dsRNA Molecule for Inhibiting C5 Gene Expression and Its Application
Patent Information
- Application Number
- RU2025136098
- Authority / Receiving Office
- RU · RU
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-24
- Publication Date
- 2026-06-30
Claims
1. A dsRNA molecule for inhibiting the expression of a complement component 5 (C5) gene, comprising a sense strand and an antisense strand complementary to each other with the possibility of forming a double-stranded region, wherein the sense strand and / or antisense strand comprises or consists of 15-25 nucleotides, the antisense strand comprises contiguous bases complementary to at least 15, 16, 17, 18, 19, 20 or 21 contiguous bases in a sequence set forth under any of SEQ ID NOs: 1-98, the double-stranded region has a length of 15-25 nucleotides (nt), wherein at least one nucleotide in the dsRNA molecule comprises a modification.
2. The dsRNA molecule according to claim 1, in which: the base sequence of the sense strand is as set forth in SEQ ID NO: 85 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 185; or the base sequence of the sense strand is as set forth in SEQ ID NO: 5 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 105; or the base sequence of the sense strand is as set forth in SEQ ID NO: 17 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 117; or the base sequence of the sense strand is as set forth in SEQ ID NO: 1 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 101; or the base sequence of the sense strand is as set forth in SEQ ID NO: 2 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 102; or the base sequence of the sense strand is as set forth in SEQ ID NO: 3 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 103; or the base sequence of the sense strand is as set forth in SEQ ID NO: 4 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 104; or the base sequence of the sense strand is as set forth in SEQ ID NO: 6 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 106; or the base sequence of the sense strand is as set forth in SEQ ID NO: 7 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 107; or the base sequence of the sense strand is as set forth in SEQ ID NO: 8 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 108; or the base sequence of the sense strand is as set forth in SEQ ID NO: 9 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 109; or the base sequence of the sense strand is as set forth in SEQ ID NO: 10 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 110; or the base sequence of the sense strand is as set forth in SEQ ID NO: 11 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 111; or the base sequence of the sense strand is as set forth in SEQ ID NO: 12 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 112; or the base sequence of the sense strand is as set forth in SEQ ID NO: 13 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 113; or the base sequence of the sense strand is as set forth in SEQ ID NO: 14 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 114; or the base sequence of the sense strand is as set forth in SEQ ID NO: 15 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 115; or the base sequence of the sense strand is as set forth in SEQ ID NO: 16 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 116; or the base sequence of the sense strand is as set forth in SEQ ID NO: 18 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 118; or the base sequence of the sense strand is as set forth in SEQ ID NO: 19 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 119; or the base sequence of the sense strand is as set forth in SEQ ID NO: 20 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 120; or the base sequence of the sense strand is as set forth in SEQ ID NO: 21 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 121; or the base sequence of the sense strand is as set forth in SEQ ID NO: 22 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 122; or the base sequence of the sense strand is as set forth in SEQ ID NO: 23 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 123; or the base sequence of the sense strand is as set forth in SEQ ID NO: 24 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 124; or the base sequence of the sense strand is as set forth in SEQ ID NO: 25 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 125; or the base sequence of the sense strand is as set forth in SEQ ID NO: 26 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 126; or the base sequence of the sense strand is as set forth in SEQ ID NO: 27 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 127; or the base sequence of the sense strand is as set forth in SEQ ID NO: 28 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 128; or the base sequence of the sense strand is as set forth in SEQ ID NO: 29 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 129; or the base sequence of the sense strand is as set forth in SEQ ID NO: 30 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 130; or the base sequence of the sense strand is as set forth in SEQ ID NO: 31 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 131; or the base sequence of the sense strand is as set forth in SEQ ID NO: 32 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 132; or the base sequence of the sense strand is as set forth in SEQ ID NO: 33 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 133; or the base sequence of the sense strand is as set forth in SEQ ID NO: 34 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 134; or the base sequence of the sense strand is as set forth in SEQ ID NO: 35 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 135; or the base sequence of the sense strand is as set forth in SEQ ID NO: 36 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 136; or the base sequence of the sense strand is as set forth in SEQ ID NO: 37 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 137; or the base sequence of the sense strand is as set forth in SEQ ID NO: 38 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 138; or the base sequence of the sense strand is as set forth in SEQ ID NO: 39 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 139; or the base sequence of the sense strand is as set forth in SEQ ID NO: 40 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 140; or the base sequence of the sense strand is as set forth in SEQ ID NO: 41 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 141; or the base sequence of the sense strand is as set forth in SEQ ID NO: 42 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 142; or the base sequence of the sense strand is as set forth in SEQ ID NO: 43 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 143; or the base sequence of the sense strand is as set forth in SEQ ID NO: 44 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 144; or the base sequence of the sense strand is as set forth in SEQ ID NO: 45 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 145; or the base sequence of the sense strand is as set forth in SEQ ID NO: 46 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 146; or the base sequence of the sense strand is as set forth in SEQ ID NO: 47 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 147; or the base sequence of the sense strand is as set forth in SEQ ID NO: 48 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 148; or the base sequence of the sense strand is as set forth in SEQ ID NO: 49 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 149; or the base sequence of the sense strand is as set forth in SEQ ID NO: 50 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 150; or the base sequence of the sense strand is as set forth in SEQ ID NO: 51 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 151; or the base sequence of the sense strand is as set forth in SEQ ID NO: 52 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 152; or the base sequence of the sense strand is as set forth in SEQ ID NO: 53 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 153; or the base sequence of the sense strand is as set forth in SEQ ID NO: 54 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 154; or the base sequence of the sense strand is as set forth in SEQ ID NO: 55 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 155; or the base sequence of the sense strand is as set forth in SEQ ID NO: 56 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 156; or the base sequence of the sense strand is as set forth in SEQ ID NO: 57 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 157; or the base sequence of the sense strand is as set forth in SEQ ID NO: 58 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 158; or the base sequence of the sense strand is as set forth in SEQ ID NO: 59 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 159; or the base sequence of the sense strand is as set forth in SEQ ID NO: 60 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 160; or the base sequence of the sense strand is as set forth in SEQ ID NO: 61 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 161; or the base sequence of the sense strand is as set forth in SEQ ID NO: 62 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 162; or the base sequence of the sense strand is as set forth in SEQ ID NO: 63 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 163; or the base sequence of the sense strand is as set forth in SEQ ID NO: 64 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 164; or the base sequence of the sense strand is as set forth in SEQ ID NO: 65 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 165; or the base sequence of the sense strand is as set forth in SEQ ID NO: 66 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 166; or the base sequence of the sense strand is as set forth in SEQ ID NO: 67 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 167; or the base sequence of the sense strand is as set forth in SEQ ID NO: 68 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 168; or the base sequence of the sense strand is as set forth in SEQ ID NO: 69 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 169; or the base sequence of the sense strand is as set forth in SEQ ID NO: 70 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 170; or the base sequence of the sense strand is as set forth in SEQ ID NO: 71 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 171; or the base sequence of the sense strand is as set forth in SEQ ID NO: 72 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 172; or the base sequence of the sense strand is as set forth in SEQ ID NO: 73 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 173; or the base sequence of the sense strand is as set forth in SEQ ID NO: 74 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 174; or the base sequence of the sense strand is as set forth in SEQ ID NO: 75 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 175; or the base sequence of the sense strand is as set forth in SEQ ID NO: 76 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 176; or the base sequence of the sense strand is as set forth in SEQ ID NO: 77 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 177; or the base sequence of the sense strand is as set forth in SEQ ID NO: 78 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 178; or the base sequence of the sense strand is as set forth in SEQ ID NO: 79 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 179; or the base sequence of the sense strand is as set forth in SEQ ID NO: 80 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 180; or the base sequence of the sense strand is as set forth in SEQ ID NO: 81 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 181; or the base sequence of the sense strand is as set forth in SEQ ID NO: 82 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 182; or the base sequence of the sense strand is as set forth in SEQ ID NO: 83 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 183; or the base sequence of the sense strand is as set forth in SEQ ID NO: 84 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 184; or the base sequence of the sense strand is as set forth in SEQ ID NO: 86 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 186; or the base sequence of the sense strand is as set forth in SEQ ID NO: 87 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 187; or the base sequence of the sense strand is as set forth in SEQ ID NO: 88 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 188; or the base sequence of the sense strand is as set forth in SEQ ID NO: 89 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 189; or the base sequence of the sense strand is as set forth in SEQ ID NO: 90 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 190; or the base sequence of the sense strand is as set forth in SEQ ID NO: 91 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 191; or the base sequence of the sense strand is as set forth in SEQ ID NO: 92 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 192; or the base sequence of the sense strand is as set forth in SEQ ID NO: 93 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 193; or the base sequence of the sense strand is as set forth in SEQ ID NO: 94 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 194; or the base sequence of the sense strand is as set forth in SEQ ID NO: 95 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 195; or the base sequence of the sense strand is as set forth in SEQ ID NO: 96 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 196; or the base sequence of the sense strand is as set forth in SEQ ID NO: 97 and the base sequence of the antisense strand is as set forth in SEQ ID NO: 197; or the base sequence of the sense strand is as set forth in SEQ ID NO: 98, and the base sequence of the antisense strand is as set forth in SEQ ID NO:
198.
3. The dsRNA molecule of any one of claims 1, 2, wherein the modification is one or more selected from the group consisting of a closed nucleic acid modification, an open or unclosed nucleic acid modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-methyl modification, 2'-C-methyl modification, 2'-fluoro modification, 2'-deoxy modification, phosphorothioate backbone modification, DNA modification, fluorescent probe modification, and ligand modification.
4. A dsRNA molecule according to any one of paragraphs 1-3, characterized in that the dsRNA molecule contains modifications, wherein: (i) the sense strand is 21 nt long, has 2'-fluoro modifications at positions 7 and 9-11 from the 5' end and 2'-O-methyl modifications at the remaining positions, and has backbone phosphorothioate linkages between adjacent nucleotides at positions 1-3 from the 5' end; and (ii) the antisense strand is 23 nt long, has 2'-fluoro modifications at positions 2, 14, and 16 and an optional position 6 at the 5' end and 2'-O-methyl modifications at the remaining positions, and has backbone phosphorothioate linkages between adjacent nucleotides at positions 1-3 at the 5' end and between adjacent nucleotides at positions 1-3 at the 3' end.
5. A dsRNA molecule according to any one of paragraphs 1-4, in which: the base sequence of the sense strand of the dsRNA molecule is set forth under SEQ ID NO: 85, and the base sequence of the antisense strand of the dsRNA molecule is set forth under SEQ ID NO: 185; or the base sequence of the sense strand of the dsRNA molecule is set forth under SEQ ID NO: 5, and the base sequence of the antisense strand of the dsRNA molecule is set forth under SEQ ID NO: 105; or the base sequence of the sense strand of the dsRNA molecule is set forth under SEQ ID NO: 17, and the base sequence of the antisense strand of the dsRNA molecule is set forth under SEQ ID NO:
117.
6. A dsRNA molecule according to any one of paragraphs 1-5, in which: the semantic strand of the dsRNA molecule contains modifications defined in Motif i modification: Motive and modifications: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXmXm; And the antisense strand of the dsRNA molecule contains modifications defined in Motif iii modification or Motif iv modification: Motive iii modification: XmsXfsXmXmXmXfXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmsXmsXm, or Motive iv modification: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmsXmsXm; wherein for each Modification Motif, individual "X"s represent ribonucleotides from the 5' end to the 3' end of the sense strand or antisense strand sequentially, "Xm" represents a ribonucleotide containing a 2'-O-methyl modification, "Xf" represents a ribonucleotide containing a 2'-fluoro modification, and "s" represents a backbone phosphorothioate linkage between two flanking ribonucleotides.
7. A dsRNA molecule according to any one of claims 1-6, characterized in that the dsRNA molecule additionally contains a ligand targeting the liver.
8. The dsRNA molecule of claim 7, wherein the ligand targets liver parenchymal cells.
9. The dsRNA molecule of claim 7, wherein the ligand is conjugated to the 3' end of the sense strand.
10. The dsRNA molecule of claim 7, wherein the ligand is a derivative or analogue of N-acetylgalactosamine (GalNAc).
11. A dsRNA molecule according to any one of paragraphs 1-10, characterized in that the dsRNA molecule additionally contains a ligand conjugated to the 3'-end of the sense strand, the ligand being L96, wherein the dsRNA molecule has a structure of Formula I: Formula I, where "SS" represents the sense strand and "AS" represents the antisense strand.
12. The dsRNA molecule of claim 6, wherein the sense strand comprises modifications defined in Motif i modification and the antisense strand comprises modifications defined in Motif iv modification.
13. A pharmaceutical composition comprising a dsRNA molecule according to any one of claims 1-12 and a pharmaceutically acceptable excipient.
14. The pharmaceutical composition according to claim 13, characterized in that the pharmaceutical composition also contains an additional compound that inhibits complement proteins or the expression of complement proteins.
15. A method for inhibiting the expression of the complement C5 gene, or decreased serum C5 protein levels, or prevention and / or treatment of complement C5 gene-mediated disease, or alleviating the symptoms of a complement C5 gene-mediated disease in a subject, comprising the step of administering to a subject in need thereof an effective amount of dsRNA according to any one of claims 1-12 or a pharmaceutical composition according to claim 13 or 14.
16. The method of claim 15, wherein the complement gene C5-mediated disease is at least one selected from the group consisting of ophthalmological diseases, including dry / wet age-related macular degeneration (AMD) and geographic atrophy (GA); hematological diseases, including paroxysmal nocturnal hemoglobinuria (PNH) and thrombotic microangiopathies (TMA); cardiovascular diseases; autoimmune diseases, including rheumatoid arthritis and lupus erythematosus; kidney diseases, including atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3G), IgA nephropathy and lupus nephritis; neurological diseases, including Alzheimer's disease (AD) and myasthenia gravis (MG); neoplastic diseases, including complement-associated liver cancer or lung cancer;surgery-related diseases, including ischemia-reperfusion liver injury, burn rehabilitation and post-transplant rejection; and respiratory diseases, including asthma, idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease (COPD).
17. A double-stranded nucleic acid for inhibiting expression of the C5 gene or a pharmaceutically acceptable salt thereof, wherein the double-stranded nucleic acid comprises a first strand and a second strand, wherein: the base sequence of the first chain is AUCGUAACAACAUUUCUUCACUA (SEQ ID NO: 185), and the base sequence of the second chain is GUGAAGAAAUGUUGUUACGAU (SEQ ID NO: 85); or the base sequence of the first chain is GUAUCCAUAAACUUGAAUCACAA (SEQ ID NO: 105), and the base sequence of the second chain is GUGAUUCAAGUUUAUGGAUAC (SEQ ID NO: 5); wherein the first chain has the modifications defined in Motif iv modification: Motive iv modification: XmsXfsXmXmXmXmXmXmXmXmXmXmXmXfXmXfXmXmXmXmXmsXmsXm; And The second chain is conjugated to ligand L96 at the 3' end and has the modifications defined in Motif i modification: Motive and modifications: XmsXmsXmXmXmXmXfXmXfXfXfXmXmXmXmXmXmXmXmXmXm; wherein individual "X"s represent ribonucleotides from the 5' end to the 3' end of the first strand or the second strand sequentially, "Xm" represents a 2'-O-methyl-modified ribonucleotide of A, U, C, or G, "Xf" represents a 2'-fluoro-modified ribonucleotide of A, U, C, or G, and "s" represents a backbone phosphorothioate linkage between two flanking ribonucleotides, wherein Double-stranded nucleic acid has the following structure: where "SS" represents the second chain and "AS" represents the first chain.
18. A pharmaceutical composition comprising a double-stranded nucleic acid or a pharmaceutically acceptable salt thereof according to claim 17 and a pharmaceutically acceptable carrier.
19. A method for inhibiting the expression of the complement C5 gene, or reducing the level of C5 protein in serum, or preventing and / or treating a disease mediated by the complement C5 gene, or alleviating the symptoms of a disease mediated by the complement C5 gene in a subject, comprising the step of administering to a subject in need thereof an effective amount of a double-stranded nucleic acid or a pharmaceutically acceptable salt thereof according to claim 17 or a pharmaceutical composition according to claim 18.
20. The method of claim 19, wherein the C5 complement gene-mediated disease is at least one selected from the group consisting of ophthalmological diseases, including dry / wet age-related macular degeneration (AMD) and geographic atrophy (GA); hematological diseases, including paroxysmal nocturnal hemoglobinuria (PNH) and thrombotic microangiopathies (TMA); cardiovascular diseases; autoimmune diseases, including rheumatoid arthritis and lupus erythematosus; kidney diseases, including atypical hemolytic uremic syndrome (aHUS), C3 glomerulopathy (C3G), IgA nephropathy and lupus nephritis; neurological diseases, including Alzheimer's disease (AD) and myasthenia gravis (MG); neoplastic diseases, including complement-associated liver cancer or lung cancer;surgery-related diseases, including ischemia-reperfusion liver injury, burn rehabilitation and post-transplant rejection; and respiratory diseases, including asthma, idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease (COPD).