Method for detecting henipavirus hendraense virus using deoxyribozyme 10-23-based method

A biosensor using deoxyribozyme 10-23 and a fluorescent probe addresses the limitations of existing Hendra virus diagnostics by enabling rapid, reliable, and cost-effective RNA detection, suitable for resource-constrained settings, with a detection limit of 7.5×10^8 copies per reaction.

RU2864959C1Active Publication Date: 2026-06-30FEDERALNOE BYUDZHETNOE UCHREZHDENIE NAUKI SANKT PETERBURGSKIJ NAUCHNO ISSLEDOVATELSKIJ INST EPIDEMIOLOGII I MIKROBIOLOGII IM PASTERA FEDERALNOJ SLUZHBY PO NADZORU V SFERE ZASHCHITY PRAV POTREBITELEJ I BLAGOPOLUCHIYA CHELOVEKA FBUN NII EPIDEMIOLOGII I MIKROBIOLOGII IMENI PASTERA
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
RU2025132227
Authority / Receiving Office
RU · RU
Patent Type
Patents
Current Assignee / Owner
Filing Date
2025-11-18
Publication Date
2026-06-30
Estimated Expiration
2045-11-18

Smart Images

  • Figure 00000002
    Figure 00000002
  • Figure 00000003
    Figure 00000003
Patent Text Reader

Abstract

FIELD: biotechnologies.SUBSTANCE: method for detecting Henipavirus hendraense virus using a deoxyribozyme 10-23-based method is described. The method includes extracting RNA from biological samples, followed by detection of target fragments of the H. hendraense genome RNA.EFFECT: reliable diagnosis of Hendra virus RNA by a method based on the use of a biosensor based on deoxyribozyme 10-23 and a fluorescently labelled probe.1 cl, 2 dwg, 1 tbl
Need to check novelty before this filing date? Find Prior Art

Description

[0001] The invention relates to biotechnology and medicine, namely to the diagnosis of infectious diseases, in particular to the problem of identifying genetic markers of the Henipavirus hendraense virus (Hendra, HeV).

[0002] Hendra virus is an enveloped RNA virus belonging to the Henipavirus genus of the Paramyxoviridae family. HeV is transmitted by flying foxes of the genus Pteropus. It can be transmitted to horses and other domestic and farm animals, causing respiratory and neurological symptoms. Humans become infected through direct contact with the bodily fluids of infected animals or by inhaling aerosols, typically during veterinary or agricultural work.

[0003] Hendra virus was first identified in Australia in 1994, and outbreaks have been reported annually since then. With the introduction of the recombinant Equivac® HeV vaccine for horses in 2012, the incidence of the disease in animals has significantly decreased, leading to a reduction in human transmission.

[0004] Despite this, Hendra remains a high-risk virus due to the development of initial respiratory symptoms that rapidly progress to severe neurological disorders such as encephalitis, with a high mortality rate (50% in hospitalized patients). Survivors often experience long-term complications such as neurological disorders or secondary bacterial infections.

[0005] Diagnosis of Hendra virus infection is based on clinical manifestations and laboratory tests. Real-time reverse transcription PCR (RT-PCR), which is used in the acute phase of the disease, is considered the most sensitive method. This method allows for the direct detection of viral RNA, especially in respiratory secretions (sputum), blood, or tissue samples. However, one of the known drawbacks of this approach is the duration of the analysis (more than one hour), as well as the need for specialized laboratory equipment, such as a thermocycler, which limits the possibility of rapid or field testing (https: / / doi.org / 10.1101 / 2021.07.16.452724).

[0006] One commercially available molecular diagnostic kit for Hendra virus, the Hendra Virus Real Time PCR Kit (BioPerfectus), provides high sensitivity for detecting viral RNA in various clinical samples (serum, CSF, oropharyngeal swabs). However, the high cost and relatively long analysis time may limit the test's use in settings requiring rapid diagnostics or in resource-constrained laboratories (BioPerfectus, 2024).

[0007] In addition, enzyme-linked immunosorbent assays (ELISA) are used for diagnosis; however, in the early stages of infection, low antibody levels significantly reduce the sensitivity of this method (https: / / doi.org / 10.1128 / cmr.00128-23).

[0008] The purpose of this invention is to expand the arsenal of tools used for the diagnosis, control and prevention of possible future epidemics.

[0009] The technical result is to obtain a reliable diagnosis of Hendra virus RNA using a method based on the use of a biosensor based on deoxyribozyme 10-23 and a fluorescently labeled probe.

[0010] The problem was solved in the following way:

[0011] 1. construction of a diagnostic biosensor based on deoxyribozyme 10-23, corresponding to a conservative region of the virus genome, and a fluorescently labeled probe;

[0012] 2. optimization of concentrations of reaction mixture components and detection conditions.

[0013] Results are analyzed using the software included with the Axxin T16-ISO Isothermal Fluorescence Reader (Axxin, Australia). Results are interpreted by comparing the fluorescence signal curve of the sample with that of a control negative sample containing no RNA. The F1 / F0 ratio, where F0 represents the fluorescence signal from the control samples and F1 represents the fluorescence signal from the samples, should be equal to or greater than 1.5.

[0014] The essence of the invention is illustrated by the drawings Fig. 1 and Fig. 2. Fig. 1 shows the design of the biosensor, where the following designations are introduced:

[0015] 1. Target RNA - a selected conservative region of the Hendra virus sequence for detection,

[0016] 2. Binding Arm - sequences that are part of the two parts of the deoxyribozyme biosensor (Split Dzl and Split Dz2), complementary to the region of the Hendra virus,

[0017] 3. Split Dzl and Split Dz2 are a pair of oligonucleotides, each of which consists of a complementary target portion, half of the catalytic yard of deoxyribozyme 10-23, and a portion interacting with a fluorescent substrate,

[0018] 4. FAM Substrate (Fsub) - a fluorescently labeled substrate, the cleavage of which leads to an increase in the fluorescent signal,

[0019] 5. Cleavage Site - the site of cleavage of the fluorescent substrate by the active deoxyribozyme.

[0020] Figure 2 shows fluorescence curves reflecting the dynamics of reaction product formation during the analysis of Hendra virus RNA samples. The orange line corresponds to the positive control (K+), and the red line to the negative control (K-).

[0021] In the initial stage, a fluorescent substrate (Fsub), a synthetic short target RNA of the Hendra virus, and a pair of oligonucleotides (Dz1 and Dz2, each consisting of a target RNA binding site, a fluorescent substrate, and half of the catalytic region of deoxyribozyme 10-23) were selected and synthesized. The biosensor is a binary probe. When the target RNA is present in solution, the RNA binds due to complementarity, leading to the assembly of a catalytic core. This core then cleaves the substrate (Fsub), which is labeled with a fluorophore and quencher, releasing the fluorophore into the solution.

[0022] All available Hendra virus sequences from the GenBank (NCBI) database were aligned using Molecular Evolutionary Genetics Analysis (MEGA) software (https: / / www.megasoftware.net / ) to identify conserved regions. A 213-nucleotide-long region was selected as the target. Since the secondary structure of RNA can interfere with complex formation with the biosensor, the secondary structure was predicted using The Nucleic Acid Package (https: / / www.nupack.org / ), and a shorter target region was determined based on this selection. This region was further analyzed for uniqueness using NCBI BLAST (http: / / www.ncbi.nlm.nih.gov / ). The sequences of the oligonucleotides and fluorescently labeled probe are presented in Table 1.

[0023]

[0024] DNA nucleotides are indicated in capital letters, RNA in lowercase letters.

[0025] The properties of the biosensor and fluorescently labeled probe were analyzed using Axxin T16-ISO Isothermal Fluorescence Reader software (Axxin, Australia).

[0026] To control the quality of detection, a positive control sample K+ was introduced, which is a short synthetic RNA of the target fragment of Hendra virus (HEV_rna).

[0027] The analytical sensitivity of the method was assessed using a dilution series of the K+ positive control. The detection limit was defined as the minimum K+ dilution at which the assay yields a positive result in 100% of cases for five identical samples. Therefore, the detection limit was calculated as 0.25 nM, which corresponds to 7.5×10 8 copies per reaction or 1.5×10 9 RNA copies per µl.

[0028] Analytical specificity was assessed using synthetic RNA samples of the following viruses: Henipavirus nipahense, Mammarenavirus juninense, Mammarenavirus guanaritoense, Mammarenavirus machupoense, Mammarenavirus brazilense, and SARS-CoV (severe acute respiratory syndrome). No non-specific reactions were observed.

[0029] Thus, as a result of the research conducted, a method for detecting Hendra virus RNA was developed and tested. This technical result is achieved by detecting the virus's synthetic RNA using a biosensor based on deoxyribozyme 10-23 in real time, according to the invention.

[0030] The diagnostics are carried out as follows: to simplify and standardize the preparation of reagents, the test system uses one buffer solution RB, containing 140 mM NaCl, 5 mM KCl, 50 mM HEPES, pH 7.4, 7.5% DMSO, 0.25% Tween-20 and 2% Triton X-100. Reagent CA is a 1 M CaCl2 solution. Reagent Dz contains a mixture of a fluorescently labeled probe (Fsub), HEV Dz1 and HEV_Dz2, each at a concentration of 10 μM. K+ is synthetic RNA HEV_rna at a concentration of 10 μM. K- is sterile water. Reagents Dz, K+ and K- are stored at a temperature of -20 °C, reagents RB and CA - at +4 °C for 3 months.

[0031] To set up a real-time reaction, select the required number of 0.2 ml tubes corresponding to the number of samples to be tested, as well as two tubes for positive and negative controls. To each tube, sequentially add 5 μl of CA, 1 μl of the Dz1+Dz2 mixture, 0.5 μl of the fluorescent probe (FAM), and 0.5 μl of the test sample, then add 43 μl of RB4* buffer; bring the total volume to 50 μl. Two control reactions are prepared: add 0.5 μl of K+ (instead of the sample) to the positive control tube, and 0.5 μl of sterile water to the negative control tube; otherwise, the composition is the same, add 43 μl of RB4* and bring the total volume to 50 μl. The final volume of the reaction mixture is 50 μl. The tubes are transferred to an Axxin T16-ISO Isothermal Fluorescence Reader (Axxin, Australia). Fluorescence signal is detected at 41°C using the FAM channel.The result is interpreted positively if the fluorescent signal accumulation curve for the corresponding sample exceeds the negative control value by 1.5 times. Thus, the proposed method allows for the reliable detection of Hendra virus RNA.

[0032] --->

[0033] <?xml version="1.0" encoding="UTF-8"?>

[0034] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0035] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0036] <ST26SequenceListing originalFreeTextLanguageCode="ru"

[0037] nonEnglishFreeTextLanguageCode="ru" dtdVersion="V1_3"

[0038] fileName="Method for detecting Henipavirus hendraense virus by the method,

[0039] based on the use of deoxyribozyme 10–23.xml"

[0040] softwareName="WIPO Sequence" softwareVersion="2.3.0"

[0041] productionDate="2025-11-06">

[0042] <applicationidentification>

[0043] <ipofficecode>RU< / ipofficecode>

[0044] <applicationnumbertext>< / applicationnumbertext>

[0045] <filingdate>< / filingdate>

[0046] < / applicationidentification>

[0047] <applicantfilereference>< / applicantfilereference>

[0048] <earliestpriorityapplicationidentification>

[0049] <ipofficecode> RU< / ipofficecode>

[0050] <applicationnumbertext>< / applicationnumbertext>

[0051] <filingdate>< / filingdate>

[0052] < / earliestpriorityapplicationidentification>

[0053] <applicantname languagecode="ru">Federal budgetary institution

[0054] Sciences "St. Petersburg Research Institute

[0055] Pasteur Institute of Epidemiology and Microbiology of the Federal Service for

[0056] Supervision in the Sphere of Consumer Protection and Welfare

[0057] human"< / applicantname>

[0058] <applicantnamelatin>Department of Epidemiology, Pasteur Institute,

[0059] Federal Service on Consumers' Rights Protection and Human

[0060] Well-Being Surveillance< / applicantnamelatin>

[0061] <inventiontitle languagecode="ru">Method for detecting the virus

[0062] Henipavirus hendraense by the method based on the application

[0063] deoxyribozyme 10–23< / inventiontitle>

[0064] <sequencetotalquantity> 4< / sequencetotalquantity>

[0065] <sequencedata sequenceidnumber="1">

[0066] <insdseq>

[0067] <INSDSeq_length> 29< / INSDSeq_length>

[0068] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0069] <INSDSeq_division> PAT< / INSDSeq_division>

[0070] <INSDSeq_feature-table>

[0071] <insdfeature>

[0072] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0073] <INSDFeature_location>19..29< / INSDFeature_location>

[0074] <INSDFeature_quals>

[0075] <insdqualifier id="q1">

[0076] <INSDQualifier_name>note< / INSDQualifier_name>

[0077] <INSDQualifier_value>RNA< / INSDQualifier_value>

[0078] < / insdqualifier>

[0079] < / INSDFeature_quals>

[0080] < / insdfeature>

[0081] <insdfeature>

[0082] <INSDFeature_key>source< / INSDFeature_key>

[0083] <INSDFeature_location>1..29< / INSDFeature_location>

[0084] <INSDFeature_quals>

[0085] <insdqualifier>

[0086] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0087] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0088] < / insdqualifier>

[0089] <insdqualifier id="q3">

[0090] <INSDQualifier_name>organism< / INSDQualifier_name>

[0091] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0092] < / insdqualifier>

[0093] < / INSDFeature_quals>

[0094] < / insdfeature>

[0095] <insdfeature>

[0096] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0097] <INSDFeature_location>1..18< / INSDFeature_location>

[0098] <INSDFeature_quals>

[0099] <insdqualifier id="q14">

[0100] <INSDQualifier_name>note< / INSDQualifier_name>

[0101] <INSDQualifier_value>DNA< / INSDQualifier_value>

[0102] < / insdqualifier>

[0103] < / INSDFeature_quals>

[0104] < / insdfeature>

[0105] < / INSDSeq_feature-table>

[0106] <INSDSeq_sequence> tgcccaggggctagctggatgagactg< / INSDSeq_sequence>

[0107] < / insdseq>

[0108] < / sequencedata>

[0109] <sequencedata sequenceidnumber="2">

[0110] <insdseq>

[0111] <INSDSeq_length> 29< / INSDSeq_length>

[0112] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0113] <INSDSeq_division> PAT< / INSDSeq_division>

[0114] <INSDSeq_feature-table>

[0115] <insdfeature>

[0116] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0117] <INSDFeature_location>1..11< / INSDFeature_location>

[0118] <INSDFeature_quals>

[0119] <insdqualifier id="q4">

[0120] <INSDQualifier_name>note< / INSDQualifier_name>

[0121] <INSDQualifier_value>RNA< / INSDQualifier_value>

[0122] < / insdqualifier>

[0123] < / INSDFeature_quals>

[0124] < / insdfeature>

[0125] <insdfeature>

[0126] <INSDFeature_key>source< / INSDFeature_key>

[0127] <INSDFeature_location>1..29< / INSDFeature_location>

[0128] <INSDFeature_quals>

[0129] <insdqualifier>

[0130] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0131] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0132] < / insdqualifier>

[0133] <insdqualifier id="q6">

[0134] <INSDQualifier_name>organism< / INSDQualifier_name>

[0135] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0136] < / insdqualifier>

[0137] < / INSDFeature_quals>

[0138] < / insdfeature>

[0139] <insdfeature>

[0140] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0141] <INSDFeature_location>12..29< / INSDFeature_location>

[0142] <INSDFeature_quals>

[0143] <insdqualifier id="q15">

[0144] <INSDQualifier_name>note< / INSDQualifier_name>

[0145] <INSDQualifier_value>DNA< / INSDQualifier_value>

[0146] < / insdqualifier>

[0147] < / INSDFeature_quals>

[0148] < / insdfeature>

[0149] < / INSDSeq_feature-table>

[0150] <INSDSeq_sequence> cttggaacatgacaacgagaggaaacctt< / INSDSeq_sequence>

[0151] < / insdseq>

[0152] < / sequencedata>

[0153] <sequencedata sequenceidnumber="3">

[0154] <insdseq>

[0155] <INSDSeq_length>38< / INSDSeq_length>

[0156] <INSDSeq_moltype>RNA< / INSDSeq_moltype>

[0157] <INSDSeq_division>PAT< / INSDSeq_division>

[0158] <INSDSeq_feature-table>

[0159] <insdfeature>

[0160] <INSDFeature_key>source< / INSDFeature_key>

[0161] <INSDFeature_location>1..38< / INSDFeature_location>

[0162] <INSDFeature_quals>

[0163] <insdqualifier>

[0164] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0165] <INSDQualifier_value>other RNA< / INSDQualifier_value>

[0166] < / insdqualifier>

[0167] <insdqualifier id="q8">

[0168] <INSDQualifier_name>organism< / INSDQualifier_name>

[0169] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0170] < / insdqualifier>

[0171] < / INSDFeature_quals>

[0172] < / insdfeature>

[0173] < / INSDSeq_feature-table>

[0174] <INSDSeq_sequence>gggagttagtagtctcatcccatgttccaagatttgcc< / INSDSeq_s

[0175] equence>

[0176] < / insdseq>

[0177] < / sequencedata>

[0178] <sequencedata sequenceidnumber="4">

[0179] <insdseq>

[0180] <INSDSeq_length> 22< / INSDSeq_length>

[0181] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0182] <INSDSeq_division> PAT< / INSDSeq_division>

[0183] <INSDSeq_feature-table>

[0184] <insdfeature>

[0185] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0186] <INSDFeature_location>12..13< / INSDFeature_location>

[0187] <INSDFeature_quals>

[0188] <insdqualifier id="q9">

[0189] <INSDQualifier_name>note< / INSDQualifier_name>

[0190] <INSDQualifier_value>RNA< / INSDQualifier_value>

[0191] < / insdqualifier>

[0192] < / INSDFeature_quals>

[0193] < / insdfeature>

[0194] <insdfeature>

[0195] <INSDFeature_key>source< / INSDFeature_key>

[0196] <INSDFeature_location>1..22< / INSDFeature_location>

[0197] <INSDFeature_quals>

[0198] <insdqualifier>

[0199] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0200] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0201] < / insdqualifier>

[0202] <insdqualifier id="q11">

[0203] <INSDQualifier_name>organism< / INSDQualifier_name>

[0204] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0205] < / insdqualifier>

[0206] < / INSDFeature_quals>

[0207] < / insdfeature>

[0208] <insdfeature>

[0209] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0210] <INSDFeature_location>6< / INSDFeature_location>

[0211] <INSDFeature_quals>

[0212] <insdqualifier id="q12">

[0213] <INSDQualifier_name> note< / INSDQualifier_name>

[0214] <INSDQualifier_value> Fluorescein-dT Phosphoramidite

[0215] (5'-Dimethoxytrityloxy-5-[N-((3'

[0216] 6'-dipivaloylfluoresceinyl)-

[0217] aminohexyl)-3-acrylimido]-2'-deoxyUridine-3'-[(2-cyanoethyl)

[0218] -(N N-diisopropyl)]- phosphoramidite)< / INSDQualifier_value>

[0219] <NonEnglishQualifier_value> Fluorescein-dT phosphoramidite

[0220] (5'-Dimethoxytrityloxy-5-[N-((3' 6'-

[0221] dipivaloylfluoresceinyl)-aminohexyl)-3-acrylimido]-2'-deoxyuri

[0222] din-3'-[(2-cyanoethyl)-(N,N-

[0223] diisopropyl)]-phosphoramidite)< / NonEnglishQualifier_value>

[0224] < / insdqualifier>

[0225] < / INSDFeature_quals>

[0226] < / insdfeature>

[0227] <insdfeature>

[0228] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0229] <INSDFeature_location>>22< / INSDFeature_location>

[0230] <INSDFeature_quals>

[0231] <insdqualifier id="q13">

[0232] <INSDQualifier_name> note< / INSDQualifier_name>

[0233] <INSDQualifier_value> Non-fluorescent Black Hole Quencher 1

[0234] (2-[N-(2-hydroxyethyl)-4-[[2-methoxy-5-methyl-4-[(4-methyl-2-

[0235] nitrophenyl)diazenyl]phenyl]diazenyl]anilino]ethanol) at

[0236] 3`-end< / INSDQualifier_value>

[0237] <NonEnglishQualifier_value> Non-fluorescent Black Quencher

[0238] Hole Quencher 1

[0239] (2-[N-(2-hydroxyethyl)-4-[[2-methoxy-5-methyl-4-[(4-methyl-2-

[0240] nitrophenyl)diazenyl]phenyl]diazenyl]anilino]ethanol) on

[0241] 3`-end< / NonEnglishQualifier_value>

[0242] < / insdqualifier>

[0243] < / INSDFeature_quals>

[0244] < / insdfeature>

[0245] <insdfeature>

[0246] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0247] <INSDFeature_location>1..11< / INSDFeature_location>

[0248] <INSDFeature_quals>

[0249] <insdqualifier id="q16">

[0250] <INSDQualifier_name>note< / INSDQualifier_name>

[0251] <INSDQualifier_value>DNA< / INSDQualifier_value>

[0252] < / insdqualifier>

[0253] < / INSDFeature_quals>

[0254] < / insdfeature>

[0255] <insdfeature>

[0256] <INSDFeature_key>misc_feature< / INSDFeature_key>

[0257] <INSDFeature_location>14..22< / INSDFeature_location>

[0258] <INSDFeature_quals>

[0259] <insdqualifier id="q17">

[0260] <INSDQualifier_name>note< / INSDQualifier_name>

[0261] <INSDQualifier_value>DNA< / INSDQualifier_value>

[0262] < / insdqualifier>

[0263] < / INSDFeature_quals>

[0264] < / insdfeature>

[0265] < / INSDSeq_feature-table>

[0266] <INSDSeq_sequence> aaggtttcctcgtccctgggca< / INSDSeq_sequence>

[0267] < / insdseq>

[0268] < / sequencedata>

[0269]

[0270] <---

Claims

A method for detecting the Henipavirus hendraense virus using a method based on the use of deoxyribozyme 10-23, including the extraction of RNA from biological samples followed by the detection of target fragments of the RNA genome of H. hendraense, characterized in that the analysis is carried out in real time using oligonucleotide sequences of a biosensor based on deoxyribozyme 10-23 and a fluorescently labeled probe complementary to a specific fragment of the RNA of the H. hendraense virus, HEV_Dz1 (SEQ ID NO1) 5'-TGCCCAGGGAGGCTAGCTggaugagacug-3', HEV_Dz2 (SEQ ID NO2) 5'-cuuggaacaugACAACGAGAGGAAACCTT-3', and as a fluorescently labeled probe - Fsub (SEQ ID NO4) 5'-AAGGTT(FAM)TCCTCguCCCTGGGCA(BHQ1)-3', and the results are interpreted based on a comparison of the fluorescent signal accumulation curve of the sample with a control negative sample that does not contain RNA, and the result is considered positive if the final value of the fluorescent signal of the sample exceeds the value of the negative control by at least one and a half times.

Citation Information

Patent Citations

  • Method of detecting nipah virus by method based on use of deoxyribozyme 10-23

    RU2816271C1

  • Method for detecting hendra henipavirus RNA by real-time RT-pcr

    RU2822161C1

  • Method for detecting Nipah virus and method for providing immunoprotection against Henipa viruses

    US20070150972A1