Preimplantation genetic testing method for cohen syndrome

Abstract

FIELD: biotechnology.SUBSTANCE: method for preimplantation genetic testing of Cohen syndrome. The specified method includes a dual detection system - direct and indirect, where direct detection is carried out using primers for amplification of SEQ ID NO: 42–47, and indirect detection is carried out using primers for the analysis of inheritance of molecular genetic markers of the STR type, linked to pathogenic variants, selected from SEQ ID NO: 1–41.EFFECT: test system for diagnosing the pathogenic variant NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) in the VPS13B gene with a dual detection system – direct and indirect.1 cl, 2 tbl, 1 ex

Description

[0001] The invention relates to preimplantation genetic testing for monogenic diseases. Currently, more than 350 million people worldwide suffer from a rare disease (according to the RARE Project). The total number of such diseases, according to estimates by the European Organization for Rare Diseases (EURORDIS), ranges from 5,000 to 7,000. Approximately 80% of rare diseases have a genetic cause. Knowing the genetic basis of a disease allows for a highly accurate prediction not only of the health of an already born child but also to assess the risk of having such a child by analyzing the parents' genotypes, as well as to conduct genetic diagnosis at the earliest stages. Preimplantation genetic testing (PGT) for monogenic diseases is becoming a powerful tool for the prevention of such diseases.

[0002] The present invention relates to a method for preimplantation genetic testing for Cohen syndrome. Cohen syndrome is a rare, inherited, autosomal recessive disorder characterized by dysfunction of multiple organs. Cohen syndrome occurs with a frequency of fewer than 1,000 known cases. This disorder results in craniofacial anomalies, morbid obesity, cognitive impairment, retinal degeneration, and hematological disorders. With autosomal recessive inheritance, the probability of having a child with this disorder in a family is 25%.

[0003] Cohen syndrome can be caused by pathogenic genetic variants in the VPS13B gene, located on chromosome 8. [Alipour, N. et al. Mutations in the VPS13B Gene in Iranian Patients with Different Phenotypes of Cohen Syndrome. J Mol Neurosci 2020; 70, 21-25] This gene encodes vacuolar protein-sorting protein 13 homolog B, a transmembrane protein involved in the transport and sorting of other proteins in the cell. This protein is important for the development of the central nervous system, eyes, and blood cells.

[0004] PGT for Cohen syndrome is performed for families with a confirmed molecular genetic cause of the disease. It is important to note that the pathogenicity and causativity of genetic variants is determined prior to PGT for a monogenic disease and is not included in the goals and objectives of PGT for a monogenic disease, nor in the comprehensive package of measures for performing PGT for a monogenic disease. Pathogenicity is assessed according to the international standard—the criteria described in 2015 by the American College of Medical Genetics and Genomics (Association for Molecular Pathology (ACMG-AMP)) during the search for the molecular genetic cause of the disease. PGT is recommended for families with a high risk of having a child with a severe (incurable) hereditary disease with identified pathogenic variants that determine this risk.PGT allows the selection of embryos without pathogenic variants in compound heterozygotes from all embryos obtained during IVF (in vitro fertilization) and, therefore, without the risk of developing disease.

[0005] The main challenge in embryo genetic diagnosis is the small initial amount of biomaterial, as each biopsy contains only one to three cells. In this case, to improve the efficiency and accuracy of the analysis, it is important to completely eliminate the possibility of contamination and mitigate the potential effects of uneven and / or incomplete amplification, as well as biomaterial degradation. This requires the development of a test system with specific characteristics. The test system is designed to accommodate various types of biomaterial—total deoxyribonucleic acid (DNA) isolated from various tissues, whole genome amplification (WGA) products, and single cells.The combination of versatility in biomaterial selection and step-by-step amplification of target fragments enables the analysis of multiple pathogenic variants in a single sample, including on single cells, and the detection of incomplete amplification, contamination, or sample degradation. Another feature of PGT is the lack of information about the embryo's biological characteristics: unlike an adult, an embryo may have any chromosomal abnormalities, which complicates the assessment of the embryo's status for a specific genetic variant. Therefore, a test system for PGT of a monogenic disease must be able to identify such cases and assess their impact on the reliability of the diagnostic result.

[0006] The PGT method for Cohen syndrome presented by us solves the problem of developing a more accurate method of preimplantation genetic testing of this monogenic disease without the use of expensive devices and reagents, which could be used on various types of biomaterial: DNA isolated from different tissues, the product of whole genome amplification (WGA), single cells.

[0007] The technical result was the creation of a test system for diagnosing a genetic variant (the nucleotide number in the reference sequence of genomic DNA is designated by the prefix NC, the nucleotide number in the reference sequence of the coding transcript is designated by the prefix NM): NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) in the VPS13B gene with a dual detection system - direct and indirect. This variant was assessed by a geneticist as the cause of the patient's Cohen syndrome with a phenotype consistent with this disease, since it was detected in the patient in a homozygous state, was not registered in healthy individuals in the "1000 Genomes", ESP6500 and ExAC control samples, the PolyPhen-2 and MutationTaster pathogenicity prediction algorithms consider this mutation as likely pathogenic, and functional analysis revealed that this variant leads to the loss of exon 23.A dual detection system is necessary when working with small amounts of biomaterial, as unstable amplification may lead to loss of information or reduced accuracy of the analysis. Direct diagnostics involves analyzing the presence or absence of a pathogenic variant directly. In this case, for the genetic variant NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) of the single nucleotide polymorphism (SNP) type, restriction endonucleases were selected that allow detection of the pathogenic variant by PCR-RFLP (restriction fragment length polymorphism), based on the difference in the restriction site sequence between different alleles. Indirect diagnostics involves analyzing the inheritance of molecular genetic markers linked to the mutation, i.e. inherited along with it.To achieve this, polymorphic loci called STRs (short tandem repeats) were selected within 3 MB of the VPS13B gene in each direction (corresponding to an average 3% crossing over) with a heterozygosity of at least 0.70 to ensure maximum indirect diagnostic information. STRs are repeats of two or more nucleotides located one after the other (e.g., the adenine-cytosine (AC) pair, repeated several times in a row: ACACACACA) and are present in large numbers in the human genome. The number of repeats in each STR can vary from individual to individual and can also differ between homologous chromosomes in the same individual.Heterozygosity above 0.70 indicates a high probability that the same individual will have a different number of nucleotide repeats in a given STR on one chromosome than in the same STR on the homologous chromosome. In other words, the alleles of a given marker in that individual will differ in length. Amplification of a fragment containing such a marker will produce amplicons of two different lengths. By analyzing the number of repeats in several markers surrounding a pathogenic variant and studying their inheritance in the tested family, it is possible to establish linkage between the marker alleles and the pathogenic variant.The diagnostic value of studying the repeat counts of these markers in embryos is that the inherited allele of each marker allows us to determine whether the embryo has inherited the VPS13B gene carrying the pathogenic variant or whether it has inherited the VPS13B gene from another, homologous chromosome that does not carry the pathogenic variant. Primers for amplification using nested or semi-nested PCR in two rounds were selected for each of these loci, increasing the accuracy and efficiency of amplification. The test system included 13 STR loci for the VPS13B gene: D8S9934, D8S9935, D8S9938, D8S9998, D8S1002, D8S1004, D8S1006.4, D8S1006.6, D8S1008, D8S1010, D8S1014, D8S1015, D8S1017. The amplification primers are located on chromosome 8 in the region of coordinates 99349637-101727387 (according to hg19). The sequences of the primers for amplification of DNA fragments containing the listed STR loci are indicated in the claims in the list of SEQ ID NOs 1-41.It is important to note that a number of special requirements were observed when selecting primers: the length of the product with external primers for the first round of PCR should not exceed 500 bp (for production from fragments obtained during whole-genome amplification), the length of the product with internal primers for the second round of PCR should be from 120 to 350 bp, high specificity of external primers, and the annealing temperature should not differ by more than 1°C.

[0008] Preparatory stage of the urban-type settlement

[0009] The preparatory stage involves testing the test system: selecting amplification conditions optimal for primer performance, analyzing the efficiency and specificity of PCR amplification in both rounds, and assessing the test system's versatility for various biosample types (DNA, WGA product, single cells). During the test system testing, stock primer dilutions with a concentration of 100 M and working dilutions of primer combinations (a combination of primer pairs for rounds 1 and 2) with a concentration of 10 mM of each primer in solution were prepared.Since various types of matrices can be used in the diagnostics of clinical material, two biopsies of single cells in a special lysis buffer (1×PCR Buffer, 0.1% Tween-20, 0.1% Triton X-100, 1 μg Proteinase K), two samples of whole-genome amplification products of embryo biopsies (WGA), as well as total DNA of family members isolated from blood were used in the development of the test system to compile a pedigree and identify the linkage of a pathogenic variant with the alleles of polymorphic markers.

[0010] In nested and semi-nested PCR, amplification is performed in two stages. In the first stage, multiplex PCR is performed with all external primers for all loci included in the test system to enrich the sample with all target fragments. In the second stage, each fragment is individually amplified with internal primers.

[0011] Semi-nested PCR

[0012] For the first stage, external highly specific primers were selected for amplifying fragments from 300 to 500 bp. For the second stage, primers were selected for amplifying fragments no longer than 350 base pairs, and labels for detection by fragment analysis were introduced. The primer sequences for amplifying DNA fragments containing STR loci are listed in the claims in SEQ ID NOs 1-41. The PCR mixture for the first round of amplification contained 1×PCR buffer with Mg2+ (Eurogen, Russia), 0.1 tM of each deoxynucleotide, 0.15 μM of each primer, 2.5 U / μl HsTaq DNA polymerase (Eurogen, Russia), 6% dimethyl sulfoxide (DMSO), and 1 μl of total DNA or 2.5 μl of WGA or 5 μl of lysis buffer with the sample as a template. The first round of amplification was carried out according to the following protocol: denaturation step at 94°C for 2 minutes, 30 cycles with a decrease in the annealing temperature of the primers from 62 to 45 C in each, a step for extension of all templates at 72°C for 10 minutes.Next, the products of the first stage were distributed into individual test tubes with one pair of primers for a specific locus.

[0013] The PCR mixture for the second stage included 1×PCR buffer with Mg2+ (Eurogen, Russia), 0.5xRediLoad™ loading buffer (Thermo Fisher Scientific, USA), 0.2 mM of each deoxynucleotide, 0.2 μM of each primer, lU / ul HsTaq DNA polymerase (Eurogen, Russia), 6% dimethyl sulfoxide (DMSO), and 1 μl of the PCR product from the first stage of amplification as a template. The second stage of amplification was carried out according to the following protocol: denaturation stage at 95°C for 2 minutes, 35 cycles: denaturation at 95°C for 30 seconds, primer annealing at 57°C for 30 seconds, template synthesis at 72°C for 1 minute, stage of extension of all templates at 72°C for 5 minutes. Evaluation of amplification efficiency and specificity was performed using 2% agarose gel electrophoresis. The agarose gel electrophoresis results allow one to determine the required dilution of the amplification products for fragment analysis (DNA amplification products from family members).

[0014] Fragment analysis of the amplification products was performed using capillary electrophoresis on a 3130×1 Genetic Analyzer (Applied Biosystems, USA). Based on the fragment analysis results, a pedigree is compiled and informative polymorphic STR loci are identified for each family, which will subsequently be used in clinical diagnostics. Loci are divided into non-informative (the carrier of the pathogenic variant is homozygous for this locus), semi-informative (the alleles for this marker are the same on some parental chromosomes), and informative (the alleles for this marker are different on all parental chromosomes, making it possible to distinguish each of them during embryo genotype analysis).

[0015] Polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP)

[0016] Restriction fragment length polymorphism (RFLP) is a method for studying genomic DNA by specifically cleaving DNA with restriction endonucleases and then analyzing the sizes of the resulting fragments (restrictions) by gel electrophoresis. This method produces fragments of varying lengths depending on differences in the nucleotide sequence at the restriction site, enabling the detection of single-nucleotide variants if they are located at the restriction site. Sanger sequencing can provide more accurate detection of pathogenic variants; however, in the context of PGT, PCR-RFLP is more effective due to the reduced probability of allele dropout (ADO) and, consequently, an erroneous result in assessing the embryo's status for a pathogenic variant.

[0017] A PCR-RFLP-based assay was developed to detect the pathogenic variant NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg). The amplification step is described in detail in the previous section. The following primers, shown in SEQ ID NOs 42-47, were used:

[0018] External: 5'-TGGCGAAGATGTTAGGTGTT-3' and 5'-AGATTAAAAGGTATGGAAGGCA-3'

[0019] Internal for detection of wild-type allele: 5'-CGACCCATCCTTGCTGAA-3' and 5'-TGGCATCACTTAGTTCACTTACT-3'

[0020] Internal for mutant allele detection: 5'-GCACAAGTATATGGAACCTCTG-3' and 5'-TGGCATCACTTAGTTCACTTACT-3'

[0021] The amplification products from the internal primers for detection of the pathogenic variant were then used in a restriction reaction. Endonuclease Eco571 cleaves only the wild-type allele, while endonuclease Tail cleaves only the mutant allele of the NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) variant. Detection was performed by electrophoresis in a 12% polyacrylamide gel.

[0022] Example 1 Patients A

[0023] Family A contacted CGRM Genetiko. They had a child with Cohen syndrome and homozygous carriage of the pathogenic variants NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) in the VPS13B gene. The couple was recommended to undergo PGT for Cohen syndrome as part of IVF to select embryos that did not inherit the disease.

[0024] Family haplotyping

[0025] In the first stage, biomaterial (peripheral blood) was obtained from family members to detect the pathogenic variant and identify linkage groups of polymorphic marker alleles. Thirteen STR loci were analyzed. DNA fragments containing STR loci were amplified using the primers listed in SEQ ID NOs 1-41 in the patent claims. Of these, 12 were found to be informative for the patient and / or partner. Therefore, embryo samples were tested only for informative markers.

[0026] Alleles matching in the child with the disease and in the parent, a carrier of the pathogenic variant NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) in the VPS13B gene were recognized as linked to each other and to the pathogenic variant. Alleles that did not match in the parent and child with the disease were recognized as linked to each other and to the normal allele of the gene. The results obtained for the informative markers are presented in Table 1. Alleles listed on the same line are located on the same chromosome, that is, they represent a linkage group. Thus, for each family member, two linkage groups are presented, corresponding to each of the two human chromosomes. Variant NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) in the VPS13B gene is designated in the table as VPS13B c.3445G>C. N in the table denotes the absence of a pathogenic variant, mut denotes the presence of the pathogenic variant NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) in the VPS13B gene.The numbers represent the lengths of the amplicons in nucleotide pairs; their lengths depend on the number of repeats in the STR marker.

[0027]

[0028] As a result of haplotyping, it was concluded that the patient's partner and the patient with a pathogenic variant had linked the following STR marker alleles: D8S9934 - 122, D8S9935 - 144, D8S9938 - 302, D8S9998 - 177, D8S1002 - 229, D8S1004 -258, D8S1006.4 - 282, D8S1006.6 - 248, D8S1010 - 290, D8S1014 - 289, D8S1015 - 260, D8S1017 - 177. The patient with a pathogenic variant had linked the following STR marker alleles: D8S9934 - 122, D8S9935 - 144, D8S9938 - 302, D8S9998 - 177, D8S1002 - 225, D8S1004 - 258, D8S1006.4 - 282, D8S1006.6 - 248, D8S1010 - 290, D8S1014 - 289, D8S1015-260, D8S1017-177.

[0029] Preimplantation genetic testing

[0030] Nine embryos were obtained in an IVF cycle. A biopsy was performed on day 5 of development (at the IVF clinic). The biopsy specimen in WGA buffer (1×PBS (Invitrogen, USA), 1% polyvinylpyrrolidone (PVP) (Fertipro, Belgium)) was sent to the Genetico laboratory. To monitor for contamination at various stages of sample processing, the laboratory has developed a system of controls: a contamination control for the biopsy buffer, a contamination control during transportation (one tube with the buffer is not opened by the embryologist), and a contamination control for each sample (a sample of the medium from the last wash drop of the biopsy material). All of these controls, along with the samples, undergo whole-genome amplification, after which the slightest amount of DNA contaminating the controls will be visible. Whole genome amplification was performed using the commercial SurePlex kit (Illumina, USA).

[0031] The whole-genome amplification product, as well as DNA from all family members, was amplified in step 1 using multiplex PCR with primers for detecting the pathogenic variant and primers for polymorphic markers informative for family A, in accordance with the test system protocol developed during the preparatory phase. In step 2, amplification was performed for each marker separately, according to the developed test system protocol. This allowed us to determine the linkage groups inherited by each embryo. The results are presented in Table 2.

[0032]

[0033] Based on the results of direct and indirect diagnostics, 6 embryos (embryos 1, 2, 3, 5, 6 and 7) did not inherit the disease, while all of them were carriers of the pathogenic variant NC_000008.10:100454863G>C (NM_017890.4:c.3445G>C, p.Gly1149Arg) in the VPS13B gene, having inherited it either from the patient (embryo 2) or from her partner (embryos 1, 3, 5, 6 and 7). In 3 embryos (embryos 4, 8 and 9), a haplotype corresponding to the inherited disease was detected. Based on the results of PGT-M, 6 embryos (embryos 1, 2, 3, 5, 6 and 7) were recommended for transfer.

[0034] --->

[0035] <?xml version="1.0" encoding="UTF-8"?>

[0036] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0037] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0038] <ST26SequenceListing dtdVersion="V1_3" fileName="Способ

[0039] преимплантационного генетического тестирования синдрома Коэна.xml"

[0040] softwareName="WIPO Sequence" softwareVersion="2.3.0"

[0041] productionDate="2026-03-31">

[0042] <applicationidentification>

[0043] <ipofficecode>RU< / ipofficecode>

[0044] <applicationnumbertext> 2025105785< / applicationnumbertext>

[0045] <filingdate> 2025-03-12< / filingdate>

[0046] < / applicationidentification>

[0047] <applicantfilereference> 2025105785< / applicantfilereference>

[0048] <applicantname languagecode="ru">Public joint-stock company

[0049] “Center of Genetics and Reproductive Medicine “GENETIKO”< / applicantname>

[0050] <applicantnamelatin> GENETICS PJSC< / applicantnamelatin>

[0051] <inventiontitle languagecode="ru">Preimplantation method

[0052] Cohen syndrome genetic testing< / inventiontitle>

[0053] <sequencetotalquantity> 47< / sequencetotalquantity>

[0054] <sequencedata sequenceidnumber="1">

[0055] <insdseq>

[0056] <INSDSeq_length> 19< / INSDSeq_length>

[0057] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0058] <INSDSeq_division> PAT< / INSDSeq_division>

[0059] <INSDSeq_feature-table>

[0060] <insdfeature>

[0061] <INSDFeature_key>source< / INSDFeature_key>

[0062] <INSDFeature_location>1..19< / INSDFeature_location>

[0063] <INSDFeature_quals>

[0064] <insdqualifier>

[0065] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0066] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0067] < / insdqualifier>

[0068] <insdqualifier id="q2">

[0069] <INSDQualifier_name>organism< / INSDQualifier_name>

[0070] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0071] < / insdqualifier>

[0072] < / INSDFeature_quals>

[0073] < / insdfeature>

[0074] < / INSDSeq_feature-table>

[0075] <INSDSeq_sequence> ggaaggggagggtattgta< / INSDSeq_sequence>

[0076] < / insdseq>

[0077] < / sequencedata>

[0078] <sequencedata sequenceidnumber="2">

[0079] <insdseq>

[0080] <INSDSeq_length>19< / INSDSeq_length>

[0081] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0082] <INSDSeq_division>PAT< / INSDSeq_division>

[0083] <INSDSeq_feature-table>

[0084] <insdfeature>

[0085] <INSDFeature_key>source< / INSDFeature_key>

[0086] <INSDFeature_location>1..19< / INSDFeature_location>

[0087] <INSDFeature_quals>

[0088] <insdqualifier>

[0089] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0090] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0091] < / insdqualifier>

[0092] <insdqualifier id="q4">

[0093] <INSDQualifier_name>organism< / INSDQualifier_name>

[0094] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0095] < / insdqualifier>

[0096] < / INSDFeature_quals>

[0097] < / insdfeature>

[0098] < / INSDSeq_feature-table>

[0099] <INSDSeq_sequence>ccccacaagctacactcag< / INSDSeq_sequence>

[0100] < / insdseq>

[0101] < / sequencedata>

[0102] <sequencedata sequenceidnumber="3">

[0103] <insdseq>

[0104] <INSDSeq_length>21< / INSDSeq_length>

[0105] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0106] <INSDSeq_division>PAT< / INSDSeq_division>

[0107] <INSDSeq_feature-table>

[0108] <insdfeature>

[0109] <INSDFeature_key>source< / INSDFeature_key>

[0110] <INSDFeature_location>1..21< / INSDFeature_location>

[0111] <INSDFeature_quals>

[0112] <insdqualifier>

[0113] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0114] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0115] < / insdqualifier>

[0116] <insdqualifier id="q6">

[0117] <INSDQualifier_name>organism< / INSDQualifier_name>

[0118] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0119] < / insdqualifier>

[0120] < / INSDFeature_quals>

[0121] < / insdfeature>

[0122] < / INSDSeq_feature-table>

[0123] <INSDSeq_sequence>ctttgaccattttcctgatct< / INSDSeq_sequence>

[0124] < / insdseq>

[0125] < / sequencedata>

[0126] <sequencedata sequenceidnumber="4">

[0127] <insdseq>

[0128] <INSDSeq_length> 21< / INSDSeq_length>

[0129] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0130] <INSDSeq_division> PAT< / INSDSeq_division>

[0131] <INSDSeq_feature-table>

[0132] <insdfeature>

[0133] <INSDFeature_key>source< / INSDFeature_key>

[0134] <INSDFeature_location>1..21< / INSDFeature_location>

[0135] <INSDFeature_quals>

[0136] <insdqualifier>

[0137] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0138] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0139] < / insdqualifier>

[0140] <insdqualifier id="q8">

[0141] <INSDQualifier_name>organism< / INSDQualifier_name>

[0142] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0143] < / insdqualifier>

[0144] < / INSDFeature_quals>

[0145] < / insdfeature>

[0146] < / INSDSeq_feature-table>

[0147] <INSDSeq_sequence> gcagtaatggcaggtttagag< / INSDSeq_sequence>

[0148] < / insdseq>

[0149] < / sequencedata>

[0150] <sequencedata sequenceidnumber="5">

[0151] <insdseq>

[0152] <INSDSeq_length> 20< / INSDSeq_length>

[0153] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0154] <INSDSeq_division> PAT< / INSDSeq_division>

[0155] <INSDSeq_feature-table>

[0156] <insdfeature>

[0157] <INSDFeature_key>source< / INSDFeature_key>

[0158] <INSDFeature_location>1..20< / INSDFeature_location>

[0159] <INSDFeature_quals>

[0160] <insdqualifier>

[0161] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0162] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0163] < / insdqualifier>

[0164] <insdqualifier id="q10">

[0165] <INSDQualifier_name>organism< / INSDQualifier_name>

[0166] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0167] < / insdqualifier>

[0168] < / INSDFeature_quals>

[0169] < / insdfeature>

[0170] < / INSDSeq_feature-table>

[0171] <INSDSeq_sequence> cactagatgaccccctccta< / INSDSeq_sequence>

[0172] < / insdseq>

[0173] < / sequencedata>

[0174] <sequencedata sequenceidnumber="6">

[0175] <insdseq>

[0176] <INSDSeq_length>21< / INSDSeq_length>

[0177] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0178] <INSDSeq_division>PAT< / INSDSeq_division>

[0179] <INSDSeq_feature-table>

[0180] <insdfeature>

[0181] <INSDFeature_key>source< / INSDFeature_key>

[0182] <INSDFeature_location>1..21< / INSDFeature_location>

[0183] <INSDFeature_quals>

[0184] <insdqualifier>

[0185] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0186] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0187] < / insdqualifier>

[0188] <insdqualifier id="q12">

[0189] <INSDQualifier_name>organism< / INSDQualifier_name>

[0190] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0191] < / insdqualifier>

[0192] < / INSDFeature_quals>

[0193] < / insdfeature>

[0194] < / INSDSeq_feature-table>

[0195] <INSDSeq_sequence>cccctctatttgctatcactg< / INSDSeq_sequence>

[0196] < / insdseq>

[0197] < / sequencedata>

[0198] <sequencedata sequenceidnumber="7">

[0199] <insdseq>

[0200] <INSDSeq_length> 18< / INSDSeq_length>

[0201] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0202] <INSDSeq_division> PAT< / INSDSeq_division>

[0203] <INSDSeq_feature-table>

[0204] <insdfeature>

[0205] <INSDFeature_key>source< / INSDFeature_key>

[0206] <INSDFeature_location>1..18< / INSDFeature_location>

[0207] <INSDFeature_quals>

[0208] <insdqualifier>

[0209] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0210] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0211] < / insdqualifier>

[0212] <insdqualifier id="q14">

[0213] <INSDQualifier_name>organism< / INSDQualifier_name>

[0214] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0215] < / insdqualifier>

[0216] < / INSDFeature_quals>

[0217] < / insdfeature>

[0218] < / INSDSeq_feature-table>

[0219] <INSDSeq_sequence> ctctaaggcccatcaagc< / INSDSeq_sequence>

[0220] < / insdseq>

[0221] < / sequencedata>

[0222] <sequencedata sequenceidnumber="8">

[0223] <insdseq>

[0224] <INSDSeq_length>20< / INSDSeq_length>

[0225] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0226] <INSDSeq_division>PAT< / INSDSeq_division>

[0227] <INSDSeq_feature-table>

[0228] <insdfeature>

[0229] <INSDFeature_key>source< / INSDFeature_key>

[0230] <INSDFeature_location>1..20< / INSDFeature_location>

[0231] <INSDFeature_quals>

[0232] <insdqualifier>

[0233] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0234] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0235] < / insdqualifier>

[0236] <insdqualifier id="q16">

[0237] <INSDQualifier_name>organism< / INSDQualifier_name>

[0238] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0239] < / insdqualifier>

[0240] < / INSDFeature_quals>

[0241] < / insdfeature>

[0242] < / INSDSeq_feature-table>

[0243] <INSDSeq_sequence>cccagtcatttcattatgca< / INSDSeq_sequence>

[0244] < / insdseq>

[0245] < / sequencedata>

[0246] <sequencedata sequenceidnumber="9">

[0247] <insdseq>

[0248] <INSDSeq_length> 19< / INSDSeq_length>

[0249] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0250] <INSDSeq_division> PAT< / INSDSeq_division>

[0251] <INSDSeq_feature-table>

[0252] <insdfeature>

[0253] <INSDFeature_key>source< / INSDFeature_key>

[0254] <INSDFeature_location>1..19< / INSDFeature_location>

[0255] <INSDFeature_quals>

[0256] <insdqualifier>

[0257] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0258] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0259] < / insdqualifier>

[0260] <insdqualifier id="q18">

[0261] <INSDQualifier_name>organism< / INSDQualifier_name>

[0262] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0263] < / insdqualifier>

[0264] < / INSDFeature_quals>

[0265] < / insdfeature>

[0266] < / INSDSeq_feature-table>

[0267] <INSDSeq_sequence> caagccctctcccctacacc< / INSDSeq_sequence>

[0268] < / insdseq>

[0269] < / sequencedata>

[0270] <sequencedata sequenceidnumber="10">

[0271] <insdseq>

[0272] <INSDSeq_length> 19< / INSDSeq_length>

[0273] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0274] <INSDSeq_division> PAT< / INSDSeq_division>

[0275] <INSDSeq_feature-table>

[0276] <insdfeature>

[0277] <INSDFeature_key>source< / INSDFeature_key>

[0278] <INSDFeature_location>1..19< / INSDFeature_location>

[0279] <INSDFeature_quals>

[0280] <insdqualifier>

[0281] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0282] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0283] < / insdqualifier>

[0284] <insdqualifier id="q20">

[0285] <INSDQualifier_name>organism< / INSDQualifier_name>

[0286] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0287] < / insdqualifier>

[0288] < / INSDFeature_quals>

[0289] < / insdfeature>

[0290] < / INSDSeq_feature-table>

[0291] <INSDSeq_sequence> gccttggacgctactctt< / INSDSeq_sequence>

[0292] < / insdseq>

[0293] < / sequencedata>

[0294] <sequencedata sequenceidnumber="11">

[0295] <insdseq>

[0296] <INSDSeq_length>23< / INSDSeq_length>

[0297] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0298] <INSDSeq_division>PAT< / INSDSeq_division>

[0299] <INSDSeq_feature-table>

[0300] <insdfeature>

[0301] <INSDFeature_key>source< / INSDFeature_key>

[0302] <INSDFeature_location>1..23< / INSDFeature_location>

[0303] <INSDFeature_quals>

[0304] <insdqualifier>

[0305] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0306] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0307] < / insdqualifier>

[0308] <insdqualifier id="q22">

[0309] <INSDQualifier_name>organism< / INSDQualifier_name>

[0310] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0311] < / insdqualifier>

[0312] < / INSDFeature_quals>

[0313] < / insdfeature>

[0314] < / INSDSeq_feature-table>

[0315] <INSDSeq_sequence>caaactttacgaatgtgtctgtc< / INSDSeq_sequence>

[0316] < / insdseq>

[0317] < / sequencedata>

[0318] <sequencedata sequenceidnumber="12">

[0319] <insdseq>

[0320] <INSDSeq_length> 21< / INSDSeq_length>

[0321] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0322] <INSDSeq_division> PAT< / INSDSeq_division>

[0323] <INSDSeq_feature-table>

[0324] <insdfeature>

[0325] <INSDFeature_key>source< / INSDFeature_key>

[0326] <INSDFeature_location>1..21< / INSDFeature_location>

[0327] <INSDFeature_quals>

[0328] <insdqualifier>

[0329] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0330] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0331] < / insdqualifier>

[0332] <insdqualifier id="q24">

[0333] <INSDQualifier_name>organism< / INSDQualifier_name>

[0334] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0335] < / insdqualifier>

[0336] < / INSDFeature_quals>

[0337] < / insdfeature>

[0338] < / INSDSeq_feature-table>

[0339] <INSDSeq_sequence> cctttaagtgcctatgtcagc< / INSDSeq_sequence>

[0340] < / insdseq>

[0341] < / sequencedata>

[0342] <sequencedata sequenceidnumber="13">

[0343] <insdseq>

[0344] <INSDSeq_length> 22< / INSDSeq_length>

[0345] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0346] <INSDSeq_division> PAT< / INSDSeq_division>

[0347] <INSDSeq_feature-table>

[0348] <insdfeature>

[0349] <INSDFeature_key>source< / INSDFeature_key>

[0350] <INSDFeature_location>1..22< / INSDFeature_location>

[0351] <INSDFeature_quals>

[0352] <insdqualifier>

[0353] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0354] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0355] < / insdqualifier>

[0356] <insdqualifier id="q26">

[0357] <INSDQualifier_name>organism< / INSDQualifier_name>

[0358] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0359] < / insdqualifier>

[0360] < / INSDFeature_quals>

[0361] < / insdfeature>

[0362] < / INSDSeq_feature-table>

[0363] <INSDSeq_sequence> ctgggataattctgttgacctt< / INSDSeq_sequence>

[0364] < / insdseq>

[0365] < / sequencedata>

[0366] <sequencedata sequenceidnumber="14">

[0367] <insdseq>

[0368] <INSDSeq_length> 18< / INSDSeq_length>

[0369] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0370] <INSDSeq_division> PAT< / INSDSeq_division>

[0371] <INSDSeq_feature-table>

[0372] <insdfeature>

[0373] <INSDFeature_key>source< / INSDFeature_key>

[0374] <INSDFeature_location>1..18< / INSDFeature_location>

[0375] <INSDFeature_quals>

[0376] <insdqualifier>

[0377] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0378] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0379] < / insdqualifier>

[0380] <insdqualifier id="q28">

[0381] <INSDQualifier_name>organism< / INSDQualifier_name>

[0382] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0383] < / insdqualifier>

[0384] < / INSDFeature_quals>

[0385] < / insdfeature>

[0386] < / INSDSeq_feature-table>

[0387] <INSDSeq_sequence> ctttggtgaggcttggaa< / INSDSeq_sequence>

[0388] < / insdseq>

[0389] < / sequencedata>

[0390] <sequencedata sequenceidnumber="15">

[0391] <insdseq>

[0392] <INSDSeq_length>23< / INSDSeq_length>

[0393] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0394] <INSDSeq_division>PAT< / INSDSeq_division>

[0395] <INSDSeq_feature-table>

[0396] <insdfeature>

[0397] <INSDFeature_key>source< / INSDFeature_key>

[0398] <INSDFeature_location>1..23< / INSDFeature_location>

[0399] <INSDFeature_quals>

[0400] <insdqualifier>

[0401] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0402] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0403] < / insdqualifier>

[0404] <insdqualifier id="q30">

[0405] <INSDQualifier_name>organism< / INSDQualifier_name>

[0406] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0407] < / insdqualifier>

[0408] < / INSDFeature_quals>

[0409] < / insdfeature>

[0410] < / INSDSeq_feature-table>

[0411] <INSDSeq_sequence>tgtagattaggtgttgctttagg< / INSDSeq_sequence>

[0412] < / insdseq>

[0413] < / sequencedata>

[0414] <sequencedata sequenceidnumber="16">

[0415] <insdseq>

[0416] <INSDSeq_length> 20< / INSDSeq_length>

[0417] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0418] <INSDSeq_division> PAT< / INSDSeq_division>

[0419] <INSDSeq_feature-table>

[0420] <insdfeature>

[0421] <INSDFeature_key>source< / INSDFeature_key>

[0422] <INSDFeature_location>1..20< / INSDFeature_location>

[0423] <INSDFeature_quals>

[0424] <insdqualifier>

[0425] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0426] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0427] < / insdqualifier>

[0428] <insdqualifier id="q32">

[0429] <INSDQualifier_name>organism< / INSDQualifier_name>

[0430] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0431] < / insdqualifier>

[0432] < / INSDFeature_quals>

[0433] < / insdfeature>

[0434] < / INSDSeq_feature-table>

[0435] <INSDSeq_sequence> gcttggaaactctcatgtgt< / INSDSeq_sequence>

[0436] < / insdseq>

[0437] < / sequencedata>

[0438] <sequencedata sequenceidnumber="17">

[0439] <insdseq>

[0440] <INSDSeq_length> 20< / INSDSeq_length>

[0441] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0442] <INSDSeq_division> PAT< / INSDSeq_division>

[0443] <INSDSeq_feature-table>

[0444] <insdfeature>

[0445] <INSDFeature_key>source< / INSDFeature_key>

[0446] <INSDFeature_location>1..20< / INSDFeature_location>

[0447] <INSDFeature_quals>

[0448] <insdqualifier>

[0449] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0450] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0451] < / insdqualifier>

[0452] <insdqualifier id="q34">

[0453] <INSDQualifier_name>organism< / INSDQualifier_name>

[0454] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0455] < / insdqualifier>

[0456] < / INSDFeature_quals>

[0457] < / insdfeature>

[0458] < / INSDSeq_feature-table>

[0459] <INSDSeq_sequence> gccaacatctactgcttgtc< / INSDSeq_sequence>

[0460] < / insdseq>

[0461] < / sequencedata>

[0462] <sequencedata sequenceidnumber="18">

[0463] <insdseq>

[0464] <INSDSeq_length> 22< / INSDSeq_length>

[0465] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0466] <INSDSeq_division> PAT< / INSDSeq_division>

[0467] <INSDSeq_feature-table>

[0468] <insdfeature>

[0469] <INSDFeature_key>source< / INSDFeature_key>

[0470] <INSDFeature_location>1..22< / INSDFeature_location>

[0471] <INSDFeature_quals>

[0472] <insdqualifier>

[0473] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0474] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0475] < / insdqualifier>

[0476] <insdqualifier id="q36">

[0477] <INSDQualifier_name>organism< / INSDQualifier_name>

[0478] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0479] < / insdqualifier>

[0480] < / INSDFeature_quals>

[0481] < / insdfeature>

[0482] < / INSDSeq_feature-table>

[0483] <INSDSeq_sequence> agagtgtttggtcaatgaga< / INSDSeq_sequence>

[0484] < / insdseq>

[0485] < / sequencedata>

[0486] <sequencedata sequenceidnumber="19">

[0487] <insdseq>

[0488] <INSDSeq_length> 18< / INSDSeq_length>

[0489] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0490] <INSDSeq_division> PAT< / INSDSeq_division>

[0491] <INSDSeq_feature-table>

[0492] <insdfeature>

[0493] <INSDFeature_key>source< / INSDFeature_key>

[0494] <INSDFeature_location>1..18< / INSDFeature_location>

[0495] <INSDFeature_quals>

[0496] <insdqualifier>

[0497] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0498] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0499] < / insdqualifier>

[0500] <insdqualifier id="q38">

[0501] <INSDQualifier_name>organism< / INSDQualifier_name>

[0502] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0503] < / insdqualifier>

[0504] < / INSDFeature_quals>

[0505] < / insdfeature>

[0506] < / INSDSeq_feature-table>

[0507] <INSDSeq_sequence> gattcaagccctctccat< / INSDSeq_sequence>

[0508] < / insdseq>

[0509] < / sequencedata>

[0510] <sequencedata sequenceidnumber="20">

[0511] <insdseq>

[0512] <INSDSeq_length> 23< / INSDSeq_length>

[0513] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0514] <INSDSeq_division> PAT< / INSDSeq_division>

[0515] <INSDSeq_feature-table>

[0516] <insdfeature>

[0517] <INSDFeature_key>source< / INSDFeature_key>

[0518] <INSDFeature_location>1..23< / INSDFeature_location>

[0519] <INSDFeature_quals>

[0520] <insdqualifier>

[0521] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0522] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0523] < / insdqualifier>

[0524] <insdqualifier id="q40">

[0525] <INSDQualifier_name>organism< / INSDQualifier_name>

[0526] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0527] < / insdqualifier>

[0528] < / INSDFeature_quals>

[0529] < / insdfeature>

[0530] < / INSDSeq_feature-table>

[0531] <INSDSeq_sequence> aaaacagactccaacctcagacac< / INSDSeq_sequence>

[0532] < / insdseq>

[0533] < / sequencedata>

[0534] <sequencedata sequenceidnumber="21">

[0535] <insdseq>

[0536] <INSDSeq_length> 22< / INSDSeq_length>

[0537] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0538] <INSDSeq_division> PAT< / INSDSeq_division>

[0539] <INSDSeq_feature-table>

[0540] <insdfeature>

[0541] <INSDFeature_key>source< / INSDFeature_key>

[0542] <INSDFeature_location>1..22< / INSDFeature_location>

[0543] <INSDFeature_quals>

[0544] <insdqualifier>

[0545] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0546] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0547] < / insdqualifier>

[0548] <insdqualifier id="q42">

[0549] <INSDQualifier_name>organism< / INSDQualifier_name>

[0550] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0551] < / insdqualifier>

[0552] < / INSDFeature_quals>

[0553] < / insdfeature>

[0554] < / INSDSeq_feature-table>

[0555] <INSDSeq_sequence> agttctcattctgttccgt< / INSDSeq_sequence>

[0556] < / insdseq>

[0557] < / sequencedata>

[0558] <sequencedata sequenceidnumber="22">

[0559] <insdseq>

[0560] <INSDSeq_length> 23< / INSDSeq_length>

[0561] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0562] <INSDSeq_division> PAT< / INSDSeq_division>

[0563] <INSDSeq_feature-table>

[0564] <insdfeature>

[0565] <INSDFeature_key>source< / INSDFeature_key>

[0566] <INSDFeature_location>1..23< / INSDFeature_location>

[0567] <INSDFeature_quals>

[0568] <insdqualifier>

[0569] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0570] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0571] < / insdqualifier>

[0572] <insdqualifier id="q44">

[0573] <INSDQualifier_name>organism< / INSDQualifier_name>

[0574] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0575] < / insdqualifier>

[0576] < / INSDFeature_quals>

[0577] < / insdfeature>

[0578] < / INSDSeq_feature-table>

[0579] <INSDSeq_sequence> aagcaggttgtgtgtttcttatgtgt< / INSDSeq_sequence>

[0580] < / insdseq>

[0581] < / sequencedata>

[0582] <sequencedata sequenceidnumber="23">

[0583] <insdseq>

[0584] <INSDSeq_length> 20< / INSDSeq_length>

[0585] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0586] <INSDSeq_division> PAT< / INSDSeq_division>

[0587] <INSDSeq_feature-table>

[0588] <insdfeature>

[0589] <INSDFeature_key>source< / INSDFeature_key>

[0590] <INSDFeature_location>1..20< / INSDFeature_location>

[0591] <INSDFeature_quals>

[0592] <insdqualifier>

[0593] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0594] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0595] < / insdqualifier>

[0596] <insdqualifier id="q46">

[0597] <INSDQualifier_name>organism< / INSDQualifier_name>

[0598] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0599] < / insdqualifier>

[0600] < / INSDFeature_quals>

[0601] < / insdfeature>

[0602] < / INSDSeq_feature-table>

[0603] <INSDSeq_sequence> ccagatggtcaggtcctcta< / INSDSeq_sequence>

[0604] < / insdseq>

[0605] < / sequencedata>

[0606] <sequencedata sequenceidnumber="24">

[0607] <insdseq>

[0608] <INSDSeq_length> 25< / INSDSeq_length>

[0609] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0610] <INSDSeq_division> PAT< / INSDSeq_division>

[0611] <INSDSeq_feature-table>

[0612] <insdfeature>

[0613] <INSDFeature_key>source< / INSDFeature_key>

[0614] <INSDFeature_location>1..25< / INSDFeature_location>

[0615] <INSDFeature_quals>

[0616] <insdqualifier>

[0617] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0618] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0619] < / insdqualifier>

[0620] <insdqualifier id="q48">

[0621] <INSDQualifier_name>organism< / INSDQualifier_name>

[0622] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0623] < / insdqualifier>

[0624] < / INSDFeature_quals>

[0625] < / insdfeature>

[0626] < / INSDSeq_feature-table>

[0627] <INSDSeq_sequence> ggacacagattcagtaaattcaaat< / INSDSeq_sequence>

[0628] < / insdseq>

[0629] < / sequencedata>

[0630] <sequencedata sequenceidnumber="25">

[0631] <insdseq>

[0632] <INSDSeq_length> 19< / INSDSeq_length>

[0633] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0634] <INSDSeq_division> PAT< / INSDSeq_division>

[0635] <INSDSeq_feature-table>

[0636] <insdfeature>

[0637] <INSDFeature_key>source< / INSDFeature_key>

[0638] <INSDFeature_location>1..19< / INSDFeature_location>

[0639] <INSDFeature_quals>

[0640] <insdqualifier>

[0641] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0642] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0643] < / insdqualifier>

[0644] <insdqualifier id="q50">

[0645] <INSDQualifier_name>organism< / INSDQualifier_name>

[0646] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0647] < / insdqualifier>

[0648] < / INSDFeature_quals>

[0649] < / insdfeature>

[0650] < / INSDSeq_feature-table>

[0651] <INSDSeq_sequence> tgagaggaggggcatcaaat< / INSDSeq_sequence>

[0652] < / insdseq>

[0653] < / sequencedata>

[0654] <sequencedata sequenceidnumber="26">

[0655] <insdseq>

[0656] <INSDSeq_length> 21< / INSDSeq_length>

[0657] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0658] <INSDSeq_division> PAT< / INSDSeq_division>

[0659] <INSDSeq_feature-table>

[0660] <insdfeature>

[0661] <INSDFeature_key>source< / INSDFeature_key>

[0662] <INSDFeature_location>1..21< / INSDFeature_location>

[0663] <INSDFeature_quals>

[0664] <insdqualifier>

[0665] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0666] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0667] < / insdqualifier>

[0668] <insdqualifier id="q52">

[0669] <INSDQualifier_name>organism< / INSDQualifier_name>

[0670] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0671] < / insdqualifier>

[0672] < / INSDFeature_quals>

[0673] < / insdfeature>

[0674] < / INSDSeq_feature-table>

[0675] <INSDSeq_sequence> tggtatttgcagggtagtcac< / INSDSeq_sequence>

[0676] < / insdseq>

[0677] < / sequencedata>

[0678] <sequencedata sequenceidnumber="27">

[0679] <insdseq>

[0680] <INSDSeq_length>21< / INSDSeq_length>

[0681] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0682] <INSDSeq_division>PAT< / INSDSeq_division>

[0683] <INSDSeq_feature-table>

[0684] <insdfeature>

[0685] <INSDFeature_key>source< / INSDFeature_key>

[0686] <INSDFeature_location>1..21< / INSDFeature_location>

[0687] <INSDFeature_quals>

[0688] <insdqualifier>

[0689] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0690] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0691] < / insdqualifier>

[0692] <insdqualifier id="q54">

[0693] <INSDQualifier_name>organism< / INSDQualifier_name>

[0694] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0695] < / insdqualifier>

[0696] < / INSDFeature_quals>

[0697] < / insdfeature>

[0698] < / INSDSeq_feature-table>

[0699] <INSDSeq_sequence>cagtgtttgtatttgcccagt< / INSDSeq_sequence>

[0700] < / insdseq>

[0701] < / sequencedata>

[0702] <sequencedata sequenceidnumber="28">

[0703] <insdseq>

[0704] <INSDSeq_length> 22< / INSDSeq_length>

[0705] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0706] <INSDSeq_division> PAT< / INSDSeq_division>

[0707] <INSDSeq_feature-table>

[0708] <insdfeature>

[0709] <INSDFeature_key>source< / INSDFeature_key>

[0710] <INSDFeature_location>1..22< / INSDFeature_location>

[0711] <INSDFeature_quals>

[0712] <insdqualifier>

[0713] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0714] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0715] < / insdqualifier>

[0716] <insdqualifier id="q56">

[0717] <INSDQualifier_name>organism< / INSDQualifier_name>

[0718] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0719] < / insdqualifier>

[0720] < / INSDFeature_quals>

[0721] < / insdfeature>

[0722] < / INSDSeq_feature-table>

[0723] <INSDSeq_sequence> ctggaaaaatatgcctcaatt< / INSDSeq_sequence>

[0724] < / insdseq>

[0725] < / sequencedata>

[0726] <sequencedata sequenceidnumber="29">

[0727] <insdseq>

[0728] <INSDSeq_length>20< / INSDSeq_length>

[0729] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0730] <INSDSeq_division>PAT< / INSDSeq_division>

[0731] <INSDSeq_feature-table>

[0732] <insdfeature>

[0733] <INSDFeature_key>source< / INSDFeature_key>

[0734] <INSDFeature_location>1..20< / INSDFeature_location>

[0735] <INSDFeature_quals>

[0736] <insdqualifier>

[0737] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0738] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0739] < / insdqualifier>

[0740] <insdqualifier id="q58">

[0741] <INSDQualifier_name>organism< / INSDQualifier_name>

[0742] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0743] < / insdqualifier>

[0744] < / INSDFeature_quals>

[0745] < / insdfeature>

[0746] < / INSDSeq_feature-table>

[0747] <INSDSeq_sequence>ccccttggatcagtaagtgt< / INSDSeq_sequence>

[0748] < / insdseq>

[0749] < / sequencedata>

[0750] <sequencedata sequenceidnumber="30">

[0751] <insdseq>

[0752] <INSDSeq_length> 22< / INSDSeq_length>

[0753] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0754] <INSDSeq_division> PAT< / INSDSeq_division>

[0755] <INSDSeq_feature-table>

[0756] <insdfeature>

[0757] <INSDFeature_key>source< / INSDFeature_key>

[0758] <INSDFeature_location>1..22< / INSDFeature_location>

[0759] <INSDFeature_quals>

[0760] <insdqualifier>

[0761] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0762] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0763] < / insdqualifier>

[0764] <insdqualifier id="q60">

[0765] <INSDQualifier_name>organism< / INSDQualifier_name>

[0766] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0767] < / insdqualifier>

[0768] < / INSDFeature_quals>

[0769] < / insdfeature>

[0770] < / INSDSeq_feature-table>

[0771] <INSDSeq_sequence> tttggggaaactcttagtcct< / INSDSeq_sequence>

[0772] < / insdseq>

[0773] < / sequencedata>

[0774] <sequencedata sequenceidnumber="31">

[0775] <insdseq>

[0776] <INSDSeq_length>22< / INSDSeq_length>

[0777] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0778] <INSDSeq_division>PAT< / INSDSeq_division>

[0779] <INSDSeq_feature-table>

[0780] <insdfeature>

[0781] <INSDFeature_key>source< / INSDFeature_key>

[0782] <INSDFeature_location>1..22< / INSDFeature_location>

[0783] <INSDFeature_quals>

[0784] <insdqualifier>

[0785] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0786] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0787] < / insdqualifier>

[0788] <insdqualifier id="q62">

[0789] <INSDQualifier_name>organism< / INSDQualifier_name>

[0790] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0791] < / insdqualifier>

[0792] < / INSDFeature_quals>

[0793] < / insdfeature>

[0794] < / INSDSeq_feature-table>

[0795] <INSDSeq_sequence>gactgtggactgacattcatct< / INSDSeq_sequence>

[0796] < / insdseq>

[0797] < / sequencedata>

[0798] <sequencedata sequenceidnumber="32">

[0799] <insdseq>

[0800] <INSDSeq_length>22< / INSDSeq_length>

[0801] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0802] <INSDSeq_division>PAT< / INSDSeq_division>

[0803] <INSDSeq_feature-table>

[0804] <insdfeature>

[0805] <INSDFeature_key>source< / INSDFeature_key>

[0806] <INSDFeature_location>1..22< / INSDFeature_location>

[0807] <INSDFeature_quals>

[0808] <insdqualifier>

[0809] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0810] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0811] < / insdqualifier>

[0812] <insdqualifier id="q64">

[0813] <INSDQualifier_name>organism< / INSDQualifier_name>

[0814] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0815] < / insdqualifier>

[0816] < / INSDFeature_quals>

[0817] < / insdfeature>

[0818] < / INSDSeq_feature-table>

[0819] <INSDSeq_sequence>gacatctgagcacttgaaaatt< / INSDSeq_sequence>

[0820] < / insdseq>

[0821] < / sequencedata>

[0822] <sequencedata sequenceidnumber="33">

[0823] <insdseq>

[0824] <INSDSeq_length> 21< / INSDSeq_length>

[0825] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0826] <INSDSeq_division> PAT< / INSDSeq_division>

[0827] <INSDSeq_feature-table>

[0828] <insdfeature>

[0829] <INSDFeature_key>source< / INSDFeature_key>

[0830] <INSDFeature_location>1..21< / INSDFeature_location>

[0831] <INSDFeature_quals>

[0832] <insdqualifier>

[0833] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0834] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0835] < / insdqualifier>

[0836] <insdqualifier id="q66">

[0837] <INSDQualifier_name>organism< / INSDQualifier_name>

[0838] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0839] < / insdqualifier>

[0840] < / INSDFeature_quals>

[0841] < / insdfeature>

[0842] < / INSDSeq_feature-table>

[0843] <INSDSeq_sequence> tgcaaggcaatgtctacagta< / INSDSeq_sequence>

[0844] < / insdseq>

[0845] < / sequencedata>

[0846] <sequencedata sequenceidnumber="34">

[0847] <insdseq>

[0848] <INSDSeq_length> 20< / INSDSeq_length>

[0849] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0850] <INSDSeq_division> PAT< / INSDSeq_division>

[0851] <INSDSeq_feature-table>

[0852] <insdfeature>

[0853] <INSDFeature_key>source< / INSDFeature_key>

[0854] <INSDFeature_location>1..20< / INSDFeature_location>

[0855] <INSDFeature_quals>

[0856] <insdqualifier>

[0857] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0858] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0859] < / insdqualifier>

[0860] <insdqualifier id="q68">

[0861] <INSDQualifier_name>organism< / INSDQualifier_name>

[0862] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0863] < / insdqualifier>

[0864] < / INSDFeature_quals>

[0865] < / insdfeature>

[0866] < / INSDSeq_feature-table>

[0867] <INSDSeq_sequence> gttttggagcctgagatctc< / INSDSeq_sequence>

[0868] < / insdseq>

[0869] < / sequencedata>

[0870] <sequencedata sequenceidnumber="35">

[0871] <insdseq>

[0872] <INSDSeq_length> 21< / INSDSeq_length>

[0873] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0874] <INSDSeq_division> PAT< / INSDSeq_division>

[0875] <INSDSeq_feature-table>

[0876] <insdfeature>

[0877] <INSDFeature_key>source< / INSDFeature_key>

[0878] <INSDFeature_location>1..21< / INSDFeature_location>

[0879] <INSDFeature_quals>

[0880] <insdqualifier>

[0881] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0882] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0883] < / insdqualifier>

[0884] <insdqualifier id="q70">

[0885] <INSDQualifier_name>organism< / INSDQualifier_name>

[0886] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0887] < / insdqualifier>

[0888] < / INSDFeature_quals>

[0889] < / insdfeature>

[0890] < / INSDSeq_feature-table>

[0891] <INSDSeq_sequence> tgcaaggcaatgtctacagta< / INSDSeq_sequence>

[0892] < / insdseq>

[0893] < / sequencedata>

[0894] <sequencedata sequenceidnumber="36">

[0895] <insdseq>

[0896] <INSDSeq_length> 18< / INSDSeq_length>

[0897] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0898] <INSDSeq_division> PAT< / INSDSeq_division>

[0899] <INSDSeq_feature-table>

[0900] <insdfeature>

[0901] <INSDFeature_key>source< / INSDFeature_key>

[0902] <INSDFeature_location>1..18< / INSDFeature_location>

[0903] <INSDFeature_quals>

[0904] <insdqualifier>

[0905] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0906] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0907] < / insdqualifier>

[0908] <insdqualifier id="q72">

[0909] <INSDQualifier_name>organism< / INSDQualifier_name>

[0910] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0911] < / insdqualifier>

[0912] < / INSDFeature_quals>

[0913] < / insdfeature>

[0914] < / INSDSeq_feature-table>

[0915] <INSDSeq_sequence> ctttggaggcatttgtgc< / INSDSeq_sequence>

[0916] < / insdseq>

[0917] < / sequencedata>

[0918] <sequencedata sequenceidnumber="37">

[0919] <insdseq>

[0920] <INSDSeq_length> 21< / INSDSeq_length>

[0921] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0922] <INSDSeq_division> PAT< / INSDSeq_division>

[0923] <INSDSeq_feature-table>

[0924] <insdfeature>

[0925] <INSDFeature_key>source< / INSDFeature_key>

[0926] <INSDFeature_location>1..21< / INSDFeature_location>

[0927] <INSDFeature_quals>

[0928] <insdqualifier>

[0929] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0930] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0931] < / insdqualifier>

[0932] <insdqualifier id="q74">

[0933] <INSDQualifier_name>organism< / INSDQualifier_name>

[0934] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0935] < / insdqualifier>

[0936] < / INSDFeature_quals>

[0937] < / insdfeature>

[0938] < / INSDSeq_feature-table>

[0939] <INSDSeq_sequence> cctacaagggacatctgtgaa< / INSDSeq_sequence>

[0940] < / insdseq>

[0941] < / sequencedata>

[0942] <sequencedata sequenceidnumber="38">

[0943] <insdseq>

[0944] <INSDSeq_length> 22< / INSDSeq_length>

[0945] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0946] <INSDSeq_division> PAT< / INSDSeq_division>

[0947] <INSDSeq_feature-table>

[0948] <insdfeature>

[0949] <INSDFeature_key>source< / INSDFeature_key>

[0950] <INSDFeature_location>1..22< / INSDFeature_location>

[0951] <INSDFeature_quals>

[0952] <insdqualifier>

[0953] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0954] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0955] < / insdqualifier>

[0956] <insdqualifier id="q76">

[0957] <INSDQualifier_name>organism< / INSDQualifier_name>

[0958] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0959] < / insdqualifier>

[0960] < / INSDFeature_quals>

[0961] < / insdfeature>

[0962] < / INSDSeq_feature-table>

[0963] <INSDSeq_sequence> gttatgcaaataccctgactcc< / INSDSeq_sequence>

[0964] < / insdseq>

[0965] < / sequencedata>

[0966] <sequencedata sequenceidnumber="39">

[0967] <insdseq>

[0968] <INSDSeq_length> 21< / INSDSeq_length>

[0969] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0970] <INSDSeq_division> PAT< / INSDSeq_division>

[0971] <INSDSeq_feature-table>

[0972] <insdfeature>

[0973] <INSDFeature_key>source< / INSDFeature_key>

[0974] <INSDFeature_location>1..21< / INSDFeature_location>

[0975] <INSDFeature_quals>

[0976] <insdqualifier>

[0977] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0978] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[0979] < / insdqualifier>

[0980] <insdqualifier id="q78">

[0981] <INSDQualifier_name>organism< / INSDQualifier_name>

[0982] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[0983] < / insdqualifier>

[0984] < / INSDFeature_quals>

[0985] < / insdfeature>

[0986] < / INSDSeq_feature-table>

[0987] <INSDSeq_sequence> ggctggctgtgtcaaatatat< / INSDSeq_sequence>

[0988] < / insdseq>

[0989] < / sequencedata>

[0990] <sequencedata sequenceidnumber="40">

[0991] <insdseq>

[0992] <INSDSeq_length> 20< / INSDSeq_length>

[0993] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0994] <INSDSeq_division> PAT< / INSDSeq_division>

[0995] <INSDSeq_feature-table>

[0996] <insdfeature>

[0997] <INSDFeature_key>source< / INSDFeature_key>

[0998] <INSDFeature_location>1..20< / INSDFeature_location>

[0999] <INSDFeature_quals>

[1000] <insdqualifier>

[1001] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1002] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1003] < / insdqualifier>

[1004] <insdqualifier id="q80">

[1005] <INSDQualifier_name>organism< / INSDQualifier_name>

[1006] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1007] < / insdqualifier>

[1008] < / INSDFeature_quals>

[1009] < / insdfeature>

[1010] < / INSDSeq_feature-table>

[1011] <INSDSeq_sequence> ttggcaagttttggtaatgtg< / INSDSeq_sequence>

[1012] < / insdseq>

[1013] < / sequencedata>

[1014] <sequencedata sequenceidnumber="41">

[1015] <insdseq>

[1016] <INSDSeq_length> 23< / INSDSeq_length>

[1017] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1018] <INSDSeq_division> PAT< / INSDSeq_division>

[1019] <INSDSeq_feature-table>

[1020] <insdfeature>

[1021] <INSDFeature_key>source< / INSDFeature_key>

[1022] <INSDFeature_location>1..23< / INSDFeature_location>

[1023] <INSDFeature_quals>

[1024] <insdqualifier>

[1025] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1026] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1027] < / insdqualifier>

[1028] <insdqualifier id="q82">

[1029] <INSDQualifier_name>organism< / INSDQualifier_name>

[1030] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1031] < / insdqualifier>

[1032] < / INSDFeature_quals>

[1033] < / insdfeature>

[1034] < / INSDSeq_feature-table>

[1035] <INSDSeq_sequence> tccaggttaaagttaatagcat< / INSDSeq_sequence>

[1036] < / insdseq>

[1037] < / sequencedata>

[1038] <sequencedata sequenceidnumber="42">

[1039] <insdseq>

[1040] <INSDSeq_length> 20< / INSDSeq_length>

[1041] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1042] <INSDSeq_division> PAT< / INSDSeq_division>

[1043] <INSDSeq_feature-table>

[1044] <insdfeature>

[1045] <INSDFeature_key>source< / INSDFeature_key>

[1046] <INSDFeature_location>1..20< / INSDFeature_location>

[1047] <INSDFeature_quals>

[1048] <insdqualifier>

[1049] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1050] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1051] < / insdqualifier>

[1052] <insdqualifier id="q84">

[1053] <INSDQualifier_name>organism< / INSDQualifier_name>

[1054] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1055] < / insdqualifier>

[1056] < / INSDFeature_quals>

[1057] < / insdfeature>

[1058] < / INSDSeq_feature-table>

[1059] <INSDSeq_sequence> tggcgaagatgttaggtgtt< / INSDSeq_sequence>

[1060] < / insdseq>

[1061] < / sequencedata>

[1062] <sequencedata sequenceidnumber="43">

[1063] <insdseq>

[1064] <INSDSeq_length> 22< / INSDSeq_length>

[1065] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1066] <INSDSeq_division> PAT< / INSDSeq_division>

[1067] <INSDSeq_feature-table>

[1068] <insdfeature>

[1069] <INSDFeature_key>source< / INSDFeature_key>

[1070] <INSDFeature_location>1..22< / INSDFeature_location>

[1071] <INSDFeature_quals>

[1072] <insdqualifier>

[1073] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1074] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1075] < / insdqualifier>

[1076] <insdqualifier id="q86">

[1077] <INSDQualifier_name>organism< / INSDQualifier_name>

[1078] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1079] < / insdqualifier>

[1080] < / INSDFeature_quals>

[1081] < / insdfeature>

[1082] < / INSDSeq_feature-table>

[1083] <INSDSeq_sequence> agattaaaaggtatggaaggca< / INSDSeq_sequence>

[1084] < / insdseq>

[1085] < / sequencedata>

[1086] <sequencedata sequenceidnumber="44">

[1087] <insdseq>

[1088] <INSDSeq_length> 18< / INSDSeq_length>

[1089] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1090] <INSDSeq_division> PAT< / INSDSeq_division>

[1091] <INSDSeq_feature-table>

[1092] <insdfeature>

[1093] <INSDFeature_key>source< / INSDFeature_key>

[1094] <INSDFeature_location>1..18< / INSDFeature_location>

[1095] <INSDFeature_quals>

[1096] <insdqualifier>

[1097] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1098] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1099] < / insdqualifier>

[1100] <insdqualifier id="q88">

[1101] <INSDQualifier_name>organism< / INSDQualifier_name>

[1102] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1103] < / insdqualifier>

[1104] < / INSDFeature_quals>

[1105] < / insdfeature>

[1106] < / INSDSeq_feature-table>

[1107] <INSDSeq_sequence> cgacccatccttgctgaa< / INSDSeq_sequence>

[1108] < / insdseq>

[1109] < / sequencedata>

[1110] <sequencedata sequenceidnumber="45">

[1111] <insdseq>

[1112] <INSDSeq_length>23< / INSDSeq_length>

[1113] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1114] <INSDSeq_division>PAT< / INSDSeq_division>

[1115] <INSDSeq_feature-table>

[1116] <insdfeature>

[1117] <INSDFeature_key>source< / INSDFeature_key>

[1118] <INSDFeature_location>1..23< / INSDFeature_location>

[1119] <INSDFeature_quals>

[1120] <insdqualifier>

[1121] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1122] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1123] < / insdqualifier>

[1124] <insdqualifier id="q90">

[1125] <INSDQualifier_name>organism< / INSDQualifier_name>

[1126] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1127] < / insdqualifier>

[1128] < / INSDFeature_quals>

[1129] < / insdfeature>

[1130] < / INSDSeq_feature-table>

[1131] <INSDSeq_sequence>tggcatcacttagttcacttact< / INSDSeq_sequence>

[1132] < / insdseq>

[1133] < / sequencedata>

[1134] <sequencedata sequenceidnumber="46">

[1135] <insdseq>

[1136] <INSDSeq_length> 22< / INSDSeq_length>

[1137] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1138] <INSDSeq_division> PAT< / INSDSeq_division>

[1139] <INSDSeq_feature-table>

[1140] <insdfeature>

[1141] <INSDFeature_key>source< / INSDFeature_key>

[1142] <INSDFeature_location>1..22< / INSDFeature_location>

[1143] <INSDFeature_quals>

[1144] <insdqualifier>

[1145] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1146] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1147] < / insdqualifier>

[1148] <insdqualifier id="q92">

[1149] <INSDQualifier_name>organism< / INSDQualifier_name>

[1150] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1151] < / insdqualifier>

[1152] < / INSDFeature_quals>

[1153] < / insdfeature>

[1154] < / INSDSeq_feature-table>

[1155] <INSDSeq_sequence> gcacaagtatatggaacctctg< / INSDSeq_sequence>

[1156] < / insdseq>

[1157] < / sequencedata>

[1158] <sequencedata sequenceidnumber="47">

[1159] <insdseq>

[1160] <INSDSeq_length>23< / INSDSeq_length>

[1161] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[1162] <INSDSeq_division>PAT< / INSDSeq_division>

[1163] <INSDSeq_feature-table>

[1164] <insdfeature>

[1165] <INSDFeature_key>source< / INSDFeature_key>

[1166] <INSDFeature_location>1..23< / INSDFeature_location>

[1167] <INSDFeature_quals>

[1168] <insdqualifier>

[1169] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1170] <INSDQualifier_value>unassigned DNA< / INSDQualifier_value>

[1171] < / insdqualifier>

[1172] <insdqualifier id="q94">

[1173] <INSDQualifier_name>organism< / INSDQualifier_name>

[1174] <INSDQualifier_value>unidentified< / INSDQualifier_value>

[1175] < / insdqualifier>

[1176] < / INSDFeature_quals>

[1177] < / insdfeature>

[1178] < / INSDSeq_feature-table>

[1179] <INSDSeq_sequence>tggcatcacttagttcacttact< / INSDSeq_sequence>

[1180] < / insdseq>

[1181] < / sequencedata>

[1182]

[1183] <---

Images