A set of oligodeoxyribonucleotide primers and a fluorescently labeled probe for the identification of RNA / cDNA of the feline leukemia virus (FeLV)

Abstract

A set of specific oligodeoxyribonucleotide primers VT-Bc-F 5'- GAGGCAGCAACGGGTAAC -3', VT-Bc-R 5'- CCAATTGYTACTCTGGTGAGG -3' and a fluorescently labeled probe VT-Bc-P 5'-(R6G)- GTTCGATTCCGGAGAGGGAGC -(BHQ2)-3' to a fragment of the gene of the small ribosomal subunit of 16S RNA of pathogenic babesia of the genus Babesia for the detection of causative agents of babesiosis (piroplasmosis) in dogs.