RNA Interference Agent for Inhibition of AGT Gene Expression and Its Application

Claims

1. A double-stranded RNA interference (RNAi) agent comprising a sense strand and an antisense strand, wherein the nucleotide sequences of the sense strand and antisense strand are as shown in any of the dsRNA sequences in Table 2.

2. A double-stranded RNAi agent according to claim 1, comprising a sense strand and an antisense strand, wherein (1) the sense strand comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 1) (in the 5' to 3' direction), and / or the antisense strand comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 2) (in the 5' to 3' direction); (2) the sense strand comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACC (SEQ ID NO: 3) (in the 5' to 3' direction), and / or the antisense strand comprises the nucleotide sequence GGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 4) (in the 5' to 3' direction), or (3) the sense strand comprises the nucleotide sequence CUUCUAAUGAGUCGACUUUGA (SEQ ID NO: 5) (in the 5' to 3' direction), and / or the antisense strand comprises the nucleotide sequence UCAAAGUCGACUCAUUAGAAGAA (SEQ ID NO: 6) (in the 5' to 3' direction).

3. The double-stranded RNAi agent of claim 1 or 2, wherein the double-stranded RNAi agent comprises, on one or more nucleotides of its sense strand and antisense strand, one or more modifications selected from the group consisting of: 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxy, a locked nucleic acid modification, a ring-opening or unlocked nucleic acid modification, a DNA modification, and a fluorescent probe modification; preferably, both the sense strand and the antisense strand of the double-stranded RNAi agent comprise 2'-O-methyl and / or 2'-fluoro modifications.

4. The double-stranded RNAi agent of claim 3, wherein the double-stranded RNAi agent further comprises at least one thiophosphate or methylphosphonate internucleotide linkage, preferably at least one thiophosphate linkage; further preferably, the internucleotide linkage is located at the 5'-end and 3'-end of the sense strand and the antisense strand; and more preferably, the internucleotide linkage is located within three nucleotides at the 5'-end and 3'-end of the sense strand and the antisense strand.

5. The double-stranded RNAi agent of any one of claims 1 to 4, wherein the double-stranded RNAi agent comprises: (1) an antisense strand having an overhang with the structure 5'(s)mN(s)mN3' at the 3' end; (2) an antisense strand comprising a fluoro modification at least at positions 2, 14, and 16 from the 5' end and a methoxy modification at the remaining positions; (3) an antisense strand comprising at least two thiophosphate modifications from the 3' end and the 5' end, preferably an antisense strand comprising a thiophosphate modification of the backbone at least at the first and second internucleotide linkages from the 3' end and the 5' end; (4) a sense strand comprising a fluoro modification at positions 7 and 9-11 from the 5' end and a methoxy modification at the remaining positions; and (5) a sense strand comprising at least two thiophosphate modifications from the 5' end, preferably a sense strand comprising a thiophosphate modification of the backbone at least in the first and second internucleotide linkages from the 5' end.

6. The double-stranded RNAi agent of any one of claims 1 to 5, wherein the double-stranded RNAi agent is conjugated to at least one ligand selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine (GalNAc) derivatives or analogs; preferably, the ligand is N-acetylglucosamine (GalNAc) derivatives or analogs.

7. The double-stranded RNAi agent of claim 6, wherein the ligand is linked to the 3'-end, 5'-end and / or within the strand of the double-stranded RNAi agent; preferably, the ligand is linked to the 3'-end of the sense strand of the double-stranded RNAi agent.

8. Double-stranded RNAi agent containing: (1) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO: 8); (2) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO: 10); (3) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12); (4) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO: 14); (5) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16); (6) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO: 18); (7) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of AmsGfsAmAmGmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO: 19), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmCmUmUmCmUm (SEQ ID NO: 20); (8) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm (SEQ ID NO: 22); (9) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmGmAm (SEQ ID NO: 24); (10) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO: 25), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO: 26), or (11) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAm (SEQ ID NO: 28); where Am, Um, Cm, and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro-modified ribonucleotides A, U, C, and G, respectively; and (s) denotes that two adjacent nucleotides are linked via a thiophosphate backbone.

9. The double-stranded RNAi agent of claim 8, wherein the double-stranded RNAi agent is conjugated to at least one ligand.

10. The double-stranded RNAi agent of claim 9, wherein the ligand is a derivative or analog of N-acetylglucosamine (GalNAc); preferably, the derivative or analog of N-acetylglucosamine (GalNAc) is linked to the 3' end of the sense strand of the double-stranded RNAi agent; more preferably, GalNAc has a structure represented by formula II: Formula II.

11. A double-stranded RNAi agent according to any one of claims 8-10, comprising: (1) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm-L96 (SEQ ID NO: 29); (2) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCm-L96 (SEQ ID NO: 30); (3) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm-L96 (SEQ ID NO: 31); (4) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm-L96 (SEQ ID NO: 32); (5) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm-L96 (SEQ ID NO: 33); (6) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsGmsAmCmAmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm-L96 (SEQ ID NO: 34); (7) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of AmsGfsAmAmGmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO: 19), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCm-L96 (SEQ ID NO: 35); (8) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm-L96 (SEQ ID NO: 36); (9) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmGmAm-L96 (SEQ ID NO: 37); (10) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO: 25), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm-L96 (SEQ ID NO: 38), or (11) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAm-L96 (SEQ ID NO: 39); where Am, Um, Cm and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro-modified ribonucleotides A, U, C and G, respectively; and (s) means that two adjacent nucleotides are linked via a phosphorothioate backbone, and L96 is linked to the 3' end of the sense strand of the double-stranded RNAi agent and has the structural formula represented by formula III: Formula III.

12. The double-stranded RNAi agent of claim 11, wherein the double-stranded RNAi agent has a structure represented by formula IV: Formula IV.

13. A reagent or kit comprising a double-stranded RNAi agent according to any one of claims 1-12.

14. A pharmaceutical composition comprising a double-stranded RNAi agent according to any one of claims 1-12.

15. Use of a double-stranded RNAi agent according to any one of claims 1-12 or a pharmaceutical composition according to claim 14 for the preparation of a medicament for the prevention and / or treatment of a disease mediated by AGT expression or the alleviation of symptoms of a disease mediated by the AGT gene.

16. The use according to claim 15, wherein the disease mediated by the AGT gene includes hypertension, borderline hypertension, primary hypertension, secondary hypertension, critical hypertension, uncomplicated hypertensive crisis, isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, intraocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension;Hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other states of glucocorticoid excess including chronic steroid therapy, pheochromocytoma, reninoma, secondary aldosteronism and other states of mineralocorticoid excess, sleep apnea syndrome, thyroid / parathyroid disease, heart failure, myocardial infarction, angina, stroke, diabetes mellitus, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR) and intrauterine growth retardation of the fetus.;