Method for preimplantation genetic testing for paroxysmal myoplegia

Abstract

FIELD: biotechnology.SUBSTANCE: method for preimplantation genetic testing of paroxysmal myoplegia. The specified method includes a dual detection system - direct and indirect, where direct detection is carried out using primers for amplification of SEQ ID NO: 33–36, and indirect detection is carried out using primers for the analysis of inheritance of molecular genetic markers of the STR type, linked to a pathogenic variant, selected from SEQ ID NO: 1–32.EFFECT: test system for diagnosing the pathogenic variant NC_000017.10:g.62034787G>A (NM_000334.4:c.2111C>T, p.Thr704Met, rs80338957) in the SCN4A gene with a dual detection system – direct and indirect.1 cl, 1 tbl, 1 ex

Description

[0001] The invention relates to preimplantation genetic testing for monogenic diseases. Currently, more than 350 million people worldwide suffer from a rare disease (according to the RARE Project). The total number of such diseases, according to estimates by the European Organization for Rare Diseases (EURORDIS), ranges from 5,000 to 7,000. Approximately 80% of rare diseases have a genetic cause. Knowing the genetic basis of a disease allows for a highly accurate prediction not only of the health of an already born child but also to assess the risk of having such a child by analyzing the parents' genotypes, as well as to conduct genetic diagnosis at the earliest stages. Preimplantation genetic testing (PGT) for monogenic diseases is becoming a powerful tool for the prevention of such diseases.

[0002] The present invention relates to a method for preimplantation genetic testing for paroxysmal myoplegia. Paroxysmal myoplegia is a genetically heterogeneous hereditary disorder associated with dysfunction of ion channels in muscle cell membranes. Paroxysmal myoplegia occurs with a frequency of approximately 1 case per 100,000 population. This disorder results in attacks of generalized or localized muscle weakness and falls. Attacks are triggered by physical activity, high-carbohydrate foods, alcohol, and stress. With autosomal dominant inheritance, the probability of having a child with this disorder is 50%.

[0003] Paroxysmal myoplegia can be caused by pathogenic genetic variants in the SCN4A gene, located on chromosome 17. [Statland, J.M. et al. Review of the Diagnosis and Treatment of Periodic Paralysis. Muscle & Nerve, 2017; 57(4), 522-530] This gene encodes the α-subunit of the sodium channel, which is part of the sodium channel in the cell membrane of neurons and muscle cells. These channels are important for the generation and conduction of action potentials in excitable tissues.

[0004] PGT for paroxysmal myoplegia is performed for families with a confirmed molecular genetic cause of the disease. It is important to note that the pathogenicity and causativity of genetic variants is determined prior to PGT for a monogenic disease and is not included in the goals and objectives of PGT for a monogenic disease, nor in the comprehensive package of measures for PGT for a monogenic disease. Pathogenicity is assessed according to the international standard—the criteria described in 2015 by the American College of Medical Genetics and Genomics (Association for Molecular Pathology (ACMG-AMP)) during the search for the molecular genetic cause of the disease. PGT is recommended for families with a high risk of having a child with a severe (incurable) hereditary disease with an identified pathogenic variant that determines this risk.PGT allows you to select from all the embryos obtained during IVF (in vitro fertilization) embryos without a pathogenic variant and, therefore, without the risk of developing a disease.

[0005] The main challenge in embryo genetic diagnosis is the small initial amount of biomaterial, as each biopsy contains only one to three cells. In this case, to improve the efficiency and accuracy of the analysis, it is important to completely eliminate the possibility of contamination and mitigate the potential effects of uneven and / or incomplete amplification, as well as biomaterial degradation. This requires the development of a test system with specific characteristics. The test system is designed to accommodate various types of biomaterial—total deoxyribonucleic acid (DNA) isolated from various tissues, whole genome amplification (WGA) products, and single cells.The combination of versatility in biomaterial selection and step-by-step amplification of target fragments enables the analysis of multiple pathogenic variants in a single sample, including on single cells, and the detection of incomplete amplification, contamination, or sample degradation. Another feature of PGT is the lack of information about the embryo's biological characteristics: unlike an adult, an embryo may have any chromosomal abnormalities, which complicates the assessment of the embryo's status for a specific genetic variant. Therefore, a test system for PGT of a monogenic disease must be able to identify such cases and assess their impact on the reliability of the diagnostic result.

[0006] No description of a similar technical solution was found in publicly available sources.

[0007] The presented method of PGT for paroxysmal myoplegia solves the problem of developing a more accurate method of preimplantation genetic testing of this monogenic disease without the use of expensive devices and reagents, which could be used on various types of biomaterial: DNA isolated from different tissues, the product of whole genome amplification (WGA), single cells.

[0008] The technical result was the creation of a test system for the diagnosis of a pathogenic variant (the nucleotide number in the reference sequence of genomic DNA is designated by the prefix NC, the nucleotide number in the reference sequence of the coding transcript is designated by the prefix NM): NC_000017.10:g.62034787G>A (NM_000334.4:c.2111C>T, p.Thr704Met, rs80338957) in the SCN4A gene [Brancati F, et al. Severe infantile hyperkalaemic periodic paralysis and paramyotonia congenita: broadening the clinical spectrum associated with the T704M mutation in SCN4A. J Neurol Neurosurg Psychiatry. 2003 Sep; 74(9): 1339-41] with a dual detection system—direct and indirect. This system is necessary when working with small amounts of biomaterial, as unstable amplification can lead to loss of information or reduced analytical accuracy. Direct diagnostics involves directly analyzing the presence or absence of a pathogenic variant. In this case, for the genetic variant NC_000017.10:g.Restriction endonucleases were selected for the single nucleotide polymorphism (SNP) 62034787G>A (NM_000334.4:c.2111C>T, p.Thr704Met, rs80338957) mutation. These enzymes enable detection of the pathogenic variant using PCR-RFLP (restriction fragment length polymorphism), based on sequence differences at the restriction site between different alleles. Indirect diagnosis involves analyzing the inheritance of molecular genetic markers linked to the mutation, i.e., inherited along with it. For this purpose, polymorphic loci called STR (short tandem repeat) were selected at a distance of no more than 3 MB (which corresponds to 3% crossing over on average) from the SCN4A gene in each direction, with a heterozygosity of at least 0.70 to ensure maximum informativeness of indirect diagnostics.STRs are repeats of two or more nucleotides located consecutively (for example, the adenine-cytosine (AC) pair, repeated several times in a row: ACACACACA) and are present in large numbers in the human genome. The number of repeats in each of them can vary from individual to individual and can also differ in the same person on two homologous chromosomes. Heterozygosity greater than 0.70 indicates a high probability that in the same person, the number of nucleotide repeats in a given STR on one chromosome will differ from the number of repeats in the same STR on the homologous chromosome. In other words, the alleles of a given marker in this individual will differ in length. Amplification of a fragment containing such a marker will produce amplicons of two different lengths.By analyzing the number of repeats in several markers surrounding a pathogenic variant and studying their inheritance in the tested family, it is possible to establish linkage between the marker alleles and the pathogenic variant. The diagnostic value of analyzing the number of repeats in these markers in embryos is that the inherited allele of each marker allows one to determine whether the embryo has inherited the SCN4A gene carrying the pathogenic variant or whether it has inherited the SCN4A gene from another, homologous chromosome that does not contain the pathogenic variant. For each of these loci, primers were selected for amplification using nested or semi-nested PCR in two rounds, increasing the accuracy and efficiency of amplification. The test system included 10 polymorphic loci for the SCN4A gene: D17S1835, D17S794, D17S924, D17S948, rs66871703_delG / GG / GGG / G4, D17S1809, D17S1825, D17S1792, D17S1821, D17S1813.The amplification primers are located on chromosome 17 in the region of coordinates 60746447-65486277 (according to hg19). The sequences of the primers for amplification of DNA fragments containing the listed loci are specified in the claims in the list of SEQ ID NOs 1-32. It is important to note that a number of special requirements were observed during the selection of primers: the length of the product with external primers for the first round of PCR should not exceed 500 bp (for production from fragments obtained during whole-genome amplification), the length of the product with internal primers for the second round of PCR from 120 to 350 bp, high specificity of external primers, and annealing temperature does not differ by more than 1°C.

[0009] Preparatory stage of the urban-type settlement

[0010] The preparatory stage involves testing the test system: selecting amplification conditions optimal for primer performance, analyzing the efficiency and specificity of PCR amplification in both rounds, and assessing the test system's versatility for various biosample types (DNA, WGA product, single cells). During the test system testing, stock primer dilutions with a concentration of 100 mM and working dilutions of primer combinations (a combination of primer pairs for rounds 1 and 2) with a concentration of 10 mM of each primer in solution were prepared.Since various types of matrices can be used in the diagnostics of clinical material, two biopsies of single cells in a special lysis buffer (1×PCR Buffer, 0.1% Tween-20, 0.1% Triton X-100, 1 μg Proteinase K), two samples of whole-genome amplification products of embryo biopsies (WGA), as well as total DNA of family members isolated from blood were used in the development of the test system to compile a pedigree and identify the linkage of a pathogenic variant with the alleles of polymorphic markers.

[0011] In nested and semi-nested PCR, amplification is performed in two stages. In the first stage, multiplex PCR is performed with all external primers for all loci included in the test system to enrich the sample with all target fragments. In the second stage, each fragment is individually amplified with internal primers.

[0012] Semi-nested PCR

[0013] For the first stage, external highly specific primers were selected for amplifying fragments from 300 to 500 bp. For the second stage, primers were selected for amplifying fragments no longer than 350 base pairs, and labels were introduced for detection by fragment analysis. The sequences of the primers for amplifying DNA fragments containing the listed loci are listed in the claims in SEQ ID NOs 1-32. The PCR mixture for the first round of amplification contained 1×PCR buffer with Mg2+ (Eurogen, Russia), 0.1 mM of each deoxynucleotide, 0.15 μM of each primer, 2.5 U / μl HsTaq DNA polymerase (Eurogen, Russia), 6% dimethyl sulfoxide (DMSO), and 1 μl of total DNA or 2.5 μl of WGA or 5 μl of lysis buffer with the sample as a template. The first round of amplification was carried out according to the following protocol: denaturation step at 94°C for 2 minutes, 30 cycles with a decrease in the annealing temperature of the primers from 62 to 45°C in each cycle, a step for extension of all templates at 72°C for 10 minutes.Next, the products of the first stage were distributed into individual test tubes with one pair of primers for a specific locus.

[0014] The PCR mixture for the second stage contained 1×PCR buffer with Mg2+ (Eurogen, Russia), 0.5xRediLoad™ loading buffer (Thermo Fisher Scientific, USA), 0.2 mM of each deoxynucleotide, 0.2 μM of each primer, 1 U / μl HsTaq DNA polymerase (Eurogen, Russia), 6% dimethyl sulfoxide (DMSO), and 1 μl of the PCR product from the first stage of amplification as a template. The second stage of amplification was carried out according to the following protocol: denaturation stage at 95°C for 2 minutes, 35 cycles: denaturation at 95°C for 30 seconds, primer annealing at 57°C for 30 seconds, template synthesis at 72°C for 1 minute, stage of extension of all templates at 72°C for 5 minutes. Evaluation of amplification efficiency and specificity was performed using 2% agarose gel electrophoresis. The agarose gel electrophoresis results allow one to determine the required dilution of the amplification products for fragment analysis (DNA amplification products from family members).

[0015] Fragment analysis of the amplification products was performed using capillary electrophoresis on a 3130xl Genetic Analyzer (Applied Biosystems, USA). Based on the fragment analysis results, a pedigree is compiled and informative polymorphic markers are identified for each family, which will subsequently be used in clinical diagnostics. Loci are divided into non-informative (the carrier of the pathogenic variant is homozygous for this locus), semi-informative (the alleles for this marker are the same on some parental chromosomes), and informative (the alleles for this marker are different on all parental chromosomes, allowing each of them to be distinguished during embryo genotyping).

[0016] Polymerase chain reaction - restriction fragment length polymorphism

[0017] (PCR-RFLP)

[0018] Restriction fragment length polymorphism RFLP (restriction polymorphism, RFLP) is a method for studying genomic DNA by specifically cleaving DNA with restriction endonucleases and then analyzing the sizes of the resulting fragments (restrictions) using gel electrophoresis. This method produces fragments of varying lengths depending on differences in the nucleotide sequence at the restriction site, enabling the detection of single-nucleotide variants if they are located at the restriction site. Sanger sequencing can provide more accurate detection of pathogenic variants; however, in the context of PGT, PCR-RFLP is more effective due to the reduced likelihood of allele dropout (ADO) and, consequently, an erroneous result in assessing the embryo's status for a pathogenic variant.

[0020] A PCR-RFLP-based assay was developed to detect the pathogenic variant NC_000017.10:g.62034787G>A (NM_000334.4:c.211 lOT, p.Thr704Met, rs80338957). The amplification step is described in detail in the previous section. The following primers, shown in SEQ ID NOs 33-36, were used:

[0021] External: 5'-ATTGCCGATGACCATGAC-3' and 5'-CGACACTGTTCTTTCTCCTAAG-3'

[0022] Internal: 5'-ACACGCACTCCTTGTAGCT-3' and 5'-CGACACTGTTCTTTCTCCTAAG-3'

[0023] The amplification products from the internal primers for detection of the pathogenic variant were then used in a restriction reaction. The Csel endonuclease cleaves only the wild-type allele, while the BmsI endonuclease cleaves only the mutant allele of the NC_000017.10:g.62034787G>A (NM_000334.4:c.21 POT, p.Thr704Met, rs80338957) variant. Detection was performed by electrophoresis in a 12% polyacrylamide gel.

[0024] Example 1

[0025] Patients A

[0026] Family A contacted CGRM Genetiko. The woman suffered from paroxysmal myoplegia and was a heterozygous carrier of the pathogenic variant NC_000017.10:g.62034787G>A (NM_000334.4:c.2111C>T, p.Thr704Met, rs80338957) in the SCN4A gene, inherited from her mother. The couple was recommended to undergo PGT for paroxysmal myoplegia as part of IVF to select embryos that did not inherit the disease.

[0027] Family haplotyping

[0028] In the first stage, biomaterial (peripheral blood) was obtained from family members to detect the pathogenic variant and identify linkage groups of polymorphic marker alleles. Ten STR loci were analyzed. DNA fragments containing polymorphic markers were amplified using the primers listed in SEQ ID NOs 1-32 in the patent claims. Of these, eight were found to be informative for the patient. Therefore, embryo samples were tested only for informative markers.

[0029] Coinciding polymorphic marker alleles in blood relatives carrying the pathogenic variant NC_000017.10:g.62034787G>A (NM_000334.4:c.2111C>T, p.Thr704Met, rs80338957) in the SCN4A gene were recognized as linked to each other and to this pathogenic variant. Mismatched polymorphic marker alleles in such relatives were recognized as linked to each other and to the normal allele of the SCN4A gene. Since the partner’s relatives were unavailable, his haplotyping was performed on embryos during their analysis. The obtained results for informative markers are presented together with the PGT-M results in Table 1. Alleles listed on the same line are located on the same chromosome, that is, they represent a linkage group. Thus, for each family member, there are two linkage groups, corresponding to each of the two seventeenth human chromosomes. Variant NC_000017.10:g.62034787G>A (NM_000334.4:c.2111C>T, NP_000325.4:p.Thr704Met, rs80338957) in the SCN4A gene is designated in the table as SCN4A C.2111C>T. N in the table denotes the absence of a pathogenic variant, mut denotes the presence of a pathogenic variant NC_000017.10:g.62034787G>A (NM_000334.4:c.2111C>T, NP_000325.4:p.Thr704Met, rs80338957) in the SCN4A gene. The numbers indicate the lengths of the amplicons in nucleotide pairs; their lengths depend on the number of repeats in the polymorphic marker.

[0030] As a result of haplotyping, it was concluded that the patient with the pathogenic variant had the following linked alleles of polymorphic markers: D17S794 - 223, D17S924 - 171, D17S948 - 260, rs66871703 - 176, D17S1809 - 205, D17S1825 - 331, D17S1821 - 305, D17S1813 - 198.

[0031] Preimplantation genetic testing

[0032] Two embryos were obtained in an IVF cycle. A biopsy was performed on day 5 of development (at the IVF clinic). The biopsy specimen in WGA buffer (1×PBS (Invitrogen, USA), 1% polyvinylpyrrolidone (PVP) (Fertipro, Belgium)) was sent to the Genetico laboratory. To monitor for contamination at various stages of sample processing, the laboratory has developed a system of controls: a contamination control for the biopsy buffer, a contamination control during transportation (one tube with the buffer is not opened by the embryologist), and a contamination control for each sample (a sample of the medium from the last wash drop of the biopsy material). All of these controls, along with the samples, undergo whole-genome amplification, after which the slightest amount of DNA contaminating the controls will be visible. Whole genome amplification was performed using the commercial SurePlex kit (Illumina, USA).

[0033] The whole-genome amplification product, as well as DNA from all family members, was amplified in step 1 using multiplex PCR with primers for detecting the pathogenic variant and primers for polymorphic markers informative for family A, in accordance with the test system protocol developed during the preparatory phase. In step 2, amplification was performed for each marker separately, according to the developed test system protocol. This allowed us to determine the linkage groups inherited by each embryo. The results are presented in Table 1.

[0034]

[0035] Table 1. Results of haplotyping and PGT-M of family A. *A recombinant maternal chromosome was detected between the D17S1825 and D17S1821 loci; it has no clinical significance.

[0036] Based on direct and indirect diagnostics, embryo 1 did not inherit the disease, while embryo 2 was found to have a haplotype consistent with the inherited disease. Embryo 1 was recommended for transfer based on the PGT-M results. Based on all embryo tests performed, the embryos were recommended for transfer.

[0037] --->

[0038] <?xml version="1.0" encoding="UTF-8"?>

[0039] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0040] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0041] <ST26SequenceListing dtdVersion="V1_3" fileName="Способ

[0042] преимплантационного генетического тестирования пароксизмальной

[0043] миоплегии.xml" softwareName="WIPO Sequence" softwareVersion="2.3.0"

[0044] productionDate="2026-03-31">

[0045] <applicationidentification>

[0046] <ipofficecode>RU< / ipofficecode>

[0047] <applicationnumbertext> 2025105786< / applicationnumbertext>

[0048] <filingdate> 2025-03-12< / filingdate>

[0049] < / applicationidentification>

[0050] <applicantfilereference> 2025105786< / applicantfilereference>

[0051] <applicantname languagecode="ru">Public joint-stock company

[0052] “Center of Genetics and Reproductive Medicine “GENETIKO”< / applicantname>

[0053] <applicantnamelatin> GENETICS PJSC< / applicantnamelatin>

[0054] <inventiontitle languagecode="ru">Preimplantation method

[0055] Genetic testing of paroxysmal myoplegia< / inventiontitle>

[0056] <sequencetotalquantity> 36< / sequencetotalquantity>

[0057] <sequencedata sequenceidnumber="1">

[0058] <insdseq>

[0059] <INSDSeq_length> 20< / INSDSeq_length>

[0060] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0061] <INSDSeq_division> PAT< / INSDSeq_division>

[0062] <INSDSeq_feature-table>

[0063] <insdfeature>

[0064] <INSDFeature_key>source< / INSDFeature_key>

[0065] <INSDFeature_location>1..20< / INSDFeature_location>

[0066] <INSDFeature_quals>

[0067] <insdqualifier>

[0068] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0069] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0070] < / insdqualifier>

[0071] <insdqualifier id="q2">

[0072] <INSDQualifier_name>organism< / INSDQualifier_name>

[0073] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0074] < / insdqualifier>

[0075] < / INSDFeature_quals>

[0076] < / insdfeature>

[0077] < / INSDSeq_feature-table>

[0078] <INSDSeq_sequence> atggacagggtctgctttag< / INSDSeq_sequence>

[0079] < / insdseq>

[0080] < / sequencedata>

[0081] <sequencedata sequenceidnumber="2">

[0082] <insdseq>

[0083] <INSDSeq_length>19< / INSDSeq_length>

[0084] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0085] <INSDSeq_division>PAT< / INSDSeq_division>

[0086] <INSDSeq_feature-table>

[0087] <insdfeature>

[0088] <INSDFeature_key>source< / INSDFeature_key>

[0089] <INSDFeature_location>1..19< / INSDFeature_location>

[0090] <INSDFeature_quals>

[0091] <insdqualifier>

[0092] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0093] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0094] < / insdqualifier>

[0095] <insdqualifier id="q4">

[0096] <INSDQualifier_name>organism< / INSDQualifier_name>

[0097] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0098] < / insdqualifier>

[0099] < / INSDFeature_quals>

[0100] < / insdfeature>

[0101] < / INSDSeq_feature-table>

[0102] <INSDSeq_sequence>gtcctgagtcgatcattgg< / INSDSeq_sequence>

[0103] < / insdseq>

[0104] < / sequencedata>

[0105] <sequencedata sequenceidnumber="3">

[0106] <insdseq>

[0107] <INSDSeq_length> 22< / INSDSeq_length>

[0108] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0109] <INSDSeq_division> PAT< / INSDSeq_division>

[0110] <INSDSeq_feature-table>

[0111] <insdfeature>

[0112] <INSDFeature_key>source< / INSDFeature_key>

[0113] <INSDFeature_location>1..22< / INSDFeature_location>

[0114] <INSDFeature_quals>

[0115] <insdqualifier>

[0116] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0117] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0118] < / insdqualifier>

[0119] <insdqualifier id="q6">

[0120] <INSDQualifier_name>organism< / INSDQualifier_name>

[0121] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0122] < / insdqualifier>

[0123] < / INSDFeature_quals>

[0124] < / insdfeature>

[0125] < / INSDSeq_feature-table>

[0126] <INSDSeq_sequence> tttactgtggtgtaggttggag< / INSDSeq_sequence>

[0127] < / insdseq>

[0128] < / sequencedata>

[0129] <sequencedata sequenceidnumber="4">

[0130] <insdseq>

[0131] <INSDSeq_length> 19< / INSDSeq_length>

[0132] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0133] <INSDSeq_division> PAT< / INSDSeq_division>

[0134] <INSDSeq_feature-table>

[0135] <insdfeature>

[0136] <INSDFeature_key>source< / INSDFeature_key>

[0137] <INSDFeature_location>1..19< / INSDFeature_location>

[0138] <INSDFeature_quals>

[0139] <insdqualifier>

[0140] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0141] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0142] < / insdqualifier>

[0143] <insdqualifier id="q8">

[0144] <INSDQualifier_name>organism< / INSDQualifier_name>

[0145] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0146] < / insdqualifier>

[0147] < / INSDFeature_quals>

[0148] < / insdfeature>

[0149] < / INSDSeq_feature-table>

[0150] <INSDSeq_sequence> caccacaatggtcttcctc< / INSDSeq_sequence>

[0151] < / insdseq>

[0152] < / sequencedata>

[0153] <sequencedata sequenceidnumber="5">

[0154] <insdseq>

[0155] <INSDSeq_length> 20< / INSDSeq_length>

[0156] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0157] <INSDSeq_division> PAT< / INSDSeq_division>

[0158] <INSDSeq_feature-table>

[0159] <insdfeature>

[0160] <INSDFeature_key>source< / INSDFeature_key>

[0161] <INSDFeature_location>1..20< / INSDFeature_location>

[0162] <INSDFeature_quals>

[0163] <insdqualifier>

[0164] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0165] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0166] < / insdqualifier>

[0167] <insdqualifier id="q10">

[0168] <INSDQualifier_name>organism< / INSDQualifier_name>

[0169] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0170] < / insdqualifier>

[0171] < / INSDFeature_quals>

[0172] < / insdfeature>

[0173] < / INSDSeq_feature-table>

[0174] <INSDSeq_sequence> actattggtcaagcacacca< / INSDSeq_sequence>

[0175] < / insdseq>

[0176] < / sequencedata>

[0177] <sequencedata sequenceidnumber="6">

[0178] <insdseq>

[0179] <INSDSeq_length>22< / INSDSeq_length>

[0180] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0181] <INSDSeq_division>PAT< / INSDSeq_division>

[0182] <INSDSeq_feature-table>

[0183] <insdfeature>

[0184] <INSDFeature_key>source< / INSDFeature_key>

[0185] <INSDFeature_location>1..22< / INSDFeature_location>

[0186] <INSDFeature_quals>

[0187] <insdqualifier>

[0188] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0189] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0190] < / insdqualifier>

[0191] <insdqualifier id="q12">

[0192] <INSDQualifier_name>organism< / INSDQualifier_name>

[0193] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0194] < / insdqualifier>

[0195] < / INSDFeature_quals>

[0196] < / insdfeature>

[0197] < / INSDSeq_feature-table>

[0198] <INSDSeq_sequence>cataccagtgtgcctgtctatt< / INSDSeq_sequence>

[0199] < / insdseq>

[0200] < / sequencedata>

[0201] <sequencedata sequenceidnumber="7">

[0202] <insdseq>

[0203] <INSDSeq_length> 20< / INSDSeq_length>

[0204] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0205] <INSDSeq_division> PAT< / INSDSeq_division>

[0206] <INSDSeq_feature-table>

[0207] <insdfeature>

[0208] <INSDFeature_key>source< / INSDFeature_key>

[0209] <INSDFeature_location>1..20< / INSDFeature_location>

[0210] <INSDFeature_quals>

[0211] <insdqualifier>

[0212] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0213] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0214] < / insdqualifier>

[0215] <insdqualifier id="q14">

[0216] <INSDQualifier_name>organism< / INSDQualifier_name>

[0217] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0218] < / insdqualifier>

[0219] < / INSDFeature_quals>

[0220] < / insdfeature>

[0221] < / INSDSeq_feature-table>

[0222] <INSDSeq_sequence> atatccagggacttcagggt< / INSDSeq_sequence>

[0223] < / insdseq>

[0224] < / sequencedata>

[0225] <sequencedata sequenceidnumber="8">

[0226] <insdseq>

[0227] <INSDSeq_length> 21< / INSDSeq_length>

[0228] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0229] <INSDSeq_division> PAT< / INSDSeq_division>

[0230] <INSDSeq_feature-table>

[0231] <insdfeature>

[0232] <INSDFeature_key>source< / INSDFeature_key>

[0233] <INSDFeature_location>1..21< / INSDFeature_location>

[0234] <INSDFeature_quals>

[0235] <insdqualifier>

[0236] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0237] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0238] < / insdqualifier>

[0239] <insdqualifier id="q16">

[0240] <INSDQualifier_name>organism< / INSDQualifier_name>

[0241] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0242] < / insdqualifier>

[0243] < / INSDFeature_quals>

[0244] < / insdfeature>

[0245] < / INSDSeq_feature-table>

[0246] <INSDSeq_sequence> tcttagaagcctctgctgtgt< / INSDSeq_sequence>

[0247] < / insdseq>

[0248] < / sequencedata>

[0249] <sequencedata sequenceidnumber="9">

[0250] <insdseq>

[0251] <INSDSeq_length> 23< / INSDSeq_length>

[0252] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0253] <INSDSeq_division> PAT< / INSDSeq_division>

[0254] <INSDSeq_feature-table>

[0255] <insdfeature>

[0256] <INSDFeature_key>source< / INSDFeature_key>

[0257] <INSDFeature_location>1..23< / INSDFeature_location>

[0258] <INSDFeature_quals>

[0259] <insdqualifier>

[0260] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0261] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0262] < / insdqualifier>

[0263] <insdqualifier id="q18">

[0264] <INSDQualifier_name>organism< / INSDQualifier_name>

[0265] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0266] < / insdqualifier>

[0267] < / INSDFeature_quals>

[0268] < / insdfeature>

[0269] < / INSDSeq_feature-table>

[0270] <INSDSeq_sequence> agagttaatggccagaaatacag< / INSDSeq_sequence>

[0271] < / insdseq>

[0272] < / sequencedata>

[0273] <sequencedata sequenceidnumber="10">

[0274] <insdseq>

[0275] <INSDSeq_length> 21< / INSDSeq_length>

[0276] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0277] <INSDSeq_division> PAT< / INSDSeq_division>

[0278] <INSDSeq_feature-table>

[0279] <insdfeature>

[0280] <INSDFeature_key>source< / INSDFeature_key>

[0281] <INSDFeature_location>1..21< / INSDFeature_location>

[0282] <INSDFeature_quals>

[0283] <insdqualifier>

[0284] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0285] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0286] < / insdqualifier>

[0287] <insdqualifier id="q20">

[0288] <INSDQualifier_name>organism< / INSDQualifier_name>

[0289] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0290] < / insdqualifier>

[0291] < / INSDFeature_quals>

[0292] < / insdfeature>

[0293] < / INSDSeq_feature-table>

[0294] <INSDSeq_sequence> taatttctcagctctgcacct< / INSDSeq_sequence>

[0295] < / insdseq>

[0296] < / sequencedata>

[0297] <sequencedata sequenceidnumber="11">

[0298] <insdseq>

[0299] <INSDSeq_length>22< / INSDSeq_length>

[0300] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0301] <INSDSeq_division>PAT< / INSDSeq_division>

[0302] <INSDSeq_feature-table>

[0303] <insdfeature>

[0304] <INSDFeature_key>source< / INSDFeature_key>

[0305] <INSDFeature_location>1..22< / INSDFeature_location>

[0306] <INSDFeature_quals>

[0307] <insdqualifier>

[0308] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0309] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0310] < / insdqualifier>

[0311] <insdqualifier id="q22">

[0312] <INSDQualifier_name>organism< / INSDQualifier_name>

[0313] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0314] < / insdqualifier>

[0315] < / INSDFeature_quals>

[0316] < / insdfeature>

[0317] < / INSDSeq_feature-table>

[0318] <INSDSeq_sequence>tggactcatacagtcgagagac< / INSDSeq_sequence>

[0319] < / insdseq>

[0320] < / sequencedata>

[0321] <sequencedata sequenceidnumber="12">

[0322] <insdseq>

[0323] <INSDSeq_length> 20< / INSDSeq_length>

[0324] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0325] <INSDSeq_division> PAT< / INSDSeq_division>

[0326] <INSDSeq_feature-table>

[0327] <insdfeature>

[0328] <INSDFeature_key>source< / INSDFeature_key>

[0329] <INSDFeature_location>1..20< / INSDFeature_location>

[0330] <INSDFeature_quals>

[0331] <insdqualifier>

[0332] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0333] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0334] < / insdqualifier>

[0335] <insdqualifier id="q24">

[0336] <INSDQualifier_name>organism< / INSDQualifier_name>

[0337] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0338] < / insdqualifier>

[0339] < / INSDFeature_quals>

[0340] < / insdfeature>

[0341] < / INSDSeq_feature-table>

[0342] <INSDSeq_sequence> gctctctacccaagacagc< / INSDSeq_sequence>

[0343] < / insdseq>

[0344] < / sequencedata>

[0345] <sequencedata sequenceidnumber="13">

[0346] <insdseq>

[0347] <INSDSeq_length> 22< / INSDSeq_length>

[0348] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0349] <INSDSeq_division> PAT< / INSDSeq_division>

[0350] <INSDSeq_feature-table>

[0351] <insdfeature>

[0352] <INSDFeature_key>source< / INSDFeature_key>

[0353] <INSDFeature_location>1..22< / INSDFeature_location>

[0354] <INSDFeature_quals>

[0355] <insdqualifier>

[0356] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0357] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0358] < / insdqualifier>

[0359] <insdqualifier id="q26">

[0360] <INSDQualifier_name>organism< / INSDQualifier_name>

[0361] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0362] < / insdqualifier>

[0363] < / INSDFeature_quals>

[0364] < / insdfeature>

[0365] < / INSDSeq_feature-table>

[0366] <INSDSeq_sequence> actggatggagtgtacacattt< / INSDSeq_sequence>

[0367] < / insdseq>

[0368] < / sequencedata>

[0369] <sequencedata sequenceidnumber="14">

[0370] <insdseq>

[0371] <INSDSeq_length> 20< / INSDSeq_length>

[0372] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0373] <INSDSeq_division> PAT< / INSDSeq_division>

[0374] <INSDSeq_feature-table>

[0375] <insdfeature>

[0376] <INSDFeature_key>source< / INSDFeature_key>

[0377] <INSDFeature_location>1..20< / INSDFeature_location>

[0378] <INSDFeature_quals>

[0379] <insdqualifier>

[0380] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0381] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0382] < / insdqualifier>

[0383] <insdqualifier id="q28">

[0384] <INSDQualifier_name>organism< / INSDQualifier_name>

[0385] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0386] < / insdqualifier>

[0387] < / INSDFeature_quals>

[0388] < / insdfeature>

[0389] < / INSDSeq_feature-table>

[0390] <INSDSeq_sequence> tgtgccgttcagtttctcta< / INSDSeq_sequence>

[0391] < / insdseq>

[0392] < / sequencedata>

[0393] <sequencedata sequenceidnumber="15">

[0394] <insdseq>

[0395] <INSDSeq_length> 21< / INSDSeq_length>

[0396] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0397] <INSDSeq_division> PAT< / INSDSeq_division>

[0398] <INSDSeq_feature-table>

[0399] <insdfeature>

[0400] <INSDFeature_key>source< / INSDFeature_key>

[0401] <INSDFeature_location>1..21< / INSDFeature_location>

[0402] <INSDFeature_quals>

[0403] <insdqualifier>

[0404] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0405] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0406] < / insdqualifier>

[0407] <insdqualifier id="q30">

[0408] <INSDQualifier_name>organism< / INSDQualifier_name>

[0409] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0410] < / insdqualifier>

[0411] < / INSDFeature_quals>

[0412] < / insdfeature>

[0413] < / INSDSeq_feature-table>

[0414] <INSDSeq_sequence> ttccctctagggtgaagactc< / INSDSeq_sequence>

[0415] < / insdseq>

[0416] < / sequencedata>

[0417] <sequencedata sequenceidnumber="16">

[0418] <insdseq>

[0419] <INSDSeq_length>20< / INSDSeq_length>

[0420] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0421] <INSDSeq_division>PAT< / INSDSeq_division>

[0422] <INSDSeq_feature-table>

[0423] <insdfeature>

[0424] <INSDFeature_key>source< / INSDFeature_key>

[0425] <INSDFeature_location>1..20< / INSDFeature_location>

[0426] <INSDFeature_quals>

[0427] <insdqualifier>

[0428] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0429] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0430] < / insdqualifier>

[0431] <insdqualifier id="q32">

[0432] <INSDQualifier_name>organism< / INSDQualifier_name>

[0433] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0434] < / insdqualifier>

[0435] < / INSDFeature_quals>

[0436] < / insdfeature>

[0437] < / INSDSeq_feature-table>

[0438] <INSDSeq_sequence>ggacttactccacttccacc< / INSDSeq_sequence>

[0439] < / insdseq>

[0440] < / sequencedata>

[0441] <sequencedata sequenceidnumber="17">

[0442] <insdseq>

[0443] <INSDSeq_length> 20< / INSDSeq_length>

[0444] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0445] <INSDSeq_division> PAT< / INSDSeq_division>

[0446] <INSDSeq_feature-table>

[0447] <insdfeature>

[0448] <INSDFeature_key>source< / INSDFeature_key>

[0449] <INSDFeature_location>1..20< / INSDFeature_location>

[0450] <INSDFeature_quals>

[0451] <insdqualifier>

[0452] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0453] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0454] < / insdqualifier>

[0455] <insdqualifier id="q34">

[0456] <INSDQualifier_name>organism< / INSDQualifier_name>

[0457] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0458] < / insdqualifier>

[0459] < / INSDFeature_quals>

[0460] < / insdfeature>

[0461] < / INSDSeq_feature-table>

[0462] <INSDSeq_sequence> ccccaatgacctagagtttc< / INSDSeq_sequence>

[0463] < / insdseq>

[0464] < / sequencedata>

[0465] <sequencedata sequenceidnumber="18">

[0466] <insdseq>

[0467] <INSDSeq_length> 19< / INSDSeq_length>

[0468] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0469] <INSDSeq_division> PAT< / INSDSeq_division>

[0470] <INSDSeq_feature-table>

[0471] <insdfeature>

[0472] <INSDFeature_key>source< / INSDFeature_key>

[0473] <INSDFeature_location>1..19< / INSDFeature_location>

[0474] <INSDFeature_quals>

[0475] <insdqualifier>

[0476] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0477] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0478] < / insdqualifier>

[0479] <insdqualifier id="q36">

[0480] <INSDQualifier_name>organism< / INSDQualifier_name>

[0481] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0482] < / insdqualifier>

[0483] < / INSDFeature_quals>

[0484] < / insdfeature>

[0485] < / INSDSeq_feature-table>

[0486] <INSDSeq_sequence> aaagctacattcctgggct< / INSDSeq_sequence>

[0487] < / insdseq>

[0488] < / sequencedata>

[0489] <sequencedata sequenceidnumber="19">

[0490] <insdseq>

[0491] <INSDSeq_length>18< / INSDSeq_length>

[0492] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0493] <INSDSeq_division>PAT< / INSDSeq_division>

[0494] <INSDSeq_feature-table>

[0495] <insdfeature>

[0496] <INSDFeature_key>source< / INSDFeature_key>

[0497] <INSDFeature_location>1..18< / INSDFeature_location>

[0498] <INSDFeature_quals>

[0499] <insdqualifier>

[0500] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0501] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0502] < / insdqualifier>

[0503] <insdqualifier id="q38">

[0504] <INSDQualifier_name>organism< / INSDQualifier_name>

[0505] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0506] < / insdqualifier>

[0507] < / INSDFeature_quals>

[0508] < / insdfeature>

[0509] < / INSDSeq_feature-table>

[0510] <INSDSeq_sequence>gcagatgcatctgctcag< / INSDSeq_sequence>

[0511] < / insdseq>

[0512] < / sequencedata>

[0513] <sequencedata sequenceidnumber="20">

[0514] <insdseq>

[0515] <INSDSeq_length> 20< / INSDSeq_length>

[0516] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0517] <INSDSeq_division> PAT< / INSDSeq_division>

[0518] <INSDSeq_feature-table>

[0519] <insdfeature>

[0520] <INSDFeature_key>source< / INSDFeature_key>

[0521] <INSDFeature_location>1..20< / INSDFeature_location>

[0522] <INSDFeature_quals>

[0523] <insdqualifier>

[0524] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0525] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0526] < / insdqualifier>

[0527] <insdqualifier id="q40">

[0528] <INSDQualifier_name>organism< / INSDQualifier_name>

[0529] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0530] < / insdqualifier>

[0531] < / INSDFeature_quals>

[0532] < / insdfeature>

[0533] < / INSDSeq_feature-table>

[0534] <INSDSeq_sequence> tagcaggactcattaagca< / INSDSeq_sequence>

[0535] < / insdseq>

[0536] < / sequencedata>

[0537] <sequencedata sequenceidnumber="21">

[0538] <insdseq>

[0539] <INSDSeq_length> 19< / INSDSeq_length>

[0540] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0541] <INSDSeq_division> PAT< / INSDSeq_division>

[0542] <INSDSeq_feature-table>

[0543] <insdfeature>

[0544] <INSDFeature_key>source< / INSDFeature_key>

[0545] <INSDFeature_location>1..19< / INSDFeature_location>

[0546] <INSDFeature_quals>

[0547] <insdqualifier>

[0548] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0549] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0550] < / insdqualifier>

[0551] <insdqualifier id="q42">

[0552] <INSDQualifier_name>organism< / INSDQualifier_name>

[0553] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0554] < / insdqualifier>

[0555] < / INSDFeature_quals>

[0556] < / insdfeature>

[0557] < / INSDSeq_feature-table>

[0558] <INSDSeq_sequence> catgctagatggaatggct< / INSDSeq_sequence>

[0559] < / insdseq>

[0560] < / sequencedata>

[0561] <sequencedata sequenceidnumber="22">

[0562] <insdseq>

[0563] <INSDSeq_length> 20< / INSDSeq_length>

[0564] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0565] <INSDSeq_division> PAT< / INSDSeq_division>

[0566] <INSDSeq_feature-table>

[0567] <insdfeature>

[0568] <INSDFeature_key>source< / INSDFeature_key>

[0569] <INSDFeature_location>1..20< / INSDFeature_location>

[0570] <INSDFeature_quals>

[0571] <insdqualifier>

[0572] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0573] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0574] < / insdqualifier>

[0575] <insdqualifier id="q44">

[0576] <INSDQualifier_name>organism< / INSDQualifier_name>

[0577] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0578] < / insdqualifier>

[0579] < / INSDFeature_quals>

[0580] < / insdfeature>

[0581] < / INSDSeq_feature-table>

[0582] <INSDSeq_sequence> cttggggaaagctattcaat< / INSDSeq_sequence>

[0583] < / insdseq>

[0584] < / sequencedata>

[0585] <sequencedata sequenceidnumber="23">

[0586] <insdseq>

[0587] <INSDSeq_length> 24< / INSDSeq_length>

[0588] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0589] <INSDSeq_division> PAT< / INSDSeq_division>

[0590] <INSDSeq_feature-table>

[0591] <insdfeature>

[0592] <INSDFeature_key>source< / INSDFeature_key>

[0593] <INSDFeature_location>1..24< / INSDFeature_location>

[0594] <INSDFeature_quals>

[0595] <insdqualifier>

[0596] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0597] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0598] < / insdqualifier>

[0599] <insdqualifier id="q46">

[0600] <INSDQualifier_name>organism< / INSDQualifier_name>

[0601] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0602] < / insdqualifier>

[0603] < / INSDFeature_quals>

[0604] < / insdfeature>

[0605] < / INSDSeq_feature-table>

[0606] <INSDSeq_sequence> ttccaggactgaaattattagtgt< / INSDSeq_sequence>

[0607] < / insdseq>

[0608] < / sequencedata>

[0609] <sequencedata sequenceidnumber="24">

[0610] <insdseq>

[0611] <INSDSeq_length> 20< / INSDSeq_length>

[0612] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0613] <INSDSeq_division> PAT< / INSDSeq_division>

[0614] <INSDSeq_feature-table>

[0615] <insdfeature>

[0616] <INSDFeature_key>source< / INSDFeature_key>

[0617] <INSDFeature_location>1..20< / INSDFeature_location>

[0618] <INSDFeature_quals>

[0619] <insdqualifier>

[0620] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0621] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0622] < / insdqualifier>

[0623] <insdqualifier id="q48">

[0624] <INSDQualifier_name>organism< / INSDQualifier_name>

[0625] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0626] < / insdqualifier>

[0627] < / INSDFeature_quals>

[0628] < / insdfeature>

[0629] < / INSDSeq_feature-table>

[0630] <INSDSeq_sequence> atttgtatgatgcacaagcc< / INSDSeq_sequence>

[0631] < / insdseq>

[0632] < / sequencedata>

[0633] <sequencedata sequenceidnumber="25">

[0634] <insdseq>

[0635] <INSDSeq_length>20< / INSDSeq_length>

[0636] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0637] <INSDSeq_division>PAT< / INSDSeq_division>

[0638] <INSDSeq_feature-table>

[0639] <insdfeature>

[0640] <INSDFeature_key>source< / INSDFeature_key>

[0641] <INSDFeature_location>1..20< / INSDFeature_location>

[0642] <INSDFeature_quals>

[0643] <insdqualifier>

[0644] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0645] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0646] < / insdqualifier>

[0647] <insdqualifier id="q50">

[0648] <INSDQualifier_name>organism< / INSDQualifier_name>

[0649] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0650] < / insdqualifier>

[0651] < / INSDFeature_quals>

[0652] < / insdfeature>

[0653] < / INSDSeq_feature-table>

[0654] <INSDSeq_sequence>gtgagcacgatgttttgagt< / INSDSeq_sequence>

[0655] < / insdseq>

[0656] < / sequencedata>

[0657] <sequencedata sequenceidnumber="26">

[0658] <insdseq>

[0659] <INSDSeq_length> 20< / INSDSeq_length>

[0660] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0661] <INSDSeq_division> PAT< / INSDSeq_division>

[0662] <INSDSeq_feature-table>

[0663] <insdfeature>

[0664] <INSDFeature_key>source< / INSDFeature_key>

[0665] <INSDFeature_location>1..20< / INSDFeature_location>

[0666] <INSDFeature_quals>

[0667] <insdqualifier>

[0668] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0669] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0670] < / insdqualifier>

[0671] <insdqualifier id="q52">

[0672] <INSDQualifier_name>organism< / INSDQualifier_name>

[0673] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0674] < / insdqualifier>

[0675] < / INSDFeature_quals>

[0676] < / insdfeature>

[0677] < / INSDSeq_feature-table>

[0678] <INSDSeq_sequence> aatttccacatgagaggct< / INSDSeq_sequence>

[0679] < / insdseq>

[0680] < / sequencedata>

[0681] <sequencedata sequenceidnumber="27">

[0682] <insdseq>

[0683] <INSDSeq_length> 20< / INSDSeq_length>

[0684] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0685] <INSDSeq_division> PAT< / INSDSeq_division>

[0686] <INSDSeq_feature-table>

[0687] <insdfeature>

[0688] <INSDFeature_key>source< / INSDFeature_key>

[0689] <INSDFeature_location>1..20< / INSDFeature_location>

[0690] <INSDFeature_quals>

[0691] <insdqualifier>

[0692] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0693] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0694] < / insdqualifier>

[0695] <insdqualifier id="q54">

[0696] <INSDQualifier_name>organism< / INSDQualifier_name>

[0697] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0698] < / insdqualifier>

[0699] < / INSDFeature_quals>

[0700] < / insdfeature>

[0701] < / INSDSeq_feature-table>

[0702] <INSDSeq_sequence> ctctggtccagctaatggtc< / INSDSeq_sequence>

[0703] < / insdseq>

[0704] < / sequencedata>

[0705] <sequencedata sequenceidnumber="28">

[0706] <insdseq>

[0707] <INSDSeq_length> 19< / INSDSeq_length>

[0708] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0709] <INSDSeq_division> PAT< / INSDSeq_division>

[0710] <INSDSeq_feature-table>

[0711] <insdfeature>

[0712] <INSDFeature_key>source< / INSDFeature_key>

[0713] <INSDFeature_location>1..19< / INSDFeature_location>

[0714] <INSDFeature_quals>

[0715] <insdqualifier>

[0716] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0717] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0718] < / insdqualifier>

[0719] <insdqualifier id="q56">

[0720] <INSDQualifier_name>organism< / INSDQualifier_name>

[0721] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0722] < / insdqualifier>

[0723] < / INSDFeature_quals>

[0724] < / insdfeature>

[0725] < / INSDSeq_feature-table>

[0726] <INSDSeq_sequence> gatccagcccaagtttgat< / INSDSeq_sequence>

[0727] < / insdseq>

[0728] < / sequencedata>

[0729] <sequencedata sequenceidnumber="29">

[0730] <insdseq>

[0731] <INSDSeq_length> 17< / INSDSeq_length>

[0732] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0733] <INSDSeq_division> PAT< / INSDSeq_division>

[0734] <INSDSeq_feature-table>

[0735] <insdfeature>

[0736] <INSDFeature_key>source< / INSDFeature_key>

[0737] <INSDFeature_location>1..17< / INSDFeature_location>

[0738] <INSDFeature_quals>

[0739] <insdqualifier>

[0740] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0741] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0742] < / insdqualifier>

[0743] <insdqualifier id="q58">

[0744] <INSDQualifier_name>organism< / INSDQualifier_name>

[0745] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0746] < / insdqualifier>

[0747] < / INSDFeature_quals>

[0748] < / insdfeature>

[0749] < / INSDSeq_feature-table>

[0750] <INSDSeq_sequence> ccaaaatccctgcgtct< / INSDSeq_sequence>

[0751] < / insdseq>

[0752] < / sequencedata>

[0753] <sequencedata sequenceidnumber="30">

[0754] <insdseq>

[0755] <INSDSeq_length>22< / INSDSeq_length>

[0756] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0757] <INSDSeq_division>PAT< / INSDSeq_division>

[0758] <INSDSeq_feature-table>

[0759] <insdfeature>

[0760] <INSDFeature_key>source< / INSDFeature_key>

[0761] <INSDFeature_location>1..22< / INSDFeature_location>

[0762] <INSDFeature_quals>

[0763] <insdqualifier>

[0764] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0765] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0766] < / insdqualifier>

[0767] <insdqualifier id="q60">

[0768] <INSDQualifier_name>organism< / INSDQualifier_name>

[0769] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0770] < / insdqualifier>

[0771] < / INSDFeature_quals>

[0772] < / insdfeature>

[0773] < / INSDSeq_feature-table>

[0774] <INSDSeq_sequence>ttcagatttgtacatctcagcc< / INSDSeq_sequence>

[0775] < / insdseq>

[0776] < / sequencedata>

[0777] <sequencedata sequenceidnumber="31">

[0778] <insdseq>

[0779] <INSDSeq_length> 19< / INSDSeq_length>

[0780] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0781] <INSDSeq_division> PAT< / INSDSeq_division>

[0782] <INSDSeq_feature-table>

[0783] <insdfeature>

[0784] <INSDFeature_key>source< / INSDFeature_key>

[0785] <INSDFeature_location>1..19< / INSDFeature_location>

[0786] <INSDFeature_quals>

[0787] <insdqualifier>

[0788] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0789] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0790] < / insdqualifier>

[0791] <insdqualifier id="q62">

[0792] <INSDQualifier_name>organism< / INSDQualifier_name>

[0793] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0794] < / insdqualifier>

[0795] < / INSDFeature_quals>

[0796] < / insdfeature>

[0797] < / INSDSeq_feature-table>

[0798] <INSDSeq_sequence> ctggtttgccaatctatgc< / INSDSeq_sequence>

[0799] < / insdseq>

[0800] < / sequencedata>

[0801] <sequencedata sequenceidnumber="32">

[0802] <insdseq>

[0803] <INSDSeq_length> 21< / INSDSeq_length>

[0804] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0805] <INSDSeq_division> PAT< / INSDSeq_division>

[0806] <INSDSeq_feature-table>

[0807] <insdfeature>

[0808] <INSDFeature_key>source< / INSDFeature_key>

[0809] <INSDFeature_location>1..21< / INSDFeature_location>

[0810] <INSDFeature_quals>

[0811] <insdqualifier>

[0812] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0813] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0814] < / insdqualifier>

[0815] <insdqualifier id="q64">

[0816] <INSDQualifier_name>organism< / INSDQualifier_name>

[0817] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0818] < / insdqualifier>

[0819] < / INSDFeature_quals>

[0820] < / insdfeature>

[0821] < / INSDSeq_feature-table>

[0822] <INSDSeq_sequence> aagtatgacccaggtctcctc< / INSDSeq_sequence>

[0823] < / insdseq>

[0824] < / sequencedata>

[0825] <sequencedata sequenceidnumber="33">

[0826] <insdseq>

[0827] <INSDSeq_length> 18< / INSDSeq_length>

[0828] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0829] <INSDSeq_division> PAT< / INSDSeq_division>

[0830] <INSDSeq_feature-table>

[0831] <insdfeature>

[0832] <INSDFeature_key>source< / INSDFeature_key>

[0833] <INSDFeature_location>1..18< / INSDFeature_location>

[0834] <INSDFeature_quals>

[0835] <insdqualifier>

[0836] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0837] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0838] < / insdqualifier>

[0839] <insdqualifier id="q66">

[0840] <INSDQualifier_name>organism< / INSDQualifier_name>

[0841] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0842] < / insdqualifier>

[0843] < / INSDFeature_quals>

[0844] < / insdfeature>

[0845] < / INSDSeq_feature-table>

[0846] <INSDSeq_sequence> attgccgatgaccatgac< / INSDSeq_sequence>

[0847] < / insdseq>

[0848] < / sequencedata>

[0849] <sequencedata sequenceidnumber="34">

[0850] <insdseq>

[0851] <INSDSeq_length>22< / INSDSeq_length>

[0852] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0853] <INSDSeq_division>PAT< / INSDSeq_division>

[0854] <INSDSeq_feature-table>

[0855] <insdfeature>

[0856] <INSDFeature_key>source< / INSDFeature_key>

[0857] <INSDFeature_location>1..22< / INSDFeature_location>

[0858] <INSDFeature_quals>

[0859] <insdqualifier>

[0860] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0861] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0862] < / insdqualifier>

[0863] <insdqualifier id="q68">

[0864] <INSDQualifier_name>organism< / INSDQualifier_name>

[0865] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0866] < / insdqualifier>

[0867] < / INSDFeature_quals>

[0868] < / insdfeature>

[0869] < / INSDSeq_feature-table>

[0870] <INSDSeq_sequence>cgacactgttctttctcctaag< / INSDSeq_sequence>

[0871] < / insdseq>

[0872] < / sequencedata>

[0873] <sequencedata sequenceidnumber="35">

[0874] <insdseq>

[0875] <INSDSeq_length>19< / INSDSeq_length>

[0876] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0877] <INSDSeq_division>PAT< / INSDSeq_division>

[0878] <INSDSeq_feature-table>

[0879] <insdfeature>

[0880] <INSDFeature_key>source< / INSDFeature_key>

[0881] <INSDFeature_location>1..19< / INSDFeature_location>

[0882] <INSDFeature_quals>

[0883] <insdqualifier>

[0884] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0885] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0886] < / insdqualifier>

[0887] <insdqualifier id="q70">

[0888] <INSDQualifier_name>organism< / INSDQualifier_name>

[0889] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0890] < / insdqualifier>

[0891] < / INSDFeature_quals>

[0892] < / insdfeature>

[0893] < / INSDSeq_feature-table>

[0894] <INSDSeq_sequence>acacgcactccttgtagct< / INSDSeq_sequence>

[0895] < / insdseq>

[0896] < / sequencedata>

[0897] <sequencedata sequenceidnumber="36">

[0898] <insdseq>

[0899] <INSDSeq_length>22< / INSDSeq_length>

[0900] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0901] <INSDSeq_division>PAT< / INSDSeq_division>

[0902] <INSDSeq_feature-table>

[0903] <insdfeature>

[0904] <INSDFeature_key>source< / INSDFeature_key>

[0905] <INSDFeature_location>1..22< / INSDFeature_location>

[0906] <INSDFeature_quals>

[0907] <insdqualifier>

[0908] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0909] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0910] < / insdqualifier>

[0911] <insdqualifier id="q72">

[0912] <INSDQualifier_name>organism< / INSDQualifier_name>

[0913] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0914] < / insdqualifier>

[0915] < / INSDFeature_quals>

[0916] < / insdfeature>

[0917] < / INSDSeq_feature-table>

[0918] <INSDSeq_sequence>cgacactgttctttctcctaag< / INSDSeq_sequence>

[0919] < / insdseq>

[0920] < / sequencedata>

[0921]

[0922] <---

Images