MGAT1-DEFICIENT CELLS AND THEIR APPLICATIONS

Claims

1. A method for producing a modified cell deficient in mannosyl (alpha-1,3-)-glycoprotein-beta-1,2-N-acetylglucosaminyltransferase (MGAT1) activity, comprising: introducing into the parent cell an RNA-guided endonuclease together with a guide RNA (gRNA) containing the sequence GGAUGGCGCAGACCUGAGCAG (SEQ ID NO: 2), GGUAGUGGAGGACGAUCUGG (SEQ ID NO: 3), UUUCUCCACCUGUAGCAGGG (SEQ ID NO: 4) or GAUCGCCAGGCACACACCGCU (SEQ ID NO: 5); culturing the parent cell and propagating the parent cell; isolation of multiple daughter cells from a cell culture; identification of a modified cell deficient in MGAT1 activity; and isolation of the said modified cell deficient in MGAT1 activity.

2. The method according to claim 1, characterized in that the identification of a modified cell deficient in MGAT1 activity includes conducting an analysis for the cleavage of genomic DNA fragments amplified from a plurality of daughter cells by bacteriophage T7 endonuclease I (T7EI), and sequencing the genomic DNA fragments from cells positive for T7EI cleavage.

3. The method according to claim 1, characterized in that the gRNA contains RNA of regularly interspaced short palindromic repeats (crRNA) and transactivating crRNA (tracrRNA), and the RNA-guided endonuclease is Cas9.

4. The method according to claim 1, characterized in that the method includes introducing into the cell an RNA-guided endonuclease together with a guide RNA (gRNA) using electroporation of a pre-formed complex of the RNA-guided endonuclease and gRNA.

5. The method according to claim 1, characterized in that the parent cell is a CHO cell.

6. The method according to claim 5, characterized in that the gRNA contains the nucleic acid sequence SEQ ID NO:

3.

7. A cell line of Chinese hamster ovary cells obtained in accordance with the method of paragraph 1.

8. The cell line according to claim 7, characterized in that it is obtained from the CHO K1 cell line.

9. A method for producing a glycoprotein, wherein the method comprises: obtaining cells deficient in mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase (MGAT1) - scarce), obtained in accordance with the method according to paragraph 1; expression in a cell deficient in MGAT1 of a protein having an N-glycosylation site, resulting in the protein becoming N-glycosylated at the N-glycosylation site of an oligomannose glycan; and release of N-glycosylated protein from the cell.

10. The method of claim 9, further comprising incubating the glycosylated protein with glycopeptide-D-mannosyl-N4-(N-acetyl-D-glucosaminyl)2-asparagine-1,4-N-acetyl-beta-glucosaminehydrolase (Endo H) to remove the oligomannose glycan, leaving an N-acetylglucosamine residue at the N-glycosylation site.

11. The method according to claim 9, characterized in that the protein is a viral envelope protein.

12. The method according to claim 11, characterized in that the protein is a viral envelope protein selected from the group consisting of the SARS-CoV2 spike protein, the pan-sarbecovirus spike protein, the pan-betacoronavirus spike protein, and the influenza virus hemagglutinin.

13. The method according to claim 12, characterized in that the SARS-CoV2 spike protein is an alpha-SARS-CoV2 spike protein, a beta-SARS-CoV2 spike protein, a gamma-SARS-CoV2 spike protein, a delta-SARS-CoV2 spike protein, or an omicron-SARS-CoV2 spike protein.

14. The method according to claim 13, characterized in that the SARS-CoV2 spike protein comprises the amino acid sequence SEQ ID NO: 16 or SEQ ID NO:

17.

15. The method according to claim 9, characterized in that the protein is selected from the group consisting of alpha-fetoprotein, β-human chorionic gonadotropin, tumor antigens 15-3, 19-9, 27, 29, 125 and 549, carcinoembryonic antigen, cell adhesion molecule associated with carcinoembryonic antigen, human epidermal growth factor receptor 2, oncofetal fibronectin, placental alkaline phosphatase and prostate-specific antigen.

16. A method for producing a glycoprotein, wherein the method comprises: obtaining cells deficient in mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase (deficient in MGAT1) in accordance with the method of claim 1; expression in a cell deficient in MGAT1 of a protein having an N-glycosylation site, resulting in the protein becoming N-glycosylated at the N-glycosylation site of an oligomannose glycan; and release of N-glycosylated protein from the cell.

17. A Chinese hamster ovary cell line deficient in mannosyl-(alpha-1,3-)-glycoprotein-beta-1,2-N-acetylglucosaminyltransferase activity, wherein the cell line contains in its genome a nucleic acid having the sequence of SEQ ID NO:

6.

18. The cell line according to claim 17, characterized in that it is obtained from the CHO K1 cell line.

19. A method for producing a glycoprotein, wherein the method comprises: obtaining a cell line of Chinese hamster ovary cells according to claim 17, deficient in mannosyl-(alpha-1,3-)-glycoprotein-beta-1,2-N-acetylglucosaminyltransferase; expressing in a cell line a protein having an N-glycosylation site, resulting in the protein becoming N-glycosylated at the N-glycosylation site of an oligomannose glycan; and Isolation of N-glycosylated protein from a cell line.

20. The method of claim 19, further comprising incubating the glycosylated protein with glycopeptide-D-mannosyl-N4-(N-acetyl-D-glucosaminyl)2-asparagine-1,4-N-acetyl-beta-glucosaminehydrolase (Endo H) to remove the oligomannose glycan, leaving an N-acetylglucosamine residue at the N-glycosylation site.

21. The method according to claim 19, characterized in that the protein is a viral envelope protein.

22. The method according to claim 21, characterized in that the protein is a viral envelope protein selected from the group consisting of the SARS-CoV2 spike protein, the pan-sarbecovirus spike protein, the pan-betacoronavirus spike protein, and the influenza virus hemagglutinin.

23. The method according to claim 22, wherein the SARS-CoV2 spike protein is an alpha-SARS-CoV2 spike protein, a beta-SARS-CoV2 spike protein, a gamma-SARS-CoV2 spike protein, a delta-SARS-CoV2 spike protein, or an omicron-SARS-CoV2 spike protein.

24. The method according to claim 23, characterized in that the SARS-CoV2 spike protein comprises the amino acid sequence SEQ ID NO: 16 or SEQ ID NO:

17.

25. The method according to claim 19, characterized in that the protein is selected from the group consisting of alpha-fetoprotein, β-human chorionic gonadotropin, tumor antigens 15-3, 19-9, 27, 29, 125 and 549, carcinoembryonic antigen, cell adhesion molecule associated with carcinoembryonic antigen, human epidermal growth factor receptor 2, oncofetal fibronectin, placental alkaline phosphatase and prostate-specific antigen.