Method for comparative assessment of impact of low and high FAO maize values on relative copy number indices

The method addresses the lack of specificity and accuracy in assessing photosynthetic processes by quantitatively measuring the rbcL gene copy number in maize chloroplast DNA, offering a more reliable and quantitative assessment of photosynthesis activity.

RU2864963C1Active Publication Date: 2026-06-30FEDERALNOE GOSUDARSTVENNOE BIUDZHETNOE NAUCHNOE UCHREZHDENIE VSEROSSIISKII NAUCHNO ISSLEDOVATELSKII INST KUKURUZY
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
RU · RU
Patent Type
Patents
Current Assignee / Owner
FEDERALNOE GOSUDARSTVENNOE BIUDZHETNOE NAUCHNOE UCHREZHDENIE VSEROSSIISKII NAUCHNO ISSLEDOVATELSKII INST KUKURUZY
Filing Date
2025-06-20
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing methods for assessing photosynthetic processes in plants lack specificity, accuracy, and objectivity, particularly in plant breeding, and often require specialized equipment.

Method used

A method using quantitative RT-PCR to determine the relative copy number of the rbcL gene of chloroplast DNA in maize, relative to the chromosomal reference gene MEK1, through a qReal-Time PCR method, involving the extraction of total genomic DNA from maize seedlings and using specific primers and a Rotor-Gene Q 5plex Platform analyzer.

Benefits of technology

Provides a highly sensitive and reliable assessment of the potential intensity of photosynthetic processes, enabling more objective and specific evaluation of photosynthesis activity in plants, suitable for breeding applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001
    Figure 00000001
Patent Text Reader

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to a method for comparatively assessing the influence of low and high FAO indicators of maize on the indicators of the relative copy number of chloroplast DNA. The invention can be used for the purposes of determining optimal conditions for growing corn in laboratory and natural conditions, as well as for breeding work.EFFECT: improved harvest performance.2 cl, 2 tbl, 1 ex
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Technical field

[0002] The invention relates to the field of "biotechnology" and is intended to evaluate the potential intensity of photosynthetic processes using an objective assessment of the relative copy number of the rbcL gene of chloroplast DNA in relation to the chromosomal reference gene MEK1 of maize using the qReal Time-PCR method.

[0003] Technology Level

[0004] A method for assessing the functional state of plant tissues and organs that do not contain chlorophyll is known (RU Patent No. 2606923, IPC A01G 7 / 00, G01N 21 / 39, published January 10, 2017). The method involves measuring optical characteristics. The flicker dynamics of speckles reflected from or transmitted by coherent laser radiation are measured over a specified period of 3 seconds or more. The degree and rate of intensity fluctuations in a given region of the speckle pattern are used to assess the functional state of the tissues: higher fluctuations indicate a higher metabolic activity level.

[0005] A disadvantage is that this method measures the optical characteristics of plant tissues using speckle flicker dynamics. While it can be useful for assessing functional status, it does not provide specific information about photosynthetic processes and their intensity.

[0006] A method for fluorimetric determination of the parameters of photosynthesis in photoautotrophic organisms, a device for implementing this method, and a measuring chamber are known (RU Patent No. 2354958, IPC G01N 21 / 64, published May 10, 2009). In the method, which includes exposure of a sample of the analyzed medium to light, the excitation light pulses have the same amplitude and variable duration, while the chlorophyll fluorescence characteristics are measured under constant background illumination simulating the irradiation intensity of the object during the study in natural conditions, and after its adaptation to the dark. The device includes a measuring chamber, an even number of measuring light sources optically coupled to the measuring chamber, a sample fluorescence measurement module, a control unit, a light source current stabilizer, and a natural irradiance sensor.The measuring chamber contains a housing, a fluorescence recorder and an even number of light sources, which are located in pairs diametrically opposite to each other in one plane perpendicular to the axis of the housing.

[0007] The disadvantage of this method is that it measures chlorophyll fluorescence under varying lighting and adaptation conditions. While it can be useful for assessing photosynthetic parameters, it is not specific for assessing the intensity of photosynthetic processes, cannot be used in plant breeding, and requires specialized equipment.

[0008] The closest in functionality to this method for assessing the potential intensity of photosynthesis is the “Method for assessing the intensity of leaf photosynthesis in breeding material of peas” (RU Patent No. 2626586, IPC A01H 1 / 04, A01H 5 / 00, published July 28, 2017). The invention is a method for evaluating the intensity of leaf photosynthesis in pea breeding material, which includes measuring the intensity of absorption of carbon dioxide molecules per unit surface area of ​​the leaves of the first fruiting node in the fruiting phase, with measurements being carried out from 9:00 to 11:00 a.m. using a portable gas analyzer of the LI-6400 XT brand, which records and displays the value of the intensity of photosynthesis on a digital screen, with the measuring chamber being attached to the plant leaf and waiting for gas exchange in the measuring chamber to stabilize for 1.5-2 minutes.

[0009] A disadvantage is that this method uses a portable gas analyzer and measures the rate of carbon dioxide absorption by pea leaves. However, it does not provide detailed information on the molecular and genetic mechanisms responsible for photosynthetic processes.

[0010] Disclosure of invention

[0011] The objective of the method for assessing the potential intensity of photosynthesis in corn using the relative copy number of chloroplast DNA is to comparatively assess the degree of photosynthetic processes in corn leaves in order to determine optimal conditions for its cultivation in laboratory and natural conditions, as well as a potential marker for breeding work.

[0012] The technical result of the invention is to increase the accuracy, objectivity and specificity of photosynthesis assessment.

[0013] The problem is solved by the fact that the method for comparative assessment of the effect of low and high FAO maize indices on the relative copy number of chloroplast DNA is characterized by the fact that the leaves of ten-day-old maize seedlings of early (FAO 130 and 150) and late (FAO 400 and 500) maturity groups were used to extract total DNA. Total genomic DNA from 70-100 mg of plant tissue of each sample was extracted using a modified CTAB DNA extraction procedure [Kryukov, Lavr & Vodolazhsky, Dmitry & Kamenetsky-Goldstein, Rina. (2022). Micropropagation of Grapevine and Strawberry from South Russia: Rapid Production and Genetic Uniformity. Agronomy. 12. 308. 10.3390 / agronomy12020308]. To perform quantitative RT-PCR, samples of total DNA obtained from the leaves of ten-day-old corn seedlings are used.The quantitative RT-PCR reaction is carried out in a 25 μl reaction mixture consisting of 12.5 μl of the "Reagent kit for RT-PCR in the presence of EVA Green dye" ("Synthol", Russia), 0.5 μl of dd H2O (deionized water), 1 μl of the corresponding primers (forward and reverse, 0.33 μM) and 10 μl of total DNA at a concentration of 5 ng / μl. PCR is carried out using a Rotor-Gene Q 5plex Platform automatic analyzer "Corbett Research" (Australia) using the following program: initial denaturation at 95°C for 5 min (1 cycle), then 40 cycles of denaturation at 95°C for 10 sec, annealing at 58°C for 15 sec and elongation at 72°C for 20 sec; Relative copy number determination of the rbcL genes (chloroplast DNA) was performed using the MEK1 gene (chromosomal DNA) as a reference. Algorithms 2 were used to quantitatively estimate the relative copy number of chloroplast DNA. -ΔCt and 2 -ΔΔCt (Schmittgen TD, Livak KJ., 2008).

[0014] The FAO index is the FAO Early Maturity Index. This index is a conventional indicator developed by the Food and Agriculture Organization of the United Nations and is used to classify maize hybrids by maturity date.

[0015] Distinctive features from the prototype:

[0016] - leaves of ten-day-old seedlings of early (FAO 130 and 150) and late (FAO 400 and 500) maturity groups of maize were used for the extraction of total DNA;

[0017] - Total genomic DNA from 70-100 mg of plant tissue of each sample was extracted using a modified CTAB DNA extraction procedure;

[0018] - the quantitative RT-PCR reaction is carried out in 25 μl of the reaction mixture consisting of 12.5 μl of the “Reagent kit for RT-PCR in the presence of EVA Green dye” (“Synthol”, Russia), 0.5 μl of dd H2O (deionized water), 1 μl of the corresponding primers (forward and reverse, 0.33 μM) and 10 μl of genomic DNA with a concentration of 5 ng / μl;

[0019] - PCR is performed using a Rotor-Gene Q 5plex Platform recording amplifier “Corbett Research” (Australia) using the following program: initial denaturation at 95°C for 5 min (1 cycle), then 40 cycles of denaturation at 95°C for 10 sec, annealing at 58°C for 15 sec and elongation at 72°C for 20 sec;

[0020] - Determination of the relative copy number of the rbcL genes (chloroplast DNA) is performed using the MEK1 gene (chromosomal DNA) as a reference. Algorithms 2 were used to quantitatively estimate the relative copy number of chloroplast DNA. -ΔCt and 2 -ΔΔCt .

[0021] Chloroplast DNA (cpDNA) exists in the form of multiple copies per organelle (chloroplasts or plastids). cpDNA is contained in leaves, and its copy number changes depending on the functional load of the chloroplast [Kuroiwa T. Review of cytological studies on cellular and molecular mechanisms of uniparental (maternal or paternal) inheritance of plastid and mitochondrial genomes induced by active digestion of organelle nuclei (nucleoids). J Plant Res. 2010 Mar;123(2):207-30. doi: 10.1007 / s10265-009-0306-9]. The number of DNA copies in chloroplasts has a direct impact on the level of RNA expressed by them and, thus, this indicator can be used as a marker of the intensity of work of these organelles in plants [Udy DB, Belcher S, Williams-Carrier R, Gualberto JM, Barkan A. Effects of reduced chloroplast gene copy number on chloroplast gene expression in maize. Plant Physiol. 2012 Nov;160(3):1420-31. doi: 10.1104 / pp.112.204198.].

[0022] Quantitative RT-PCR (qRT-PCR) measures the relative abundance of organelle DNA relative to a nuclear target gene. We used this approach to determine changes in organelle DNA copy number relative to the nuclear genome in maize seedling leaves under laboratory conditions.

[0023] The set of features of the invention ensures the inventive level of the technical solution.

[0024] Implementation of the invention

[0025] The method is implemented as follows

[0026] Leaves of 10-day-old maize seedlings of early (FAO 130 and FAO 150) and late (FAO 400 and FAO 500) maturity groups were used for total DNA extraction. Total genomic DNA from 70-100 mg of plant tissue of each sample was extracted using a modified CTAB DNA extraction procedure. [Schenk JJ, Becklund LE, Carey SJ, Fabre PP. What is the "modified" CTAB protocol? Characterizing modifications to the CTAB DNA extraction protocol. Appl Plant Sci. 2023 Jun 2; 11(3):e11517. doi: 10.1002 / aps3.11517].

[0027] All primers for non-overlapping organelle genes were designed using the Primer-BLAST program (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The reference sequence NC_001666.2 was used for the rbcL gene, and the reference sequence NM_001371620.1 was used for the MEK1 gene.

[0028] The approach we used ensures the required sensitivity and reproducibility of the proposed method. The main properties of the in-house designed primers used are listed in Table 1.

[0029]

[0030] Table 1. Characteristics of the primers used.

[0031] Primer Nucleotide sequence, 5'-3' Amplicon (b.n.) Tm (°C) Compartment rbcL_F_CNV GACTGGGTATCCATGCCAGG 148 60 Chloroplast DNA rbcL_R_CNV CAGGTGCATTTCCCCAAGGA MEK1_F_CNV GATCCGGCTCAGAGGATGTC 209 60 Chromosomal DNA MEK1_R_CNV CAGTTGAGGAGCAGATGCCA

[0032] The quantitative RT-PCR reaction is carried out in a 25 μl reaction mixture consisting of 12.5 μl EVA Green “Synthol” (Russia), 0.5 μl dd H2O (deionized water), 1 μl of the corresponding primers (forward and reverse, 0.33 μM) and 10 μl of total DNA.

[0033] PCR is performed using the Rotor-Gene Q 5plex Platform automated analyzer "Corbett Research" (Australia) or other analogs using the following program: initial denaturation at 95°C for 5 min (1 cycle), then 40 cycles of denaturation at 95°C for 10 sec, annealing at 58°C for 15 sec and elongation at 72°C for 20 sec. Determination of the relative copy number of the rbcL genes (chloroplast DNA) is carried out using the MEK1 gene (chromosomal DNA) as a reference. Algorithms 2 were used for quantitative assessment. -ΔCt and 2 -ΔΔCt (Schmittgen, Livak, 2008).

[0034] Conducting analysis

[0035] The analysis of primary data is carried out using the amplifier software product in the Ct dimension, the relative copy number of the chloroplast gene rbcL is calculated relative to the chromosomal reference gene MEK1.

[0036] This indicator, using the relative copy number of chloroplast DNA, allows for a comparative assessment of the potential intensity of photosynthesis processes.

[0037] Example

[0038] A comparative assessment of the effects of low and high FAO maize values ​​on the relative copy number of chloroplast DNA was carried out.

[0039] 1. Experimental plants were obtained from maize seeds of various maturity groups, germinated in accordance with GOST 12038-84 "Seeds of Agricultural Crops. Methods for Determining Germination." One seed sample was laid out on two layers of moistened filter paper measuring 10 x 100 cm (±2 cm), embryo-side down, along a line drawn 2–3 cm from the upper edge of the sheet. The seeds were covered with a strip of moistened filter paper of the same size, then loosely rolled into a roll and placed vertically in a dry-air thermostat.

[0040] 2. Plants were incubated at 20 ± 1°C in a TCO-1 / 80 SPU dry-air thermostat (Russia) for 10 days. Six leaf blade samples (70–100 mg) were randomly selected from each group of plants for subsequent total DNA extraction.

[0041] 3. A quantitative RT-PCR reaction was performed with the obtained total DNA preparations in a 25 μl reaction mixture consisting of 12.5 μl EVA Green "Synthol" (Russia), 0.5 μl dd H2O (deionized water), 1 μl of the corresponding primers (forward and reverse, 0.33 μM) and 10 μl of total DNA. RT-PCR was performed using an automatic analyzer Rotor-Gene Q 5plex Platform "Corbett Research" (Australia) using the following program: initial denaturation at 95 ° C for 5 min (1 cycle), then 40 cycles of denaturation at 95 ° C for 10 sec, annealing at 58 ° C for 15 sec and elongation at 72 ° C for 20 sec. Relative copy number determination of the rbcL genes (chloroplast DNA) is performed using the MEK1 gene (chromosomal DNA) as a reference. Algorithms 2 were used for quantitative evaluation. -ΔCt and 2 -ΔΔCt (Schmittgen, Livak, 2008).

[0042] 4. Statistical analysis of the obtained data was performed using parametric and nonparametric tests in STATISTICA 10.0. The results of the statistical analysis are presented in Table 2.

[0043] Table 2. Statistical analysis data of the obtained data.

[0044] Statistical parameters K LowFAO K HighFAO Number of measurements (n) 9 9 Arithmetic mean 1280,2 2496,0 Median 1209 2096 Standard deviation 419,87 864,81 Standard error 139,96 288,27

[0045] A comparative analysis of the obtained data revealed a statistically significant (Student's t-test, p < 1%) difference in the relative chloroplast DNA copy number in maize leaves between plants with low and high PAO values. The relative chloroplast DNA copy number in maize with low PAO was significantly lower, based on the arithmetic mean values ​​(by 42%), than in maize with high PAO.

[0046]

[0047] where K is the coefficient of the ratio of the relative copy number indicators between corn varieties with high (K highFAO ) and low (K lowFAO ) FAO compared to that for plants with high FAO (K highFAO ), %;

[0048] K highFAO – an indicator of the relative copy number of chloroplast DNA of high-FAO maize;

[0049] K lowFAO – an indicator of the relative copy number of chloroplast DNA of low-PAO maize;

[0050] Our proposed approach enables highly sensitive and reliable quantitative measurements of the relative copy number of chloroplast DNA for indirect assessment of the potential intensity of plant photosynthetic activity and the use of these indicators in breeding. Unlike older methods, this method, using qReal-Time PCR to estimate the relative copy number of the rbcL gene in maize chloroplast DNA, provides a more objective and specific assessment of the intensity of photosynthetic processes. It is based on molecular genetic methods and enables a more reliable and quantitative assessment of photosynthesis activity in plants.

Claims

1. A method for comparative evaluation of the effect of low and high FAO values ​​of maize on the relative copy number of chloroplast DNA, characterized in that the leaves of ten-day-old maize seedlings of early and late maturity groups are used as plant tissue samples for total DNA extraction, with genomic DNA from 70-100 mg of plant tissue of each sample being extracted using a modified DNA extraction procedure using the CTAB method; the quantitative RT-PCR reaction is carried out in 25 μl of a reaction mixture consisting of 12.5 μl of EVA Green "Synthol", 0.5 μl of dd H2O - deionized water, 1 μl of the corresponding primers: forward and reverse, 0.33 μM, and 10 μl of genomic DNA with a concentration of 5 ng / μl;PCR is performed using the Rotor-Gene Q 5plex Platform "Corbett Research" automatic analyzer at temperatures of initial denaturation at 95°C for 5 min - 1 cycle, then 40 cycles of denaturation at 95°C for 10 sec, annealing at 58°C for 15 sec - signal registration, and elongation at 72°C for 20 sec; the relative copy number of chloroplast DNA is determined using the rbcL gene - chloroplast DNA, the MEK1 gene - chromosomal DNA, is used as a reference; for quantitative assessment, algorithms 2 are used; -ΔCt and 2 -ΔΔCt , the analysis of primary data is carried out using the amplifier software product in the Ct dimension, the relative copy number of the chloroplast gene rbcL is calculated relative to the chromosomal reference gene MEK1.

2. The evaluation method according to paragraph 1, characterized in that the early maturity group corn sprouts have an FAO index of 130 and 150, and the late maturity group have an FAO index of 400 and 500.