Arriah-saratov strain of newcastle disease virus avian orthoavulavirus 1 for evaluating effectiveness of vaccines against newcastle disease and production of drugs for diagnosis of newcastle disease
The VNIIZH-Saratov strain of Newcastle disease virus addresses the ineffectiveness of existing vaccines by providing a virulent strain for diagnostics and vaccine evaluation, ensuring high antibody titers and protection against genotype VII strains.
Patent Information
- Application Number
- RU2025128106
- Authority / Receiving Office
- RU · RU
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2025-10-14
- Publication Date
- 2026-06-29
- Estimated Expiration
- 2045-10-14
Smart Images

Figure 00000001
Abstract
Description
[0001] The invention relates to the field of veterinary virology and biotechnology, namely to the production of a new strain of the Newcastle disease virus, and can be used to diagnose Newcastle disease, as well as to evaluate the effectiveness of biopreparations for the specific prevention of Newcastle disease.
[0002] Newcastle disease is one of the most significant infectious diseases for poultry farming in Russia and, despite regular preventive vaccination, Newcastle disease virus (NDV) is widespread and still poses a threat to poultry farming [1].
[0003] Newcastle disease (ND, pseudofowl plague) is a highly contagious viral infection, primarily affecting chickens, characterized by pneumonia, encephalitis, and damage to internal organs. It is considered a particularly dangerous infection. Transmission factors include infected birds and virus-contaminated objects.
[0004] Newcastle disease virus (Avian orthoavulavirus1) is an RNA-containing virus, belongs to the paramyxovirus family (Paramyxoviridae) genus Orthoavulavirus[2].
[0005] Currently, in the Russian Federation, the disease is classified as a controlled infection in industrial poultry farms. However, despite regular preventive vaccination programs, new cases of the disease are registered annually in poultry farms and private households [3].
[0006] The causative agent of the infection is widespread in many countries around the world, but the frequency of outbreaks of the disease and the number of affected birds vary significantly, depending on both climatic and socio-economic factors.
[0007] Newcastle disease virus has a wide host range. More than 240 bird species belonging to 27 orders are susceptible to the disease. Wild birds are the natural reservoir of the virus, in which the disease often proceeds asymptomatically [4].
[0008] The greatest threat to poultry farming in Russia and neighboring countries in recent years has been posed by virulent Newcastle disease viruses of genotypes VI and VII [5].
[0009] Seasonal migrations of wild birds facilitate the spread of various Newcastle disease virus variants to remote geographic regions and ensure their long-term presence in many ecosystems, which underscores the importance and necessity of epizootic monitoring of the virus in natural conditions. During seasonal migrations, diverse ecological groups of wild birds move along different routes, maintaining favorable habitats.
[0010] During the development of industrial poultry farming, the disease spread over vast territories. Many authors believe the causes of this phenomenon include the migration of wild and exotic birds, the movement of racing pigeons, and the arrival of replacement pigeons from regions with high rates of poultry disease. Also playing a significant role in the spread of Newcastle disease are the uncontrolled sale of poultry products, the high concentration of poultry in a limited area, violations of veterinary and sanitary regulations and poultry rearing and husbandry practices, and the use of contaminated feed. The virus's ability to persist in birds for long periods of time poses a particular threat [1].
[0011] Newcastle disease virus outbreaks are registered annually in various countries. According to the World Organization for Animal Health (OIE), in 2023, 322 outbreaks of Newcastle disease were registered in 18 countries, 13 of which were in the Russian Federation [6].
[0012] It should also be added that the most common vaccine strains today were isolated in the mid-thirties of the last century and belong to class 2 genotype II, while the most dangerous - highly pathogenic strains of the Newcastle disease virus - belong to class 2 genotype VII. Representatives of this genetic group have spread almost throughout the world, including South America and China [7]. In the Russian Federation, in 2019, subgenotype VII-L was isolated in 17 foci of Newcastle disease [8]. Extensive seromonitoring conducted in the same year showed the presence of antibodies to the Newcastle disease virus in 39% of samples from unvaccinated backyard chickens and a high seroprevalence of synanthropic birds [9].
[0013] Known strains of the Newcastle disease virus isolated in the Russian Federation are used to produce diagnostic and vaccine preparations.
[0014] The strain “NDV / Mallard / Adigeya / 8 / 2008” of the Newcastle disease virus is known, isolated from a dead duck to study the oncolytic properties and mechanisms of oncolysis, as well as to develop candidate anticancer drugs based on it
[10] .
[0015] Recombinant Newcastle disease viruses with oncolytic activity are known. However, the use of these genetically engineered constructs is associated with a high risk of reverse mutations, low viability, and complex production technology. Furthermore, there is a risk of initiating mutations in the host DNA due to the presence of vector structures in the genome of these viruses
[11] .
[0016] The strain “NDV / Pigeon / Omsk / 13 / 2008” of the Newcastle disease virus is known, obtained from a clinically healthy pigeon for the preparation of antigen-containing serum for the purpose of serodiagnosis of Newcastle disease
[12] .
[0017] The strain “NDV / Altai / pigeon / 770 / 2011” of the Newcastle disease virus is known, it belongs to the group of strains of pigeon paramyxovirus type 1 (GPMV-1) for studying the oncolytic properties and mechanisms of oncolysis with the prospect of creating a prototype anticancer drug
[13] .
[0018] The strains “D26” and “Beaudette C” of the Newcastle disease virus are known and are used to create diagnostic serums
[14] .
[0019] The above strains belong to class 2, genotype II.
[0020] There are 48 known strains of Newcastle disease virus with pronounced oncological properties
[15] , isolated from natural reservoirs among birds in various regions of Russia and used in the development of effective diagnostic and vaccine preparations for Newcastle disease.
[0021] The cold-adapted strain “N” of GKV 2348 and the strain “VBN-X-32 / 19” of Newcastle disease virus, used as an interferon inducer, are known
[16] .
[0022] The above inventions on strains relate to medical virology.
[0023] There are several strains for the preparation of live vaccines for the specific prevention of Newcastle disease, such as "La Sota", "B1", "Bor-74 VGNKI" or "V-4", "GAM-61" [17, 18]. Strains "La Sota", "Bor-74 VGNKI", "B1" in a dose of 1-5x10 6 ED 50 / cm 3 When administered intranasally, they induce the production of virus-specific antibodies (≥3 log2) and protect at least 80% of birds from the disease. However, these strains only reproduce in chicken embryos, and only SPF embryos are used for their cultivation.
[0024] The vaccine produced in the Russian Federation from the mesogenic strain "N" has proven itself in conditions of epizootic instability and unfavorable conditions, but its use is limited due to residual virulence for chickens of younger age groups.
[0025] The GAM-61 strain was obtained by attenuation of the virulent ND virus by intermittent passages in primary calf kidney cell cultures and chicken embryos and is a strain of the latest selection. The virus replicated in primary (chicken, duck, and quail fibroblasts, embryonic kidneys, and cattle testicles) and continuous lines (Hela, Hep-1, and SPEV). The hemagglutination level was in the range of 2-4 log2, and the infectious titer was 5.0-6.0 lg TCID. 50 / cm 3 .
[0026] The vaccine strain "ARRIAH-G7", belonging to the II genotype of the Newcastle disease virus, is closest to the proposed invention in terms of its essential features. This strain is proposed as a production strain and is used for the manufacture of biopreparations for specific prophylaxis, as well as for the manufacture of biopreparations for the diagnosis of Newcastle disease
[19] .
[0027] The La Sota vaccine strain was isolated in 1946 and is antigenically different from currently existing variants of the Newcastle disease virus. One of the most important factors in selecting an effective strain for the production of biopreparations for diagnostics and specific prophylaxis is the antigenic match between the hemagglutinin of the vaccine strain and the strain circulating in the field. It was established that inherited variation in the structure of the hemagglutinin-neuraminidase epitope occurred over 6 years in 22 of 56 isolates of the Newcastle disease virus
[20] . Thus, the antigenic distance between the vaccine and field strains may be one of the main reasons for the reduced effectiveness of vaccines against Newcastle disease used in practice. In addition, it is known that immune sera obtained after vaccination of birds with the La Sota strain antigen, tested in the RTGA with homo- and heterologous antigens (strains of genotype VII), demonstrated significant differences
[21] .
[0028] To test the vaccine's effectiveness in the USSR, the classical virulent Newcastle disease virus genotype 2, strain "Tomilinsky T-53," was used. The infectious activity of this virus is 7.5-10.0 lg EID. 50 / cm 3 , the antigenic activity in the RGA is within 8-9 log2
[22] . The virus has a clear cytopathic effect; when it is cultivated in the PSGC culture, pronounced destruction of the cellular monolayer is observed in the form of the formation of symplasts and multinucleated syncytia
[21] . Nevertheless, the current epizootic situation with Newcastle disease in Russia and worldwide indicates a large number of outbreaks caused by Newcastle disease viruses of genotype VII, and emphasizes the importance of assessing the effectiveness of vaccines using virulent viruses of genotype VII.
[0029] According to the results of a comparative analysis of nucleotide sequences, the isolated "ARRIAH-Saratov" strain of the Newcastle disease virus Avian orthoavulavirus1 belongs to genotype VII, which differs significantly from production strains of the Newcastle disease virus.
[0030] The patent and scientific literature does not contain any known technical solutions containing the VNIIZH-Saratov strain of the Newcastle disease virus Avian orthoavulavirus1 similar to the claimed one, i.e. the proposal meets the criterion of “novelty”.
[0031] The technical challenge lies in expanding the arsenal of current strains of the Newcastle disease virus circulating in the Russian Federation, which possess infectious activity and retain pathogenic properties, thereby ensuring the production of sensitive and highly specific diagnostics and means for monitoring the immunogenic activity of vaccines.
[0032] The problem was solved by obtaining the VNIIZH-Saratov strain of the Newcastle disease virus Avian orthoavulavirus1 genotype VII, which can be used to evaluate the effectiveness of vaccines against Newcastle disease and to manufacture drugs for diagnosing Newcastle disease.
[0033] The viral isolate "NDV / rus / chicken / Saratov / 2403-3 / 22", which served as the source for obtaining the strain, was isolated at the Federal State Budgetary Institution "All-Russian Research Institute of Animal Health" in 2022 from samples of pathological material obtained from poultry from private farms in the Saratov Region.
[0034] As a result of research work by passaging the isolated virus on SPF chicken embryos using the method of limiting dilutions from allantoic fluid, the "ARRIAH-Saratov" strain of the Newcastle disease virus was obtained.
[0035] The strain "VNIIZZH-Saratov" is deposited in the All-Russian State Collection of Exotic Types of Foot-and-Mouth Disease Virus and Other Animal Pathogens (GKSHM) of the FGBU "VNIIZZH", under the registration number: No. 789 - dep / 25-6 - GKSHM of the FGBU "VNIIZZH".
[0036] The possibility of using the VNIIZH-Saratov strain of the Newcastle disease virus Avian orthoavulavirus1 to evaluate the effectiveness of vaccines against Newcastle disease and to produce drugs for diagnosing Newcastle disease has been experimentally confirmed.
[0037] The essence of the invention is explained in the graphic image:
[0038] Fig. 1. Dendrogram reflecting the phylogenetic position of the "ARRIAH-Saratov" strain of Newcastle disease virus (Avian orthoavulavirus 1) with epizootic and vaccine strains of Newcastle disease virus. The dendrogram is based on a comparison of the nucleotide sequences of the F gene (nucleotides 1-1662 of the ORF of the F gene).
[0039] It was shown that the studied strain "ARRIAH-Saratov" of the Newcastle disease virus Avian orthoavulavirus1 belongs to the subgenotype VII.1.1 (VII-L).
[0040] The essence of the invention is explained by the following sequence lists:
[0041] SEQ ID NO:1 represents the nucleotide sequence of the F gene of the VNIIZH-Saratov strain of Newcastle disease virus subgenotype VII.1.1 (VII-L).
[0042] The "ARRIAH-Saratov" strain of Newcastle disease virus Avian orthoavulavirus1 is characterized by the following signs and properties.
[0043] Morphological features
[0044] The "ARRIAH-Saratov" strain of Newcastle disease virus (NDV) belongs to the Paramyxoviridae family, genus Orthoavulavirus, species Avian orthoavulavirus 1, and possesses morphological features characteristic of Newcastle disease virus (NDV). The NDV virion size ranges from 120-300 nm. The virion shape is generally spherical, with occasional filamentous forms. The NDV genome is single-stranded minus RNA consisting of 15,186, 15,192, or 15,198 nucleotide bases. The RNA contains six genes separated by conserved noncoding "start" and "end" regions that control transcription. Among genera within the Paramyxoviridae family, the gene order is universal, while their number varies, ranging from 6 to 10.
[0045] Virions of the Paramyxoviridae family have a bilayer lipid membrane that incorporates part of the host cell's plasma membrane. The membrane contains glycoprotein "spikes" that facilitate virion entry and exit from the cell. The "spikes" consist of viral proteins: the fusion protein (F) and hemagglutinin-neuraminidase. The attachment protein (HN) is a trimer and contains two chains, F1 and F2, linked by disulfide bridges. The viral surface hemagglutinin-neuraminidase (HN) and the F fusion protein play a key role in the fusion of the cell and virion membranes and its entry into the infecting cell.
[0046] Genetic identification of the strain.
[0047] The nucleotide sequence of a 331-nt F gene fragment (nucleotides 43-373 of the F gene ORF) was obtained for analysis. The F0 protein cleavage site sequence of the studied sample is 112-RRQKR^F-117 and contains paired basic amino acids, which is characteristic of virulent forms of orthoavulavirus 1 (Newcastle disease virus). This site sequence ensures efficient cleavage by cellular proteases in various organ systems and ensures the virulence of the strain.
[0048] According to its genetic properties, the VNIIZh-Saratov strain of the Newcastle disease virus belongs to class II, according to the traditional classification - genotype VII, subgenotype L, according to the classification of Dimitrov et al., 2019 - group VII.1.1.
[0049] Comparative analysis of the obtained sequences with previously determined and published sequences showed their high similarity to the sequences of a number of isolates of the VII1.1 (VIIL) subgenotype isolated over the past 15 years in Iran and regularly detected in the Russian Federation since 2019. The studied sequence had the greatest similarity to the sequence of isolates identified in the Vladimir and Samara regions and the Republic of Bashkortostan in 2021-2022.
[0050] Antigenic properties
[0051] Based on its antigenic properties, the VNIIZh-Saratov strain of Newcastle disease virus belongs to subgenotype VII.1.1. Inoculation of poultry with the VNIIZh-Saratov strain of Newcastle disease virus is accompanied by the formation of virus-neutralizing antibodies in the blood at a titer of 8.60 ± 0.22 log2. The hemagglutinating activity of the VNIIZh-Saratov strain of Newcastle disease virus in the RGA is 1:64.
[0052] Resistance to external factors
[0053] The VNIIZh-Saratov strain of Newcastle disease virus Avian orthoavulavirus1 is sensitive to detergents, formaldehyde, ethanol, mirodes basic, chloramine B, and is quickly inactivated by heating (56°C), ultraviolet irradiation, and at pH below 5.0.
[0054] Biotechnological properties
[0055] The optimal conditions for cultivating the VNIIZh-Saratov strain of the Newcastle disease virus are as follows:
[0056] - cultivation system - developing chicken embryos aged 9-11 days;
[0057] - infection method - inoculation with a syringe into the allantoic cavity;
[0058] - the duration of virus cultivation is 48 hours.
[0059] When cultivated, the VNIIZh-Saratov strain of the Newcastle disease virus accumulates in a titer of 9.1 lg EID 50 / cm 3 retains its original characteristics when passaged in sensitive biological systems for at least 5 passages (observation period).
[0060] Geno- and chemotaxonomic characteristics
[0061] The "ARRIAH-Saratov" strain of Newcastle disease virus belongs to the order Mononegavirales, family Paramyxoviridae, subfamily Avulavirinae, genus Orthoavulavirus, species Avian orthoavulavirus 1. The genome is represented by single-stranded, non-fragmented RNA of negative polarity with a length of 15,192 nucleotides. The viral genome encodes six structural proteins: nucleoprotein (NP) (ORF - 122...1591 nt), phosphoprotein (P) (ORF - 1893...3080 nt), matrix protein (M) (ORF - 3296...4390 nt), fusion protein (F) (ORF - 4550...6211 nt), hemagglutinin-neuraminidase (HN) (ORF - 6418...8133 nt) and RNA-dependent RNA polymerase (L) (ORF - 8387...15001 nt) [22, 23].
[0062] The classification of Newcastle disease virus strains and isolates is based on the complete sequence of the F fusion gene [24-26]. Phylogenetic analysis of the nucleotide sequence of the F gene revealed (Fig. 1) that the studied "ARRIAH-Saratov" strain of Newcastle disease virus belongs to subgenotype VII.1.1 according to the classification of Dimitrov et al. (2019)
[24] or subgenotype VII-L according to the classification of Diel et al. (2012)
[26] . Viruses of this subgenotype are widespread in the Middle East, as well as in China and Indonesia. The studied sequence of the "ARRIAH-Saratov" strain had the greatest similarity to the sequence of isolates identified in the Vladimir and Samara regions and the Republic of Bashkortostan in 2021-2022.
[0063] Additional features and properties
[0064] Virulent: High. The 50% lethal dose is 9.5 lg LD 50 / cm 3 The intracerebral pathogenicity index is 1.62.
[0065] Contagiousness - contagious. Non-immune chickens can become infected when kept together with infected ones.
[0066] Contamination with bacteria, fungi, mycoplasma and foreign viruses - the VNIIZh-Saratov strain of Newcastle disease virus in birds is not contaminated with bacteria, fungi, mycoplasma and foreign viruses.
[0067] Storage conditions
[0068] When storing the strain at a temperature of minus (45.0±5.0)°C, the permissible shelf life without refreshment is 5 years.
[0069] The essence of the proposed invention is explained by examples of its use, which do not limit the scope of the invention.
[0070] Example 1. Identification and phylogenetic relationship of the “ARRIAH-Saratov” strain of Newcastle disease virus.
[0071] Genetic identification of the obtained virus and comparative analysis of the cDNA sequence were performed. Reverse transcription-polymerase chain reaction (RT-PCR) was used. Nucleotide sequencing was performed for identification and phylogenetic analysis.
[0072] Alignment and editing of nucleotide sequences were performed using ClustalW and BioEdit software (version 7.0.5.3). Phylogenetic analysis was performed using the maximum likelihood method with the HKY model. The stability of the phylogeny was tested using the bootstrap method (500 replicates). A discrete gamma distribution was used to model differences in the rates of site evolution. The analysis was performed using MEGA X (version 10.2.6). The dendrogram is based on a comparison of the nucleotide sequences of the F fusion gene (nucleotides 1-1662 of the ORF) (Fig. 1).
[0073] The study established that the VNIIZh-Saratov strain of Newcastle disease virus belongs to the VII.1.1 (VII-L) subgenotype (Fig. 1). The study was based on determining the primary structure of the F gene of the tested sample of the VNIIZh-Saratov strain of Newcastle disease virus, followed by an analysis of the phylogenetic relationship with other strains and isolates of Newcastle disease virus.
[0074] Example 2. Obtaining a viral suspension of the VNIIZh-Saratov strain of the Newcastle disease virus.
[0075] Developing SPF chicken embryos incubated 9-11 days were used to cultivate the virulent "ARRIAH-Saratov" strain of Newcastle disease virus. Before use, the embryos were ovoscoped to confirm their condition. The position and boundary of the pugi were marked with a pencil on the shell surface.
[0076] An ampoule containing a lyophilized viral suspension of the VNIIZh-Saratov strain of Newcastle disease virus was opened, saline was added to the initial volume of the preparation before lyophilization, and the suspension was resuspended, during which the sublimate completely dissolved. The viral material was then diluted with sterile saline (pH 7.2-7.6). The dilution rate was determined such that 0.1 cm³ of viral suspension contained from 2.0 to 5.0 lg EID. 50 virus.
[0077] The embryo's shell was treated with a disinfectant solution. A hole approximately 1 mm in diameter was made in the shell near the pugus, 5-6 mm above the air cell border. A 0.1 cm³ viral suspension of the VNIIZH-Saratov strain of Newcastle disease virus was injected into the allantoic cavity through the hole in the embryo's natural air cell using a syringe. The hole in the shell was then filled with sterile paraffin.
[0078] Infected chicken embryos were placed in a thermostat at a temperature of (37.5 ± 0.5)°C and a relative humidity of 50-70%. Infected chicken embryos were examined using an ovoscope daily for 4 days. All embryos that died within 24 hours of incubation were discarded. Only live embryos incubated for 24-96 hours were used to prepare inoculum.
[0079] After incubation, live chicken embryos were placed in a refrigerated chamber (4°C) for 18 hours. Before dissection, the chicken embryos were kept at room temperature for 3 hours until the condensation (moisture) on the shell evaporated.
[0080] The inoculum was collected aseptically. The eggshell above the air cell was disinfected with 70% alcohol and then flambed. The eggshell was broken open, then the inner shell membrane was removed with sterile eye tweezers, and the allantoic fluid was aspirated with a sterile pipette into sterile, numbered 100 cm³ vials. The virus-containing fluid from each vial was inoculated onto bacterial media to check for microbial contamination and to determine the hemagglutinating titer.
[0081] The absence of contamination by bacteria and fungi is determined according to GOST 28085
[27] . Contamination of the viral suspension of the VNIIZh-Saratov strain by foreign bacteria and fungi was absent.
[0082] The contamination of the seed material with mycoplasmas was tested in accordance with the requirements of the State Pharmacopoeia XV, Volume II, pp. 2997-3008 (OPS.1.7.2.0031)
[28] . There was no growth of mycoplasmas on the media.
[0083] Tests for contamination with foreign viruses were carried out by the PCR method using test systems (commercial kits and methods).
[0084] According to the relevant PCR methods, the viral suspension of the VNIIZh-Saratov strain of the Newcastle disease virus was tested for the absence of genomes of the following possible contaminants:
[0085] - chicken infectious bronchitis virus according to the “Methodological recommendations for the detection of the chicken infectious bronchitis virus genome using real-time polymerase chain reaction”
[29] ;
[0086] - infectious bursal disease virus according to the “Guidelines for the detection of the genome of chicken infectious bursal disease virus using real-time polymerase chain reaction”
[30] ;
[0087] - infectious encephalomyelitis virus according to the “Methodological recommendations for the detection of RNA of the infectious encephalomyelitis virus of chickens by the polymerase chain reaction method in real time”
[31] ;
[0088] - egg drop syndrome virus-76 according to the “Methodological recommendations for the detection of egg drop syndrome virus DNA by real-time polymerase chain reaction”
[32] ;
[0089] - chicken reovirus infection virus according to the “Methodological recommendations for the detection of chicken reovirus RNA by the polymerase chain reaction method in real time”
[33] ;
[0090] - avian infectious laryngotracheitis virus according to the “Methodological recommendations for the detection of the genome of avian infectious laryngotracheitis virus using real-time polymerase chain reaction”
[34] ;
[0091] - chicken infectious anemia virus according to the “Methodological recommendations for the indication of chicken infectious anemia virus using polymerase chain reaction”
[35] ;
[0092] - fowlpox virus according to the “Methodological recommendations for the detection of fowlpox virus DNA by real-time polymerase chain reaction”
[36] ;
[0093] - avian leukosis virus according to the “Guidelines for the detection of the genome of avian leukosis virus subtype J using real-time polymerase chain reaction”
[37] ;
[0094] - avian influenza A virus according to the “Methodological recommendations for the detection of RNA of the avian influenza virus type A by the RT-PCR method in real time”
[38] ;
[0095] - Marek's disease virus according to the “Methodological recommendations for the detection of DNA of Marek's disease virus of three serotypes using real-time polymerase chain reaction in multiplex format”
[39] ;
[0096] - turkey rhinotracheitis virus (avian metapneumovirus) according to the “Methodological guidelines for identifying the genome of avian metapneumoviruses of subtypes A and B using real-time polymerase chain reaction”
[40] .
[0097] All the above reactions had negative results, which confirms the absence of genomes of other viruses in the viral suspension of the VNIIZh-Saratov strain of the ND virus.
[0098] The nucleotide sequence of the F0 gene fragment of the ND virus was determined by PCR in accordance with the “Methodology for identifying the genome and strain differentiation of the Newcastle disease virus using PCR and direct sequencing”
[41] .
[0099] As a result of the research, it was established that the obtained VNIIZh-Saratov strain of Newcastle disease virus is not contaminated with bacteria, fungi, mycoplasmas and foreign viruses, and the nucleotide sequence of the F0 gene fragment corresponded to the F0 gene sequence of the reference VNIIZh-Saratov strain of ND virus.
[0100] As a result of tests using the polymerase chain reaction (PCR) and reverse transcription polymerase chain reaction (RT-PCR) methods, it was found that the VNIIZh-Saratov strain of Newcastle disease virus is not contaminated with avian influenza (A), chicken infectious bronchitis (IB), avian infectious laryngotracheitis (ILT), infectious bursal disease (IBD), avian reovirus, EDS-76, chicken infectious anemia, chicken infectious encephalomyelitis, chicken pox and chicken leukemia and contains only the genome of the Newcastle disease virus.
[0101] Example 3. Determination of the infectious activity of the “ARRIAH-Saratov” strain of the Newcastle disease virus.
[0102] Determination of the infectious activity of the VNIIZh-Saratov strain of the Newcastle disease virus was carried out on developing SPF chicken embryos.
[0103] Three vials of lyophilized viral material of the VNIIZh-Saratov strain of Newcastle disease virus were resuspended: physiological solution was added to each vial to reach the initial volume of the material before lyophilization, forming a suspension, and the contents of the vials were combined to obtain an average sample.
[0104] Successive tenfold dilutions of virus-containing material were prepared in physiological solution up to 10 -10 inclusive.
[0105] Each dilution (from 10 -5 up to 10 -10 ) 0.1 cm³ of antigen were inoculated into the allantoic cavity of five embryos. At least five embryos were left as controls.
[0106] Infected embryos were incubated for 72 hours at a temperature of (37.5±0.5)°C and a relative humidity of 50-70%. Ovoscopy of infected embryos was performed at intervals of 6 hours.
[0107] Embryo death during the first 24 hours was considered nonspecific. After 72 hours of incubation, all embryos were cooled at 4-8°C for 12-18 hours and dissected.
[0108] Before embryo dissection, the shells above the air space were disinfected with a 70% alcohol solution and flambed. In a sterile box, the upper portion of the shell was cut off with scissors around the circumference of the pugi, and the embryo membranes were opened. Allantoic fluid from the embryo cavity was pipetted and collected in glass tubes from each embryo separately. The hemagglutinating activity of the virus was monitored in a droplet hemagglutination assay (DHA), which was performed on glass by mixing one drop of allantoic fluid with one drop of a 5% suspension of chicken erythrocytes.
[0109] The virus titer was calculated using the Spearman-Kerber method. The infectious activity of the VNIIZH-Saratov strain of Newcastle disease virus was 9.1 lg EID. 50 / cm³.
[0110] Example 4. Determination of the hemagglutinating activity of the “ARRIAH-Saratov” strain of the Newcastle disease virus.
[0111] The hemagglutinating activity of the VNIIZh-Saratov strain of the Newcastle disease virus was determined in the hemagglutination reaction (HAR) using the micromethod in a volume of 0.025 cm³.
[0112] For viral hepatitis assay, two-fold dilutions of the viral suspension were prepared in 0.025 cm³ saline. Each dilution was prepared using a separate pipette.
[0113] A 72-well Plexiglas plate was used for the viral hepatitis assay. 0.025 cm³ of saline was added to one row of wells. 0.025 cm³ of the starting material was added to the first well (to obtain a 1:2 dilution). Using a new pipette, the liquid in this well was thoroughly mixed, and then 0.025 cm³ was transferred to the next well to obtain a 1:4 dilution of the virus. Subsequent dilutions were prepared in the same manner.
[0114] After mixing, 0.025 cm³ of the contents of the last well was removed. Then, 0.025 cm³ of a 1% erythrocyte suspension was added to the resulting dilutions of the VNIIZh-Saratov strain of Newcastle disease virus.
[0115] The plate was then shaken and left at room temperature for 30-45 minutes. The reaction was then recorded based on the shape and size of the erythrocyte sediment.
[0116] When a large precipitate in the form of an “umbrella” was formed, the reaction was assessed by 3 crosses (+++), a less intense reaction by 2 crosses (++), and a weak reaction by 1 cross (+).
[0117] The hemagglutinin titer or one hemagglutinating unit (HAU) was defined as the highest virus dilution that yielded clearly expressed agglutination of erythrocytes by 3 or 2 crosses.
[0118] When performing the RHA, a check for nonspecific erythrocyte agglutination was mandatory. For this purpose, 0.025 cm³ of a 1% erythrocyte suspension was added to 0.025 cm³ of saline.
[0119] Thus, the hemagglutinating titer of the lyophilized VNIIZH-Saratov strain of Newcastle disease virus was 1:64.
[0120] Example 5. Determination of virulence of the "ARRIAH-Saratov" strain of Newcastle disease virus. Intracerebral pathogenicity index (ICPI).
[0121] The method involves assessing the virulence of the virus by intracerebral infection of day-old chicks with virus-containing allantoic fluid.
[0122] Three vials containing the inoculum of the "ARRIAH-Saratov" strain of Newcastle disease virus were used. The pooled sample was inoculated into the allantoic cavity of 9-11-day-old SPF chicken embryos in a volume of 0.1 cm 3 .
[0123] Inoculated chicken embryos were incubated at a temperature of (37.0±0.5)°C and a relative humidity of 60-70% for 24-96 hours. The resulting allantoic fluid with a titer in RGA 2 9 (1 / 512) was diluted with sterile saline solution at a ratio of 1 / 10 without the addition of antibiotics. Ten chickens obtained from SPF eggs were infected with this virus dilution intracerebrally in a volume of 0.05 cm 3 The control group of 10 chickens was injected intracerebrally with a sterile physiological isotonic solution in a volume of 0.05 cm 3 At the time of inoculation, the bird should be 24-40 hours old.
[0124] Observations were conducted every 24 hours for 8 days, assigning each bird a score: 0 for healthy, 1 for sick, and 2 for dead. Dead birds were assigned 2 points for the remainder of the experiment (8 days).
[0125] The intracerebral pathogenicity index was calculated as the average score of the pathogenic effect of the virus on poultry per observation over an 8-day period. Strains with an index greater than 0.7 are considered velogenic or virulent.
[0126] As a result of the study, it was established that the intracerebral pathogenicity index of the VNIIZh-Saratov strain of the Newcastle disease virus Avian orthoavulavirus 1 was 1.62 (Table 1).
[0127] Example 6. Determination of the 50% lethal dose (LD) 50 ) of the VNIIZh-Saratov strain of the Newcastle disease virus in chickens.
[0128] Titration of infectivity was performed on 40-day-old egg-laying chickens. For this, a total sample of material obtained by combining suspensions from two vials containing the VNIIZh-Saratov strain of Newcastle disease virus was diluted to a power of 10. Five chickens were inoculated with the prepared dilutions in the femoral muscle in a volume of 0.5 cm. 3 Over the next 14 days, sick and dead birds were counted daily. Results were recorded based on the number of birds killed and the presence of pronounced clinical signs of disease (Table 2).
[0129] Logarithmic value of the infectious virus titer (lg T, LD 50 ) in a given injection volume (v) was calculated using the Spearman-Kerber formula.
[0130] lgT =X max +lgh×(∑c+0.5),
[0131] where: ∑c is the sum of the estimates of positive effects (values 1>C>0) established within the boundaries of the working range;
[0132] lg h = 1;
[0133] 0.5 - constant coefficient.
[0134] Using the Spearman-Kerber method, the 50% lethal dose of the virus was calculated to be 9.5 lg LD 50 / cm 3 .
[0135] Example 7. Obtaining specific components of the VNIIZh-Saratov strain of Newcastle disease virus for RTGA.
[0136] Obtaining antigen from the VNIIZh-Saratov strain of Newcastle disease virus. A sample of thiomersal at a rate of 1 g per 4 L of fluid and a prepared aqueous solution of aminoethylethyleneimine inactivator with a pH of 8.2-8.3, calculated to produce a concentration of 0.25% in the suspension, were added to the extraembryonic fluid of chicken embryos infected with a viral suspension from the VNIIZh-Saratov strain of Newcastle disease virus obtained in Example 1. Virus inactivation was carried out at 37°C for 24 hours. The resulting antigen was tested for sterility and completeness of inactivation.
[0137] Thus, the inactivated antigen of the Newcastle disease virus Avian orthoavulavirus1 was obtained by VNIIZH-Saratov.
[0138] Obtaining hyperimmune blood serum for the "ARRIAH-Saratov" strain of Newcastle disease virus. For this purpose, a specific immunogenic complex was prepared - a vaccine consisting of the "ARRIAH-Saratov" strain antigen of Newcastle disease virus and an oil adjuvant, in a ratio of 30-70%.
[0139] Then 3 chickens were immunized with this vaccine in a volume of 0.5 cm³, intramuscularly.
[0140] On the 28th day after immunization, blood was collected from the chickens to obtain serum. The collected serum was analyzed using the HI method to detect specific antibodies to the VRIAH-Saratov strain of Newcastle disease virus. It was found that 28 days after vaccination, the birds produced a high titer of antibodies to Newcastle disease virus. Thus, the average antibody titer to the VRIAH-Saratov strain of Newcastle disease virus in vaccinated birds was 8.60 ± 0.22 log2 (Table 3).
[0141] Thus, a highly active and specific blood serum to the VNIIZh-Saratov strain of the Newcastle disease virus was obtained.
[0142] Example 8. Use of the antigen of the VNIIZh-Saratov strain of the Newcastle disease virus for performing RTGA.
[0143] To monitor humoral immunity in vaccinated chickens, the inactivated antigen from the VRIAH-Saratov strain of Newcastle disease virus (Avian orthoavulavirus1), obtained in Example 7, and the antigen from the La Sota strain of Newcastle disease virus were used as antigens in the HI assay. Thirty chickens were used in the experiment, divided into three groups of 10 chickens each. Chickens in each group were immunized with various Newcastle disease vaccines according to the product instructions.
[0144] Group 1 was immunized with a monovalent vaccine from the VNIIZh G7 strain;
[0145] Group 2 was immunized with a monovalent vaccine from the VNIIZh NB-En strain;
[0146] Group 3 was immunized with a monovalent vaccine from the La Sota strain.
[0147] On day 28 post-immunization, blood was collected from the chickens. The resulting blood serum was analyzed using the HI technique. The results of the study of the humoral immune response of chickens to Newcastle disease virus are presented in Table 4.
[0148] The data presented in Table 4 indicate that the vaccines induced humoral immunity to Newcastle disease virus in vaccinated poultry. Antibody titers in the HI assay differed slightly when using different antigens: the La Sota antigen of Newcastle disease virus genotype II and the VRIAH-Saratov antigen of Newcastle disease virus genotype VII. The highest antibody titers to the La Sota antigen were detected in groups of chickens vaccinated with vaccines based on the VRIAH G7 and La Sota strains: 7.10±0.1 and 9.70±0.1 log2, respectively. However, in the RTGA with the inactivated antigen of the VNIIZh-Saratov strain of the Newcastle disease virus Avian orthoavulavirus1, the highest titers of specific antibodies to the Newcastle disease virus were obtained - 8.90±0.14 log2 for the vaccine from the VNIIZh G7 strain (genotype VII), and 7.8±0.1 log2 for the vaccine from the La Sota strain.
[0149] Thus, the claimed VNIIZH-Saratov strain of the Newcastle disease virus Avian orthoavulavirus1 is applicable for assessing the immunogenicity of vaccines against Newcastle disease by serological methods.
[0150] Example 9. Use of the VNIIZh-Saratov strain for control infection of vaccinated birds
[0151] The VNIIZh-Saratov strain of Newcastle disease virus can be used for challenge infection to evaluate the effectiveness of drugs for the specific prevention of Newcastle disease.
[0152] To test the protective activity of two vaccines against Newcastle disease: a monovalent vaccine based on the La Sota strain and a monovalent vaccine based on the VRIAH G7 strain, a challenge infection with the VRIAH-Saratov virus was conducted. For this purpose, chickens were immunized with the La Sota strain-based vaccine in whole form and at dilutions of 1:25, 1:50, and 1:100, as well as with the VRIAH G7 strain-based vaccine in whole form and at dilutions of 1:25, 1:50, and 1:100 (Table 5). Each vaccine dilution was tested on a separate group of 10 birds.
[0153] 28 days after immunization, the chickens were injected with a viral suspension from the VNIIZh-Saratov strain of the Newcastle disease virus, obtained in Example 1. The infectious dose was 6.0 lg EID 50 / 0.5 cm³ was administered intramuscularly to chickens in the thigh area. The clinical condition of the infected birds was monitored for the next 10 days, and mortality was recorded.
[0154] Table 5 presents the results of the control infection of chickens vaccinated with various vaccines against Newcastle disease with a viral suspension of the VNIIZG-Saratov strain of the Newcastle disease virus - a study was conducted of the protective activity of vaccines against Newcastle disease.
[0155] The data presented in Table 5 show that vaccines with different antigen doses, from whole to 1:100, induced varying degrees of protection in vaccinated chickens (from 100% to 40%) against Newcastle disease virus infection. Vaccines with whole antigen doses induced the highest protection (90% to 100%), while vaccines with 1:100 antigen doses induced the lowest protection (40%).
[0156] The presented data show that the monovalent vaccine based on the "ARRIAH G7" antigen of Newcastle disease virus genotype VII demonstrated higher protection against infection with a viral suspension of the "ARRIAH-Saratov" strain of Newcastle disease virus than the monovalent vaccine based on the antigen from the "La Sota" strain of Newcastle disease virus genotype II. This confirms that both the "ARRIAH G7" strain of Newcastle disease virus and the "ARRIAH-Saratov" strain of Newcastle disease virus belong to genotype VII.
[0157] The presented example illustrates the use of the VNIIZH-Saratov strain of the Newcastle disease virus Avian orthoavulavirus1 to control the effectiveness of vaccination of birds against Newcastle disease by the challenge method.
[0158] Thus, the use of the VNIIZH-Saratov strain of the Newcastle disease virus Avian orthoavulavirus1 for obtaining antigen and specific blood serum for the diagnosis of Newcastle disease and for assessing the effectiveness of vaccines against Newcastle disease has been confirmed.
[0159] Sources of information taken into account when preparing the description of the invention for the application for the issuance of a Russian Federation patent for the invention "The VNIIZh-Saratov strain of the Newcastle disease virus Avian orthoavulavirus1 for assessing the effectiveness of vaccines against Newcastle disease and the manufacture of drugs for the diagnosis of Newcastle disease":
[0160] 1. Alexander DJ Newcastle disease in the European Union 2000 to 2009 / / Avian Pathol. 2011. Vol. 40 (6). P. 547-558.
[0161] 2. Newcastle disease virus: Current status and our understanding / Ketan Ganar, Moushumee Das, Sugandha Sinha [et al.] / / Virus Res.-2014.-Vol.184-P.71-81.
[0162] 3. Korotetsky I.S., Bogoyavlensky A.P. et al. Molecular genetic characteristics of velogenic isolates of Newcastle disease virus isolated in the Russian Federation, Ukraine, Kazakhstan and Kyrgyzstan / / Questions of Virology. 2010. Vol. 55. No. 4. P. 15-17.
[0163] 4. Identification of Newcastle disease virus subgenotype VII.2 in wild birds in Turkey / Nuri Turan, Cemal Ozsemir, Aysun Yilmaz [et al.] / / Appl Environ Microbiol.-2020-Vol.16.-P.277
[0164] 5. Chvala I.A. Detection of Newcastle disease virus in bird populations in Russia / / Veterinary science. 2015. No. 1. p. 15-18.
[0165] 6. https: / / fsvps.gov.ru / files / neblagopoluchnye-strany-mira-po-bolezni-njukasla-v-2023-g / .
[0166] 7. Lomniczi B., Wehmann E., Herczeg J., Ballagi-Pordany A., Kaleta EF, Werner O, et al. Newcastle disease outbreaks in recent years in western Europe were caused by an old (VI) and a novel genotype (VII). Archives of Virology. 1998;143:49-64. URL: https: / / link.springer.com / article / 10.1007 / s007050050267?utm_source=getftr&utm_medium=getftr&utm_campaign=getftr_pilot.
[0167] 8. Frolov S.V., Moroz N.V., Chvala I.A., Irza V.N. Efficacy of vaccines against Newcastle disease produced by the All-Russian Research Institute of Animal Health in relation to current viruses of genotype VII. Veterinary science today. 2021; 1 (1): 44-51. URL: https: / / veterinary.arriah.ru / jour / article / view / 543.
[0168] 9. Volkova M.A., Chvala Ir.A., Osipova O.S., Kulagina M.A., Andreychuk D.B. Serological monitoring of avian influenza and Newcastle disease in the Russian Federation in 2019. Veterinary science today. 2020;(2):76-82. URL: https: / / veterinary.arriah.ru / jour / article / view / 471.
[0169] 10. Patent RU No. 2482129 dated 11.11.2012 “Newcastle disease virus strain for creating a candidate anticancer drug based on it and studying the mechanisms of oncolysis”, published 11.11.2010. Bulletin No. 14.
[0170] 11. US Application No. 20100178684, IPC C12N 7 / 01, published July 15, 2010.
[0171] 12. Application RU 2010146027 dated 11.11.2010, published 20.05.2012 Bulletin No. 14.
[0172] 13. Yurchenko K.S. Study of the antitumor potential of wild strains of Newcastle disease virus on human tumor cells and in a model of experimental oncogenesis in vivo / / diss... Cand. Biological Sciences. St. Petersburg. 2019.
[0173] 14. Patent RU No. 2482184 dated 11.11.2010 "Strain of Newcastle disease virus for use in serodiagnosis of Newcastle disease in RTGA", published 20.05.2013. Bulletin No. 14.
[0174] 15. Glushchenko A.V. Biological properties of Newcastle disease viruses isolated from natural reservoirs among wild birds in various regions of Russia in 2008-2018 / / Dissert. Cand. Biological Sciences. Vladimir, 2022.
[0175] 16. Mullagulova M.N. Obtaining variants of Newcastle disease virus with reduced virulence for interferon-producing cells / / Abstract of Cand. Sci. (Biol.) Dissertation. Moscow, 2000.
[0176] 17. Syurin V.I. et al., Viral diseases of animals, 1998, M., VNIITIBP, pp. 214-232.
[0177] 18. Smolensky V.I. Means and methods of specific prevention of bird diseases of viral etiology, diss. Doctor of Veterinary Sciences, 1999.
[0178] 19. Patent RU No. 2821028, dated 13.02.2024. "Strain "ARRIAH G7" of the Newcastle disease virus in birds for the manufacture of biological products for the diagnosis and specific prevention of Newcastle disease in birds", application 2025103509 dated 13.02.2024.
[0179] 20. Sun-Hee Cho, Hyuk-Joon Kwon, Tae-Eun Kim, Jae-Hong Kim, Han-Sang Yoo, Sun-Joong Kim. Variation of a newcastle disease virus hemagglutinin-neuraminidase linear epitope. Journal of Clinical Microbiology. 2008;46:1541-1544. URL: https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC2292945 / .
[0180] 21. Jingjing Liu, Jie Zhu, Haixu Xu, Juan Li, Zenglei Hu, Shunlin Hu, et al. Effects of the HN Antigenic Difference between the Vaccine Strain and the Challenge Strain of Newcastle Disease Virus on Virus Shedding and Transmission. Viruses. 2017;9(8):225. URL: https: / / www.mdpi.com / 1999-4915 / 9 / 8 / 225 / htm#table_body_display_viruses-09-00225-t002.
[0181] 22. Kapustina, O. V. Development and improvement of means and methods for control of especially dangerous infections caused by viruses of the order Mononegavirales: specialty 06.02.02 "Veterinary microbiology, virology, epizootology, mycology with mycotoxicology and immunology": dissertation for the degree of Doctor of Biological Sciences / Kapustina Olga Vladimirovna; State Scientific Institution All-Russian Research Institute of Veterinary Virology and Microbiology. - Volginsky, 2016. - 306 p.
[0182] 23. Newcastle disease virus: Current status and our understanding / K. Ganar, M. Das, S. Sinha [et al.] / / Virus Res. - Vol. 184. - 2014. - p. 71-81 https: / / doi.org / 10.1016 / j.virusres.2014.02.016
[0183] 24. Third genome size category of avian paramyxovirus serotype 1 (Newcastle disease virus) and evolutionary implications / A. Czeglédi, D. Ujvári, E. Somogui [et al.] / / Virus Res. - Vol. 120 (1-2). - 2006. - p. 36-48 https: / / doi.org / 10.1016 / j.virusres.2005.11.009
[0184] 25. Updated unified phylogenetic classification system and revised nomenclature for Newcastle disease virus / K. Dimitrov, C. Abolnik, C. Afonso [et al.] / / Infect. Genet. Evol. - 2019; 74; https: / / doi.org / 10.1016 / j.meegid.2019.103917
[0185] 26. Diel, D. G., da Silva, L. H., Liu, H., Wang, Z., Miller, P. J., Afonso, C. L., 2012a. Genetic diversity of avian paramyxovirus type1: proposal for a unified nomenclature and classification system of Newcastle disease virus genotypes. Infect. Genet. Evol. 12, 1770-1779. https: / / doi.org / 10.1016 / j.meegid.2012.07.012.
[0186] 27. GOST 28085-2013. Biological medicinal products for veterinary use. Sterility control methods.
[0187] 28. OFS.1.7.2.0031.15. General pharmacopoeial article. Test for the presence of mycoplasmas" (approved and put into effect by Order of the Ministry of Health of Russia dated October 31, 2018, No. 749) - "State Pharmacopoeia of the Russian Federation. XIV edition. Volume II", 2018
[0188] 29. Guidelines for identifying the genome of the chicken infectious bronchitis virus using real-time polymerase chain reaction / E.V. Ovchinnikova, L.O. Shcherbakova, A.V. Andriasov, I.A. Chvala / / FGBU "ARRIAH". - Vladimir: 2017.
[0189] 30. Guidelines for identifying the genome of the infectious bursal disease virus using real-time polymerase chain reaction / E.V. Ovchinnikova, L.O. Shcherbakova, I.A. Chvala / / FGBU "ARRIAH". - Vladimir: 2017.
[0190] 31. Guidelines for the detection of chicken encephalomyelitis virus RNA using real-time polymerase chain reaction / D.B. Andreychuk, O.S. Osipova, A.N. Kolotilov, I.A. Chvala / / FGBU "ARRIAH". - Vladimir: 2017.
[0191] 32. Guidelines for the detection of egg drop syndrome virus DNA -76 using real-time polymerase chain reaction / N.G. Zinyakov, T.I. Eroshina, I.A. Chvala / / FGBU "ARRIAH". - Vladimir: 2017.
[0192] 33. Guidelines for the detection of chicken reovirus RNA by real-time polymerase chain reaction / N.G. Zinyakov, D.B. Andreychuk, A.V. Andriasov, I.A. Chvala / / FGU "ARRIAH". - Vladimir: 2017.
[0193] 34. Guidelines for identifying the genome of avian infectious laryngotracheitis virus using real-time polymerase chain reaction / L.O. Shcherbakova, T.I. Eroshina, V.Yu. Kulakov, I.A. Chvala / / FGU "ARRIAH". - Vladimir: 2017.
[0194] 35. Guidelines for the detection of the chicken infectious anemia virus genome using real-time polymerase chain reaction [Text]: approved 01.12.2017 / 52-17, L.O. Shcherbakova, Z.B. Nikonova, T.I. Eroshina, I.A. Chvala; FGBU "ARRIAH". - Vladimir: [b. i.], 2017. - 12 p. - B. c.
[0195] 36. Guidelines for the detection of fowlpox virus DNA by real-time polymerase chain reaction [Text]: approved by FGBU "ARRIAH" 31.05.2017 / 46-17, N.P. Yelatkin, A.N. Ushakova, D.B. Andreychuk, I.A. Chvala; FGBU "ARRIAH". - Vladimir: [b. i.], 2017. - 15 p. - B. c.
[0196] 37. Guidelines for the detection of the genome of avian leukosis virus subtype J using real-time polymerase chain reaction [Text]: approved 01.12.2017 / 53-17, L.O. Shcherbakova, M.I. Shulpin, S.P. Lazareva, I.A. Chvala; FGBU "ARRIAH". - Vladimir: [b. i.], 2017. - 15 p. - B. c.
[0197] 38. Guidelines for the detection of RNA of the avian influenza virus type A by the RT-PCR method in real time [Text]: methodological material / 45-16, A. V. Andriasov, D. B. Andreychuk, I. A. Chvala; FGBU "ARRIAH". - Vladimir: [b. i.], 2016. - 13 p.
[0198] 39. Guidelines for the detection of Marek's disease virus DNA of three serotypes using real-time polymerase chain reaction in multiplex format [Text]: approved 01.12.2017 / 57-17, D.B. Andreychuk, T.I. Eroshina, A.A. Kozlov, I.A. Chvala; FGBU "ARRIAH". - Vladimir: [b. i.], 2017. - 13 p. - B. c.
[0199] 40. Guidelines for the detection of the genome of avian metapneumovirus subtypes A and B using real-time polymerase chain reaction [Text]: approved 01.12.2017 / 59-17, Z.B. Nikonova, N.G. Zinyakov, S.N. Kolosov, I.A. Chvala; FGBU "ARRIAH". - Vladimir: [b. i.], 2017. - 17 p. - B. c.
[0200] 41. Methodology for genome detection and strain differentiation of Newcastle disease virus using PCR and direct sequencing [Text]: methodological material / 35-03, L.O. Shcherbakova, I.P. Pchelkina, V.V. Drygin, S.K. Starov; FGU "ARRIAH". - Vladimir: [b. i.], 2003. - 10 p. - B. c.
[0201] Table 1
[0202] Determination of the ICPI of the "ARRIAH-Saratov" strain of the Newcastle disease virus Avian orthoavulavirus 1 (proposed invention) genotype VII
[0203] Bird number Observation day, days Average score, days 1 2 3 4 5 6 7 8 1 0 0 2 2 2 2 2 2 1,5 2 0 1 2 2 2 2 2 2 1,63 3 0 1 2 2 2 2 2 2 1,63 4 0 1 2 2 2 2 2 2 1,63 5 0 1 2 2 2 2 2 2 1,63 6 0 1 2 2 2 2 2 2 1,63 7 0 1 2 2 2 2 2 2 1,63 8 0 1 2 2 2 2 2 2 1,63 9 0 1 2 2 2 2 2 2 1,63 10 0 1 2 2 2 2 2 2 1,63 Average score for experience 1,62
[0204] Table 2
[0205] Determination of the 50% lethal dose (LD50) of the VNIIZH-Saratov strain of the Newcastle disease virus Avian orthoavulavirus 1 (proposed invention) in chickens Virus propagation 7 8 9 10 Control Effect + + + + + + + + + + + + + +- + - - - - - - - - - Number of test objects 5 5 5 5 5 Evaluation of the effect 5 / 5=1 5 / 5=1 4 / 5=0,8 1 / 5=0,2 0 / 5=0 50% lethal dose (LD50) 9.5 lg LD50 / ml
[0206] Notes: “+” - positive effect (presence of an infectious process);
[0207] «-» - negative effect (no infectious process);
[0208] Table 3
[0209] Test results of blood serum samples collected 28 days after immunization of poultry for the presence of antibodies to the Newcastle disease (ND) virus
[0210] Chicken No. The number of reacted serum samples in the RTGA according to their dilutions Quantity 1:16 1:32 1:64 1:128 1:256 1:512 1:1024 1:2048 1:4096 log2 1 10 0 0 0 3 2 2 2 1 0 8,60±0,13 2 10 1 0 0 1 1 2 3 2 0 8,90±0,15 3 10 0 0 1 2 3 2 2 0 0 8,30±0,13 control 10 0 0 0 0 0 0 0 0 0 - Average antibody titer 8,60 ± 0,22
[0211] Table 4
[0212] Humoral immune response of chickens to the use of three vaccines against ND
[0213] Vaccine Results of RTGA according to antigen, log2 La Sota VNIIZh-Saratov Monovalent vaccine from the VNIIZh G7 strain 7,10±0,10 8,90±0,14 Monovalent vaccine from the VNIIZh NB-En strain 6,20±0,08 3,80±0,11 Monovalent vaccine from the La Sota strain 9,70±0,10 7,80±0,10 control 0 0
[0214] Table 5
[0215] Results of the protective effect of two vaccines against Newcastle disease based on the results of a control infection with the "ARRIAH-Saratov" strain of the Newcastle disease virus Avian orthoavulavirus1 (proposed invention)
[0216] Vaccine Antigen dose (D) Clinical indicator Palo, goal Survived, goals (%) Monovalent vaccine from the VNIIZh G7 strain 1 0 10 (100) 1:25 1 9 (90) 1:50 2 8 (80) 1:100 6 4 (40) Monovalent vaccine from the La Sota strain 1 1 9 (90) 1:25 2 8 (80) 1:50 6 4 (40) 1:100 6 4 (40) control not vaccinated 10 0
[0217] --->
[0218] <st26sequencelisting dtdversion="V1_3" filename="Штамм
[0219] «ВНИИЗЖ-Saratov» вируса болезни Ньюкасла +.xml" softwarename="WIPO
[0220] Sequence" softwareversion="2.3.0" productiondate="2026-04-21">
[0221] <applicationidentification>
[0222] <ipofficecode> RU< / ipofficecode>
[0223] <applicationnumbertext> 0< / applicationnumbertext>
[0224] <filingdate> 2025-09-19< / filingdate>
[0225] < / applicationidentification>
[0226] <applicantfilereference> 0< / applicantfilereference>
[0227] <earliestpriorityapplicationidentification>
[0228] <ipofficecode> RU< / ipofficecode>
[0229] <applicationnumbertext> 0< / applicationnumbertext>
[0230] <filingdate> 2025-09-19< / filingdate>
[0231] < / earliestpriorityapplicationidentification>
[0232] <applicantname languagecode="ru">Federal State Budgetary Institution "Federal Security Center"
[0233] Animal Health"< / applicantname>
[0234] <applicantnamelatin>Federal State-Financed Institution Federal Centre
[0235] for Animal Health (FGBI ARRIAH)< / applicantnamelatin>
[0236] <inventorname languagecode="ru">Moroz Natalia
[0237] Vladimirovna< / inventorname>
[0238] <inventornamelatin> Moroz Natalia Vladimirovna< / inventornamelatin>
[0239] <inventiontitle languagecode="ru">The VNIIZh-Saratov strain of the virus
[0240] Newcastle disease Avian orthoavulavirus 1 for efficacy evaluation
[0241] vaccines against Newcastle disease and the manufacture of preparations for
[0242] Newcastle disease diagnostics< / inventiontitle>
[0243] <sequencetotalquantity> 1< / sequencetotalquantity>
[0244] <sequencedata sequenceidnumber="1">
[0245] <insdseq>
[0246] <INSDSeq_length>396< / INSDSeq_length>
[0247] <INSDSeq_moltype>RNA< / INSDSeq_moltype>
[0248] <INSDSeq_division>PAT< / INSDSeq_division>
[0249] <INSDSeq_feature-table>
[0250] <insdfeature>
[0251] <INSDFeature_key>source< / INSDFeature_key>
[0252] <INSDFeature_location>1..396< / INSDFeature_location>
[0253] <INSDFeature_quals>
[0254] <insdqualifier>
[0255] <INSDQualifier_name>mol_type< / INSDQualifier_name>
[0256] <INSDQualifier_value>other RNA< / INSDQualifier_value>
[0257] < / insdqualifier>
[0258] <insdqualifier id="q2">
[0259] <INSDQualifier_name>organism< / INSDQualifier_name>
[0260] <INSDQualifier_value>Avian orthoavulavirus 1 < / INSDQualifier_value>
[0261] < / insdqualifier>
[0262] < / INSDFeature_quals>
[0263] < / insdfeature>
[0264] < / INSDSeq_feature-table>
[0265] <INSDSeq_sequence>aatcatagtcaagttgctcccgaatatgcctagggataaggaggcgtgtgca
[0266] aaagccccattagaggcatataacagaacactgactactttgctcactcctcttggcgactctatccgca
[0267] agatccaagggtctgtgtccacgtctggaggaaggagacaaaaacgctttataggtgctgttattggcag
[0268] tgtagctcttggggttgcaacggcggcacagataacagcagctgcggccctaatacaagccaaccaaaac
[0269] gccgccaacatcctccggcttaaggagagcatcgctgcgaccaatgaagctgtgcatgaagttaccaacg
[0270] gattatcacaactatcagtggcagttggaaaaatgcagcagtttgtcaatgaacagcttaataa< / INSD
[0271] Seq_sequence>
[0272] < / insdseq>
[0273] < / sequencedata>
[0274] < / st26sequencelisting>
[0275] <---
Citation Information
Patent Citations
Recombinant newcastle disease virus LaSota vaccine strain for expressing nipah encephalitis virus F protein
CN102533675A
Newcastle disease and H9 subtype bird flu combined inactivate vaccine and preparing method thereof
CN104906570A
Chimeric Newcastle disease virus vector H7 (avian influenza) live vaccine candidate strain capable of overcoming effect of Newcastle disease virus maternal antibody of chick and a construction method thereof
CN107384875A
Strain of poultry newcastle virus disease psevdopestis avium used for vaccine preparing
RU2192464C2
Newcastle disease virus "vniizzh g7" strain for production of biopreparations for diagnosis and specific prevention of newcastle disease of birds
RU2821028C1