 41 , 1852.9. Found 1854.7. 1< H NMR (500 MHz, DMSO-d 6 ) δ 7.90-7.80 (m, 10H), 7.65-7.62 (m, 4H), 7.47-7.43 (m, 3H), 7.38-7.32 (m, 8H), 5.24-5.22 (m, 3H), 5.02-4.97 (m, 4H), 4.60-4.57 (m, 3 H), 4.07-3.90 (m 10H), 3.67-3.36 (m, 70H), 3.23-3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80-1.78 (m, 17H). 13< C NMR (125 MHz, DMSO-d 6 ) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH 2 ), 69.0 (CH 2 ), 68.2 (CH 2 ), 67.2 (CH 2 ), 66.7 (CH 2 ), 61.4 (CH 2 ), 22.6 (CH 2 ), 22.4 (3xCH 3 ), 20.7 (9xCH 3 ).

[0448] Preparation of compound 10: Triantennary GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 eq.) was dissolved in MeOH (15 mL), 3 drops of acetic acid (AcOH) and Pd / C (30 mg) was added. The reaction mixture was degassed using vacuum / argon cycles (3x) and hydrogenated under balloon pressure overnight. The completion of the reaction was followed by mass spectrometry and the resulting mixture was filtered through a thin pad of celite. The solvent was evaporated and the residue obtained was dried under high vacuum and used for the next step without further purification. The product was obtained as pale yellowish oil (0.24 g, quantitative yield). MS: calculated for C 73 H 119 N 7 O 39 , 1718.8. Found 1719.3.

[0449] Preparation of compound 11: Commercially available suberic acid bis(N-hydroxysuccinimide ester) (3.67 g, 9.9 mmol, 1.0 eq.) was dissolved in DMF (5 mL) and triethylamine (1.2 mL) was added. To this solution was added dropwise a solution of 3-azido-1-propylamine (1.0 g, 9.9 mmol, 1.0 eq.) in DMF (5 mL). The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with EtOAc (100 mL) and washed with water (50 mL). The organic layer was separated, dried over Na 2 SO 4 and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM in 16 CV). The product was obtained as white solid (1.54 g, 43%, rf = 0.71 (5% MeOH in DCM)). MS: calculated for C 15 H 23 N 5 O 5 , 353.4. Found 354.3.

[0450] Preparation of TriGalNAc (12 ): Triantennary GalNAc compound 10 (0.35 g, 0.24 mmol, 1.0 eq.) and compound 11 (0.11 g, 0.31 mmol, 1.5 eq.) were dissolved in DCM (5 mL) under argon and triethylamine (0.1 mL, 0.61 mmol, 3.0 eq.) was added. The reaction was stirred at room temperature overnight. The solvent was removed under reduced pressure, the residue was dissolved in EtOAc (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na 2 SO 4 . The solvent was evaporated and the resulting crude material was purified by flash chromatography (elution gradient: 0-10% MeOH in DCM in 20 CV) to afford the title compound as white fluffy solid (0.27 g, 67%, rf = 0.5 (10% MeOH in DCM)). MS: calculated for C 84 H 137 N 11 O 41 , 1957.1. Found 1959.6.Conjugation of Tether 1 to a siRNA strand: Monofluoro cyclooctyne (MFCO) conjugation at 5'- or 3'-end5'-end MFCO conjugation

[0451] 3'-end MFCO conjugation

[0452]

[0453] General conditions for MFCO conjugation: Amine-modified single strand was dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer pH 9.6 / dimethyl sulfoxide (DMSO) 4:6 (v / v) and to this solution was added one molar equivalent of a 35 mM solution of MFCO-C6-NHS ester (Berry&Associates, Cat. # LK 4300) in DMF. The reaction was carried out at room temperature and after 1 h another molar equivalent of the MFCO solution was added. The reaction was allowed to proceed for an additional hour and was monitored by LC / MS. At least two molar equivalent excess of the MFCO NHS ester reagent relative to the amino modified oligonucleotide were needed to achieve quantitative consumption of the starting material. The reaction mixture was diluted 15-fold with water, filtered through a 1.2 µm filter from Sartorius and then purified by reserve phase (RP HPLC) on an Äkta Pure instrument (GE Healthcare).

[0454] Purification was performed using a XBridge C18 Prep 19 x 50 mm column from Waters. Buffer A was 100 mM TEAAc pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60°C were employed. UV traces at 280 nm were recorded. A gradient of 0-100% B within 60 column volumes was employed.

[0455] Fractions containing full length conjugated oligonucleotide were pooled, precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol and the collected pellet was dissolved in water. Samples were desalted by size exclusion chromatography and concentrated using a speed-vac concentrator to yield the conjugated oligonucleotide in an isolated yield of 40-80%.5'-GalNAc-T1 conjugates

[0456] 3'-GalNAc-T1 conjugates

[0457]

[0458] General procedure for TriGalNAc conjugation: MFCO-modified single strand was dissolved at 2000 OD / mL in water and to this solution was added one equivalent solution of compound 12 (10 mM) in DMF. The reaction was carried out at room temperature and after 3 h 0.7 molar equivalent of the compound 12 solution was added. The reaction was allowed to proceed overnight and completion was monitored by LCMS. The conjugate was diluted 15-fold in water, filtered through a 1.2 µm filter from Sartorius and then purified by RP HPLC on an Äkta Pure instrument (GE Healthcare).

[0459] RP HPLC purification was performed using a XBridge C18 Prep 19 x 50 mm column from Waters. Buffer A was 100 mM triethylammonium acetate pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60°C were employed. UV traces at 280 nm were recorded. A gradient of 0-100% B within 60 column volumes was employed.

[0460] Fractions containing full-length conjugated oligonucleotide were pooled, precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol and the collected pellet was dissolved in water to give an oligonucleotide solution of about 1000 OD / mL. The O-acetates were removed by adding 20% aqueous ammonia. Quantitative removal of these protecting groups was verified by LC-MS.

[0461] The conjugates were desalted by size exclusion chromatography using Sephadex G25 Fine resin (GE Healthcare) on an Äkta Pure (GE Healthcare) instrument to yield the conjugated oligonucleotides in an isolated yield of 50-70%.

[0462] The following schemes further set out the routes of synthesis: EXAMPLE 3: DUPLEX ANNEALING

[0463] To generate the desired siRNA duplex, the two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixtures were placed into a water bath at 70°C for 5 minutes and subsequently allowed to cool to ambient temperature within 2 h. The duplexes were lyophilized for 2 days and stored at -20°C.

[0464] The duplexes were analyzed by analytical SEC HPLC on Superdex ™< 75 Increase 5 / 150 GL column 5 x 153-158 mm (Cytiva) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system. Mobile phase consisted of 1x PBS containing 10% acetonitrile. An isocratic gradient was run in 10 min at a flow rate of 1.5 mL / min at room temperature. UV traces at 260 and 280 nm were recorded. Water (LC-MS grade) was purchased from Sigma-Aldrich and Phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).EXAMPLE 4: SYNTHESIS OF TETHER 2General Experimental conditions:

[0465] Thin layer chromatography (TLC) was performed on silica-coated aluminium plates with fluorescence indicator 254 nm from Macherey-Nagel. Compounds were visualized under UV light (254 nm), or after spraying with the 5% H 2 SO 4 in methanol (MeOH) or ninhydrin reagent according to Stahl (from Sigma-Aldrich), followed by heating. Flash chromatography was performed with a Biotage Isolera One flash chromatography instrument equipped with a dual variable UV wavelength detector (200-400 nm) using Biotage Sfär Silica 10, 25, 50 or 100 g columns (Uppsala, Sweden).

[0466] All moisture-sensitive reactions were carried out under anhydrous conditions using dry glassware, anhydrous solvents, and argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich and solvents from Carl Roth GmbH + Co. KG. D-Galactosamine pentaacetate was purchased from AK scientific.

[0467] HPLC / ESI-MS was performed on a Dionex UltiMate 3000 RS UHPLC system and Thermo Scientific MSQ Plus Mass spectrometer using an Acquity UPLC Protein BEH C4 column from Waters (300Å, 1.7 µm, 2.1 x 100 mm) at 60 °C. The solvent system consisted of solvent A with H 2 O containing 0.1% formic acid and solvent B with acetonitrile (ACN) containing 0.1% formic acid. A gradient from 5-100% of B over 15 min with a flow rate of 0.4 mL / min was employed. Detector and conditions: Corona ultra-charged aerosol detection (from esa). Nebulizer Temp.: 25 °C. N 2 pressure: 35.1 psi. Filter: Corona.

[0468] 1< H and 13< C NMR spectra were recorded at room temperature on a Varian spectrometer at 500 MHz ( 1< H NMR) and 125 MHz ( 13< C NMR). Chemical shifts are given in ppm referenced to the solvent residual peak (CDCl 3 - 1< H NMR: δ at 7.26 ppm and 13< C NMR δ at 77.2 ppm; DMSO-d 6 - 1< H NMR: δ at 2.50 ppm and 13< C NMR δ at 39.5 ppm). Coupling constants are given in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t) or multiplet (m).Synthesis route for the conjugate building block TriGalNAc Tether2:

[0469]

[0470] Preparation of compound 2: D-Galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 eq.) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under argon and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 eq.) was added. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aq. NaHCO 3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na 2 SO 4 , and concentrated to afford the title compound as yellow oil, which was purified by flash chromatography (gradient elution: 0-10% MeOH in DCM in 10 CV). The product was obtained as colourless oil (2.5 g, 98%, rf= 0.45 (2% MeOH in DCM)).

[0471] Preparation of compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 eq.) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 eq.) were dissolved in anhydrous DCM (40 mL) under argon and molecular sieves 3 Å (5 g) were added to the solution. The mixture was stirred at room temperature for 1 h. TMSOTf (0.77 g, 3.49 mmol, 0.5 eq.) was then added to the mixture and the reaction was stirred overnight. The molecular sieves were filtered, the filtrate was diluted with DCM (100 mL) and washed with cold saturated aq. NaHCO 3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na 2 SO 4 and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-3% MeOH in DCM in 10 CV) to afford the title product as light-yellow oil (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)). MS: calculated for C 20 H 32 N 4 O 11 , 504.21. Found 505.4. 1< H NMR (500 MHz, CDCl 3 ) δ 6.21-6.14 (m, 1H), 5.30 (dd, J= 3.4, 1.1 Hz, 1H), 5.04 (dd, J= 11.2, 3.4 Hz,1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23-4.08 (m, 3H), 3.91-3.80 (m, 3H), 3.74-3.59 (m, 9H), 3.49-3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J= 4.2 Hz, 6H). 13< C NMR (125 MHz, CDCl 3 ) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH 2 ), 69.7 (CH 2 ), 68.5 (CH 2 ), 66.6 (CH 2 ), 61.5 (CH 2 ), 23.1 (CH 3 ), 20.7 (3xCH 3 ).

[0472] Preparation of compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 eq.) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL 1: 1 v / v) and Pd / C (100 mg) was added. The reaction mixture was degassed using vacuum / argon cycles (3x) and hydrogenated under balloon pressure overnight. The reaction mixture was filtered through celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to afford the title compound as colourless oil (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). The compound was used without further purification. MS: calculated for C 20 H 34 N 2 O 11 , 478.2. Found 479.4.

[0473] Preparation of compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq.) was dissolved in a mixture of DCM / water (40 mL 1: 1 v / v) and Na 2 CO 3 (0.18 g, 1.7 mmol, 0.25 eq.) was added while stirring vigorously. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq.) was added dropwise to the previous mixture and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH 2 Cl 2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na 2 SO 4 . The solvent was removed under reduced pressure and the resulting crude material was purified by flash chromatography (gradient elution: 0-10% EtOAc in cyclohexane in 12 CV) to afford the title compound as pale yellowish oil (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: calculated for C 33 H 53 NO 11 , 639.3. Found 640.9. 1< H NMR (500 MHz, DMSO-d 6 ) δ 7.38-7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13< C NMR (125 MHz, DMSO-d 6 ) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH 2 ), 66.8 (3xCH 2 ), 64.9 (C), 58.7 (CH 2 ), 35.8 (3xCH 2 ), 27.7 (9xCH 3 ).

[0474] Preparation of compound 8: Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 eq.) was dissolved in CH 2 Cl 2 (1 mL) under argon, trifluoroacetic acid (TFA, 1 mL) was added and the reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, the residue was co-evaporated 3 times with toluene (5 mL) and dried under high vacuum to get the compound as its TFA salt (0.183 g, 98%). The compound was used without further purification. MS: calculated for C 21 H 29 NO 11 , 471.6. Found 472.4.

[0475] Preparation of compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 eq.) and GalNAc-PEG3-NH 2 5 (3.56 g, 7.44 mmol, 5.0 eq.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then N,N,N;N'-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 eq.), 1-hydroxybenzotriazole hydrate (HOBt) (1.05 g, 7.44 mmol, 5.0 eq.) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 eq.) were added to the solution and the reaction was stirred for 72 h. The solvent was removed under reduced pressure, the residue was dissolved in DCM (100 mL) and washed with saturated aq. NaHCO 3 (100 mL). The organic layer was dried over Na 2 SO 4 , the solvent evaporated and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM in 14 CV). The product was obtained as pale yellowish oil (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: calculated for C 81 H 125 N 7 O 41 , 1852.9. Found 1854.7. 1< H NMR (500 MHz, DMSO-d 6 ) δ 7.90-7.80 (m, 10H), 7.65-7.62 (m, 4H), 7.47-7.43 (m, 3H), 7.38-7.32 (m, 8H), 5.24-5.22 (m, 3H), 5.02-4.97 (m, 4H), 4.60-4.57 (m, 3 H), 4.07-3.90 (m 10H), 3.67-3.36 (m, 70H), 3.23-3.07(m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80-1.78 (m, 17H). 13< C NMR (125 MHz, DMSO-d 6 ) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH 2 ), 69.0 (CH 2 ), 68.2 (CH 2 ), 67.2 (CH 2 ), 66.7 (CH 2 ), 61.4 (CH 2 ), 22.6 (CH 2 ), 22.4 (3xCH 3 ), 20.7 (9xCH 3 ).

[0476] Preparation of compound 10: Triantennary GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 eq.) was dissolved in MeOH (15 mL), 3 drops of acetic acid (AcOH) and Pd / C (30 mg) was added. The reaction mixture was degassed using vacuum / argon cycles (3x) and hydrogenated under balloon pressure overnight. The completion of the reaction was followed by mass spectrometry and the resulting mixture was filtered through a thin pad of celite. The solvent was evaporated, and the residue obtained was dried under high vacuum and used for the next step without further purification. The product was obtained as pale yellowish oil (0.24 g, quantitative yield). MS: calculated for C 73 H 119 N 7 O 39 , 1718.8. Found 1719.3.

[0477] Preparation of compound 14: Triantennary GalNAc compound 10 (0.45 g, 0.26 mmol, 1.0 eq.), HBTU (0.19 g, 0.53 mmol, 2.0 eq.) and DIPEA (0.23 mL, 1.3 mmol, 5.0 eq.) were dissolved in DCM (10 mL) under argon. To this mixture, it was added dropwise a solution of compound 13 (0.14 g, 0.53 mmol, 2.0 eq.) in DCM (5 mL). The reaction was stirred at room temperature overnight. The solvent was removed, and the residue was dissolved in EtOAc (50 mL), washed with water (50 mL) and dried over Na 2 SO 4 . The solvent was evaporated, and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM in 20 CV). The product was obtained as white fluffy solid (0.25 g, 48%, rf = 0.4 (10% MeOH in DCM)). MS: calculated for C88H137N7O42, 1965.1. Found 1965.6.

[0478] Preparation of TriGalNAc (15 ): Triantennary GalNAc compound 14 (0.31 g, 0.15 mmol, 1.0 eq.) was dissolved in EtOAc (15 mL) and Pd / C (40 mg) was added. The reaction mixture was degassed by using vacuum / argon cycles (3x) and hydrogenated under balloon pressure overnight. The completion of the reaction was monitored by mass spectrometry and the resulting mixture was filtered through a thin pad of celite. The solvent was removed under reduced pressure and the resulting residue was dried under high vacuum overnight. The residue was used for conjugations to oligonucleosides without further purification (0.28 g, quantitative yield). MS: calculated for C 81 H 131 N 7 O 42 , 1874.9. Found 1875.3.Conjugation of Tether 2 to a siRNA strand: TriGalNAc tether 2 (GalNAc-T2) conjugation at 5'-end or 3'-end5'-GalNAc-T2 conjugates

[0479] 3'-GalNAc-T2 conjugates

[0480]

[0481] Preparation of TriGalNAc tether 2 NHS ester: To a solution of carboxylic acid tether 2 (compound 15, 227 mg, 121 µmol) in DMF (2.1 mL), N-hydroxysuccinimide (NHS) (15.3 mg, 133 µmol) and N,N'-diisopropylcarbodiimide (DIC) (19.7 µL, 127 µmol) were added. The solution was stirred at room temperature for 18 h and used without purification for the subsequent conjugation reactions.

[0482] General procedure for triGalNAc tether 2 conjugation: Amine-modified single strand was dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer pH 9.6 / DMSO 4:6 (v / v) and to this solution was added one molar equivalent of Tether 2 NHS ester (57 mM) solution in DMF. The reaction was carried out at room temperature and after 1 h another molar equivalent of the NHS ester solution was added. The reaction was allowed to proceed for one more hour and reaction progress was monitored by LCMS. At least two molar equivalent excess of the NHS ester reagent relative to the amino modified oligonucleoside were needed to achieve quantitative consumption of the starting material. The reaction mixture was diluted 15-fold with water, filtered once through 1.2 µm filter from Sartorius and then purified by reserve phase (RP HPLC) on an Äkta Pure (GE Healthcare) instrument.

[0483] The purification was performed using a XBridge C18 Prep 19 x 50 mm column from Waters. Buffer A was 100 mM TEAA pH 7 and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60°C were employed. UV traces at 280 nm were recorded. A gradient of 0-100% B within 60 column volumes was employed.

[0484] Fractions containing full-length conjugated oligonucleosides were pooled together, precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol and then dissolved at 1000 OD / mL in water. The O-acetates were removed with 20% ammonium hydroxide in water until completion (monitored by LC-MS).

[0485] The conjugates were desalted by size exclusion chromatography using Sephadex G25 Fine resin (GE Healthcare) on an Äkta Pure (GE Healthcare) instrument to yield the conjugated oligonucleotides in an isolated yield of 60-80%.

[0486] The conjugates were characterized by HPLC-MS analysis with a 2.1 x 50 mm XBridge C18 column (Waters) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system equipped with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics). Buffer A was 16.3 mM triethylamine, 100 mM HFIP in 1% MeOH in H2O and buffer B contained 95% MeOH in buffer A. A flow rate of 250 µL / min and a temperature of 60°C were employed. UV traces at 260 and 280 nm were recorded. A gradient of 1-100% B within 31 min was employed.

[0487] The following schemes further set out the routes of synthesis:

[0488] To generate the desired siRNA duplex, the two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixtures were placed into a water bath at 70°C for 5 minutes and subsequently allowed to cool to ambient temperature within 2 h. The duplexes were lyophilized for 2 days and stored at -20°C.

[0489] The duplexes were analyzed by analytical SEC HPLC on Superdex ™< 75 Increase 5 / 150 GL column 5 x 153-158 mm (Cytiva) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system. Mobile phase consisted of 1x PBS containing 10% acetonitrile. An isocratic gradient was run in 10 min at a flow rate of 1.5 mL / min at room temperature. UV traces at 260 and 280 nm were recorded. Water (LC-MS grade) was purchased from Sigma-Aldrich and Phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).EXAMPLE 6: ALTERNATIVE SYNTHESIS ROUTE FOR THE CONJUGATE BUILDING BLOCK TRIGALNAC TETHER2:

[0490] Conjugation of Tether 2 to a siRNA strand: TriGalNAc tether 2 (GalNAc-T2) conjugation at 5'-end or 3'-endConjugation conditions

[0491]

[0492] Pre-activation: To a solution of compound 15 (16 umol, 4 eq.) in DMF (160 µL) was added TFA-O-PFP (15 µl, 21 eq.) followed by DIPEA (23 µl, 32 eq.) at 25°C. The tube was shaken for 2 h at 25°C. The reaction was quenched with H 2 O (10 µL).

[0493] Coupling: The resulting mixture was diluted with DMF (400 µl), followed by addition of oligo-amine solution (4.0 µmol in 10 x PBS, pH 7.4, 500 µL; final oligo concentration in organic and aqueous solution: 4 µmol / ml = 4 mM). The tube was shaken at 25°C for 16 h and the reaction was analysed by LCMS. The resulting mixture was treated with 28% NH 4 OH (4.5 ml) and shaken for 2 h at 25°C. The mixture was analysed by LCMS, concentrated, and purified by IP-RP HPLC to produce the oligonucleotides conjugated to tether 2 GalNAc.5'-GalNAc-T2 conjugates

[0494] 3'-GalNAc-T2 conjugates

[0495] EXAMPLE 7: SOLID PHASE SYNTHESIS METHOD: SCALE ≤1µMOL

[0496] Syntheses of siRNA sense and antisense strands were performed on a MerMade192X synthesiser with commercially available solid supports made of controlled pore glass with universal linker (Universal CPG, with a loading of 40 µmol / g; LGC Biosearch or Glen Research).

[0497] RNA phosphoramidites were purchased from ChemGenes or Hongene.

[0498] The 2'-O-Methyl phosphoramidites used were the following: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-adenosine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)- (N,N-diisopropyl)]-phosphoramidite.

[0499] The 2'-F phosphoramidites used were the following: 5'-dimethoxytrityl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 5'-dimethoxytrityl-deoxyuridine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0500] All phosphoramidites were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05M, except 2'-O-methyl-uridine phosphoramidite which was dissolved in DMF / MeCN (1:4, v / v). Iodine at 0.02M in acetonitrile / Pyridine / H2O (DNAchem) was used as oxidizing reagent. Thiolation for phosphorothioate linkages was performed with 0.2 M PADS (TCI) in acetonitrile / pyridine 1: 1 v / v. 5-Ethyl thiotetrazole (ETT), 0.25M mM in acetonitrile was used as activator solution.

[0501] Inverted abasic phosphoramidite, 3-O-Dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoramidite were purchased from Chemgenes (ANP-1422) or Hongene (OP-040).

[0502] At each cycle, the DMT was removed by deblock solution, 3% TCA in DCM (DNAchem).

[0503] The coupling time was 180 seconds. The oxidizer contact time was set to 80 seconds and thiolation time was 2*100 seconds.

[0504] At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a NH 4 OH:EtOH solution 4:1 (v / v) for 20 hours at 45°C (TCI). The solid support was then filtered off, the filter was thoroughly washed with H 2 O and the volume of the combined solution was reduced by evaporation under reduced pressure.

[0505] Oligonucleotide were treated to form the sodium salt by ultracentrifugation using Amicon Ultra-2 Centrifugal Filter Unit; PBS buffer (10x, Teknova, pH 7.4, Sterile) or by EtOH precipitation from 1M sodium acetate.

[0506] The single strands identity were assessed by MS ESI- and then, were annealed in water to form the final duplex siRNA and duplex purity were assessed by size exclusion chromatography.EXAMPLE 8: SOLID PHASE SYNTHESIS METHOD: SCALE ≥5 µMOL

[0507] Syntheses of siRNA sense and antisense strands were performed on a MerMade12 synthesiser with commercially available solid supports made of controlled pore glass with universal linker (Universal CPG, with a loading of 40 µmol / g; LGC Biosearch or Glen Research) at 5 µmol scale. Sense strand destined to 3' conjugation were sytnthesised at 12 µmol on 3'-PT-Amino-Modifier C6 CPG 500 Å solid support with a loading of 86 µmol / g (LGC).

[0508] RNA phosphoramidites were purchased from ChemGenes or Hongene.

[0509] The 2'-O-Methyl phosphoramidites used were the following: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-adenosine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)- (N,N-diisopropyl)]-phosphoramidite.

[0510] The 2'-F phosphoramidites used were the following: 5'-dimethoxytrityl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'- [(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 5'-dimethoxytrityl-deoxyuridine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0511] Inverted abasic phosphoramidite, 3-O-Dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoramidite were purchased from Chemgenes (ANP-1422) or Hongene (OP-040).

[0512] All phosphoramidites were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05M, except 2'-O-methyl-uridine phosphoramidite which was dissolved in DMF / MeCN (1:4, v / v). Iodine at 0.02M in acetonitrile / Pyridine / H 2 O (DNAchem) was used as oxidizing reagent. Thiolation for phosphorothioate linkages was performed with 0.2 M PADS (TCI) in acetonitrile / pyridine 1:1 v / v. 5-Ethyl thiotetrazole (ETT), 0.25M mM in acetonitrile was used as activator solution.

[0513] At each cycle, the DMT was removed by deblock solution, 3% TCA in DCM (DNAchem).

[0514] For strands synthesised on universal CPG the coupling was performed with 8 eq. of amidite for 130 seconds. The oxidation time was 47 seconds, the thiolation time was 210 seconds.

[0515] For strands synthesised on 3'-PT-Amino-Modifier C6 CPG the coupling was performed with 8 eq. of amidite for 2*150 seconds. The oxidation time was 47 seconds, the thiolation time was 250 seconds

[0516] At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a NH 4 OH:EtOH solution 4:1 (v / v) for 20 hours at 45°C (TCI). The solid support was then filtered off, the filter was thoroughly washed with H 2 O and the volume of the combined solution was reduced by evaporation under reduced pressure.

[0517] Oligonucleotide were treated to form the sodium salt by EtOH precipitation from 1M sodium acetate.

[0518] The single strand oligonucleotides were purified by IP-RP HPLC on Xbridge BEH C18 5 µm, 130 Å, 19x150 mm (Waters) column with an increasing gradient of B in A. Mobile phase A: 240 mM HFIP, 7 mM TEA and 5% methanol in water; mobile phase B: 240 mM HFIP, 7 mM TEA in methanol.

[0519] The single strands purity and identity were assessed by UPLC / MS ESI- on Xbridge BEH C18 2.5 µm, 3x50 mm (Waters) column with an increasing gradient of B in A. Mobile phase A: 100 mM HFIP, 5 mM TEA in water; mobile phase B: 20% mobile phase A: 80% Acetonitrile (v / v).

[0520] Sense strands were conjugated as per protocol provided in any of Examples 2, 4, 6.

[0521] Sense and Antisense strands were then annealed in water to form the final duplex siRNA and duplex purity were assessed by size exclusion chromatography.

[0522] The present invention is not intended to be limited in scope to the particular disclosed embodiments, which are provided, for example, to illustrate various aspects of the invention. Various modifications to the compositions and methods described will become apparent from the description and teachings herein.EXAMPLE 9: B4GALT1 PHARMACOLOGY STUDY

[0523] ETX in-house computational biology analysis identified B4GALT1, encoding beta-1,4-galactosyltransferase 1, as a gene associated with Type 2 Diabetes (T2D) (see Example 1). Here we establish B4GALT1 as a potential therapeutic target for T2D. In-silico-designed GalNAc-siRNAs targeting mouse hepatic B4GALT1 were synthesized and tested to access the plausibility of the hypothesis that a significant knockdown of hepatic B4GALT1 mRNA lowers the plasma levels of LDL-c, fibrinogen, and fasting glucose.In vitro dose-response assay to select potent molecules

[0524] In vitro dose-response assay measuring the gene knockdown in primary mouse hepatocytes (PMHs) was performed to test 20 GalNAc-siRNAs targeting hepatic B4GALT1. Primary C57BL / 6 mouse hepatocytes (PMHs) were isolated fresh by two-step collagenase liver perfusion. Cells were maintained in DMEM (Gibco-11995-092) supplemented with FBS, Penicillin / Streptomycin, HEPES and L-glutamine. Cells were cultured at 37°C in an atmosphere with 5% CO 2 in a humidified incubator. Within 2 hours post isolation, PMHs were seeded at a density of 36,000 cells / well in regular 96-well tissue culture plates. Dose response analysis in PMHs was done by direct incubation of cells in a gymnotic free uptake setting with final GalNAc-siRNA concentrations of 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9, 1.95 nM. In control wells, cells were incubated without GalNAc-siRNA. After 48hr incubation, cells were harvested for RNA extraction. Total RNA was extracted using RNeasy Kit following the manufacturer's instructions (Qiagen, Shanghai, China). After reverse transcription, real-time quantitative PCR was performed using an ABI Prism 7900HT to detect the relative abundance of B4GALT1 mRNA normalized to the housekeeping gene GAPDH. The expression of the target gene in each test sample was determined by relative quantitation using the comparative Ct (ΔΔCt) method. This method measures the Ct differences (ΔCt) between target gene and housekeeping gene. The formula is as follows: ΔCt = average Ct of B4GALT1 -average Ct of GAPDH, ΔΔCt=ΔCt (sample) - average ΔCt (untreated control), relative expression of target gene mRNA = 2 -ΔΔCt< . Based on the results of in vitro free uptake experiment, GalNAc-siRNAs displaying good activity were selected for EC 50 determination using a 10-point concentration curve (Figure 12).In vivo pharmacology with four selected GalNAc-siRNAs

[0525] The pharmacodynamic activity of four selected B4GALT1 GalNAc-siRNAs was measured in vivo. Twelve C57BL / 6 male mice were allocated for each of GalNAc-siRNAs, ETXM619, ETXM624, ETXM628 and ETXM633. 5 mice were allocated as no-treatment control group. Mice were subcutaneously dosed with ETXMs (10 mg / kg) on day 0, defined as the day mice were first dosed, day 3 and day 7. 3 mice in each treatment group were sacrificed on day 3, day 7, day 10 and day 14. Upon termination, liver tissues and plasma samples were harvested for further analysis. Day 3 samples were used to evaluate the single dose effect of ETXMs given on day 0. Day 7 samples represent the repeat dose effect of ETXMs given on day 0 and day3. Likewise, day 10 and day 14 samples represent the repeat dose effect of ETXMs given on day 0, day 3 and day 7. 5 mice allocated as the control group were sacrificed on day 14.B4GALT1 gene knockdown in mouse liver

[0526] Harvested liver samples were used to measure the B4GALT1 mRNA knockdown level by RT-qPCR. Upon collection, each tissue was treated with RNAlater and stored at 4°C overnight then at -80°C until the further analysis. Liver tissues were homogenized with TRIZOL for RNA extraction. RNA samples, adjusted to 400 ng / µL, were reverse transcribed to cDNA using FastKing RT Kit, manufactured by TIANGEN. After gDNA removal procedure, purified cDNA samples were used for RT-qPCR. RT-qPCR method and the relative mRNA expression calculations are as described above. Figure 13 shows that all test articles exhibit > 50% gene knockdown efficiency at day 3, 7, 10 and 14.Terminal plasma collection and measurement of plasma biomarkers using biochemical analyser

[0527] The terminal plasma samples were collected via submandibular vein after 4-5 hour fasting. Blood samples were collected in heparin sodium coated tubes then centrifuged at 7,000g at 4°C for 10 min to obtain plasma samples. The plasma samples were used for the measurements of AST, ALT, albumin, ALP, BUN, CREA, TBIL, glucose, total cholesterol, LDL-c, HDL-c, triglycerides and NEFA (free fatty acids) by a biochemical analyser.Measurement of plasma insulin and fibrinogen levels using ELISA kits

[0528] Blood samples were collected in K 2 EDTA coated tubes then centrifuged at 7,000g at 4°C for 10 minutes to obtain plasma samples. The plasma insulin level was measured using Mouse Insulin ELISA kit (Mercodia, 10-1247-01) according to the manufacturer's protocol. The fibrinogen plasma level was measured using Mouse Fibrinogen Antigen Assay kit (Innovative Research, IMSFBGKTT).B4GALT1 gene silence effect in biomarker modulation

[0529] The means of the untreated control group (n=5) and the day-14 treatment group comprising groups administered with ETXM619, ETXM624, ETXM628 or ETXM633 subcutaneously at day 0, day 3 and day7 (n=3 per group, n=12 total) were tested for equality under the null hypothesis via a two-tailed t-test. Statistically significant differences in the means of efficacy biomarker readouts were detected with an 18.8% decrease in LDL-C (p<0.05); a 21.0% decrease in fasting glucose (p<0.05); and a 29.6% decrease in fibrinogen (p<0.01) (Figure 14).

Claims

1. An inhibitor of expression of B4GALT1 for use in the treatment of diabetes, wherein the inhibitor is an siRNA oligomer.

2. An inhibitor for use according to claim 1, which is an siRNA oligomer conjugated to one or more ligand moieties.

3. An inhibitor for use according to claim 2, wherein said one or more ligand moieties comprise one or more GalNAc ligands, and / or one or more GalNAc ligand derivatives.

4. An inhibitor for use, according to any preceding claim, which is an siRNA oligomer having a first and a second strand wherein: i) the first strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25; even more preferably 23; and / or ii) the second strand of the siRNA has a length in the range of 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 21 nucleosides.

5. An inhibitor for use, according to claim 4, wherein the second sense strand further comprises one or more abasic nucleosides in a terminal region of the second strand, and wherein said abasic nucleoside(s) is / are connected to an adjacent nucleoside through a reversed intemucleoside linkage.

6. An inhibitor for use, according to claim 5, wherein the second strand comprises: i 2, or more than 2, abasic nucleosides in a terminal region of the second strand; and / or ii 2, or more than 2, abasic nucleosides in either the 5' or 3' terminal region of the second strand; and / or iii 2, or more than 2, abasic nucleosides in either the 5' or 3' terminal region of the second strand, wherein the abasic nucleosides are present in an overhang as herein described; and / or iv 2, or more than 2, consecutive abasic nucleosides in a terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside; and / or v 2, or more than 2, consecutive abasic nucleosides in either the 5' or 3' terminal region of the second strand, wherein preferably one such abasic nucleoside is a terminal nucleoside in either the 5' or 3' terminal region of the second strand; and / or vi a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in a terminal region of the second strand; and / or vii a reversed intemucleoside linkage connects at least one abasic nucleoside to an adjacent basic nucleoside in either the 5' or 3' terminal region of the second strand; and / or viii an abasic nucleoside as the penultimate nucleoside which is connected via the reversed linkage to the nucleoside which is not the terminal nucleoside (called the antepenultimate nucleoside herein); and / or ix abasic nucleosides as the 2 terminal nucleosides connected via a 5'-3' linkage when reading the strand in the direction towards that terminus; x abasic nucleosides as the 2 terminal nucleosides connected via a 3'-5' linkage when reading the strand in the direction towards the terminus comprising the terminal nucleosides; xi abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein the reversed linkage is a 5-5' reversed linkage or a 3'-3' reversed linkage; xii abasic nucleosides as the terminal 2 positions, wherein the penultimate nucleoside is connected via the reversed linkage to the antepenultimate nucleoside, and wherein either (1) the reversed linkage is a 5-5' reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 3'5' when reading towards the terminus comprising the terminal and penultimate abasic nucleosides; or (2) the reversed linkage is a 3-3' reversed linkage and the linkage between the terminal and penultimate abasic nucleosides is 5'3' when reading towards the terminus comprising the terminal and penultimate abasic nucleosides.

7. An inhibitor for use, according claim 5 or 6, wherein the reversed internucleoside linkage is at a terminal region which is distal to the 5' terminal region of the second strand, or at a terminal region which is distal to the 3' terminal region of the second strand.

8. An inhibitor for use, according to any one of claims 5 to 7, wherein the reversed intemucleoside linkage is a 3'3 reversed linkage or a 5'5 reversed linkage.

9. An inhibitor for use, according to any one of claims 4 to 8, wherein one or more nucleosides on the first strand and / or the second strand is / are modified, to form modified nucleosides.

10. An inhibitor for use, according to claim 9, wherein the modification is a modification at the 2'-OH group of the ribose sugar, optionally selected from 2'-Me or 2'-F modifications.

11. An inhibitor for use, according to claim 9 or 10, wherein the first strand comprises a 2'-F at any of position 14, position 2, position 6, or any combination thereof, counting from position 1 of said first strand.

12. A pharmaceutical composition comprising an inhibitor as disclosed in any preceding claim, in combination with a pharmaceutically acceptable excipient or carrier, for use in the treatment of diabetes.

13. Use of B4GALT1 as a target for identifying one or more therapeutic agents for the treatment of diabetes.