Integrative plasmid and method for integrating genetic material into the strain genome
Patent Information
- Authority / Receiving Office
- RU · RU
- Patent Type
- Applications
- Current Assignee / Owner
- FEDERALNOE GOSUDARSTVENNOE BYUDZHETNOE UCHREZHDENIE NAUKI FEDERALNYJ ISSLEDOVATELSKIJ TSENTR KAZANSKIJ NAUCHNYJ TSENTR ROSSIJSKOJ AKADI NAUK
- Filing Date
- 2024-12-28
- Publication Date
- 2026-06-29
Claims
1. The integrative plasmid pK-int01150, having a size of 7564 bp and characterized by the nucleotide sequence pK-int01150 given in SEQ ID NO 1, as a means for integrating genes into the genome of the Pseudomonas putida B-13802 strain.
2. A method for integrating genetic material into the genome of the P. putida B-13802 strain, including creation of an expression cassette by cloning the target gene into the pJNT-L vector, amplification of the fragment containing the expression cassette using primers 01150-int-pJNTN-L-5, having the sequence GGCCGGTGCAGGCGACCCCCATGGGCAAATATTCTGAAATGAGCTGTTG, and 01150-int-pJNTN-L-3 with the sequence ACGCGGGTCGAATAGATCCCCCCAGTCTTTCGACTGAGCCTTTCG, cloning the resulting PCR fragment containing the expression cassette into the integrative plasmid pKint-01150, which has a size of 7564 bp and is characterized by the nucleotide sequence pKint-01150 given in SEQ ID NO 1, and conjugative transfer of this plasmid into the P. putida B-13802 strain, resulting in the integration of the pKint-01150 plasmid into the chromosome of the P. putida B-13802 strain.
3. The method according to paragraph 2, characterized in that the PCR is carried out in a mixture of 20 μl volume, consisting of 2 μl of 10× PCR buffer, 0.2 mM of each of the four deoxyribonucleoside triphosphates, 5 μl of the DNA fragment of the introduced gene, 1 pM of each of the primers specific to the introduced gene, 1 unit of polymerase, the rest being water.
4. The method according to paragraph 1, characterized in that the PCR is carried out observing the following regimens: primary denaturation at 95°C - 3 minutes, followed by 35 cycles with the regimen: denaturation at 95°C - 15 seconds, annealing at 55°C - 30 seconds and polymerization at 72°C - 1 minute in the case of one introduced gene, or 3 minutes in the case of introducing more than one gene.