Preimplantation genetic testing for wiskott-aldrich syndrome

Abstract

FIELD: biotechnology.SUBSTANCE: method for preimplantation genetic testing of Wiskott-Aldrich syndrome. The specified method provides for the identification of the inheritance of the genetic variant NC_000023.10:g.48547261-48547282del22 (NM_000377.2:c.1144_1165de122, p.Pro382Val_fs*56) in the WAS gene and includes a dual detection system – direct and indirect, where direct detection is carried out using primers for amplification of SEQ ID NO. 35–38, and indirect detection is carried out using primers selected from SEQ ID NO. 1–34.EFFECT: invention provides a test system for diagnosing genetic NC_000023.10:g.48547261-48547282del22 in the WAS gene with a dual detection system – direct and indirect.1 cl, 2 tbl, 1 ex

Description

[0001] The invention relates to preimplantation genetic testing for monogenic diseases. Currently, more than 350 million people worldwide suffer from a rare disease (according to the RARE Project). The total number of such diseases, according to estimates by the European Organization for Rare Diseases (EURORDIS), ranges from 5,000 to 7,000. Approximately 80% of rare diseases have a genetic cause. Knowing the genetic basis of a disease allows for a highly accurate prediction not only of the health of an already born child but also to assess the risk of having such a child by analyzing the parents' genotypes, as well as to conduct genetic diagnosis at the earliest stages. Preimplantation genetic testing (PGT) for monogenic diseases is becoming a powerful tool for the prevention of such diseases.

[0002] The present invention relates to a method for preimplantation genetic testing for Wiskott-Aldrich syndrome. Wiskott-Aldrich syndrome is a rare inherited disorder of the immune system characterized by an X-linked recessive inheritance pattern. Wiskott-Aldrich syndrome occurs with a frequency of 1 in 100,000 live births. This disease leads to the development of immunodeficiency beginning in infancy, and sometimes neonatal age. A child suffering from this syndrome is prone to severe infections of various localizations, eczema, hemorrhages (including intracranial), and has an increased risk of autoimmune diseases and malignant neoplasms. With the X-linked recessive inheritance pattern, the probability of having a child with this disease in a family is 50% for a boy, and 50% for a girl.

[0003] Wiskott-Aldrich syndrome can be caused by pathogenic genetic variants in the WAS gene, located on chromosome X [Massaad, MJ, Ramesh, N. and Geha, RS (2013), Wiskott-Aldrich syndrome: a comprehensive review. Ann. NY Acad. Sci., 1285: 26–43]. This gene encodes the Wiskott-Aldrich syndrome protein (WAS protein), which is expressed exclusively in hematopoietic tissues. This protein is involved in apoptosis, cytoskeletal reorganization, and signal transduction.

[0004] PGT for Wiskott-Aldrich syndrome is performed for families with a confirmed molecular genetic cause of the disease. It is important to note that the pathogenicity and causativity of genetic variants is determined prior to PGT for a monogenic disease and is not included in the goals and objectives of PGT for a monogenic disease or in the comprehensive package of measures for PGT for a monogenic disease. Pathogenicity is assessed according to the international standard—the criteria described in 2015 by the American College of Medical Genetics and Genomics (Association for Molecular Pathology (ACMG-AMP)) during the search for the molecular genetic cause of the disease. PGT is recommended for families with a high risk of having a child with a severe (incurable) hereditary disease with identified pathogenic variants that determine this risk.PGT allows the selection of embryos without pathogenic variants in compound heterozygotes from all embryos obtained during IVF (in vitro fertilization) and, therefore, without the risk of developing disease.

[0005] The main challenge in embryo genetic diagnosis is the small initial amount of biomaterial, as each biopsy contains only one to three cells. In this case, to improve the efficiency and accuracy of the analysis, it is important to completely eliminate the possibility of contamination and mitigate the potential effects of uneven and / or incomplete amplification, as well as biomaterial degradation. This requires the development of a test system with specific characteristics. The test system is designed to accommodate various types of biomaterial—total deoxyribonucleic acid (DNA) isolated from various tissues, whole genome amplification (WGA) products, and single cells.The combination of versatility in biomaterial selection and step-by-step amplification of target fragments enables the analysis of multiple pathogenic variants in a single sample, including on single cells, and the detection of incomplete amplification, contamination, or sample degradation. Another feature of PGT is the lack of information about the embryo's biological characteristics: unlike an adult, an embryo may have any chromosomal abnormalities, which complicates the assessment of the embryo's status for a specific genetic variant. Therefore, a test system for PGT of a monogenic disease must be able to identify such cases and assess their impact on the reliability of the diagnostic result.

[0006] No description of a similar technical solution was found in publicly available sources.

[0007] The presented method of PGT for Wiskott-Aldrich syndrome solves the problem of developing a more accurate method of preimplantation genetic testing of this monogenic disease without the use of expensive devices and reagents, which could be used on various types of biomaterial: DNA isolated from different tissues, the product of whole genome amplification (WGA), single cells.

[0008] The technical result was the creation of a test system for diagnosing a genetic variant (the nucleotide number in the reference sequence of genomic DNA is designated by the prefix NC, the nucleotide number in the reference sequence of the coding transcript is designated by the prefix NM): NC_000023.10:g.48547261-48547282del22 (NM_000377.2:c.1144_1165del22, p.Pro382Val_fs*56) in the WAS gene with a dual detection system - direct and indirect. This genetic variant was identified as the cause of Wiskott-Aldrich syndrome in the patient, as it is located in the WAS gene, mutations in which lead to the development of this syndrome. It was detected in a hemizygous state in a child with clinically established Wiskott-Aldrich syndrome. It causes a frameshift and translation termination at 56 codons, disrupting protein function. A dual detection system is necessary when working with small amounts of biomaterial, as unstable amplification can lead to loss of information or reduced analytical accuracy.Direct diagnosis involves directly analyzing the presence or absence of a pathogenic variant. In this case, primers were selected for the genetic variant NC_000023.10:g.48547261-48547282del22 (NM_000377.2:c.1144_1165del22, p.Pro382Val_fs*56) of the deletion type (absence of several nucleotides, or "Deletion del"). These primers allow for detection of the mutation by the difference in fragment lengths using capillary electrophoresis. Indirect diagnosis involves analyzing the inheritance of molecular genetic markers linked to the mutation, i.e., inherited along with it. For this purpose, polymorphic loci called STR (short tandem repeat) were selected at a distance of no more than 3 MB (which corresponds to 3% crossing over on average) from the WAS gene in each direction, with a heterozygosity of at least 0.70 to ensure maximum informativeness of indirect diagnostics.STRs are repeats of two or more nucleotides located consecutively (for example, the adenine-cytosine (AC) pair, repeated several times in a row: ACACACACA) and are present in large numbers in the human genome. The number of repeats in each of them can vary from individual to individual and can also differ in the same person on two homologous chromosomes. Heterozygosity greater than 0.70 indicates a high probability that in the same person, the number of nucleotide repeats in a given STR on one chromosome will differ from the number of repeats in the same STR on the homologous chromosome. In other words, the alleles of a given marker in this individual will differ in length. Amplification of a fragment containing such a marker will produce amplicons of two different lengths.By analyzing the number of repeats in several markers surrounding a pathogenic variant and studying their inheritance in the tested family, it is possible to establish linkage between the marker alleles and the pathogenic variant. The diagnostic value of analyzing the number of repeats in these markers in embryos is that the inherited allele of each marker allows one to determine whether the embryo has inherited the WAS gene carrying the pathogenic variant or whether it has inherited a WAS gene from another, homologous chromosome that does not contain the pathogenic variant. For each of these loci, primers were selected for amplification using nested or semi-nested PCR in two rounds, increasing the accuracy and efficiency of amplification. The test system included 11 STR loci for the WAS gene: DXS4734, DXS4763, DXS4768, DXS4791, DXS4783, DXS4835, DXS4857, DXS4884, DXS1208, DXS4911, DXS4945.The amplification primers are located on the X chromosome in the region of coordinates 47348825-49458668 (according to hg19). The sequences of the primers for the amplification of DNA fragments containing the listed STR loci are specified in the claims in the list of SEQ ID NOs 1-34. It is important to note that a number of special requirements were observed when selecting the primers: the length of the product with external primers for the first round of PCR should not exceed 500 bp (for production from fragments obtained during whole-genome amplification), the length of the product with internal primers for the second round of PCR from 120 to 350 bp, high specificity of external primers, and annealing temperature not differing by more than 1°C.

[0009] Preparatory stage of the urban-type settlement

[0010] The preparatory stage involves testing the test system: selecting amplification conditions optimal for primer performance, analyzing the efficiency and specificity of PCR amplification in both rounds, and assessing the test system's versatility for various biosample types (DNA, WGA product, single cells). During the test system testing, stock primer dilutions with a concentration of 100 mM and working dilutions of primer combinations (a combination of primer pairs for rounds 1 and 2) were prepared with a concentration of 100 mM for each primer in solution.Since various types of matrices can be used in the diagnostics of clinical material, two biopsies of single cells in a special lysis buffer (1×PCR Buffer, 0.1% Tween-20, 0.1% Triton X-100, 1 μg Proteinase K), two samples of whole-genome amplification products of embryo biopsies (WGA), as well as total DNA of family members isolated from blood were used in the development of the test system to compile a pedigree and identify the linkage of a pathogenic variant with the alleles of polymorphic markers.

[0011] In nested and semi-nested PCR, amplification is performed in two stages. In the first stage, multiplex PCR is performed with all external primers for all loci included in the test system to enrich the sample with all target fragments. In the second stage, each fragment is individually amplified with internal primers.

[0012] Semi-nested PCR

[0013] For the first stage, external highly specific primers were selected for amplifying fragments from 300 to 500 bp. For the second stage, primers were selected for amplifying fragments no longer than 350 base pairs, and labels for detection by fragment analysis were introduced. The primer sequences for amplifying DNA fragments containing STR loci are listed in the claims in SEQ ID NOs 1-34. The PCR mixture for the first round of amplification contained 1xPCR Buffer with Mg2+ (Eurogen, Russia), 0.1 mM of each deoxynucleotide, 0.15 μM of each primer, 2.5 U / μl of HsTaq DNA polymerase (Eurogen, Russia), 6% DMSO, and 1 μl of total DNA, 2.5 μl of WGA, or 5 μl of lysis buffer with the sample as a template. The first round of amplification was carried out according to the following protocol: denaturation at 94°C for 2 minutes, 30 cycles with a decrease in the annealing temperature of the primers from 62 to 45°C in each cycle, and an extension step for all templates at 72°C for 10 minutes.Next, the products of the first stage were distributed into individual test tubes with one pair of primers for a specific locus.

[0014] The PCR mixture for the second stage included 1xPCR buffer with Mg2+ (Eurogen, Russia), 0.5xRediLoad™ loading buffer (Thermo Fisher Scientific, USA), 0.2 mM of each deoxynucleotide, 0.2 μM of each primer, 1 U / μl HsTaq DNA polymerase (Eurogen, Russia), 6% dimethyl sulfoxide (DMSO), and 1 μl of the PCR product from the first stage of amplification as a template. The second stage of amplification was carried out according to the following protocol: denaturation stage at 95°C for 2 minutes, 35 cycles: denaturation at 95°C for 30 seconds, primer annealing at 57°C for 30 seconds, template synthesis at 72°C for 1 minute, stage of extension of all templates at 72°C for 5 minutes. Evaluation of amplification efficiency and specificity was performed using 2% agarose gel electrophoresis. The agarose gel electrophoresis results allow one to determine the required dilution of the amplification products for fragment analysis (DNA amplification products from family members).

[0015] Fragment analysis of the amplification products was performed using capillary electrophoresis on a 3130x1 Genetic Analyzer (Applied Biosystems, USA). Based on the fragment analysis results, a pedigree is compiled and informative polymorphic STR loci are identified for each family, which will subsequently be used in clinical diagnostics. Loci are categorized as non-informative (the carrier of the pathogenic variant is homozygous for this locus), semi-informative (the alleles for this marker are the same on some parental chromosomes), and informative (the alleles for this marker are different on all parental chromosomes, allowing each of them to be distinguished during embryo genotype analysis).

[0016] Detection of pathogenic variant NC_000023.10:g.48547261-48547282del22

[0017] (NM_000377.2:cl 144 1165del22, p.Pro382Val_fs*56) was carried out using the amplification primers shown in SEQ ID NO 35-38, where the outer primers are SEQ ID N0 35-36, and the inner primers are SEQ ID N0 37-38.

[0018] Example 1

[0019] Patients A

[0020] Family A contacted CGRM Genetiko. They had a child with Wiskott-Aldrich syndrome and hemizygous carriage of the genetic variant NC_000023.10:g.48547261-48547282del22 (NM_000377.2:c.ll44_1165del22, p.Pro382Val_fs*56) in the WAS gene. The couple was recommended to undergo PET for Wiskott-Aldrich syndrome as part of IVF to select embryos that did not inherit the disease.

[0021] Family haplotyping

[0022] In the first stage, biomaterial (peripheral blood) was obtained from family members to detect the pathogenic variant and identify linkage groups of polymorphic marker alleles. Primer sequences for amplifying DNA fragments containing STR loci are listed in the patent claims as SEQ ID NOs 1-34. Eleven STR loci were analyzed. Of these, eight were found to be maternally informative. Therefore, embryo samples were tested only for informative markers.

[0023] Linkage groups were established as follows. Alleles of polymorphic markers that match in the patient, a heterozygous carrier of the genetic variant NC_000023.10:g.48547261-48547282del22 (NM_000377.2:cl 1441165del22, p.Pro382Val_fs*56) in the WAS gene and her child with Wiskott-Aldrich syndrome and a hemizygous carrier of this variant, are recognized as linked to this genetic variant and to each other. Alleles of polymorphic markers of the patient that do not match the alleles of the child with the disease are recognized as linked to each other and to the normal allele of the WAS gene.

[0024] The alleles of polymorphic markers in a healthy male family member are recognized as linked to each other and to the normal F8 gene. Indirect diagnosis allows us to conclude whether a normal or mutant allele of the gene is inherited, even in cases of allele loss or failure of the DNA fragment amplification reaction for direct diagnosis.

[0025] As a result of haplotyping and linkage group determination for family A from the example, the results presented in Table 1 were obtained. Alleles listed on the same line are located on the same chromosome, that is, they represent a linkage group. Thus, for the female patient, two linkage groups are represented, corresponding to each of the two X chromosomes. The male partner and child have only one X chromosome and only one linkage group. N in the table denotes the wild-type allele, and mut denotes the mutant allele. The numbers indicate the lengths of the amplicons in nucleotide pairs; their lengths depend on the number of repeats in the STR marker. The pathogenic variant NC_000023.10:g.4854726 l-48547282del22 (NM_000377.2:cl 144 1165del22, p.Pro382Val_fs*56) in the WAS gene is designated briefly in the table as WAS p.Pro382Val_fs*56.

[0026]

[0027] Table 1. Haplotyping results of family A

[0028] As a result of haplotyping, it was concluded that the patient with the pathogenic variant had the following linked alleles of STR markers: DXS4763 - 262, DXS4768 - 265, DXS4783 - 190, DXS4791 - 127, DXS4835 - 344, DXS4857 - 317, DXS4884 - 288, DXS4911 - 258.

[0029] Preimplantation genetic testing

[0030] Two embryos were obtained in an IVF cycle. A biopsy was performed on day 5 of development (at the IVF clinic). The biopsy specimen in WGA buffer (lxPBS (Invitrogen, USA), 1% polyvinylpyrrolidone (PVP) (Fertipro, Belgium)) was sent to the Genetico laboratory. To monitor for contamination at various stages of sample processing, the laboratory has developed a system of controls: a contamination control for the biopsy buffer, a contamination control during transportation (one tube containing the buffer is not opened by the embryologist), and a contamination control for each sample (a sample of the medium from the last wash drop of the biopsy material). All of these controls, along with the samples, undergo whole-genome amplification, after which the slightest amount of DNA contaminating the controls will be visible. Whole genome amplification was performed using the commercial SurePlex kit (Illumina, USA).

[0031] The whole-genome amplification product, as well as DNA from all family members, was amplified in step 1 using multiplex PCR with primers for detecting the pathogenic variant and primers for polymorphic markers informative for family A, in accordance with the test system protocol developed during the preparatory phase. In step 2, amplification was performed for each marker separately, according to the developed test system protocol. This allowed us to determine the linkage groups inherited by each embryo. A test for sex chromosome markers AMEL and SRY was also performed. The results are presented in Table 2.

[0032]

[0033] Table 2. PGT-M results for family A

[0034] Based on direct and indirect diagnostic tests, two embryos did not inherit the disease. Both embryos were found to be male and inherited the patient's marker linkage group associated with the normal WAS gene. They were recommended for transfer based on the PGT-M results.

[0035] --->

[0036] <?xml version="1.0" encoding="UTF-8"?>

[0037] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0038] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0039] <ST26SequenceListing dtdVersion="V1_3" fileName="Способ

[0040] преимплантационного генетического тестирования синдрома

[0041] Вискотта-Олдрича.xml" softwareName="WIPO Sequence"

[0042] softwareVersion="2.3.0" productionDate="2026-04-09">

[0043] <applicationidentification>

[0044] <ipofficecode>RU< / ipofficecode>

[0045] <applicationnumbertext> 2025124339< / applicationnumbertext>

[0046] <filingdate> 2025-09-03< / filingdate>

[0047] < / applicationidentification>

[0048] <applicantfilereference> 2025124339< / applicantfilereference>

[0049] <applicantname languagecode="ru">Public joint-stock company

[0050] “Center of Genetics and Reproductive Medicine “GENETIKO”< / applicantname>

[0051] <applicantnamelatin>CENTER OF GENETICS AND REPRODUCTIVE MEDICINE

[0052] GENETICO PUBLIC JOINT-STOCK COMPANY< / applicantnamelatin>

[0053] <inventiontitle languagecode="ru">Preimplantation method

[0054] Genetic testing for Wiskott-Aldrich syndrome< / inventiontitle>

[0055] <sequencetotalquantity> 38< / sequencetotalquantity>

[0056] <sequencedata sequenceidnumber="1">

[0057] <insdseq>

[0058] <INSDSeq_length>19< / INSDSeq_length>

[0059] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0060] <INSDSeq_division>PAT< / INSDSeq_division>

[0061] <INSDSeq_feature-table>

[0062] <insdfeature>

[0063] <INSDFeature_key>source< / INSDFeature_key>

[0064] <INSDFeature_location>1..19< / INSDFeature_location>

[0065] <INSDFeature_quals>

[0066] <insdqualifier>

[0067] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0068] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0069] < / insdqualifier>

[0070] <insdqualifier id="q2">

[0071] <INSDQualifier_name>organism< / INSDQualifier_name>

[0072] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0073] < / insdqualifier>

[0074] < / INSDFeature_quals>

[0075] < / insdfeature>

[0076] < / INSDSeq_feature-table>

[0077] <INSDSeq_sequence>cccttctccctcccttagt< / INSDSeq_sequence>

[0078] < / insdseq>

[0079] < / sequencedata>

[0080] <sequencedata sequenceidnumber="2">

[0081] <insdseq>

[0082] <INSDSeq_length>21< / INSDSeq_length>

[0083] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0084] <INSDSeq_division>PAT< / INSDSeq_division>

[0085] <INSDSeq_feature-table>

[0086] <insdfeature>

[0087] <INSDFeature_key>source< / INSDFeature_key>

[0088] <INSDFeature_location>1..21< / INSDFeature_location>

[0089] <INSDFeature_quals>

[0090] <insdqualifier>

[0091] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0092] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0093] < / insdqualifier>

[0094] <insdqualifier id="q4">

[0095] <INSDQualifier_name>organism< / INSDQualifier_name>

[0096] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0097] < / insdqualifier>

[0098] < / INSDFeature_quals>

[0099] < / insdfeature>

[0100] < / INSDSeq_feature-table>

[0101] <INSDSeq_sequence>aagtgaaaactacgctgctgt< / INSDSeq_sequence>

[0102] < / insdseq>

[0103] < / sequencedata>

[0104] <sequencedata sequenceidnumber="3">

[0105] <insdseq>

[0106] <INSDSeq_length> 19< / INSDSeq_length>

[0107] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0108] <INSDSeq_division> PAT< / INSDSeq_division>

[0109] <INSDSeq_feature-table>

[0110] <insdfeature>

[0111] <INSDFeature_key>source< / INSDFeature_key>

[0112] <INSDFeature_location>1..19< / INSDFeature_location>

[0113] <INSDFeature_quals>

[0114] <insdqualifier>

[0115] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0116] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0117] < / insdqualifier>

[0118] <insdqualifier id="q6">

[0119] <INSDQualifier_name>organism< / INSDQualifier_name>

[0120] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0121] < / insdqualifier>

[0122] < / INSDFeature_quals>

[0123] < / insdfeature>

[0124] < / INSDSeq_feature-table>

[0125] <INSDSeq_sequence> gagggcagaatgaagaggt< / INSDSeq_sequence>

[0126] < / insdseq>

[0127] < / sequencedata>

[0128] <sequencedata sequenceidnumber="4">

[0129] <insdseq>

[0130] <INSDSeq_length> 19< / INSDSeq_length>

[0131] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0132] <INSDSeq_division> PAT< / INSDSeq_division>

[0133] <INSDSeq_feature-table>

[0134] <insdfeature>

[0135] <INSDFeature_key>source< / INSDFeature_key>

[0136] <INSDFeature_location>1..19< / INSDFeature_location>

[0137] <INSDFeature_quals>

[0138] <insdqualifier>

[0139] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0140] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0141] < / insdqualifier>

[0142] <insdqualifier id="q8">

[0143] <INSDQualifier_name>organism< / INSDQualifier_name>

[0144] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0145] < / insdqualifier>

[0146] < / INSDFeature_quals>

[0147] < / insdfeature>

[0148] < / INSDSeq_feature-table>

[0149] <INSDSeq_sequence> tctgctgcaggcattctac< / INSDSeq_sequence>

[0150] < / insdseq>

[0151] < / sequencedata>

[0152] <sequencedata sequenceidnumber="5">

[0153] <insdseq>

[0154] <INSDSeq_length> 22< / INSDSeq_length>

[0155] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0156] <INSDSeq_division> PAT< / INSDSeq_division>

[0157] <INSDSeq_feature-table>

[0158] <insdfeature>

[0159] <INSDFeature_key>source< / INSDFeature_key>

[0160] <INSDFeature_location>1..22< / INSDFeature_location>

[0161] <INSDFeature_quals>

[0162] <insdqualifier>

[0163] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0164] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0165] < / insdqualifier>

[0166] <insdqualifier id="q10">

[0167] <INSDQualifier_name>organism< / INSDQualifier_name>

[0168] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0169] < / insdqualifier>

[0170] < / INSDFeature_quals>

[0171] < / insdfeature>

[0172] < / INSDSeq_feature-table>

[0173] <INSDSeq_sequence> cactggagagaagccttatgag< / INSDSeq_sequence>

[0174] < / insdseq>

[0175] < / sequencedata>

[0176] <sequencedata sequenceidnumber="6">

[0177] <insdseq>

[0178] <INSDSeq_length> 22< / INSDSeq_length>

[0179] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0180] <INSDSeq_division> PAT< / INSDSeq_division>

[0181] <INSDSeq_feature-table>

[0182] <insdfeature>

[0183] <INSDFeature_key>source< / INSDFeature_key>

[0184] <INSDFeature_location>1..22< / INSDFeature_location>

[0185] <INSDFeature_quals>

[0186] <insdqualifier>

[0187] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0188] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0189] < / insdqualifier>

[0190] <insdqualifier id="q12">

[0191] <INSDQualifier_name>organism< / INSDQualifier_name>

[0192] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0193] < / insdqualifier>

[0194] < / INSDFeature_quals>

[0195] < / insdfeature>

[0196] < / INSDSeq_feature-table>

[0197] <INSDSeq_sequence> attgaaagctaatctctgggtg< / INSDSeq_sequence>

[0198] < / insdseq>

[0199] < / sequencedata>

[0200] <sequencedata sequenceidnumber="7">

[0201] <insdseq>

[0202] <INSDSeq_length> 20< / INSDSeq_length>

[0203] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0204] <INSDSeq_division> PAT< / INSDSeq_division>

[0205] <INSDSeq_feature-table>

[0206] <insdfeature>

[0207] <INSDFeature_key>source< / INSDFeature_key>

[0208] <INSDFeature_location>1..20< / INSDFeature_location>

[0209] <INSDFeature_quals>

[0210] <insdqualifier>

[0211] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0212] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0213] < / insdqualifier>

[0214] <insdqualifier id="q14">

[0215] <INSDQualifier_name>organism< / INSDQualifier_name>

[0216] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0217] < / insdqualifier>

[0218] < / INSDFeature_quals>

[0219] < / insdfeature>

[0220] < / INSDSeq_feature-table>

[0221] <INSDSeq_sequence> acaaaaacaggaacgaccct< / INSDSeq_sequence>

[0222] < / insdseq>

[0223] < / sequencedata>

[0224] <sequencedata sequenceidnumber="8">

[0225] <insdseq>

[0226] <INSDSeq_length> 20< / INSDSeq_length>

[0227] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0228] <INSDSeq_division> PAT< / INSDSeq_division>

[0229] <INSDSeq_feature-table>

[0230] <insdfeature>

[0231] <INSDFeature_key>source< / INSDFeature_key>

[0232] <INSDFeature_location>1..20< / INSDFeature_location>

[0233] <INSDFeature_quals>

[0234] <insdqualifier>

[0235] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0236] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0237] < / insdqualifier>

[0238] <insdqualifier id="q16">

[0239] <INSDQualifier_name>organism< / INSDQualifier_name>

[0240] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0241] < / insdqualifier>

[0242] < / INSDFeature_quals>

[0243] < / insdfeature>

[0244] < / INSDSeq_feature-table>

[0245] <INSDSeq_sequence> ggtgatgtcctgattgaagc< / INSDSeq_sequence>

[0246] < / insdseq>

[0247] < / sequencedata>

[0248] <sequencedata sequenceidnumber="9">

[0249] <insdseq>

[0250] <INSDSeq_length> 21< / INSDSeq_length>

[0251] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0252] <INSDSeq_division> PAT< / INSDSeq_division>

[0253] <INSDSeq_feature-table>

[0254] <insdfeature>

[0255] <INSDFeature_key>source< / INSDFeature_key>

[0256] <INSDFeature_location>1..21< / INSDFeature_location>

[0257] <INSDFeature_quals>

[0258] <insdqualifier>

[0259] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0260] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0261] < / insdqualifier>

[0262] <insdqualifier id="q18">

[0263] <INSDQualifier_name>organism< / INSDQualifier_name>

[0264] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0265] < / insdqualifier>

[0266] < / INSDFeature_quals>

[0267] < / insdfeature>

[0268] < / INSDSeq_feature-table>

[0269] <INSDSeq_sequence> ttgcttttggcttaggtagct< / INSDSeq_sequence>

[0270] < / insdseq>

[0271] < / sequencedata>

[0272] <sequencedata sequenceidnumber="10">

[0273] <insdseq>

[0274] <INSDSeq_length>20< / INSDSeq_length>

[0275] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0276] <INSDSeq_division>PAT< / INSDSeq_division>

[0277] <INSDSeq_feature-table>

[0278] <insdfeature>

[0279] <INSDFeature_key>source< / INSDFeature_key>

[0280] <INSDFeature_location>1..20< / INSDFeature_location>

[0281] <INSDFeature_quals>

[0282] <insdqualifier>

[0283] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0284] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0285] < / insdqualifier>

[0286] <insdqualifier id="q20">

[0287] <INSDQualifier_name>organism< / INSDQualifier_name>

[0288] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0289] < / insdqualifier>

[0290] < / INSDFeature_quals>

[0291] < / insdfeature>

[0292] < / INSDSeq_feature-table>

[0293] <INSDSeq_sequence>cgactgatgactgtgacctg< / INSDSeq_sequence>

[0294] < / insdseq>

[0295] < / sequencedata>

[0296] <sequencedata sequenceidnumber="11">

[0297] <insdseq>

[0298] <INSDSeq_length> 21< / INSDSeq_length>

[0299] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0300] <INSDSeq_division> PAT< / INSDSeq_division>

[0301] <INSDSeq_feature-table>

[0302] <insdfeature>

[0303] <INSDFeature_key>source< / INSDFeature_key>

[0304] <INSDFeature_location>1..21< / INSDFeature_location>

[0305] <INSDFeature_quals>

[0306] <insdqualifier>

[0307] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0308] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0309] < / insdqualifier>

[0310] <insdqualifier id="q22">

[0311] <INSDQualifier_name>organism< / INSDQualifier_name>

[0312] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0313] < / insdqualifier>

[0314] < / INSDFeature_quals>

[0315] < / insdfeature>

[0316] < / INSDSeq_feature-table>

[0317] <INSDSeq_sequence> aacagccaccttcctagtacc< / INSDSeq_sequence>

[0318] < / insdseq>

[0319] < / sequencedata>

[0320] <sequencedata sequenceidnumber="12">

[0321] <insdseq>

[0322] <INSDSeq_length> 20< / INSDSeq_length>

[0323] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0324] <INSDSeq_division> PAT< / INSDSeq_division>

[0325] <INSDSeq_feature-table>

[0326] <insdfeature>

[0327] <INSDFeature_key>source< / INSDFeature_key>

[0328] <INSDFeature_location>1..20< / INSDFeature_location>

[0329] <INSDFeature_quals>

[0330] <insdqualifier>

[0331] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0332] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0333] < / insdqualifier>

[0334] <insdqualifier id="q24">

[0335] <INSDQualifier_name>organism< / INSDQualifier_name>

[0336] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0337] < / insdqualifier>

[0338] < / INSDFeature_quals>

[0339] < / insdfeature>

[0340] < / INSDSeq_feature-table>

[0341] <INSDSeq_sequence> caaggcctttcactctgtct< / INSDSeq_sequence>

[0342] < / insdseq>

[0343] < / sequencedata>

[0344] <sequencedata sequenceidnumber="13">

[0345] <insdseq>

[0346] <INSDSeq_length> 21< / INSDSeq_length>

[0347] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0348] <INSDSeq_division> PAT< / INSDSeq_division>

[0349] <INSDSeq_feature-table>

[0350] <insdfeature>

[0351] <INSDFeature_key>source< / INSDFeature_key>

[0352] <INSDFeature_location>1..21< / INSDFeature_location>

[0353] <INSDFeature_quals>

[0354] <insdqualifier>

[0355] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0356] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0357] < / insdqualifier>

[0358] <insdqualifier id="q26">

[0359] <INSDQualifier_name>organism< / INSDQualifier_name>

[0360] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0361] < / insdqualifier>

[0362] < / INSDFeature_quals>

[0363] < / insdfeature>

[0364] < / INSDSeq_feature-table>

[0365] <INSDSeq_sequence> attacttacaacagggcttgc< / INSDSeq_sequence>

[0366] < / insdseq>

[0367] < / sequencedata>

[0368] <sequencedata sequenceidnumber="14">

[0369] <insdseq>

[0370] <INSDSeq_length> 20< / INSDSeq_length>

[0371] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0372] <INSDSeq_division> PAT< / INSDSeq_division>

[0373] <INSDSeq_feature-table>

[0374] <insdfeature>

[0375] <INSDFeature_key>source< / INSDFeature_key>

[0376] <INSDFeature_location>1..20< / INSDFeature_location>

[0377] <INSDFeature_quals>

[0378] <insdqualifier>

[0379] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0380] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0381] < / insdqualifier>

[0382] <insdqualifier id="q28">

[0383] <INSDQualifier_name>organism< / INSDQualifier_name>

[0384] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0385] < / insdqualifier>

[0386] < / INSDFeature_quals>

[0387] < / insdfeature>

[0388] < / INSDSeq_feature-table>

[0389] <INSDSeq_sequence> aacctccactccaagttgtt< / INSDSeq_sequence>

[0390] < / insdseq>

[0391] < / sequencedata>

[0392] <sequencedata sequenceidnumber="15">

[0393] <insdseq>

[0394] <INSDSeq_length> 18< / INSDSeq_length>

[0395] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0396] <INSDSeq_division> PAT< / INSDSeq_division>

[0397] <INSDSeq_feature-table>

[0398] <insdfeature>

[0399] <INSDFeature_key>source< / INSDFeature_key>

[0400] <INSDFeature_location>1..18< / INSDFeature_location>

[0401] <INSDFeature_quals>

[0402] <insdqualifier>

[0403] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0404] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0405] < / insdqualifier>

[0406] <insdqualifier id="q30">

[0407] <INSDQualifier_name>organism< / INSDQualifier_name>

[0408] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0409] < / insdqualifier>

[0410] < / INSDFeature_quals>

[0411] < / insdfeature>

[0412] < / INSDSeq_feature-table>

[0413] <INSDSeq_sequence> ttgagccataggagagg< / INSDSeq_sequence>

[0414] < / insdseq>

[0415] < / sequencedata>

[0416] <sequencedata sequenceidnumber="16">

[0417] <insdseq>

[0418] <INSDSeq_length> 19< / INSDSeq_length>

[0419] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0420] <INSDSeq_division> PAT< / INSDSeq_division>

[0421] <INSDSeq_feature-table>

[0422] <insdfeature>

[0423] <INSDFeature_key>source< / INSDFeature_key>

[0424] <INSDFeature_location>1..19< / INSDFeature_location>

[0425] <INSDFeature_quals>

[0426] <insdqualifier>

[0427] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0428] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0429] < / insdqualifier>

[0430] <insdqualifier id="q32">

[0431] <INSDQualifier_name>organism< / INSDQualifier_name>

[0432] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0433] < / insdqualifier>

[0434] < / INSDFeature_quals>

[0435] < / insdfeature>

[0436] < / INSDSeq_feature-table>

[0437] <INSDSeq_sequence> gcatgtgtgtgtgcaaaag< / INSDSeq_sequence>

[0438] < / insdseq>

[0439] < / sequencedata>

[0440] <sequencedata sequenceidnumber="17">

[0441] <insdseq>

[0442] <INSDSeq_length> 20< / INSDSeq_length>

[0443] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0444] <INSDSeq_division> PAT< / INSDSeq_division>

[0445] <INSDSeq_feature-table>

[0446] <insdfeature>

[0447] <INSDFeature_key>source< / INSDFeature_key>

[0448] <INSDFeature_location>1..20< / INSDFeature_location>

[0449] <INSDFeature_quals>

[0450] <insdqualifier>

[0451] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0452] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0453] < / insdqualifier>

[0454] <insdqualifier id="q34">

[0455] <INSDQualifier_name>organism< / INSDQualifier_name>

[0456] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0457] < / insdqualifier>

[0458] < / INSDFeature_quals>

[0459] < / insdfeature>

[0460] < / INSDSeq_feature-table>

[0461] <INSDSeq_sequence> acagacaccaagatccaagg< / INSDSeq_sequence>

[0462] < / insdseq>

[0463] < / sequencedata>

[0464] <sequencedata sequenceidnumber="18">

[0465] <insdseq>

[0466] <INSDSeq_length> 18< / INSDSeq_length>

[0467] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0468] <INSDSeq_division> PAT< / INSDSeq_division>

[0469] <INSDSeq_feature-table>

[0470] <insdfeature>

[0471] <INSDFeature_key>source< / INSDFeature_key>

[0472] <INSDFeature_location>1..18< / INSDFeature_location>

[0473] <INSDFeature_quals>

[0474] <insdqualifier>

[0475] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0476] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0477] < / insdqualifier>

[0478] <insdqualifier id="q36">

[0479] <INSDQualifier_name>organism< / INSDQualifier_name>

[0480] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0481] < / insdqualifier>

[0482] < / INSDFeature_quals>

[0483] < / insdfeature>

[0484] < / INSDSeq_feature-table>

[0485] <INSDSeq_sequence> tggatgcccataaaggtg< / INSDSeq_sequence>

[0486] < / insdseq>

[0487] < / sequencedata>

[0488] <sequencedata sequenceidnumber="19">

[0489] <insdseq>

[0490] <INSDSeq_length> 19< / INSDSeq_length>

[0491] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0492] <INSDSeq_division> PAT< / INSDSeq_division>

[0493] <INSDSeq_feature-table>

[0494] <insdfeature>

[0495] <INSDFeature_key>source< / INSDFeature_key>

[0496] <INSDFeature_location>1..19< / INSDFeature_location>

[0497] <INSDFeature_quals>

[0498] <insdqualifier>

[0499] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0500] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0501] < / insdqualifier>

[0502] <insdqualifier id="q38">

[0503] <INSDQualifier_name>organism< / INSDQualifier_name>

[0504] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0505] < / insdqualifier>

[0506] < / INSDFeature_quals>

[0507] < / insdfeature>

[0508] < / INSDSeq_feature-table>

[0509] <INSDSeq_sequence> gcatgggttcctagggata< / INSDSeq_sequence>

[0510] < / insdseq>

[0511] < / sequencedata>

[0512] <sequencedata sequenceidnumber="20">

[0513] <insdseq>

[0514] <INSDSeq_length>20< / INSDSeq_length>

[0515] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0516] <INSDSeq_division>PAT< / INSDSeq_division>

[0517] <INSDSeq_feature-table>

[0518] <insdfeature>

[0519] <INSDFeature_key>source< / INSDFeature_key>

[0520] <INSDFeature_location>1..20< / INSDFeature_location>

[0521] <INSDFeature_quals>

[0522] <insdqualifier>

[0523] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0524] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0525] < / insdqualifier>

[0526] <insdqualifier id="q40">

[0527] <INSDQualifier_name>organism< / INSDQualifier_name>

[0528] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0529] < / insdqualifier>

[0530] < / INSDFeature_quals>

[0531] < / insdfeature>

[0532] < / INSDSeq_feature-table>

[0533] <INSDSeq_sequence>gaactcaccatctgggacat< / INSDSeq_sequence>

[0534] < / insdseq>

[0535] < / sequencedata>

[0536] <sequencedata sequenceidnumber="21">

[0537] <insdseq>

[0538] <INSDSeq_length> 23< / INSDSeq_length>

[0539] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0540] <INSDSeq_division> PAT< / INSDSeq_division>

[0541] <INSDSeq_feature-table>

[0542] <insdfeature>

[0543] <INSDFeature_key>source< / INSDFeature_key>

[0544] <INSDFeature_location>1..23< / INSDFeature_location>

[0545] <INSDFeature_quals>

[0546] <insdqualifier>

[0547] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0548] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0549] < / insdqualifier>

[0550] <insdqualifier id="q42">

[0551] <INSDQualifier_name>organism< / INSDQualifier_name>

[0552] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0553] < / insdqualifier>

[0554] < / INSDFeature_quals>

[0555] < / insdfeature>

[0556] < / INSDSeq_feature-table>

[0557] <INSDSeq_sequence> tatcctgcaggtaaggtctctag< / INSDSeq_sequence>

[0558] < / insdseq>

[0559] < / sequencedata>

[0560] <sequencedata sequenceidnumber="22">

[0561] <insdseq>

[0562] <INSDSeq_length> 19< / INSDSeq_length>

[0563] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0564] <INSDSeq_division> PAT< / INSDSeq_division>

[0565] <INSDSeq_feature-table>

[0566] <insdfeature>

[0567] <INSDFeature_key>source< / INSDFeature_key>

[0568] <INSDFeature_location>1..19< / INSDFeature_location>

[0569] <INSDFeature_quals>

[0570] <insdqualifier>

[0571] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0572] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0573] < / insdqualifier>

[0574] <insdqualifier id="q44">

[0575] <INSDQualifier_name>organism< / INSDQualifier_name>

[0576] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0577] < / insdqualifier>

[0578] < / INSDFeature_quals>

[0579] < / insdfeature>

[0580] < / INSDSeq_feature-table>

[0581] <INSDSeq_sequence> acccccaacagatcaaatc< / INSDSeq_sequence>

[0582] < / insdseq>

[0583] < / sequencedata>

[0584] <sequencedata sequenceidnumber="23">

[0585] <insdseq>

[0586] <INSDSeq_length> 18< / INSDSeq_length>

[0587] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0588] <INSDSeq_division> PAT< / INSDSeq_division>

[0589] <INSDSeq_feature-table>

[0590] <insdfeature>

[0591] <INSDFeature_key>source< / INSDFeature_key>

[0592] <INSDFeature_location>1..18< / INSDFeature_location>

[0593] <INSDFeature_quals>

[0594] <insdqualifier>

[0595] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0596] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0597] < / insdqualifier>

[0598] <insdqualifier id="q46">

[0599] <INSDQualifier_name>organism< / INSDQualifier_name>

[0600] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0601] < / insdqualifier>

[0602] < / INSDFeature_quals>

[0603] < / insdfeature>

[0604] < / INSDSeq_feature-table>

[0605] <INSDSeq_sequence> cttacctgctccagggc< / INSDSeq_sequence>

[0606] < / insdseq>

[0607] < / sequencedata>

[0608] <sequencedata sequenceidnumber="24">

[0609] <insdseq>

[0610] <INSDSeq_length> 20< / INSDSeq_length>

[0611] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0612] <INSDSeq_division> PAT< / INSDSeq_division>

[0613] <INSDSeq_feature-table>

[0614] <insdfeature>

[0615] <INSDFeature_key>source< / INSDFeature_key>

[0616] <INSDFeature_location>1..20< / INSDFeature_location>

[0617] <INSDFeature_quals>

[0618] <insdqualifier>

[0619] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0620] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0621] < / insdqualifier>

[0622] <insdqualifier id="q48">

[0623] <INSDQualifier_name>organism< / INSDQualifier_name>

[0624] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0625] < / insdqualifier>

[0626] < / INSDFeature_quals>

[0627] < / insdfeature>

[0628] < / INSDSeq_feature-table>

[0629] <INSDSeq_sequence> atattgtactgcgtgggctc< / INSDSeq_sequence>

[0630] < / insdseq>

[0631] < / sequencedata>

[0632] <sequencedata sequenceidnumber="25">

[0633] <insdseq>

[0634] <INSDSeq_length>19< / INSDSeq_length>

[0635] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0636] <INSDSeq_division>PAT< / INSDSeq_division>

[0637] <INSDSeq_feature-table>

[0638] <insdfeature>

[0639] <INSDFeature_key>source< / INSDFeature_key>

[0640] <INSDFeature_location>1..19< / INSDFeature_location>

[0641] <INSDFeature_quals>

[0642] <insdqualifier>

[0643] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0644] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0645] < / insdqualifier>

[0646] <insdqualifier id="q50">

[0647] <INSDQualifier_name>organism< / INSDQualifier_name>

[0648] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0649] < / insdqualifier>

[0650] < / INSDFeature_quals>

[0651] < / insdfeature>

[0652] < / INSDSeq_feature-table>

[0653] <INSDSeq_sequence>tccacttgttcctgtgcat< / INSDSeq_sequence>

[0654] < / insdseq>

[0655] < / sequencedata>

[0656] <sequencedata sequenceidnumber="26">

[0657] <insdseq>

[0658] <INSDSeq_length> 18< / INSDSeq_length>

[0659] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0660] <INSDSeq_division> PAT< / INSDSeq_division>

[0661] <INSDSeq_feature-table>

[0662] <insdfeature>

[0663] <INSDFeature_key>source< / INSDFeature_key>

[0664] <INSDFeature_location>1..18< / INSDFeature_location>

[0665] <INSDFeature_quals>

[0666] <insdqualifier>

[0667] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0668] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0669] < / insdqualifier>

[0670] <insdqualifier id="q52">

[0671] <INSDQualifier_name>organism< / INSDQualifier_name>

[0672] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0673] < / insdqualifier>

[0674] < / INSDFeature_quals>

[0675] < / insdfeature>

[0676] < / INSDSeq_feature-table>

[0677] <INSDSeq_sequence> cggcacgtagacagag< / INSDSeq_sequence>

[0678] < / insdseq>

[0679] < / sequencedata>

[0680] <sequencedata sequenceidnumber="27">

[0681] <insdseq>

[0682] <INSDSeq_length> 20< / INSDSeq_length>

[0683] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0684] <INSDSeq_division> PAT< / INSDSeq_division>

[0685] <INSDSeq_feature-table>

[0686] <insdfeature>

[0687] <INSDFeature_key>source< / INSDFeature_key>

[0688] <INSDFeature_location>1..20< / INSDFeature_location>

[0689] <INSDFeature_quals>

[0690] <insdqualifier>

[0691] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0692] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0693] < / insdqualifier>

[0694] <insdqualifier id="q54">

[0695] <INSDQualifier_name>organism< / INSDQualifier_name>

[0696] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0697] < / insdqualifier>

[0698] < / INSDFeature_quals>

[0699] < / insdfeature>

[0700] < / INSDSeq_feature-table>

[0701] <INSDSeq_sequence> caggtgtcttagggtctcca< / INSDSeq_sequence>

[0702] < / insdseq>

[0703] < / sequencedata>

[0704] <sequencedata sequenceidnumber="28">

[0705] <insdseq>

[0706] <INSDSeq_length> 18< / INSDSeq_length>

[0707] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0708] <INSDSeq_division> PAT< / INSDSeq_division>

[0709] <INSDSeq_feature-table>

[0710] <insdfeature>

[0711] <INSDFeature_key>source< / INSDFeature_key>

[0712] <INSDFeature_location>1..18< / INSDFeature_location>

[0713] <INSDFeature_quals>

[0714] <insdqualifier>

[0715] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0716] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0717] < / insdqualifier>

[0718] <insdqualifier id="q56">

[0719] <INSDQualifier_name>organism< / INSDQualifier_name>

[0720] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0721] < / insdqualifier>

[0722] < / INSDFeature_quals>

[0723] < / insdfeature>

[0724] < / INSDSeq_feature-table>

[0725] <INSDSeq_sequence> taaaggatttgggaggcc< / INSDSeq_sequence>

[0726] < / insdseq>

[0727] < / sequencedata>

[0728] <sequencedata sequenceidnumber="29">

[0729] <insdseq>

[0730] <INSDSeq_length> 21< / INSDSeq_length>

[0731] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0732] <INSDSeq_division> PAT< / INSDSeq_division>

[0733] <INSDSeq_feature-table>

[0734] <insdfeature>

[0735] <INSDFeature_key>source< / INSDFeature_key>

[0736] <INSDFeature_location>1..21< / INSDFeature_location>

[0737] <INSDFeature_quals>

[0738] <insdqualifier>

[0739] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0740] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0741] < / insdqualifier>

[0742] <insdqualifier id="q58">

[0743] <INSDQualifier_name>organism< / INSDQualifier_name>

[0744] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0745] < / insdqualifier>

[0746] < / INSDFeature_quals>

[0747] < / insdfeature>

[0748] < / INSDSeq_feature-table>

[0749] <INSDSeq_sequence> gctagggcggtatgagatact< / INSDSeq_sequence>

[0750] < / insdseq>

[0751] < / sequencedata>

[0752] <sequencedata sequenceidnumber="30">

[0753] <insdseq>

[0754] <INSDSeq_length> 19< / INSDSeq_length>

[0755] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0756] <INSDSeq_division> PAT< / INSDSeq_division>

[0757] <INSDSeq_feature-table>

[0758] <insdfeature>

[0759] <INSDFeature_key>source< / INSDFeature_key>

[0760] <INSDFeature_location>1..19< / INSDFeature_location>

[0761] <INSDFeature_quals>

[0762] <insdqualifier>

[0763] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0764] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0765] < / insdqualifier>

[0766] <insdqualifier id="q60">

[0767] <INSDQualifier_name>organism< / INSDQualifier_name>

[0768] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0769] < / insdqualifier>

[0770] < / INSDFeature_quals>

[0771] < / insdfeature>

[0772] < / INSDSeq_feature-table>

[0773] <INSDSeq_sequence> gcaaaataggactccgagg< / INSDSeq_sequence>

[0774] < / insdseq>

[0775] < / sequencedata>

[0776] <sequencedata sequenceidnumber="31">

[0777] <insdseq>

[0778] <INSDSeq_length> 19< / INSDSeq_length>

[0779] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0780] <INSDSeq_division> PAT< / INSDSeq_division>

[0781] <INSDSeq_feature-table>

[0782] <insdfeature>

[0783] <INSDFeature_key>source< / INSDFeature_key>

[0784] <INSDFeature_location>1..19< / INSDFeature_location>

[0785] <INSDFeature_quals>

[0786] <insdqualifier>

[0787] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0788] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0789] < / insdqualifier>

[0790] <insdqualifier id="q62">

[0791] <INSDQualifier_name>organism< / INSDQualifier_name>

[0792] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0793] < / insdqualifier>

[0794] < / INSDFeature_quals>

[0795] < / insdfeature>

[0796] < / INSDSeq_feature-table>

[0797] <INSDSeq_sequence> tgccctcatagaggacaca< / INSDSeq_sequence>

[0798] < / insdseq>

[0799] < / sequencedata>

[0800] <sequencedata sequenceidnumber="32">

[0801] <insdseq>

[0802] <INSDSeq_length> 18< / INSDSeq_length>

[0803] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0804] <INSDSeq_division> PAT< / INSDSeq_division>

[0805] <INSDSeq_feature-table>

[0806] <insdfeature>

[0807] <INSDFeature_key>source< / INSDFeature_key>

[0808] <INSDFeature_location>1..18< / INSDFeature_location>

[0809] <INSDFeature_quals>

[0810] <insdqualifier>

[0811] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0812] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0813] < / insdqualifier>

[0814] <insdqualifier id="q64">

[0815] <INSDQualifier_name>organism< / INSDQualifier_name>

[0816] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0817] < / insdqualifier>

[0818] < / INSDFeature_quals>

[0819] < / insdfeature>

[0820] < / INSDSeq_feature-table>

[0821] <INSDSeq_sequence> gaaaaaaaaaaaaahccccg< / INSDSeq_sequence>

[0822] < / insdseq>

[0823] < / sequencedata>

[0824] <sequencedata sequenceidnumber="33">

[0825] <insdseq>

[0826] <INSDSeq_length>19< / INSDSeq_length>

[0827] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0828] <INSDSeq_division>PAT< / INSDSeq_division>

[0829] <INSDSeq_feature-table>

[0830] <insdfeature>

[0831] <INSDFeature_key>source< / INSDFeature_key>

[0832] <INSDFeature_location>1..19< / INSDFeature_location>

[0833] <INSDFeature_quals>

[0834] <insdqualifier>

[0835] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0836] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0837] < / insdqualifier>

[0838] <insdqualifier id="q66">

[0839] <INSDQualifier_name>organism< / INSDQualifier_name>

[0840] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0841] < / insdqualifier>

[0842] < / INSDFeature_quals>

[0843] < / insdfeature>

[0844] < / INSDSeq_feature-table>

[0845] <INSDSeq_sequence>gatgagcaacctgacgaag< / INSDSeq_sequence>

[0846] < / insdseq>

[0847] < / sequencedata>

[0848] <sequencedata sequenceidnumber="34">

[0849] <insdseq>

[0850] <INSDSeq_length> 19< / INSDSeq_length>

[0851] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0852] <INSDSeq_division> PAT< / INSDSeq_division>

[0853] <INSDSeq_feature-table>

[0854] <insdfeature>

[0855] <INSDFeature_key>source< / INSDFeature_key>

[0856] <INSDFeature_location>1..19< / INSDFeature_location>

[0857] <INSDFeature_quals>

[0858] <insdqualifier>

[0859] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0860] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0861] < / insdqualifier>

[0862] <insdqualifier id="q68">

[0863] <INSDQualifier_name>organism< / INSDQualifier_name>

[0864] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0865] < / insdqualifier>

[0866] < / INSDFeature_quals>

[0867] < / insdfeature>

[0868] < / INSDSeq_feature-table>

[0869] <INSDSeq_sequence> gttgcatggctttcattc< / INSDSeq_sequence>

[0870] < / insdseq>

[0871] < / sequencedata>

[0872] <sequencedata sequenceidnumber="35">

[0873] <insdseq>

[0874] <INSDSeq_length> 21< / INSDSeq_length>

[0875] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0876] <INSDSeq_division> PAT< / INSDSeq_division>

[0877] <INSDSeq_feature-table>

[0878] <insdfeature>

[0879] <INSDFeature_key>source< / INSDFeature_key>

[0880] <INSDFeature_location>1..21< / INSDFeature_location>

[0881] <INSDFeature_quals>

[0882] <insdqualifier>

[0883] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0884] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0885] < / insdqualifier>

[0886] <insdqualifier id="q70">

[0887] <INSDQualifier_name>organism< / INSDQualifier_name>

[0888] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0889] < / insdqualifier>

[0890] < / INSDFeature_quals>

[0891] < / insdfeature>

[0892] < / INSDSeq_feature-table>

[0893] <INSDSeq_sequence> gtgtataccccctccacaga< / INSDSeq_sequence>

[0894] < / insdseq>

[0895] < / sequencedata>

[0896] <sequencedata sequenceidnumber="36">

[0897] <insdseq>

[0898] <INSDSeq_length> 17< / INSDSeq_length>

[0899] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0900] <INSDSeq_division> PAT< / INSDSeq_division>

[0901] <INSDSeq_feature-table>

[0902] <insdfeature>

[0903] <INSDFeature_key>source< / INSDFeature_key>

[0904] <INSDFeature_location>1..17< / INSDFeature_location>

[0905] <INSDFeature_quals>

[0906] <insdqualifier>

[0907] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0908] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0909] < / insdqualifier>

[0910] <insdqualifier id="q72">

[0911] <INSDQualifier_name>organism< / INSDQualifier_name>

[0912] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0913] < / insdqualifier>

[0914] < / INSDFeature_quals>

[0915] < / insdfeature>

[0916] < / INSDSeq_feature-table>

[0917] <INSDSeq_sequence> gacccccaatcctccat< / INSDSeq_sequence>

[0918] < / insdseq>

[0919] < / sequencedata>

[0920] <sequencedata sequenceidnumber="37">

[0921] <insdseq>

[0922] <INSDSeq_length>17< / INSDSeq_length>

[0923] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0924] <INSDSeq_division>PAT< / INSDSeq_division>

[0925] <INSDSeq_feature-table>

[0926] <insdfeature>

[0927] <INSDFeature_key>source< / INSDFeature_key>

[0928] <INSDFeature_location>1..17< / INSDFeature_location>

[0929] <INSDFeature_quals>

[0930] <insdqualifier>

[0931] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0932] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0933] < / insdqualifier>

[0934] <insdqualifier id="q74">

[0935] <INSDQualifier_name>organism< / INSDQualifier_name>

[0936] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0937] < / insdqualifier>

[0938] < / INSDFeature_quals>

[0939] < / insdfeature>

[0940] < / INSDSeq_feature-table>

[0941] <INSDSeq_sequence>tgccccctgtacctttg< / INSDSeq_sequence>

[0942] < / insdseq>

[0943] < / sequencedata>

[0944] <sequencedata sequenceidnumber="38">

[0945] <insdseq>

[0946] <INSDSeq_length> 17< / INSDSeq_length>

[0947] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0948] <INSDSeq_division> PAT< / INSDSeq_division>

[0949] <INSDSeq_feature-table>

[0950] <insdfeature>

[0951] <INSDFeature_key>source< / INSDFeature_key>

[0952] <INSDFeature_location>1..17< / INSDFeature_location>

[0953] <INSDFeature_quals>

[0954] <insdqualifier>

[0955] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0956] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0957] < / insdqualifier>

[0958] <insdqualifier id="q76">

[0959] <INSDQualifier_name>organism< / INSDQualifier_name>

[0960] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0961] < / insdqualifier>

[0962] < / INSDFeature_quals>

[0963] < / insdfeature>

[0964] < / INSDSeq_feature-table>

[0965] <INSDSeq_sequence> gacccccaatcctccat< / INSDSeq_sequence>

[0966] < / insdseq>

[0967] < / sequencedata>

[0968]

[0969] <---

Images