Method for diagnosis of hereditary breast and ovarian cancer in representatives of non-slavic ethnic groups living in the north caucasus

Abstract

FIELD: molecular biology.SUBSTANCE: method for diagnosing hereditary breast and ovarian cancer in representatives of non-Slavic ethnic groups living in the North Caucasus is described, using developed primers and fluorescently labeled probes.EFFECT: ability to quickly identify common pathogenic variants of BRCA1 and BRCA2 specific to the peoples of the North Caucasus, using standard detection amplifiers and improving the molecular genetic diagnosis of hereditary breast and ovarian cancer in this region.1 cl, 2 dwg, 1 tbl, 2 ex

Description

[0001] The invention relates to medicine, namely to oncology and laboratory genetics, and can be used for molecular genetic diagnostics of hereditary breast and ovarian cancer in patients of non-Slavic nationalities living in the republics of the North Caucasus.

[0002] A method for detecting hereditary mutations in the BRCA1 and BRCA2 genes is known, based on testing by the polymerase chain reaction (PCR) of 8 common pathogenic terminal variants of BRCA1 5382insC, 4153de1A, 185de1AG, C61G, 2080de1A, 3819de15, 3875de14, BRCA2 6174de1T [Sokolenko AP, Sokolova TN, Ni VI, Preobrazhenskaya EV, Iyevleva AG, Aleksakhina SN, Romanko AA, Bessonov AA, Gorodnova TV, Anisimova EI, Savonevich EL, Bizin IV, Stepanov IA, Krivorotko PV, Berlev IV, Belyaev AM, Togo AV, Imyanitov EN. Frequency and spectrum of founder and non-founder BRCA1 and BRCA2 mutations in a large series of Russian breast cancer and ovarian cancer patients. Breast Cancer Res Treat. 2020 Nov; 184(1):229-235]. A disadvantage of this method is the low informativeness of the test for representatives of non-Slavic nationalities.The specified panel of variants was developed based on data from the molecular epidemiology of hereditary cancers in patients of predominantly Slavic origin and does not take into account the peculiarities of the spectra of pathogenic alleles of BRCA1 and BRCA2 in regions with a compact residence of non-Slavic populations.

[0003] Discovered method for detecting hereditary mutations in BRCA1 and BRCA2 genes, based on targeted high-throughput sequencing (NGS, next-generation sequencing) coding sequences of specified genes. The advantage of this method is the possibility of identification of all variations of BRCA1, BRCA2, localized in coding regions [Sokolenko AR, Bakaeva EC, Venina AR, Kuligina ES, Romanko AA, Aleksakhina SN, Belysheva YV, Belogubova EV, Stepanov IA, Zaitseva OA, Yatsuk OS, Togo AV, Khamgokov ZM, Kadyrova AO, Pirmagomedov AS, Bolieva MB, Epkhiev AA, Tsutsaev AK, Chakhieva MD, Khabrieva KM, Khabriev IM, Murachuev MA, Buttaeva BN, Baboshkina LS, Bayramkulova FI, Katchiev IR, Alieva LK, Raskin GA, Orlov SV, Khachmamuk ZK, Levonyan KR, Gichko DM, Kirtbaya DV, Degtyariov AM, Sultanova LV, Musayeva HS, Belyaev AM, Imyanitov EN. Ethnicity-specific BRCA1, BRCA2, PALB2, and ATM pathogenic alleles in breast and ovarian cancer patients from the North Caucasus.Breast Cancer Res Treat. 2024 Jan;203(2):307-315]. The disadvantage is the need for expensive genetic analysis systems and sequencing reagent kits, which currently have no Russian-made analogues, which limits its widespread use.

[0004] The technical result of the invention is the ability to quickly identify common pathogenic variants of BRCA1 and BRCA2 specific to the peoples of the North Caucasus, using standard detecting amplifiers and improving the molecular genetic diagnostics of hereditary breast and ovarian cancer in this region.

[0005] The said technical result is achieved in a method for diagnosing hereditary breast and ovarian cancer in representatives of non-Slavic ethnic groups living in the North Caucasus, characterized in that DNA samples from patient peripheral blood lymphocytes or archival histological tissues are examined by the allele-discriminatory polymerase chain reaction method with primers and fluorescently labeled oligonucleotide probes specific to the normal and mutant sequences of the BRCA1 and BRCA2 genes, allowing for the detection of 10 of the most common pathogenic variants among representatives of non-Slavic nationalities of the North Caucasus, associated with a high risk of developing breast cancer and ovarian cancer: BRCA1 c.5266dupC, c.1961de1A, c.66dupA, c.3629_3630de1AG, BRCA2 c.2808_2811de1ACAA, c.7868A>G (p.His2623Arg), c.6341de1C, c.5621_5624de1TTAA, c.5351dupA, c.9895C>T, when detected, hereditary breast and ovarian cancer is diagnosed.

[0006] The claimed method is based on genotyping of the following pathogenic variants of BRCA1: c.5266dupC [rs80357906], c.1961de1A [rs80357522], c.66dupA [rs80357783], c.3629_3630de1AG [rs80357589] nBRCA2: c.2808_281 Ide1ACAA [rs80359351], c.7868A>G (p.His2623Arg) [rs80359012], c.6341de1C, c.5621_5624de1TTAA [rs80359526], c.5351dupA [rs80359507], c.9895C>T (p.Gln3299Ter) [rs1555289997].

[0007] This panel is based on the results of high-throughput DNA-sequencing of 1059 cases of breast cancer and ovarian cancer patients - representatives of non-Slavic nationalities of the republics of the Northern Caucasus and Armenians, living in the South федеральном округе [Sokolenko АР, Bakaeva ЕК, Venina AR, Kuligina ES, Romanko AA, Aleksakhina SN, Belysheva YV, Belogubova EV, Stepanov IA, Zaitseva OA, Yatsuk OS, Togo AV, Khamgokov ZM, Kadyrova AO, Pirmagomedov AS, Bolieva MB, Epkhiev AA, Tsutsaev AK, Chakhieva MD, Khabrieva KM, Khabriev IM, Murachuev MA, Buttaeva BN, Baboshkina LS, Bayramkulova FI, Katchiev IR, Alieva LK, Raskin GA, Orlov SV, Khachmamuk ZK, Levonyan KR, Gichko DM, Kirtbaya DV, Degtyariov AM, Sultanova LV, Musayeva HS, Belyaev AM, Imyanitov EN. Ethnicity-specific BRCAl, BRCA2, PALB2, and ATM pathogenic alleles in breast and ovarian cancer patients from the North Caucasus. Breast Cancer Res Treat. 2024 Jan;203(2):307-315].The North Caucasus republics are characterized by a pronounced "founder effect" in relation to BRCA1 and BRCA2 mutations, which allows to significantly simplify the diagnosis of hereditary cancer by analyzing major pathogenic variants. To develop allele discrimination tests, the most common pathogenic founder variants were selected in the most numerous ethnic groups of the North Caucasus (Chechens, Avars, Kabardians, Lezgins, Ossetians, Ingush). In Chechens, the most frequent allele is the insertion-deletion variant BRCA1 c.3629_3630de1AG (50% of all pathogenic variants of BRCA1 / BRCA2). In Avars, the most common variants of BRCA2 are c.5621_5624deiTTAA and c. 9895C>T; the latter is also found in Ossetians, Chechens, and Kumyks. A common pathogenic BRCA1 variant c.66dupA was identified among Lezgins. Variants BRCA2 c.7868A>G, BRCA1 c.5266dupC and c.1961de1A are common for representatives of Kabardian nationality. The BRCA2 c.5351dupA variant is an Ingush founder allele.BRCA2 c.6341de1C is the Ossetian founder variant. The BRCA2 c.2808_281 Ide1ACAA allele is found in Armenians living in Stavropol Krai and Krasnodar Krai, as well as Ossetians.

[0008] The method is illustrated in Table 1 and Figs. 1-2, where: in Table 1 - primers and fluorescently labeled probes for detecting the 10 most common pathogenic alleles of BRCA1 and BRCA2 in the republics of the North Caucasus;

[0009] in Fig. 1 - an example of allele-discriminatory HSV: detection of the “Chechen” founder variant of BRCA1 c.3629_3630de1AG, heterozygous genotype;

[0010] in Fig. 2 is an example of allele-discriminatory 1TCR: detection of the “Chechen” founder variant of BRCA1 c.3629_3630de1AG, normal homozygous genotype.

[0011] The method is carried out as follows:

[0012] The 1PCR reaction is carried out using 50 ng of DNA obtained from peripheral blood lymphocytes or archival histological tissues. The reaction mixture (final volume 10 μl) contains 0.5 units of Taq DNA polymerase, 1x PCR buffer (pH 8.3), 5 pmol of forward and reverse primers (according to Table 1), MgCb at a final concentration of 2.5 μM, a mixture of deoxynucleoside triphosphates (dCTP, dTTP, dATP, dGTP) at a final concentration of 200 μM, 5 pmol of fluorophore-labeled oligonucleotide probes specific to normal and mutant sequences (according to Table 1). Forty-five cycles of two-step amplification are performed, including denaturation for 15 seconds at 95°C and annealing and elongation for 45 seconds at 58°C. The amplicon size (69-119 bp) allows the use of partially degraded DNA from archival histological material. PCR and allelic discrimination are performed on detection amplifiers using specialized software.The heterozygous genotype is determined by the presence of fluorescence curves corresponding to the fluorescence of labels specific to the normal and mutant sequences (Fig. 1). The normal homozygous genotype is determined by the presence of a fluorescence curve specific to the normal sequence and the absence of a fluorescence curve specific to the mutant sequence (Fig. 2). When analyzing tumor tissue from a patient carrying a mutation, loss of heterozygosity at the locus under study may be observed, which is determined by the presence of a fluorescence curve of the mutant sequence and the absence or delay of a fluorescence curve of the normal sequence-specific probe label. The analysis takes approximately 3 hours, including reaction mixture preparation, cycling, and data processing.

[0013] To test the specificity and sensitivity of the test system, control DNA samples from patients with and without mutations, analyzed by targeted sequencing, were used. The panel was tested on 366 DNA samples with known BRCA1 and BRCA2 status. Concordance with high-throughput sequencing results was 100%.

[0014] The method is supported by the following clinical examples. Example 1. DNA samples of patient D., 58, a resident of Vladikavkaz (Republic of North Ossetia-Alania), were sent to the reference center of the National Medical Research Center of Oncology for molecular genetic diagnostics. Analysis of 8 common mutations that make up the standard diagnostic panel of BRCA1 and BRCA2 was negative. The patient underwent allele-discriminatory PCR to determine the Ossetian founder variant of BRCA2 c.6341de1C; this mutation was detected, eliminating the need for analysis of the full coding sequence of BRCA1 and BRCA2. A sample of the patient's tumor tissue was also analyzed using the developed allele-discriminatory PCR: loss of heterozygosity with the loss of the normal copy of BRCA2 was detected. Molecular genetic analysis revealed BRCA2-associated ovarian carcinoma; the patient was prescribed olaparib.

[0015] Example 2. Patient S., a 61-year-old resident of Grozny (Chechen Republic), diagnosed with breast cancer, sought molecular genetic testing at the National Medical Research Center of Oncology. Analysis of 8 common mutations that make up the standard BRCA1 and BRCA2 diagnostic panel was negative. The patient underwent allele-discriminatory PCR to detect the Chechen founder variant of BRCA1 c.3629_3630de1AG. This mutation was detected, eliminating the need for analysis of the full coding sequence of BRCA1 and BRCA2. Loss of heterozygosity with the loss of the normal copy of BRCA1 was detected in a breast tumor tissue sample. A diagnosis of BRCA1-associated breast carcinoma was established.

[0016] The method enables rapid detection of common pathogenic variants of BRCA1 and BRCA2 specific to the peoples of the North Caucasus using standard detection amplifiers and improves molecular genetic diagnostics of hereditary breast and ovarian cancer in this region.

[0017]

[0018] --->

[0019] <?xml version="1.0" encoding="ISO-8859-1"?>

[0020] <!DOCTYPE ST26SequenceListing SYSTEM "ST26SequenceListing_V1_3.dtd"

[0021] PUBLIC "- / / WIPO / / DTD Sequence Listing 1.3 / / EN">

[0022] <st26sequencelisting productiondate="2026-04-06"

[0023] softwareversion="2.3.0" softwarename="WIPO Sequence"

[0024] filename="Последовательности олигонуклеотидов_R.xml"

[0025] dtdversion="V1_3">

[0026] <applicantfilereference> 2025107102 / 10(018087)< / applicantfilereference>

[0027] <applicantname languagecode="ru">Federal State

[0028] Budgetary institution "National Medical Research

[0029] N.N. Petrov Oncology Center of the Ministry of Health

[0030] Russian Federation< / applicantname>

[0031] <applicantnamelatin>NMRC of Oncology named after N.N. Petrov of MoH

[0032] of Russia< / applicantnamelatin>

[0033] <inventorname languagecode="ru">Sokolenko Anna

[0034] Petrovna< / inventorname>

[0035] <inventornamelatin>Sokolenko Anna Petrovna< / inventornamelatin>

[0036] <inventiontitle languagecode="ru">METHOD OF DIAGNOSIS OF HEREDITARY

[0037] BREAST AND OVARIAN CANCER IN NON-SLAVIC PEOPLE

[0038] ETHNIC GROUPS LIVING IN THE NORTH CAUCASUS< / inventiontitle>

[0039] <sequencetotalquantity> 40< / sequencetotalquantity>

[0040] <sequencedata sequenceidnumber="1">

[0041] <insdseq>

[0042] <INSDSeq_length> 19< / INSDSeq_length>

[0043] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0044] <INSDSeq_division> PAT< / INSDSeq_division>

[0045] <INSDSeq_feature-table>

[0046] <insdfeature>

[0047] <INSDFeature_key>source< / INSDFeature_key>

[0048] <INSDFeature_location>1..19< / INSDFeature_location>

[0049] <INSDFeature_quals>

[0050] <insdqualifier>

[0051] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0052] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0053] < / insdqualifier>

[0054] <insdqualifier id="q83">

[0055] <INSDQualifier_name>organism< / INSDQualifier_name>

[0056] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0057] < / insdqualifier>

[0058] < / INSDFeature_quals>

[0059] < / insdfeature>

[0060] < / INSDSeq_feature-table>

[0061] <INSDSeq_sequence> tgagggggggctttacc< / INSDSeq_sequence>

[0062] < / insdseq>

[0063] < / sequencedata>

[0064] <sequencedata sequenceidnumber="2">

[0065] <insdseq>

[0066] <INSDSeq_length>20< / INSDSeq_length>

[0067] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0068] <INSDSeq_division>PAT< / INSDSeq_division>

[0069] <INSDSeq_feature-table>

[0070] <insdfeature>

[0071] <INSDFeature_key>source< / INSDFeature_key>

[0072] <INSDFeature_location>1..20< / INSDFeature_location>

[0073] <INSDFeature_quals>

[0074] <insdqualifier>

[0075] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0076] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0077] < / insdqualifier>

[0078] <insdqualifier id="q84">

[0079] <INSDQualifier_name>organism< / INSDQualifier_name>

[0080] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0081] < / insdqualifier>

[0082] < / INSDFeature_quals>

[0083] < / insdfeature>

[0084] < / INSDSeq_feature-table>

[0085] <INSDSeq_sequence>gaaaccaccaaggtccaaag< / INSDSeq_sequence>

[0086] < / insdseq>

[0087] < / sequencedata>

[0088] <sequencedata sequenceidnumber="3">

[0089] <insdseq>

[0090] <INSDSeq_length> 20< / INSDSeq_length>

[0091] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0092] <INSDSeq_division> PAT< / INSDSeq_division>

[0093] <INSDSeq_feature-table>

[0094] <insdfeature>

[0095] <INSDFeature_key>source< / INSDFeature_key>

[0096] <INSDFeature_location>1..20< / INSDFeature_location>

[0097] <INSDFeature_quals>

[0098] <insdqualifier>

[0099] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0100] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0101] < / insdqualifier>

[0102] <insdqualifier id="q85">

[0103] <INSDQualifier_name>organism< / INSDQualifier_name>

[0104] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0105] < / insdqualifier>

[0106] < / INSDFeature_quals>

[0107] < / insdfeature>

[0108] < / INSDSeq_feature-table>

[0109] <INSDSeq_sequence> ccttccatgagtgtaggtt< / INSDSeq_sequence>

[0110] < / insdseq>

[0111] < / sequencedata>

[0112] <sequencedata sequenceidnumber="4">

[0113] <insdseq>

[0114] <INSDSeq_length>19< / INSDSeq_length>

[0115] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0116] <INSDSeq_division>PAT< / INSDSeq_division>

[0117] <INSDSeq_feature-table>

[0118] <insdfeature>

[0119] <INSDFeature_key>source< / INSDFeature_key>

[0120] <INSDFeature_location>1..19< / INSDFeature_location>

[0121] <INSDFeature_quals>

[0122] <insdqualifier>

[0123] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0124] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0125] < / insdqualifier>

[0126] <insdqualifier id="q8">

[0127] <INSDQualifier_name>organism< / INSDQualifier_name>

[0128] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0129] < / insdqualifier>

[0130] < / INSDFeature_quals>

[0131] < / insdfeature>

[0132] < / INSDSeq_feature-table>

[0133] <INSDSeq_sequence>agcccacctaattgtactg< / INSDSeq_sequence>

[0134] < / insdseq>

[0135] < / sequencedata>

[0136] <sequencedata sequenceidnumber="5">

[0137] <insdseq>

[0138] <INSDSeq_length>21< / INSDSeq_length>

[0139] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0140] <INSDSeq_division>PAT< / INSDSeq_division>

[0141] <INSDSeq_feature-table>

[0142] <insdfeature>

[0143] <INSDFeature_key>source< / INSDFeature_key>

[0144] <INSDFeature_location>1..21< / INSDFeature_location>

[0145] <INSDFeature_quals>

[0146] <insdqualifier>

[0147] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0148] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0149] < / insdqualifier>

[0150] <insdqualifier id="q86">

[0151] <INSDQualifier_name>organism< / INSDQualifier_name>

[0152] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0153] < / insdqualifier>

[0154] < / INSDFeature_quals>

[0155] < / insdfeature>

[0156] < / INSDSeq_feature-table>

[0157] <INSDSeq_sequence>gctcttcatcctcactagata< / INSDSeq_sequence>

[0158] < / insdseq>

[0159] < / sequencedata>

[0160] <sequencedata sequenceidnumber="6">

[0161] <insdseq>

[0162] <INSDSeq_length> 19< / INSDSeq_length>

[0163] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0164] <INSDSeq_division> PAT< / INSDSeq_division>

[0165] <INSDSeq_feature-table>

[0166] <insdfeature>

[0167] <INSDFeature_key>source< / INSDFeature_key>

[0168] <INSDFeature_location>1..19< / INSDFeature_location>

[0169] <INSDFeature_quals>

[0170] <insdqualifier>

[0171] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0172] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0173] < / insdqualifier>

[0174] <insdqualifier id="q87">

[0175] <INSDQualifier_name>organism< / INSDQualifier_name>

[0176] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0177] < / insdqualifier>

[0178] < / INSDFeature_quals>

[0179] < / insdfeature>

[0180] < / INSDSeq_feature-table>

[0181] <INSDSeq_sequence> tggctcagggttaccgaag< / INSDSeq_sequence>

[0182] < / insdseq>

[0183] < / sequencedata>

[0184] <sequencedata sequenceidnumber="7">

[0185] <insdseq>

[0186] <INSDSeq_length> 22< / INSDSeq_length>

[0187] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0188] <INSDSeq_division> PAT< / INSDSeq_division>

[0189] <INSDSeq_feature-table>

[0190] <insdfeature>

[0191] <INSDFeature_key>source< / INSDFeature_key>

[0192] <INSDFeature_location>1..22< / INSDFeature_location>

[0193] <INSDFeature_quals>

[0194] <insdqualifier>

[0195] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0196] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0197] < / insdqualifier>

[0198] <insdqualifier id="q121">

[0199] <INSDQualifier_name>organism< / INSDQualifier_name>

[0200] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0201] < / insdqualifier>

[0202] < / INSDFeature_quals>

[0203] < / insdfeature>

[0204] < / INSDSeq_feature-table>

[0205] <INSDSeq_sequence> agtacaaaatgtcattaatgct< / INSDSeq_sequence>

[0206] < / insdseq>

[0207] < / sequencedata>

[0208] <sequencedata sequenceidnumber="8">

[0209] <insdseq>

[0210] <INSDSeq_length>22< / INSDSeq_length>

[0211] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0212] <INSDSeq_division>PAT< / INSDSeq_division>

[0213] <INSDSeq_feature-table>

[0214] <insdfeature>

[0215] <INSDFeature_key>source< / INSDFeature_key>

[0216] <INSDFeature_location>1..22< / INSDFeature_location>

[0217] <INSDFeature_quals>

[0218] <insdqualifier>

[0219] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0220] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0221] < / insdqualifier>

[0222] <insdqualifier id="q88">

[0223] <INSDQualifier_name>organism< / INSDQualifier_name>

[0224] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0225] < / insdqualifier>

[0226] < / INSDFeature_quals>

[0227] < / insdfeature>

[0228] < / INSDSeq_feature-table>

[0229] <INSDSeq_sequence>atacactcttgtgctgacttac< / INSDSeq_sequence>

[0230] < / insdseq>

[0231] < / sequencedata>

[0232] <sequencedata sequenceidnumber="9">

[0233] <insdseq>

[0234] <INSDSeq_length> 18< / INSDSeq_length>

[0235] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0236] <INSDSeq_division> PAT< / INSDSeq_division>

[0237] <INSDSeq_feature-table>

[0238] <insdfeature>

[0239] <INSDFeature_key>source< / INSDFeature_key>

[0240] <INSDFeature_location>1..18< / INSDFeature_location>

[0241] <INSDFeature_quals>

[0242] <insdqualifier>

[0243] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0244] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0245] < / insdqualifier>

[0246] <insdqualifier id="q89">

[0247] <INSDQualifier_name>organism< / INSDQualifier_name>

[0248] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0249] < / insdqualifier>

[0250] < / INSDFeature_quals>

[0251] < / insdfeature>

[0252] < / INSDSeq_feature-table>

[0253] <INSDSeq_sequence> ccaggtgtggatccaaag< / INSDSeq_sequence>

[0254] < / insdseq>

[0255] < / sequencedata>

[0256] <sequencedata sequenceidnumber="10">

[0257] <insdseq>

[0258] <INSDSeq_length> 18< / INSDSeq_length>

[0259] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0260] <INSDSeq_division> PAT< / INSDSeq_division>

[0261] <INSDSeq_feature-table>

[0262] <insdfeature>

[0263] <INSDFeature_key>source< / INSDFeature_key>

[0264] <INSDFeature_location>1..18< / INSDFeature_location>

[0265] <INSDFeature_quals>

[0266] <insdqualifier>

[0267] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0268] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0269] < / insdqualifier>

[0270] <insdqualifier id="q90">

[0271] <INSDQualifier_name>organism< / INSDQualifier_name>

[0272] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0273] < / insdqualifier>

[0274] < / INSDFeature_quals>

[0275] < / insdfeature>

[0276] < / INSDSeq_feature-table>

[0277] <INSDSeq_sequence> tccatagctgccagtttc< / INSDSeq_sequence>

[0278] < / insdseq>

[0279] < / sequencedata>

[0280] <sequencedata sequenceidnumber="11">

[0281] <insdseq>

[0282] <INSDSeq_length> 24< / INSDSeq_length>

[0283] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0284] <INSDSeq_division> PAT< / INSDSeq_division>

[0285] <INSDSeq_feature-table>

[0286] <insdfeature>

[0287] <INSDFeature_key>source< / INSDFeature_key>

[0288] <INSDFeature_location>1..24< / INSDFeature_location>

[0289] <INSDFeature_quals>

[0290] <insdqualifier>

[0291] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0292] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0293] < / insdqualifier>

[0294] <insdqualifier id="q91">

[0295] <INSDQualifier_name>organism< / INSDQualifier_name>

[0296] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0297] < / insdqualifier>

[0298] < / INSDFeature_quals>

[0299] < / insdfeature>

[0300] < / INSDSeq_feature-table>

[0301] <INSDSeq_sequence> atgtatcaaaaatacttcctcgtg< / INSDSeq_sequence>

[0302] < / insdseq>

[0303] < / sequencedata>

[0304] <sequencedata sequenceidnumber="12">

[0305] <insdseq>

[0306] <INSDSeq_length>24< / INSDSeq_length>

[0307] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0308] <INSDSeq_division>PAT< / INSDSeq_division>

[0309] <INSDSeq_feature-table>

[0310] <insdfeature>

[0311] <INSDFeature_key>source< / INSDFeature_key>

[0312] <INSDFeature_location>1..24< / INSDFeature_location>

[0313] <INSDFeature_quals>

[0314] <insdqualifier>

[0315] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0316] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0317] < / insdqualifier>

[0318] <insdqualifier id="q92">

[0319] <INSDQualifier_name>organism< / INSDQualifier_name>

[0320] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0321] < / insdqualifier>

[0322] < / INSDFeature_quals>

[0323] < / insdfeature>

[0324] < / INSDSeq_feature-table>

[0325] <INSDSeq_sequence>tttccatttctgagtttacacagt< / INSDSeq_sequence>

[0326] < / insdseq>

[0327] < / sequencedata>

[0328] <sequencedata sequenceidnumber="13">

[0329] <insdseq>

[0330] <INSDSeq_length> 21< / INSDSeq_length>

[0331] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0332] <INSDSeq_division> PAT< / INSDSeq_division>

[0333] <INSDSeq_feature-table>

[0334] <insdfeature>

[0335] <INSDFeature_key>source< / INSDFeature_key>

[0336] <INSDFeature_location>1..21< / INSDFeature_location>

[0337] <INSDFeature_quals>

[0338] <insdqualifier>

[0339] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0340] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0341] < / insdqualifier>

[0342] <insdqualifier id="q93">

[0343] <INSDQualifier_name>organism< / INSDQualifier_name>

[0344] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0345] < / insdqualifier>

[0346] < / INSDFeature_quals>

[0347] < / insdfeature>

[0348] < / INSDSeq_feature-table>

[0349] <INSDSeq_sequence> gattctggtattgagccagta< / INSDSeq_sequence>

[0350] < / insdseq>

[0351] < / sequencedata>

[0352] <sequencedata sequenceidnumber="14">

[0353] <insdseq>

[0354] <INSDSeq_length>22< / INSDSeq_length>

[0355] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0356] <INSDSeq_division>PAT< / INSDSeq_division>

[0357] <INSDSeq_feature-table>

[0358] <insdfeature>

[0359] <INSDFeature_key>source< / INSDFeature_key>

[0360] <INSDFeature_location>1..22< / INSDFeature_location>

[0361] <INSDFeature_quals>

[0362] <insdqualifier>

[0363] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0364] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0365] < / insdqualifier>

[0366] <insdqualifier id="q94">

[0367] <INSDQualifier_name>organism< / INSDQualifier_name>

[0368] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0369] < / insdqualifier>

[0370] < / INSDFeature_quals>

[0371] < / insdfeature>

[0372] < / INSDSeq_feature-table>

[0373] <INSDSeq_sequence>gcatttgcatcttttacattgg< / INSDSeq_sequence>

[0374] < / insdseq>

[0375] < / sequencedata>

[0376] <sequencedata sequenceidnumber="15">

[0377] <insdseq>

[0378] <INSDSeq_length> 24< / INSDSeq_length>

[0379] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0380] <INSDSeq_division> PAT< / INSDSeq_division>

[0381] <INSDSeq_feature-table>

[0382] <insdfeature>

[0383] <INSDFeature_key>source< / INSDFeature_key>

[0384] <INSDFeature_location>1..24< / INSDFeature_location>

[0385] <INSDFeature_quals>

[0386] <insdqualifier>

[0387] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0388] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0389] < / insdqualifier>

[0390] <insdqualifier id="q95">

[0391] <INSDQualifier_name>organism< / INSDQualifier_name>

[0392] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0393] < / insdqualifier>

[0394] < / INSDFeature_quals>

[0395] < / insdfeature>

[0396] < / INSDSeq_feature-table>

[0397] <INSDSeq_sequence> aaagtgaaagacatatttacagac< / INSDSeq_sequence>

[0398] < / insdseq>

[0399] < / sequencedata>

[0400] <sequencedata sequenceidnumber="16">

[0401] <insdseq>

[0402] <INSDSeq_length> 21< / INSDSeq_length>

[0403] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0404] <INSDSeq_division> PAT< / INSDSeq_division>

[0405] <INSDSeq_feature-table>

[0406] <insdfeature>

[0407] <INSDFeature_key>source< / INSDFeature_key>

[0408] <INSDFeature_location>1..21< / INSDFeature_location>

[0409] <INSDFeature_quals>

[0410] <insdqualifier>

[0411] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0412] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0413] < / insdqualifier>

[0414] <insdqualifier id="q96">

[0415] <INSDQualifier_name>organism< / INSDQualifier_name>

[0416] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0417] < / insdqualifier>

[0418] < / INSDFeature_quals>

[0419] < / insdfeature>

[0420] < / INSDSeq_feature-table>

[0421] <INSDSeq_sequence> tcgtttggcaaatttttgatt< / INSDSeq_sequence>

[0422] < / insdseq>

[0423] < / sequencedata>

[0424] <sequencedata sequenceidnumber="17">

[0425] <insdseq>

[0426] <INSDSeq_length> 23< / INSDSeq_length>

[0427] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0428] <INSDSeq_division> PAT< / INSDSeq_division>

[0429] <INSDSeq_feature-table>

[0430] <insdfeature>

[0431] <INSDFeature_key>source< / INSDFeature_key>

[0432] <INSDFeature_location>1..23< / INSDFeature_location>

[0433] <INSDFeature_quals>

[0434] <insdqualifier>

[0435] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0436] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0437] < / insdqualifier>

[0438] <insdqualifier id="q97">

[0439] <INSDQualifier_name>organism< / INSDQualifier_name>

[0440] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0441] < / insdqualifier>

[0442] < / INSDFeature_quals>

[0443] < / insdfeature>

[0444] < / INSDSeq_feature-table>

[0445] <INSDSeq_sequence> gttttatatggacacaggtga< / INSDSeq_sequence>

[0446] < / insdseq>

[0447] < / sequencedata>

[0448] <sequencedata sequenceidnumber="18">

[0449] <insdseq>

[0450] <INSDSeq_length> 23< / INSDSeq_length>

[0451] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0452] <INSDSeq_division> PAT< / INSDSeq_division>

[0453] <INSDSeq_feature-table>

[0454] <insdfeature>

[0455] <INSDFeature_key>source< / INSDFeature_key>

[0456] <INSDFeature_location>1..23< / INSDFeature_location>

[0457] <INSDFeature_quals>

[0458] <insdqualifier>

[0459] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0460] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0461] < / insdqualifier>

[0462] <insdqualifier id="q98">

[0463] <INSDQualifier_name>organism< / INSDQualifier_name>

[0464] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0465] < / insdqualifier>

[0466] < / INSDFeature_quals>

[0467] < / insdfeature>

[0468] < / INSDSeq_feature-table>

[0469] <INSDSeq_sequence> tgcagaaaaaaactctt< / INSDSeq_sequence>

[0470] < / insdseq>

[0471] < / sequencedata>

[0472] <sequencedata sequenceidnumber="19">

[0473] <insdseq>

[0474] <INSDSeq_length>19< / INSDSeq_length>

[0475] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0476] <INSDSeq_division>PAT< / INSDSeq_division>

[0477] <INSDSeq_feature-table>

[0478] <insdfeature>

[0479] <INSDFeature_key>source< / INSDFeature_key>

[0480] <INSDFeature_location>1..19< / INSDFeature_location>

[0481] <INSDFeature_quals>

[0482] <insdqualifier>

[0483] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0484] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0485] < / insdqualifier>

[0486] <insdqualifier id="q99">

[0487] <INSDQualifier_name>organism< / INSDQualifier_name>

[0488] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0489] < / insdqualifier>

[0490] < / INSDFeature_quals>

[0491] < / insdfeature>

[0492] < / INSDSeq_feature-table>

[0493] <INSDSeq_sequence>acatttgtttctccggctg< / INSDSeq_sequence>

[0494] < / insdseq>

[0495] < / sequencedata>

[0496] <sequencedata sequenceidnumber="20">

[0497] <insdseq>

[0498] <INSDSeq_length> 20< / INSDSeq_length>

[0499] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0500] <INSDSeq_division> PAT< / INSDSeq_division>

[0501] <INSDSeq_feature-table>

[0502] <insdfeature>

[0503] <INSDFeature_key>source< / INSDFeature_key>

[0504] <INSDFeature_location>1..20< / INSDFeature_location>

[0505] <INSDFeature_quals>

[0506] <insdqualifier>

[0507] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0508] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0509] < / insdqualifier>

[0510] <insdqualifier id="q100">

[0511] <INSDQualifier_name>organism< / INSDQualifier_name>

[0512] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0513] < / insdqualifier>

[0514] < / INSDFeature_quals>

[0515] < / insdfeature>

[0516] < / INSDSeq_feature-table>

[0517] <INSDSeq_sequence> gttcgtatttggtgccaca< / INSDSeq_sequence>

[0518] < / insdseq>

[0519] < / sequencedata>

[0520] <sequencedata sequenceidnumber="21">

[0521] <insdseq>

[0522] <INSDSeq_length>22< / INSDSeq_length>

[0523] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0524] <INSDSeq_division>PAT< / INSDSeq_division>

[0525] <INSDSeq_feature-table>

[0526] <insdfeature>

[0527] <INSDFeature_key>source< / INSDFeature_key>

[0528] <INSDFeature_location>1..22< / INSDFeature_location>

[0529] <INSDFeature_quals>

[0530] <insdqualifier>

[0531] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0532] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0533] < / insdqualifier>

[0534] <insdqualifier id="q101">

[0535] <INSDQualifier_name>organism< / INSDQualifier_name>

[0536] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0537] < / insdqualifier>

[0538] < / INSDFeature_quals>

[0539] < / insdfeature>

[0540] < / INSDSeq_feature-table>

[0541] <INSDSeq_sequence>tctgtcctgggattctcttgct< / INSDSeq_sequence>

[0542] < / insdseq>

[0543] < / sequencedata>

[0544] <sequencedata sequenceidnumber="22">

[0545] <insdseq>

[0546] <INSDSeq_length>22< / INSDSeq_length>

[0547] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0548] <INSDSeq_division>PAT< / INSDSeq_division>

[0549] <INSDSeq_feature-table>

[0550] <insdfeature>

[0551] <INSDFeature_key>source< / INSDFeature_key>

[0552] <INSDFeature_location>1..22< / INSDFeature_location>

[0553] <INSDFeature_quals>

[0554] <insdqualifier>

[0555] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0556] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0557] < / insdqualifier>

[0558] <insdqualifier id="q102">

[0559] <INSDQualifier_name>organism< / INSDQualifier_name>

[0560] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0561] < / insdqualifier>

[0562] < / INSDFeature_quals>

[0563] < / insdfeature>

[0564] < / INSDSeq_feature-table>

[0565] <INSDSeq_sequence>tctgtcctggggattctcttgc< / INSDSeq_sequence>

[0566] < / insdseq>

[0567] < / sequencedata>

[0568] <sequencedata sequenceidnumber="23">

[0569] <insdseq>

[0570] <INSDSeq_length>29< / INSDSeq_length>

[0571] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0572] <INSDSeq_division>PAT< / INSDSeq_division>

[0573] <INSDSeq_feature-table>

[0574] <insdfeature>

[0575] <INSDFeature_key>source< / INSDFeature_key>

[0576] <INSDFeature_location>1..29< / INSDFeature_location>

[0577] <INSDFeature_quals>

[0578] <insdqualifier>

[0579] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0580] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0581] < / insdqualifier>

[0582] <insdqualifier id="q103">

[0583] <INSDQualifier_name>organism< / INSDQualifier_name>

[0584] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0585] < / insdqualifier>

[0586] < / INSDFeature_quals>

[0587] < / insdfeature>

[0588] < / INSDSeq_feature-table>

[0589] <INSDSeq_sequence>tggttgtacttttttttctttatctcttc< / INSDSeq_sequence>

[0590] < / insdseq>

[0591] < / sequencedata>

[0592] <sequencedata sequenceidnumber="24">

[0593] <insdseq>

[0594] <INSDSeq_length>28< / INSDSeq_length>

[0595] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0596] <INSDSeq_division>PAT< / INSDSeq_division>

[0597] <INSDSeq_feature-table>

[0598] <insdfeature>

[0599] <INSDFeature_key>source< / INSDFeature_key>

[0600] <INSDFeature_location>1..28< / INSDFeature_location>

[0601] <INSDFeature_quals>

[0602] <insdqualifier>

[0603] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0604] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0605] < / insdqualifier>

[0606] <insdqualifier id="q104">

[0607] <INSDQualifier_name>organism< / INSDQualifier_name>

[0608] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0609] < / insdqualifier>

[0610] < / INSDFeature_quals>

[0611] < / insdfeature>

[0612] < / INSDSeq_feature-table>

[0613] <INSDSeq_sequence>tggttgtactttttttctttatctcttc< / INSDSeq_sequence>

[0614] < / insdseq>

[0615] < / sequencedata>

[0616] <sequencedata sequenceidnumber="25">

[0617] <insdseq>

[0618] <INSDSeq_length> 22< / INSDSeq_length>

[0619] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0620] <INSDSeq_division> PAT< / INSDSeq_division>

[0621] <INSDSeq_feature-table>

[0622] <insdfeature>

[0623] <INSDFeature_key>source< / INSDFeature_key>

[0624] <INSDFeature_location>1..22< / INSDFeature_location>

[0625] <INSDFeature_quals>

[0626] <insdqualifier>

[0627] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0628] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0629] < / insdqualifier>

[0630] <insdqualifier id="q105">

[0631] <INSDQualifier_name>organism< / INSDQualifier_name>

[0632] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0633] < / insdqualifier>

[0634] < / INSDFeature_quals>

[0635] < / insdfeature>

[0636] < / INSDSeq_feature-table>

[0637] <INSDSeq_sequence> ctgaggactctaatttcttggc< / INSDSeq_sequence>

[0638] < / insdseq>

[0639] < / sequencedata>

[0640] <sequencedata sequenceidnumber="26">

[0641] <insdseq>

[0642] <INSDSeq_length> 22< / INSDSeq_length>

[0643] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0644] <INSDSeq_division> PAT< / INSDSeq_division>

[0645] <INSDSeq_feature-table>

[0646] <insdfeature>

[0647] <INSDFeature_key>source< / INSDFeature_key>

[0648] <INSDFeature_location>1..22< / INSDFeature_location>

[0649] <INSDFeature_quals>

[0650] <insdqualifier>

[0651] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0652] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0653] < / insdqualifier>

[0654] <insdqualifier id="q106">

[0655] <INSDQualifier_name>organism< / INSDQualifier_name>

[0656] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0657] < / insdqualifier>

[0658] < / INSDFeature_quals>

[0659] < / insdfeature>

[0660] < / INSDSeq_feature-table>

[0661] <INSDSeq_sequence> tctgaggactaatttcttggcc< / INSDSeq_sequence>

[0662] < / insdseq>

[0663] < / sequencedata>

[0664] <sequencedata sequenceidnumber="27">

[0665] <insdseq>

[0666] <INSDSeq_length> 22< / INSDSeq_length>

[0667] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0668] <INSDSeq_division> PAT< / INSDSeq_division>

[0669] <INSDSeq_feature-table>

[0670] <insdfeature>

[0671] <INSDFeature_key>source< / INSDFeature_key>

[0672] <INSDFeature_location>1..22< / INSDFeature_location>

[0673] <INSDFeature_quals>

[0674] <insdqualifier>

[0675] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0676] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0677] < / insdqualifier>

[0678] <insdqualifier id="q107">

[0679] <INSDQualifier_name>organism< / INSDQualifier_name>

[0680] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0681] < / insdqualifier>

[0682] < / INSDFeature_quals>

[0683] < / insdfeature>

[0684] < / INSDSeq_feature-table>

[0685] <INSDSeq_sequence> aaggcatttcagccaccaagga< / INSDSeq_sequence>

[0686] < / insdseq>

[0687] < / sequencedata>

[0688] <sequencedata sequenceidnumber="28">

[0689] <insdseq>

[0690] <INSDSeq_length> 22< / INSDSeq_length>

[0691] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0692] <INSDSeq_division> PAT< / INSDSeq_division>

[0693] <INSDSeq_feature-table>

[0694] <insdfeature>

[0695] <INSDFeature_key>source< / INSDFeature_key>

[0696] <INSDFeature_location>1..22< / INSDFeature_location>

[0697] <INSDFeature_quals>

[0698] <insdqualifier>

[0699] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0700] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0701] < / insdqualifier>

[0702] <insdqualifier id="q108">

[0703] <INSDQualifier_name>organism< / INSDQualifier_name>

[0704] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0705] < / insdqualifier>

[0706] < / INSDFeature_quals>

[0707] < / insdfeature>

[0708] < / INSDSeq_feature-table>

[0709] <INSDSeq_sequence> aaggcattttagccaccaagga< / INSDSeq_sequence>

[0710] < / insdseq>

[0711] < / sequencedata>

[0712] <sequencedata sequenceidnumber="29">

[0713] <insdseq>

[0714] <INSDSeq_length> 27< / INSDSeq_length>

[0715] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0716] <INSDSeq_division> PAT< / INSDSeq_division>

[0717] <INSDSeq_feature-table>

[0718] <insdfeature>

[0719] <INSDFeature_key>source< / INSDFeature_key>

[0720] <INSDFeature_location>1..27< / INSDFeature_location>

[0721] <INSDFeature_quals>

[0722] <insdqualifier>

[0723] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0724] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0725] < / insdqualifier>

[0726] <insdqualifier id="q109">

[0727] <INSDQualifier_name>organism< / INSDQualifier_name>

[0728] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0729] < / insdqualifier>

[0730] < / INSDFeature_quals>

[0731] < / insdfeature>

[0732] < / INSDSeq_feature-table>

[0733] <INSDSeq_sequence> tgatccatctatagtgattattaaaccc< / INSDSeq_sequence>

[0734] < / insdseq>

[0735] < / sequencedata>

[0736] <sequencedata sequenceidnumber="30">

[0737] <insdseq>

[0738] <INSDSeq_length> 27< / INSDSeq_length>

[0739] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0740] <INSDSeq_division> PAT< / INSDSeq_division>

[0741] <INSDSeq_feature-table>

[0742] <insdfeature>

[0743] <INSDFeature_key>source< / INSDFeature_key>

[0744] <INSDFeature_location>1..27< / INSDFeature_location>

[0745] <INSDFeature_quals>

[0746] <insdqualifier>

[0747] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0748] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0749] < / insdqualifier>

[0750] <insdqualifier id="q110">

[0751] <INSDQualifier_name>organism< / INSDQualifier_name>

[0752] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0753] < / insdqualifier>

[0754] < / INSDFeature_quals>

[0755] < / insdfeature>

[0756] < / INSDSeq_feature-table>

[0757] <INSDSeq_sequence> tgatccatctatagcgattataaaccc< / INSDSeq_sequence>

[0758] < / insdseq>

[0759] < / sequencedata>

[0760] <sequencedata sequenceidnumber="31">

[0761] <insdseq>

[0762] <INSDSeq_length>24< / INSDSeq_length>

[0763] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0764] <INSDSeq_division>PAT< / INSDSeq_division>

[0765] <INSDSeq_feature-table>

[0766] <insdfeature>

[0767] <INSDFeature_key>source< / INSDFeature_key>

[0768] <INSDFeature_location>1..24< / INSDFeature_location>

[0769] <INSDFeature_quals>

[0770] <insdqualifier>

[0771] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0772] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0773] < / insdqualifier>

[0774] <insdqualifier id="q111">

[0775] <INSDQualifier_name>organism< / INSDQualifier_name>

[0776] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0777] < / insdqualifier>

[0778] < / INSDFeature_quals>

[0779] < / insdfeature>

[0780] < / INSDSeq_feature-table>

[0781] <INSDSeq_sequence>tgataagagaaacccagagcactg< / INSDSeq_sequence>

[0782] < / insdseq>

[0783] < / sequencedata>

[0784] <sequencedata sequenceidnumber="32">

[0785] <insdseq>

[0786] <INSDSeq_length>24< / INSDSeq_length>

[0787] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0788] <INSDSeq_division>PAT< / INSDSeq_division>

[0789] <INSDSeq_feature-table>

[0790] <insdfeature>

[0791] <INSDFeature_key>source< / INSDFeature_key>

[0792] <INSDFeature_location>1..24< / INSDFeature_location>

[0793] <INSDFeature_quals>

[0794] <insdqualifier>

[0795] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0796] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0797] < / insdqualifier>

[0798] <insdqualifier id="q112">

[0799] <INSDQualifier_name>organism< / INSDQualifier_name>

[0800] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0801] < / insdqualifier>

[0802] < / INSDFeature_quals>

[0803] < / insdfeature>

[0804] < / INSDSeq_feature-table>

[0805] <INSDSeq_sequence>ttgataagagaaaccagagcactg< / INSDSeq_sequence>

[0806] < / insdseq>

[0807] < / sequencedata>

[0808] <sequencedata sequenceidnumber="33">

[0809] <insdseq>

[0810] <INSDSeq_length> 27< / INSDSeq_length>

[0811] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0812] <INSDSeq_division> PAT< / INSDSeq_division>

[0813] <INSDSeq_feature-table>

[0814] <insdfeature>

[0815] <INSDFeature_key>source< / INSDFeature_key>

[0816] <INSDFeature_location>1..27< / INSDFeature_location>

[0817] <INSDFeature_quals>

[0818] <insdqualifier>

[0819] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0820] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0821] < / insdqualifier>

[0822] <insdqualifier id="q113">

[0823] <INSDQualifier_name>organism< / INSDQualifier_name>

[0824] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0825] < / insdqualifier>

[0826] < / INSDFeature_quals>

[0827] < / insdfeature>

[0828] < / INSDSeq_feature-table>

[0829] <INSDSeq_sequence> agaatgttgaagatcaaaaaacacta< / INSDSeq_sequence>

[0830] < / insdseq>

[0831] < / sequencedata>

[0832] <sequencedata sequenceidnumber="34">

[0833] <insdseq>

[0834] <INSDSeq_length> 27< / INSDSeq_length>

[0835] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0836] <INSDSeq_division> PAT< / INSDSeq_division>

[0837] <INSDSeq_feature-table>

[0838] <insdfeature>

[0839] <INSDFeature_key>source< / INSDFeature_key>

[0840] <INSDFeature_location>1..27< / INSDFeature_location>

[0841] <INSDFeature_quals>

[0842] <insdqualifier>

[0843] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0844] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0845] < / insdqualifier>

[0846] <insdqualifier id="q114">

[0847] <INSDQualifier_name>organism< / INSDQualifier_name>

[0848] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0849] < / insdqualifier>

[0850] < / INSDFeature_quals>

[0851] < / insdfeature>

[0852] < / INSDSeq_feature-table>

[0853] <INSDSeq_sequence> agaatgttgaagatcaaaaaaaaacact< / INSDSeq_sequence>

[0854] < / insdseq>

[0855] < / sequencedata>

[0856] <sequencedata sequenceidnumber="35">

[0857] <insdseq>

[0858] <INSDSeq_length> 29< / INSDSeq_length>

[0859] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0860] <INSDSeq_division> PAT< / INSDSeq_division>

[0861] <INSDSeq_feature-table>

[0862] <insdfeature>

[0863] <INSDFeature_key>source< / INSDFeature_key>

[0864] <INSDFeature_location>1..29< / INSDFeature_location>

[0865] <INSDFeature_quals>

[0866] <insdqualifier>

[0867] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0868] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0869] < / insdqualifier>

[0870] <insdqualifier id="q115">

[0871] <INSDQualifier_name>organism< / INSDQualifier_name>

[0872] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0873] < / insdqualifier>

[0874] < / INSDFeature_quals>

[0875] < / insdfeature>

[0876] < / INSDSeq_feature-table>

[0877] <INSDSeq_sequence> ttcagtaagtattaaggaaaaacaacga< / INSDSeq_sequence>

[0878] < / insdseq>

[0879] < / sequencedata>

[0880] <sequencedata sequenceidnumber="36">

[0881] <insdseq>

[0882] <INSDSeq_length> 25< / INSDSeq_length>

[0883] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0884] <INSDSeq_division> PAT< / INSDSeq_division>

[0885] <INSDSeq_feature-table>

[0886] <insdfeature>

[0887] <INSDFeature_key>source< / INSDFeature_key>

[0888] <INSDFeature_location>1..25< / INSDFeature_location>

[0889] <INSDFeature_quals>

[0890] <insdqualifier>

[0891] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0892] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0893] < / insdqualifier>

[0894] <insdqualifier id="q116">

[0895] <INSDQualifier_name>organism< / INSDQualifier_name>

[0896] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0897] < / insdqualifier>

[0898] < / INSDFeature_quals>

[0899] < / insdfeature>

[0900] < / INSDSeq_feature-table>

[0901] <INSDSeq_sequence> ttcagtaagtaaggaaaaacaacga< / INSDSeq_sequence>

[0902] < / insdseq>

[0903] < / sequencedata>

[0904] <sequencedata sequenceidnumber="37">

[0905] <insdseq>

[0906] <INSDSeq_length> 27< / INSDSeq_length>

[0907] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0908] <INSDSeq_division> PAT< / INSDSeq_division>

[0909] <INSDSeq_feature-table>

[0910] <insdfeature>

[0911] <INSDFeature_key>source< / INSDFeature_key>

[0912] <INSDFeature_location>1..27< / INSDFeature_location>

[0913] <INSDFeature_quals>

[0914] <insdqualifier>

[0915] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0916] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0917] < / insdqualifier>

[0918] <insdqualifier id="q117">

[0919] <INSDQualifier_name>organism< / INSDQualifier_name>

[0920] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0921] < / insdqualifier>

[0922] < / INSDFeature_quals>

[0923] < / insdfeature>

[0924] < / INSDSeq_feature-table>

[0925] <INSDSeq_sequence> taattgacacttgggttgcttgttat< / INSDSeq_sequence>

[0926] < / insdseq>

[0927] < / sequencedata>

[0928] <sequencedata sequenceidnumber="38">

[0929] <insdseq>

[0930] <INSDSeq_length> 26< / INSDSeq_length>

[0931] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0932] <INSDSeq_division> PAT< / INSDSeq_division>

[0933] <INSDSeq_feature-table>

[0934] <insdfeature>

[0935] <INSDFeature_key>source< / INSDFeature_key>

[0936] <INSDFeature_location>1..26< / INSDFeature_location>

[0937] <INSDFeature_quals>

[0938] <insdqualifier>

[0939] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0940] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0941] < / insdqualifier>

[0942] <insdqualifier id="q118">

[0943] <INSDQualifier_name>organism< / INSDQualifier_name>

[0944] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0945] < / insdqualifier>

[0946] < / INSDFeature_quals>

[0947] < / insdfeature>

[0948] < / INSDSeq_feature-table>

[0949] <INSDSeq_sequence> taattgacacttgggttgcttatcac< / INSDSeq_sequence>

[0950] < / insdseq>

[0951] < / sequencedata>

[0952] <sequencedata sequenceidnumber="39">

[0953] <insdseq>

[0954] <INSDSeq_length> 22< / INSDSeq_length>

[0955] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0956] <INSDSeq_division> PAT< / INSDSeq_division>

[0957] <INSDSeq_feature-table>

[0958] <insdfeature>

[0959] <INSDFeature_key>source< / INSDFeature_key>

[0960] <INSDFeature_location>1..22< / INSDFeature_location>

[0961] <INSDFeature_quals>

[0962] <insdqualifier>

[0963] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0964] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0965] < / insdqualifier>

[0966] <insdqualifier id="q119">

[0967] <INSDQualifier_name>organism< / INSDQualifier_name>

[0968] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0969] < / insdqualifier>

[0970] < / INSDFeature_quals>

[0971] < / insdfeature>

[0972] < / INSDSeq_feature-table>

[0973] <INSDSeq_sequence> aaggcatttcagccaccaagga< / INSDSeq_sequence>

[0974] < / insdseq>

[0975] < / sequencedata>

[0976] <sequencedata sequenceidnumber="40">

[0977] <insdseq>

[0978] <INSDSeq_length> 22< / INSDSeq_length>

[0979] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0980] <INSDSeq_division> PAT< / INSDSeq_division>

[0981] <INSDSeq_feature-table>

[0982] <insdfeature>

[0983] <INSDFeature_key>source< / INSDFeature_key>

[0984] <INSDFeature_location>1..22< / INSDFeature_location>

[0985] <INSDFeature_quals>

[0986] <insdqualifier>

[0987] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0988] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0989] < / insdqualifier>

[0990] <insdqualifier id="q120">

[0991] <INSDQualifier_name>organism< / INSDQualifier_name>

[0992] <INSDQualifier_value>Homo sapiens< / INSDQualifier_value>

[0993] < / insdqualifier>

[0994] < / INSDFeature_quals>

[0995] < / insdfeature>

[0996] < / INSDSeq_feature-table>

[0997] <INSDSeq_sequence> aaggcattttagccaccaagga< / INSDSeq_sequence>

[0998] < / insdseq>

[0999] < / sequencedata>

[1000] < / st26sequencelisting>

[1001] <---

Images