mRNA AGENT COMPOSITIONS AGAINST MICROTUBULE-ASSOCIATED TAU PROTEIN (MAPT) AND METHODS OF THEIR USE

Claims

1. A double-stranded ribonucleic acid (dsRNA)-based agent for inhibiting the expression of MAPT, wherein the dsRNA-based agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region of complementarity to mRNA encoding the tau protein, and wherein the region of complementarity comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from SEQ ID NO: 1003, 1001, 1002, 1011, 1009, 1010 or any of the antisense nucleotide sequences in any of Tables 3-6.

2. The dsRNA-based agent according to claim 1, wherein the sense strand comprises at least 15 consecutive nucleotides differing by no more than three nucleotides from any nucleotide sequence of nucleotides 514-534, 1072-1092 and 1067-1087 of SEQ ID NO: 3, and the antisense strand comprises at least 15 consecutive nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 4; wherein the sense strand comprises at least 15 consecutive nucleotides that differ by no more than three nucleotides from any nucleotide sequence of nucleotides 514-534, 1067-1087, 1072-1092, 506-526, 507-527, 508-528, 509-529, 510-530, 511-531, 512-532, 513-533, 515-535, 516-536, 517-537, 518-538, 519-539, 520-540, 521-541, 522-542, 523-543, 524-544, 525-545, 526-544, 526-546, 527-547, 528-548, 529-54 9, 530-550, 531-551, 532-552, 533-553, 969-989, 970-990, 971-991, 972-992, 973-993, 974-994, 975-995, 976-996, 977-997, 978-997, 978-998, 97 9-997, 97 9-999, 980-1000, 981-1001, 982-1002, 983-1003, 984-1004, 985-1003, 985-1005, 986-1006, 987-1007, 988-1008, 989-1009, 990-1010, 1069-1089, 1070-1090, 1071-1091, 1073-1093, 1074-1094, 1075-1095, 1076-1096, 1077-1095, 1077-1097, 1078-1098, 1079-1099, 1080-1100, 1081-1101, 5511-5531, 5512-5532, 5513-5533, 5514-5534, 5515-5535, 5516-5536, 5517-5537, 5518-5538, 5519-5539, 5520-5540, 5521-5541, 5522-5542 and 5523-5543 SEQ ID NO: 1,and the antisense strand comprises at least 15 consecutive nucleotides from the corresponding nucleotide sequence of SEQ ID NO: 2;, wherein the antisense strand comprises at least 15 consecutive nucleotides differing by no more than three nucleotides from any of the nucleotide sequences of the antisense strand of a duplex selected from the group consisting of AD-1786708, AD-1786708v2, AD-1637701, AD-1623140, AD-1397070, AD-1397072, AD-1397073, AD-1397075, AD-1397081, AD-1397083, AD-1397088, AD-1397249, AD-1397252, AD-1397253, AD-1397258, AD-1397261, AD-1397262, AD-1397263, AD-1397291, AD-1397293, AD-1397294, AD-1397295, AD-1397298, AD-1397299, AD-1637732, AD-1637733, AD-1637734, AD-1637735, AD-1637736, AD-1637737, AD-1637739, AD-1637744, AD-1637745, AD-1637746, AD-1637747, AD-1637748, AD-1637749, AD-1637750, AD-1637751, AD-1637752, AD-1637753, AD-1637754, AD-1637755, AD-1637756, AD-1637757, AD-1637758, AD-1637759, AD-1637760, AD-1637761, AD-1637762, AD-1637763, AD-1637764, AD-1637765, AD-1637766, AD-1637767, AD-1637768, AD-1637769, AD-1637770, AD-1637771, AD-1637772, AD-1637773, AD-1637774, AD-1637775,AD-1637776, AD-1637777, AD-1637778, AD-1637779, AD-1637780, AD-1637781, AD-1637782, AD-1637783, AD-1637784, AD-1637785, AD-1637786, AD-1637787, AD-1637788, AD-1637789, AD-1637790, AD-1637791, AD-1637792, AD-1637793, AD-1637794, AD-1637795, AD-1637796, AD-1637797, AD-1637798, AD-1637799, AD-1637800, AD-1637801, AD-1637802, AD-1637803, AD-1637804, AD-1637805, AD-1637806, AD-1637807, AD-1637808, AD-1637809, AD-1637810, AD-1637811, AD-1637812, AD-1637813, AD-1637814, AD-1637815, AD-1637816, AD-1637817, AD-1637818, AD-1637819, AD-1637820, AD-1637821, AD-1637822, AD-1637823, AD-1637824, AD-1637825, AD-1637826, AD-1637827, AD-1637828, AD-1637829, AD-1637830, AD-1637831, AD-1637832, AD-1637833, AD-1637834, AD-1637835, AD-1637836, AD-1637837, AD-1637838, AD-1637839, AD-1637840, AD-1637841, AD-1637842, AD-1637843, AD-1637844, AD-1637845, AD-1637846, AD-1637847, AD-1637848, AD-1637849, AD-1637850, AD-1637851, AD-1637852, AD-1637853, AD-1637854, AD-1637855, AD-1637856, AD-1637857, AD-1637858,AD-1637859, AD-1637860, AD-1637861, AD-1637862, AD-1637863, AD-1637864, AD-1637865, AD-1637866, AD-1637867, AD-1637868, AD-1637869, AD-1637870, AD-1637871, AD-1637872, AD-1637873, AD-1637874, AD-1637875, AD-1637876, AD-1637877, AD-1637878, AD-1637879, AD-1637880, AD-1637881, AD-1637882, AD-1637883, AD-1637884, AD-1637885, AD-1637886, AD-1637887, AD-1637888, AD-1637889, AD-1637890, AD-1637891, AD-1637892, AD-1637893, AD-1637894, AD-1637895, AD-1637896, AD-1637897, AD-1637898, AD-1637899, AD-1637900, AD-1637901, AD-1637902, AD-1637903, AD-1637904, AD-1637905, AD-1637906, AD-1637907, AD-1637908, AD-1637909, AD-1637910, AD-1637911, AD-1637912, AD-1637913, AD-1637914, AD-1637915, AD-1637916, AD-1637917, AD-1637918, AD-1637919, AD-1637920, AD-1637921, AD-1637922, AD-1637923, AD-1637924, AD-1637925, AD-1637926, AD-1637927, AD-1637928, AD-1637929, AD-1637930, AD-1637931, AD-1637932, AD-1637933, AD-1637934, AD-1637935, AD-1637936, AD-1637937, AD-1637938, AD-1637939, AD-1637940, AD-1637941,AD-1637942, AD-1637943, AD-1637944, AD-1637945, AD-1637946, AD-1637947, AD-1637948, AD-1637949, AD-1637950, AD-1637951, AD-1637952, AD-1637953, AD-1637954, AD-1637955, AD-1637956, AD-1637957, AD-1637958, AD-1637959, AD-1637960, AD-397167 and AD-523565;, wherein the duplex is selected from the group consisting of AD-1637922, AD-1637806, AD-1637762, AD-1637777, AD-1637779, AD-1397081, AD-1637793, AD-1637798, AD-1637807, AD-1637829, AD-1637831, AD-1637840, AD-1637841, AD-1637855, AD-1637883 and AD-1637884; where the duplex is selected from the group consisting of AD-1623140, AD-1637701 and AD-1786708; where duplex is AD-1786708; where the region of complementarity consists of the antisense sequence; wherein the region of complementarity comprises at least nucleotides 1-17, 1-18, 1-19, 1-20, or 1-21 of the antisense sequence, counted from the 5' end of the antisense sequence; and / or wherein the region of complementarity comprises at least nucleotides 2-18, 2-19, 2-20, 2-21 or 2-22 of the antisense sequence, counted from the 5' end of the antisense sequence.

3. A double-stranded ribonucleic acid (dsRNA)-based agent for inhibiting the expression of MAPT, wherein the dsRNA-based agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region of complementarity to the mRNA encoding the tau protein, and wherein the region of complementarity comprises at least 17 consecutive nucleotides of the antisense sequence UACCA UNCGA GCUUG GGUCA CGU (SEQ ID NO. 1268), where only N represents a nucleotide that does not correspond to the mRNA encoding the tau protein.

4. The dsRNA-based agent of claim 3, wherein N is I, A, C, T, or U; where the antisense sequence is UACCA UHCGA GCUUG GGUCA CGU (SEQ ID NO. 1269), where H is A, C, T or U; where the antisense sequence is UACCA UACGA GCUUG GGUCA CGU (SEQ ID NO. 1003); wherein the region of complementarity comprises at least 18, 19, 20 or 21 consecutive nucleotides of the antisense sequence; where the region of complementarity consists of the antisense sequence; wherein the region of complementarity comprises at least nucleotides 1-17, 1-18, 1-19, 1-20, or 1-21 of the antisense sequence, counted from the 5' end of the antisense sequence; and / or wherein the region of complementarity comprises at least nucleotides 2-18, 2-19, 2-20, 2-21 or 2-22 of the antisense sequence, counted from the 5' end of the antisense sequence.

5. The dsRNA-based agent of claim 1, wherein the nucleotide sequence of the sense and antisense strand comprises any of the nucleotide sequences of the sense and antisense strand in any of Tables 3-6.

6. The dsRNA-based agent of claim 1, wherein the nucleotide sequence of the sense strand comprises at least 15 consecutive nucleotides corresponding to the sequence of the sense strand of exon 10 of the MAPT gene set forth in SEQ ID No.: 992, and the antisense strand comprises a sequence complementary thereto.

7. The dsRNA-based agent of claim 1, wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand are conjugated to one or more lipophilic moieties.

8. The dsRNA-based agent according to claim 7, wherein one or more lipophilic moieties are conjugated to one or more internal positions on at least one chain; wherein one or more lipophilic moieties are conjugated to one or more internal positions in the double-stranded region of the dsRNA-based agent; wherein one or more lipophilic moieties are conjugated via a linker or carrier; and / or where the lipophilicity of one or more lipophilic moieties, measured by logKow, exceeds 0.

9. The dsRNA-based agent of claim 1, wherein the hydrophobicity of the double-stranded RNA agent, as measured by the unbound fraction of the double-stranded RNA agent in a plasma protein binding assay, is greater than 0.2, optionally wherein the plasma protein binding assay is an electrophoretic mobility shift assay using human serum albumin protein.

10. The dsRNA-based agent of claim 1, wherein the dsRNA-based agent comprises at least one modified nucleotide.

11. The dsRNA-based agent according to claim 10, where no more than five nucleotides of the sense strand and no more than five nucleotides of the antisense strand are unmodified nucleotides; where all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides; wherein at least one of the modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymidine (dT) nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, a blocked nucleotide, an unblocked nucleotide, a conformationally constrained nucleotide, a constrained ethyl nucleotide, a baseless nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxyl-modified nucleotide, a 2'-methoxyethyl-modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholine nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, tetrahydropyran-modified nucleotide, 1,5-anhydrohexitol-modified nucleotide, cyclohexenyl-modified nucleotide, nucleotide containing a 5'-phosphothioate group, nucleotide,containing a 5'-methylphosphonate group, a nucleotide containing a 5'-phosphate or a 5'-phosphate mimetic, a nucleotide containing a vinylphosphonate, glycol nucleic acid (GNA), the S-isomer of glycol nucleic acid (S-GNA), 2'-5'-linked ribonucleotides ("3'-RNA"), a nucleotide containing 2-hydroxymethyltetrahydrofuran-5-phosphate, a nucleotide containing 2'-deoxythymidine-3'-phosphate, a nucleotide containing 2'-deoxyguanosine-3'-phosphate, and a terminal nucleotide linked to a cholesterol derivative and a bisdecylamide group of dodecanoic acid; and combinations thereof;, wherein the modified nucleotide is selected from the group consisting of a 2'-deoxy-2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, 3'-terminal deoxythymidine (dT) nucleotides, a blocked nucleotide, a baseless nucleotide, a 2'-amine-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholine nucleotide, a phosphoramidate, and a nucleotide containing a non-natural base; wherein the modified nucleotide comprises a short sequence of 3'-terminal deoxythymidine (dT) nucleotides; and / or wherein the modifications on the nucleotides are independently selected from the group consisting of 2'-deoxy, 2'-O-methyl, 3'-RNA, GNA, S-GNA and 2'-deoxy-2'-fluoro modifications.

12. The dsRNA-based agent of claim 1, further comprising at least one phosphorothioate internucleotide linkage; where the dsRNA-based agent contains 6-8 phosphorothioate internucleotide linkages; where each chain has a length of no more than 30 nucleotides; wherein at least one strand comprises a 3' overhang of at least 1 nucleotide; wherein at least one strand comprises a 3' overhang of at least 2 nucleotides; where the double-stranded region has a length of 15-30 nucleotide pairs; where the double-stranded region has a length of 16-20 nucleotide pairs; where the double-stranded region has a length of 10-18 nucleotide pairs; where the double-stranded region has a length of 10-16 nucleotide pairs; where the double-stranded region has a length of 12-14 nucleotide pairs; where the double-stranded region has a length of 14-16 nucleotide pairs; where each chain has 12-23 nucleotides; where each chain has 12-16 nucleotides; and / or where each chain has 14-16 nucleotides.

13. The dsRNA-based agent of claim 7, (i) wherein one or more lipophilic moieties are conjugated to one or more internal positions on at least one chain via a linker or carrier, optionally, where the internal positions include all positions except two end positions at each end of at least one chain; or wherein the internal positions include all positions except three end positions at each end of at least one chain; (ii) where internal positions exclude the region of the sense strand cleavage site, optionally, wherein internal positions include all positions except positions 9-12, counted from the 5'-end of the sense strand; and / or where internal positions include all positions except positions 11-13, counted from the 3'-end of the sense strand; (iii) where the internal positions exclude the antisense strand cleavage site region, optionally, wherein internal positions include all positions except positions 12-14, counted from the 5' end of the antisense strand; and / or where internal positions include all positions except positions 11-13 on the sense strand, counted from the 3' end, and positions 12-14 on the antisense strand, counted from the 5' end.

14. The dsRNA-based agent of claim 7, (i) wherein one or more lipophilic moieties are conjugated to one or more internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand and positions 6-10 and 15-18 on the antisense strand, counted from the 5' end of each strand, optionally, wherein one or more lipophilic moieties are conjugated to one or more internal positions selected from the group consisting of positions 5, 6, 7, 15 and 17 on the sense strand and positions 15 and 17 on the antisense strand, counted from the 5' end of each strand; (ii) where internal positions in the double-stranded region exclude the sense strand cleavage site region; (iii) wherein the sense strand is 21 nucleotides long, the antisense strand is 23 nucleotides long, and said one or more lipophilic moieties are conjugated to position 21, position 20, position 15, position 1, position 7, position 6, or position 2 of the sense strand or position 16 of the antisense strand, optionally, wherein one or more lipophilic moieties are conjugated to position 21, position 20, position 15, position 1, or position 7 of the sense strand, or wherein one or more lipophilic moieties are conjugated to position 21, position 20, or position 15 of the sense strand, or wherein one or more lipophilic moieties are conjugated to position 20 or position 15 of the sense strand, or wherein one or more lipophilic moieties are conjugated to position 16 of the antisense strand; or (iv) wherein one or more lipophilic moieties are an aliphatic, alicyclic or polyalicyclic compound, optionally wherein one or more lipophilic moieties are selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl and phenoxazine, or wherein one or more lipophilic moieties comprise a saturated or unsaturated C4-C30 hydrocarbon chain and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide and alkyne, or wherein one or more lipophilic moieties comprise a saturated or unsaturated C6-C18 hydrocarbon chain, or wherein one or more lipophilic moieties comprise a saturated or unsaturated C16 hydrocarbon chain, optionally, where the saturated or unsaturated C16 hydrocarbon chain is conjugated at position 6 or 7 of the sense strand, counting from the 5' end of the sense strand; (v) wherein one or more lipophilic moieties are conjugated via a carrier that replaces one or more nucleotides at an internal position(s) or a double-stranded region, optionally, wherein the carrier is a cyclic group selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl and decalinyl; or is an acyclic moiety based on a serinol backbone or a diethanolamine backbone; (vi) wherein one or more lipophilic moieties are conjugated to the double-stranded mRNA agent via a linker comprising an ether, thioether, urea, carbonate, amine, amide, maleimide thioether, disulfide, phosphodiester, sulfonamide linkage, click reaction product, or carbamate; (vii) wherein one or more lipophilic moieties are conjugated to a nucleobase, a sugar moiety, or an internucleoside linkage; (viii) wherein one or more lipophilic moieties or the targeting ligand are conjugated via a biodegradable linker selected from the group consisting of DNA, RNA, disulfide, amide, functionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, mannose, and combinations thereof; and / or (ix) wherein the 3'-end of the sense strand is protected by a terminal cap which is a cyclic group containing an amine, said cyclic group being selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolanyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl and decalinyl.

15. The dsRNA-based agent of claim 7, further comprising a targeting ligand that targets a neuronal cell.

16. The dsRNA-based agent of claim 7, further comprising a targeting ligand that targets a liver cell, optionally wherein the targeting ligand is a GalNAc conjugate.

17. The dsRNA-based agent according to claim 1, further comprising (i) a terminal chiral modification located in the first internucleotide linkage at the 3' end of the antisense strand, having the binding phosphorus atom in the Sp configuration, a terminal chiral modification located in the first internucleotide bond at the 5' end of the antisense strand, having the binding phosphorus atom in the Rp configuration, and a terminal chiral modification located in the first internucleotide linkage at the 5' end of the sense strand, having the binding phosphorus atom in either the Rp or Sp configuration; (ii) a terminal chiral modification located in the first and second internucleotide linkages at the 3' end of the antisense strand, having the binding phosphorus atom in the Sp configuration, a terminal chiral modification located in the first internucleotide bond at the 5' end of the antisense strand, having the binding phosphorus atom in the Rp configuration, and a terminal chiral modification located in the first internucleotide linkage at the 5' end of the sense strand, having the binding phosphorus atom in either the Rp or Sp configuration; (iii) a terminal chiral modification located in the first, second, or third internucleotide linkages at the 3' end of the antisense strand, having the binding phosphorus atom in the Sp configuration, a terminal chiral modification located in the first internucleotide bond at the 5' end of the antisense strand, having the binding phosphorus atom in the Rp configuration, and a terminal chiral modification located in the first internucleotide linkage at the 5' end of the sense strand, having the binding phosphorus atom in either the Rp or Sp configuration; (iv) a terminal chiral modification located in the first and second internucleotide linkages at the 3' end of the antisense strand, having the binding phosphorus atom in the Sp configuration, a terminal chiral modification located in the third internucleotide bond at the 3' end of the antisense strand, having a binding phosphorus atom in the Rp configuration, a terminal chiral modification located in the first internucleotide bond at the 5' end of the antisense strand, having the binding phosphorus atom in the Rp configuration, and a terminal chiral modification located in the first internucleotide linkage at the 5' end of the sense strand, having the linking phosphorus atom in either the Rp or Sp configuration; or (v) a terminal chiral modification located in the first and second internucleotide linkages at the 3' end of the antisense strand, having the binding phosphorus atom in the Sp configuration, a terminal chiral modification located in the first and second internucleotide bonds at the 5' end of the antisense strand, having a binding phosphorus atom in the Rp configuration, and a terminal chiral modification located in the first internucleotide linkage at the 5' end of the sense strand, having the binding phosphorus atom in either the Rp or Sp configuration.

18. The dsRNA-based agent according to claim 1, (i) wherein the dsRNA-based agent further comprises a phosphate or phosphate mimetic at the 5'-end of the antisense strand, optionally, where the phosphate mimetic is 5'-vinyl phosphonate (VP); (ii) where the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair; and / or (iii) where the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides.

19. A cell comprising a dsRNA-based agent according to any one of claims 1-18.

20. A pharmaceutical composition for inhibiting the expression of a gene encoding MAPT or for selectively inhibiting MAPT transcripts containing exon 10, comprising (i) a dsRNA-based agent according to any one of claims 1-18; or (ii) a dsRNA-based agent according to any one of claims 1-18 and a pharmaceutically acceptable diluent.

21. The pharmaceutical composition according to claim 20, (i) wherein the dsRNA-based agent is in an unbuffered solution, optionally, where the unbuffered solution is saline or water; (ii) wherein said dsRNA-based agent is in a buffer solution, optionally, wherein the buffer solution contains acetate, citrate, prolamine, carbonate or phosphate or any combination thereof, or where the buffer solution is phosphate buffered saline (PBS).

22. A method for inhibiting the expression of a MAPT gene or selectively inhibiting MAPT transcripts containing exon 10 in a cell, wherein the method comprises contacting the cell with a dsRNA-based agent according to any one of claims 1-18 or a pharmaceutical composition comprising a dsRNA-based agent according to any one of claims 1-18, thereby inhibiting the expression of the MAPT gene in the cell.

23. The method of claim 22, wherein (i) the cell is in the body of a subject, optionally wherein the subject is a human, optionally the subject has a MAP-associated disorder, optionally the MAP-associated disorder is a neurodegenerative disorder, optionally the neurodegenerative disorder is associated with an abnormality of the tau protein encoded by the MAP gene, optionally wherein the abnormality of the tau protein encoded by the MAP gene results in the aggregation of tau protein in the brain of the subject, where the neurodegenerative disorder is a familial disorder, a sporadic disorder and / or wherein the MAP-associated disorder is selected from the group consisting of tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant of frontotemporal dementia (bvFTD), nonfluent variant of primary progressive aphasia (nfvPPA), semantic variant of primary progressive aphasia (PPA-S), logopenic variant of primary progressive aphasia (PPA-L), 17-linked frontotemporal dementia with parkinsonism (FTDP-17), Pick's disease (PiD), argyrophilic granule disorder (AGD), multiple system tauopathy with presenile dementia (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), MAP-mutated FTLD, neurofibrillary dementia tangles (NFT), FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), corticobasal degeneration (CBD),progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1, and Down syndrome (DS); and / or, (ii) wherein the dsRNA-based agent or pharmaceutical composition inhibits the expression of MAPT by at least 25%; and / or reduces the level of tau protein in the blood serum of the subject by at least 25%.

24. A method of treating a subject having a disorder that can benefit from reducing the expression of a MAPT gene, comprising administering to the subject a therapeutically effective amount of a dsRNA-based agent according to any one of claims 1-18 or a pharmaceutical composition comprising a dsRNA-based agent according to any one of claims 1-18, thereby providing treatment for the subject having a disorder that can benefit from reducing the expression of MAPT.

25. The method of claim 24, wherein the disorder is associated with an abnormality in the tau protein encoded by the MAPT gene, optionally, where abnormality of the tau protein encoded by the MAPT gene results in tau protein aggregation in the subject's brain; wherein the disorder is selected from the group consisting of tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant of frontotemporal dementia (bvFTD), nonfluent variant of primary progressive aphasia (nfvPPA), primary progressive aphasia - semantic variant (PPA-S), logopenic variant of primary progressive aphasia (PPA-L), frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Pick's disease (PiD), argyrophilic granule disorder (AGD), multiple system tauopathy with presenile dementia (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAPT mutations, neurofibrillary tangle dementia (NFT), FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS), corticobasal degeneration (CBD), progressive supranuclear palsy (PSP),Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1 and Down syndrome (DS); where the subject is a human being; wherein administration of the dsRNA-based agent or pharmaceutical composition causes a decrease in tau protein aggregation in the brain of the subject; wherein the dsRNA-based agent is administered to the subject at a dose of from about 0.01 mg / kg to about 50 mg / kg; wherein the dsRNA-based agent is administered to the subject intrathecally; wherein the dsRNA-based agent is administered to the subject intracisternally; further including determination of the level of MART in sample(s) from the subject; where the level of MAPT in the sample(s) from the subject is the level of tau protein in the cerebrospinal fluid sample(s); and / or further comprising administering to the subject an additional therapeutic agent.

26. A kit or container comprising a dsRNA-based agent according to any one of claims 1-18 or a pharmaceutical composition according to claim 20 or 21 containing a dsRNA-based agent according to any one of claims 1-18, optionally wherein the container is a vial, a syringe or an intrathecal pump.

27. A double-stranded ribonucleic acid (dsRNA)-based agent, or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotide sequence of the antisense strand differs by no more than three bases from the nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID. NO: 1011), Where VP is 5'-vinylphosphonate; s represents a phosphorothioate linkage; a, c, g and u represent 2'-O-methyl (2'-OMe) A, C, G and U, respectively; dA is 2'-deoxy A; and Af, Gf, Uf represent 2'-deoxy-2'-fluoro (2'-F) of A, G, and U, respectively.

28. The dsRNA-based agent, or a pharmaceutically acceptable salt thereof, according to claim 27, wherein the nucleotide sequence of the antisense strand differs by no more than two bases from the nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID. NO: 1011).

29. A dsRNA-based agent or a pharmaceutically acceptable salt thereof according to claim 27, wherein the nucleotide sequence of the antisense strand differs by no more than one base from the nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID. NO: 1011).

30. A dsRNA-based agent or a pharmaceutically acceptable salt thereof according to claim 27, wherein the sense strand comprises a nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID. NO: 1007), Where (Chd) is 2'-O-hexadecylcytidine-3'-phosphate; s represents a phosphorothioate linkage; a, c, g and u represent 2'-O-methyl (2'-OMe) A, C, G and U, respectively; and Af, Cf and Gf represent 2'-deoxy-2'-fluoro (2'-F) A, C and G, respectively.

31. A double-stranded ribonucleic acid (dsRNA)-based agent or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID. NO: 1011), Where VP is 5'-vinylphosphonate; s represents a phosphorothioate linkage; a, c, g and u represent 2'-O-methyl (2'-OMe) A, C, G and U, respectively; dA is 2'-deoxy A; and Af, Gf, Uf represent 2'-deoxy-2'-fluoro (2'-F) of A, G, and U, respectively.

32. The dsRNA-based agent according to claim 31, or a pharmaceutically acceptable salt thereof, wherein the sense strand comprises a nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID. NO: 1007), Where (Chd) is 2'-O-hexadecylcytidine-3'-phosphate; s represents a phosphorothioate linkage; a, c, g and u represent 2'-O-methyl (2'-OMe) A, C, G and U, respectively; and Af, Cf and Gf represent 2'-deoxy-2'-fluoro (2'-F) A, C and G, respectively.

33. A double-stranded ribonucleic acid (dsRNA)-based agent or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand consists of a nucleotide sequence 5'-gsusgac(Chd)caAfGfCfucguauggsusa-3' (SEQ ID. NO: 1007), and the antisense strand consists of a nucleotide sequence 5'-VPusAfsccdAudAcgagcuUfgGfgucacsgsu-3' (SEQ ID. NO: 1011), Where VP is 5'-vinylphosphonate; s represents a phosphorothioate linkage; a, c, g and u represent 2'-O-methyl (2'-OMe) A, C, G and U, respectively; dA is 2'-deoxy A; Af, Cf, Gf, Uf represent 2'-deoxy-2'-fluoro (2'-F) A, C, G and U, respectively; and (Chd) is 2'-O-hexadecylcytidine-3'-phosphate.

34. A double-stranded ribonucleic acid (dsRNA)-based agent or a pharmaceutically acceptable salt thereof for inhibiting MAPT expression, wherein the dsRNA-based agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region of complementarity to mRNA encoding the tau protein, and wherein the region of complementarity comprises at least 17 consecutive nucleotides that differ in positions, with the exception of A at position 7, counted from the 5'-end of the antisense strand, by no more than three nucleotides from the antisense sequence, UACCA UACGA GCUUG GGUCA CGU (SEQ ID NO: 1003).

35. The dsRNA agent or its pharmaceutically acceptable salt according to claim 34, wherein the region of complementarity comprises at least 19 consecutive nucleotides of the antisense sequence; wherein the region of complementarity comprises at least nucleotides 2-18 of the antisense sequence, counted from the 5' end of the antisense sequence; wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 999; and / or wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1003.

36. A dsRNA-based agent or a pharmaceutically acceptable salt thereof according to claim 35, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 999, and the antisense strand comprises the nucleotide sequence of SEQ ID NO: 1003.

37. A dsRNA-based agent or a pharmaceutically acceptable salt thereof according to claim 35, wherein the sense strand consists of the nucleotide sequence of SEQ ID NO: 999, and the antisense strand consists of the nucleotide sequence of SEQ ID NO: 1003.

38. An agent based on double-stranded ribonucleic acid (dsRNA) or a pharmaceutically acceptable salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the nucleotide sequence of the sense strand comprises at least 15 consecutive nucleotides of the sequence GUGACCCAAGCUCGUAUGGUA (SEQ ID NO: 999).

39. A dsRNA-based agent or a pharmaceutically acceptable salt thereof according to claim 38, wherein the sense strand and the antisense strand are fully complementary.

40. A dsRNA-based agent or a pharmaceutically acceptable salt thereof according to claim 38, wherein the sense chain has a length of 17-21 nucleotides.

41. A dsRNA-based agent or a pharmaceutically acceptable salt thereof according to any one of paragraphs 27-40: wherein the dsRNA-based agent comprises at least one modified nucleotide, optionally wherein the at least one modified nucleotide is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymidine (dT) nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-fluoro-modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally constrained nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxyl-modified nucleotide, a 2'-methoxyethyl-modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholine nucleotide, phosphoramidate, nucleotide containing a non-natural base, tetrahydropyran-modified nucleotide, 1,5-anhydrohexitol-modified nucleotide,a cyclohexenyl-modified nucleotide, a nucleotide containing a 5'-phosphorothioate group, a nucleotide containing a 5'-methylphosphonate group, a nucleotide containing a 5'-phosphate or a 5'-phosphate mimetic, a nucleotide containing a vinylphosphonate, glycol nucleic acid (GNA), the S-isomer of glycol nucleic acid (S-GNA), 2'-5'-linked ribonucleotides ("3'-RNA"), a nucleotide containing 2-hydroxymethyltetrahydrofuran-5-phosphate, a nucleotide containing 2'-deoxythymidine-3'-phosphate, a nucleotide containing 2'-deoxyguanosine-3'-phosphate, and a terminal nucleotide linked to a cholesterol derivative and a bisdecylamide group of dodecanoic acid; and combinations thereof;, wherein at least one chain comprises a 3' sticky end of 1 or 2 nucleotides; where each chain has 19-23 nucleotides and forms a duplex region of 17-23 nucleotides in length; where the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides; wherein the dsRNA-based agent further comprises at least one phosphorothioate internucleotide linkage; where the dsRNA-based agent contains 6-8 phosphorothioate internucleotide linkages; wherein the dsRNA-based agent further comprises a phosphate or phosphate mimetic at the 5'-end of the antisense strand; where the phosphate mimetic is 5'-vinyl phosphonate (VP); where the base pair at position 1 of the 5' end of the antisense strand of the duplex is the AU base pair; wherein the sense strand, the antisense strand, or both the sense strand and the antisense strand are conjugated to one or more lipophilic moieties; one or more lipophilic moieties are conjugated to one or more internal positions selected from the group consisting of positions 4-8 and 13-18 in the sense strand, and positions 6-10 and 15-18 in the antisense strand, counted from the 5' end of each strand; wherein one or more lipophilic moieties comprise a saturated or unsaturated C4-C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide and alkyne; wherein one or more lipophilic moieties are conjugated to a nucleic acid base, a sugar moiety, or an internucleoside linkage; wherein one or more lipophilic moieties comprise a saturated or unsaturated C16 hydrocarbon chain; wherein a saturated or unsaturated C16 hydrocarbon chain is conjugated to position 6 or 7 of the sense strand, counted from the 5' end of the sense strand; and / or wherein its pharmaceutically acceptable salt is the sodium salt.

42. A pharmaceutical composition comprising a dsRNA-based agent or a pharmaceutically acceptable salt thereof according to any one of claims 27-40 and a pharmaceutically acceptable diluent.

43. The pharmaceutical composition according to claim 42, characterized in that the pharmaceutical composition includes a sterile aqueous solution, where the pharmaceutical composition contains a buffer and / or where the diluent is a saline solution or water.

44. A method for inhibiting the expression of a MAPT gene in a cell, wherein the method comprises: (a) contacting the cell with the dsRNA-based agent or a pharmaceutically acceptable salt thereof according to any one of claims 27-40 or a pharmaceutical composition comprising the dsRNA-based agent or a pharmaceutically acceptable salt thereof according to any one of claims 27-40; and (b) maintaining the cell obtained in step (a) for a time sufficient to degrade the MAPT gene mRNA transcript, thereby inhibiting the expression of the MAPT gene in the cell.

45. A method for treating a MAPT-associated neurodegenerative disease, comprising administering to a patient in need thereof a pharmaceutically effective amount of a dsRNA-based agent according to any one of claims 27-40 or a pharmaceutical composition comprising a dsRNA-based agent or a pharmaceutically acceptable salt thereof according to any one of claims 27-40.

46. ​​The method of claim 45, wherein the MAPT-associated neurodegenerative disease is selected from the group consisting of tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), behavioral variant of frontotemporal dementia (bvFTD), nonfluent variant of primary progressive aphasia (nfvPPA), semantic variant of primary progressive aphasia (PPA-S), logopenic variant of primary progressive aphasia (PPA-L), 17-linked frontotemporal dementia with parkinsonism (FTDP-17), Pick's disease (PiD), argyrophilic granule disorder (AGD), multiple system tauopathy with presenile dementia (MSTD), white matter tauopathy with globular glial inclusions (FTLD with GGI), FTLD with MAP mutations, dementia characterized by the appearance of neurofibrillary tangles (NFT), FTD with motor neuron disease, amyotrophic lateral sclerosis (ALS), corticobasal syndrome (CBS),corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), Parkinson's disease, postencephalitic parkinsonism, Niemann-Pick disease, Huntington's disease, myotonic dystrophy type 1 and Down syndrome (DS); where MART-associated neurodegenerative disease is Alzheimer's disease; where the MART-associated neurodegenerative disease is progressive supranuclear palsy (PSP); and / or where MART-associated neurodegenerative disease is a tauopathy.