Conjugate and its applications

Conjugates with specific peptide carriers effectively deliver therapeutic nucleic acids to trinucleotide disorders, correcting splicing defects and reducing toxicity, addressing the limitations of existing carriers in treating neuromuscular diseases.

RU2865482C2Active Publication Date: 2026-07-06OXFORD UNIVERSITY INNOVATION LTD +4
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
RU2022105559
Authority / Receiving Office
RU · RU
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-08-09
Filing Date
2020-08-07
Publication Date
2026-07-06
Estimated Expiration
2040-08-07

AI Technical Summary

Technical Problem

Current carrier peptides used for delivering antisense oligonucleotides to treat trinucleotide repeat disorders face challenges in achieving an effective balance between efficacy and toxicity, and their use has been limited to diseases like DMD, not addressing other neuromuscular disorders effectively.

Method used

Development of conjugates with peptide carriers composed of 40 amino acids or less, containing two or more cationic domains and one hydrophobic domain, specifically designed to target trinucleotide repeats, enhancing cellular delivery and reducing toxicity.

Benefits of technology

The conjugates effectively penetrate target cells, reduce trinucleotide repeat expansion, correct splicing defects, and demonstrate lower toxicity compared to previous carriers, offering a therapeutic option for trinucleotide disorders like DM1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000009
    Figure 00000009
  • Figure 00000010
    Figure 00000010
  • Figure 00000011
    Figure 00000011
Patent Text Reader

Abstract

FIELD: biotechnology.SUBSTANCE: methods for preventing or treating a disorder caused by trinucleotide repeats in a subject in need thereof are proposed. The methods include administering to a subject a conjugate comprising a peptide carrier covalently linked to a therapeutic molecule. The peptide carrier contains two cationic domains and one hydrophobic domain, and the therapeutic molecule is a nucleic acid containing multiple trinucleotide repeats.EFFECT: improved delivery of antisense oligonucleotides for the effective and safe therapy of trinucleotide repeat-associated genetic diseases such as myotonic dystrophy type 1.22 cl, 43 dwg, 5 tbl
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Field of technology to which the invention relates

[0002] The present invention relates to a conjugate comprising a peptide carrier and a therapeutic molecule, wherein the peptide carrier is characterized by specific domains, and the therapeutic molecule is a nucleic acid formed from trinucleotide repeats. The present invention also relates to the use of said conjugate in methods of treatment or as a drug, especially in the treatment of disorders caused by trinucleotide repeats, such as myotonic dystrophy (DM1).

[0003] Prerequisites for the creation of the invention

[0004] Nucleic acid-based therapeutics are genomic drugs with the potential to transform healthcare. Research has demonstrated that these therapeutics have potential for use in a wide range of diseases. In particular, the use of antisense oligonucleotide-based approaches to modulate mRNA expression has emerged as a valuable therapeutic tool in the cutting-edge field of personalized medicine.

[0005] However, the therapeutic development of these promising antisense therapeutics has been hampered by insufficient cell permeability and unsatisfactory distribution characteristics.

[0006] There is therefore a clear and pressing need to improve the delivery of antisense oligonucleotides to provide more effective therapy for genetic diseases such as devastating trinucleotide repeat disorders.

[0007] Trinucleotide repeat disorders are genetic diseases characterized by the presence of an abnormally large number of repeats of a specific three-nucleotide sequence in genomic DNA, also known as trinucleotide repeat expansions. Trinucleotide repeat expansions are a specific type of microsatellite repeat, often referred to as microsatellite expansions. Typically, there is a threshold number of repeats present in a healthy individual, and if the number of repeats exceeds this threshold, the disease becomes pathogenic. This threshold number varies depending on the disease and the affected genes. In these diseases, the number of repeats can also serve as an indicator of disease severity. Generally, a higher number of repeats indicates a more severe case of the disease.The number of repetitions can also be used to predict the age at which diseases may begin, with a higher number of repetitions indicating an earlier onset.

[0008] Currently, 14 trinucleotide repeat disorders affecting humans are known. These disorders can be grouped using several methods, such as by determining the location of the trinucleotide repeat within the gene, such as its location in a protein-coding ORF; in an exon; or in the untranslated region. Alternatively, they can be grouped by the sequence of the triplet repeat. In many trinucleotide repeat disorders, the triplet repeat is "CAG," encoding glutamine; this group of disorders is typically referred to as polyglutamine disorders. However, trinucleotide repeats with different sequences are known and can be classified as non-polyglutamine repeat disorders.

[0009] One of the trinucleotide-related disorders related to non-polyglutamine repeat disorder is myotonic dystrophy type 1 (DM1). DM1 is caused by the trinucleotide repeat "CTO" present in the 3' UTR of the DMPK (myotrophic dystrophy protein kinase) gene. The typical repeat number for this gene ranges from 5 to 34 repeats. Repeat numbers greater than 34 may cause some symptoms of the disease, while repeat numbers greater than 50 indicate pathogenicity.

[0010] DM1 and other trinucleotide repeat disorders typically affect the neuromuscular system and there is currently no effective treatment.

[0011] While the use of antisense oligonucleotides that can bind to repeat regions and disrupt splicing or translation is theoretically promising, and has been demonstrated in vitro, their use as therapeutic agents has proven impossible due to the difficulty of delivering these molecules to affected cells. This applies to the treatment of a wide range of genetic diseases, including disorders caused by trinucleotide repeats.

[0012] Viruses have been proposed as delivery vehicles, but their use is limited by the immunotoxicity of the viral envelope protein and potential oncogenic effects. A number of non-viral delivery vectors have been developed as an alternative, with peptides proving the most promising due to their small size, specific targeting, and ability to transcapillary deliver large biological cargo molecules (biocargo). Several peptides have been shown to be able to penetrate cells either independently or with biocargo.

[0013] In recent years, cell-penetrating peptides (CPPs) have been conjugated to antisense oligonucleotides (specifically, neutrally charged phosphorodiamidate morpholine oligomers (PMOs) and peptide nucleic acids (PNAs)) to enhance the cellular delivery of these oligonucleotide analogs by efficiently transporting them across cell membranes to reach their pre-mRNA target sites in the cell nucleus. It has been found that therapeutics that include PMOs conjugated to specific arginine-rich peptides (referred to as P-PMOs or peptide-PMOs) can effectively penetrate target cells.

[0014] Specifically, peptides derived from the internalization of PNA / PMO (Pip) were developed. These peptides are arginine-rich CPPs consisting of two arginine-rich sequences separated by a short central hydrophobic sequence. These "Pip" peptides were engineered to enhance serum stability while maintaining high levels of exon skipping, initially by conjugation to the PNA cargo molecule. Additional derivatives of these peptides were created as PMO conjugates, which, as shown in DMD (Duchenne muscular dystrophy) models, after systemic administration to mice, provide therapy to skeletal muscle throughout the body, and, importantly, also to the cardiac muscle.

[0015] Although these carrier peptides are effective, their therapeutic use is hampered by their associated toxicity.

[0016] Alternative carrier peptides with a single arginine-rich domain, such as R6Gly, were also obtained. These peptides were used to produce peptide conjugates with antisense oligonucleotides, which exhibited reduced toxicity; however, these conjugates were less effective than Pip peptides.

[0017] Furthermore, virtually all development of carrier peptides has been conducted in the context of DMD treatment. Peptides with a hydrophobic central domain have been shown to be particularly active in the treatment of DMD. To date, the use of such carrier peptides in other neuromuscular diseases with different etiologies and pathologies has not been studied.

[0018] Thus, there are currently no available carrier peptides that can be used in conjugates with therapeutic nucleic acids for the treatment of genetic disorders, particularly those that are not related to diseases that arise as a result of other pathology, such as trinucleotide repeat disorders.

[0019] A challenge in the field of carrier peptide technology has been to address the issue of efficacy-toxicity balance. The present inventors have now identified, synthesized, and tested conjugates containing improved carrier peptides with defined structures covalently linked to a therapeutic nucleic acid for the treatment of a trinucleotide-mediated disorder, which addresses at least this issue.

[0020] Brief summary of the invention

[0021] A first object of the present invention is a conjugate that comprises: a peptide carrier covalently linked to a therapeutic molecule;

[0022] wherein the peptide carrier consists of a total of 40 amino acids or less and comprises: two or more cationic domains, each of which contains at least 4 amino acid residues, and one or more hydrophobic domains, each of which contains at least 3 amino acid residues, wherein the peptide carrier does not contain artificial amino acid residues;

[0023] and wherein the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises a plurality of trinucleotide repeats.

[0024] A second object of the present invention is a conjugate as specified in the first object of the invention, which is intended for use as a medicine.

[0025] A third object of the present invention is a method of treating a disease in an individual, wherein the method comprises: administering to the individual an effective amount of the conjugate specified in the first object of the invention.

[0026] A fourth object of the present invention is a conjugate as defined in the first object of the invention, intended for use in the prevention or treatment of a disorder caused by trinucleotide repeats.

[0027] A fifth aspect of the present invention is a method for preventing or treating a trinucleotide repeat disorder in an individual, the method comprising: administering to the individual an effective amount of the conjugate as defined in the first aspect of the invention.

[0028] The sixth object of the present invention is a pharmaceutical composition containing the conjugate specified in the first object of the invention.

[0029] In one embodiment of the second, third, fourth or fifth subject matter of the invention, the conjugate is contained in a pharmaceutical composition.

[0030] Other features and embodiments of the invention will be described in the following sections, each with its own heading. Unless otherwise specifically stated, any feature may be combined with the above-mentioned aspects of the invention or with other features described herein in any compatible combination. Individual features are not limited to any particular embodiment of the invention. The section headings used in this description are for organizational purposes only and should not be construed as limiting the claimed scope of the invention.

[0031] As used herein, "peptide carrier" refers to a peptide that can transport a molecule conjugated to it into cells, i.e., cell-penetrating peptides. In the context of the description of the term "cell-penetrating peptide," both "peptide carrier" and "peptide" may be used interchangeably.

[0032] In the context of the description, references to "X" refer to any form of artificial, synthetically produced amino acid that is aminocaproic acid.

[0033] In the context of the description, references to "B" refer to the naturally occurring but not genetically encoded amino acid beta-alanine.

[0034] In the context of the description, references to "Ac" refer to acetylation of the relevant peptide.

[0035] In the context of the description, references to "Nur" refer to the naturally occurring but not genetically encoded amino acid hydroxyproline.

[0036] In the context of the description, references to other capital letters refer to the relevant genetically encoded amino acid residue according to the accepted amino acid letter code.

[0037] In the context of the description, references to an "artificial" amino acid or an "artificial" residue mean any amino acid that is not naturally occurring, and include synthetic amino acids, modified amino acids (e.g., modified with sugars), non-naturally occurring amino acids, man-made amino acids, spacers, and spacers linked by compounds that are not peptides. For the avoidance of doubt, in the context of the present invention, aminocaproic acid (X) is an artificial amino acid. For the avoidance of doubt, in the context of the present invention, beta-alanine (B) and hydroxyproline (Hyp) are naturally occurring amino acids and therefore do not refer to artificial amino acids, but are naturally occurring amino acids.Artificial amino acids may include, for example, 6-aminocaproic acid (X), tetrahydroisoquinoline-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy) and 3-azetidinecarboxylic acid (Az), 11-aminoundecanoic acid.

[0038] In the context of the description of the reference, the term "cationic" refers to an amino acid or amino acid domain that has an overall positive charge at physiological pH.

[0039] By “arginine-rich” or “histidine-rich” is meant a cationic domain consisting of at least 40% of the indicated residue(s).

[0040] In the context of the description of a reference, the term "hydrophobic / hydrophobic" refers to an amino acid or amino acid domain that has the ability to repel water or is immiscible with water.

[0041] Detailed description of the invention

[0042] The present invention is based on the discovery that the attachment of specific peptide carriers to a nucleic acid, which can be used for the prevention and treatment of trinucleotide repeat disorders, allows the nucleic acid to effectively penetrate target cells and bind to trinucleotide repeats present in the genes of affected individuals, exerting a targeted effect on their expansion. This activity reduces the levels of transcript and / or protein repeat expansion present in the cell, thereby blocking their pathological effects on the cellular splicing mechanism, normalizing splicing and improving the physiological state of these individuals.

[0043] An advantage is that the peptide carriers described herein likely enhance the resistance of the therapeutic nucleic acid to cleavage, increase its ability to penetrate target cells, and provide targeted action on trinucleotide expansion, thereby implementing treatment. Furthermore, the conjugates proposed in the invention exhibit significantly lower toxicity compared to conjugates formed using known peptide carriers. Thus, the conjugate provides a means of effectively delivering nucleic acid for the treatment of trinucleotide repeat disorders while remaining nontoxic to the individual.

[0044] This invention was the first to demonstrate that any peptide carriers with a hydrophobic core are effective for the treatment of neuromuscular diseases other than DMD. Previous studies focused on the use of peptide carriers for the delivery of therapeutic agents for the treatment of DMD. The pathology of DMD differs significantly from that of trinucleotide repeat-associated disorders. Specifically, DMD involves active muscle degeneration and muscle renewal and repair, including inflammation, while trinucleotide repeat-associated disorders such as myotonic dystrophy type 1 (DM1) involve muscle dysfunction without overt degeneration.In the present invention, it was discovered that peptide carriers interact with muscle membranes, ensuring efficient delivery of the therapeutic molecule, and the membrane types they interact with vary greatly between degenerated and non-degenerated muscle, i.e., between DMD and trinucleotide repeat-mediated disorders. Unlike degenerative diseases such as DMD, in DM1 the muscle membrane is not disrupted, and therefore, it might be expected that conjugate penetration into muscle tissue should be inhibited, which is much more difficult to achieve. However, the data obtained in the present invention indicate for the first time that peptide carriers are not only effective in delivering to degenerated muscle for the treatment of DM1, but, as unexpectedly found, are more effective against DM1 than DMD.

[0045] According to the data presented in the present invention, the conjugates of the invention maintain high levels of efficacy and delivery to critical target tissues affected by trinucleotide-mediated disorders, such as the gastrocnemius and quadriceps skeletal muscles. Furthermore, these conjugates demonstrated increased efficacy compared to previously available peptide carriers when used in the same conjugate. The conjugates of the invention target mutant CUGexpanded-DMPK transcripts (DMPK transcripts with a CUG expansion), preventing the formation of nuclear foci and thereby preventing detrimental sequestration of the MBNL1 splicing factor by nuclear RNA foci and, as a result, reducing the loss of function of the MBNL1 factor, which is responsible for splicing defects in multiple genes, and muscle dysfunction.

[0046] This is demonstrated herein by the reduction in the number of nuclear foci formed by DMPK transcripts containing repeat expansions following administration of the conjugate of the invention and by the correction of gene splicing following administration of the conjugate of the invention, i.e., those genes whose splicing is typically impaired in DM1 due to the reduced availability of MBNL1 sequestered by transcripts with an increased number of trinucleotide repeats. In particular, the conjugates presented herein demonstrated the ability to correct splicing by 50-90% relative to healthy controls, with the exception of exon 7a of clicn1 and exon 5 of mblnl1, and including exon 22 of serca, compared to untreated cells / individuals.This has also been demonstrated by the improvement in the physiological state of trinucleotide-induced disorders, as shown in the present description in DM1 models, where normalization and correction of myotonin in mice was observed up to complete recovery even after a single injection of the conjugates indicated in the present description.

[0047] In the creation of the invention, it was unexpectedly found that the peptide carriers used in the conjugate effectively delivered the therapeutic molecule into the nuclear compartment and into nuclear aggregates of DMPK transcripts at a concentration sufficient to ensure a favorable stoichiometric interaction with the CUG mutation.

[0048] At the same time, the conjugates of the invention were effective in vivo, as evidenced by a reduction in clinical signs after systemic injection and reduced toxicity detected after measuring biochemical markers. Of extreme importance is the fact that the conjugates of the present invention unexpectedly demonstrated reduced toxicity after a similar systemic injection in mice compared to previously described carrier peptides in the same conjugate. As demonstrated herein, the conjugates of the invention did not lead to a significant increase in toxicity markers compared to saline at therapeutically relevant doses, while cell viability was maintained, while conjugates using prior art peptide carriers resulted in significant cell death.Following administration of the conjugates to mice, a short recovery period was observed, which was much faster than following administration of conjugates formed using previously available peptides.

[0049] Thus, the conjugates proposed in the invention can be more successfully used for the safe and effective therapy of trinucleotide repeat disorders in humans, they open the way for the treatment of these devastating diseases that would otherwise be incurable.

[0050] Artificial amino acids

[0051] The present invention relates to conjugates that contain peptide carriers having a specific structure in which artificial amino acid residues are absent.

[0052] Preferably, the peptide does not contain aminocaproic acid residues. Preferably, the peptide does not contain any form of aminocaproic acid residues. Preferably, the peptide does not contain 6-aminocaproic acid residues.

[0053] Preferably, the peptide contains only naturally occurring amino acid residues and is therefore composed of naturally occurring amino acid residues.

[0054] Preferably, artificial amino acids such as 6-aminocaproic acid, which are commonly used in cell-penetrating peptides, are replaced with naturally occurring amino acids. Preferably, artificial amino acids such as 6-aminocaproic acid, which are commonly used in cell-penetrating peptides, are replaced with amino acids selected from beta-alanine, serine, proline, arginine, and histidine or hydroxyproline.

[0055] In one embodiment of the invention, aminocaproic acid is replaced with beta-alanine. Preferably, 6-aminocaproic acid is replaced with beta-alanine.

[0056] In one embodiment of the invention, aminocaproic acid is replaced with histidine. Preferably, 6-aminocaproic acid is replaced with histidine.

[0057] In one embodiment of the invention, aminocaproic acid is replaced with hydroxyproline. Preferably, 6-aminocaproic acid is replaced with hydroxyproline.

[0058] Preferably, artificial amino acids such as 6-aminocaproic acid, which are usually used in cell-penetrating peptides, can be replaced with a combination of any amino acids such as beta-alanine, serine, proline, arginine and histidine or hydroxyproline, preferably with a combination of any amino acids such as beta-alanine, histidine and hydroxyproline.

[0059] In one embodiment of the invention, the peptide carrier may consist of a total of 40 amino acid residues or less, wherein the peptide comprises:

[0060] two or more cationic domains, each of which contains at least 4 amino acid residues; and

[0061] and one or more hydrophobic domains, each of which contains at least 3 amino acid residues;

[0062] wherein at least one cationic domain comprises histidine residues.

[0063] It is preferable if at least one cationic domain is histidine-rich.

[0064] Preferably, the term “histidine-rich” is used in the present description in relation to cationic domains.

[0065] Cationic domain

[0066] The present invention relates to conjugates that contain short peptide carriers having a certain structure in which at least two cationic domains of a certain length are present.

[0067] Preferably, the peptide contains up to 4 cationic domains, up to 3 cationic domains.

[0068] Preferably, the peptide contains 2 cationic domains.

[0069] As indicated above, the peptide contains two or more cationic domains, each of which consists of at least 4 amino acid residues.

[0070] Preferably, each cationic domain comprises from 4 to 12 amino acid residues, preferably from 4 to 7 amino acid residues.

[0071] Preferably, each cationic domain contains 4, 5, 6, or 7 amino acid residues.

[0072] Preferably, each cationic domain has a similar length, preferably, each cationic domain has the same length.

[0073] Preferably, each cationic domain comprises cationic amino acids and may also comprise polar and / or non-polar amino acids.

[0074] Non-polar amino acids can be selected from: alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, phenylalanine. Preferably, non-polar amino acids have no charge.

[0075] Polar amino acids can be selected from: serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine. Preferably, the polar amino acids selected do not have a negative charge.

[0076] Cationic amino acids can be selected from: arginine, histidine, lysine. Preferably, cationic amino acids have a positive charge at physiological pH.

[0077] Preferably, each cationic domain does not contain anionic or negatively charged amino acid residues.

[0078] Preferably, each cationic domain comprises arginine, histidine, beta-alanine, hydroxyproline, and / or serine residues.

[0079] Preferably, each cationic domain consists of arginine, histidine, beta-alanine, hydroxyproline, and / or serine residues.

[0080] Preferably, each cationic domain comprises at least 40%, at least 45%, at least 50% cationic amino acids.

[0081] Preferably, each cationic domain contains mainly cationic amino acids. Preferably, each cationic domain contains at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.

[0082] Preferably, each cationic domain has an isoelectric point (pI) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0.

[0083] Preferably, each cationic domain has an isoelectric point (pI) of at least 10.0.

[0084] Preferably, each cationic domain has an isoelectric point (pI) of 10.0 to 13.0

[0085] In one embodiment of the invention, each cationic domain has an isoelectric point (pI) of from 10.4 to 12.5.

[0086] Preferably, the isoelectric point of the cationic domain is calculated at physiological pH using any suitable method known in the art. Preferably, this is done using the IPC web algorithm (www.isoelectric.org) developed by Lukasz Kozlowski, Biol Direct. 11, 2016, p. 55. DOI: 10.1186 / sl3062-016-0159-9.

[0087] Preferably, each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues.

[0088] Preferably, the cationic domain may comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine residues.

[0089] Preferably, the cationic domain may comprise at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% histidine residues.

[0090] The cationic domain may preferably comprise a total of 1 to 5 histidine residues and 1 to 5 arginine residues. The cationic domain may preferably comprise 1 to 5 arginine residues. The cationic domain may preferably comprise 1 to 5 histidine residues. The cationic domain may preferably comprise 2 to 5 histidine residues and 3 to 5 arginine residues. The cationic domain may preferably comprise 3 to 5 arginine residues. The cationic domain may preferably comprise 2 to 5 histidine residues.

[0091] Preferably, each cationic domain comprises one or more beta-alanine residues. Preferably, each cationic domain may comprise a total of 2 to 5 beta-alanine residues, preferably a total of 2 or 3 beta-alanine residues.

[0092] Preferably, each cationic domain may comprise one or more hydroxyproline residues or serine residues.

[0093] Preferably, the cationic domain may contain 1 to 2 hydroxyproline residues. Preferably, the cationic domain may contain 1 to 2 serine residues.

[0094] Preferably, all cationic amino acids in said cationic domain may be histidine, alternatively, preferably, all cationic amino acids in said cationic domain may be arginine.

[0095] Preferably, the peptide may comprise at least one histidine-rich cationic domain. Preferably, the peptide may comprise at least one arginine-rich cationic domain.

[0096] Preferably, the peptide may comprise at least one arginine-rich cationic domain and at least one histidine-rich cationic domain.

[0097] In one embodiment of the invention, the peptide comprises two arginine-rich cationic domains.

[0098] In one embodiment of the invention, the peptide comprises two histidine-rich cationic domains.

[0099] In one embodiment of the invention, the peptide comprises two arginine-rich and histidine-rich cationic domains.

[0100] In one embodiment of the invention, the peptide comprises one arginine-rich cationic domain and one histidine-rich cationic domain.

[0101] Preferably, each cationic domain comprises no more than 3 contiguous arginine residues, preferably no more than 2 contiguous arginine residues.

[0102] Preferably, each cationic domain does not contain adjacent histidine residues.

[0103] Preferably, each cationic domain comprises arginine, histidine, and / or beta-alanine residues. Preferably, each cationic domain comprises mainly arginine, histidine, and / or beta-alanine residues. Preferably, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% of the amino acid residues in each cationic domain are arginine, histidine, and / or beta-alanine residues. Preferably, each cationic domain consists of arginine, histidine, and / or beta-alanine residues.

[0104] In one embodiment, the peptide comprises a first cationic domain comprising arginine and beta-alanine residues and a second cationic domain comprising arginine and beta-alanine residues.

[0105] In one embodiment, the peptide comprises a first cationic domain comprising arginine and beta-alanine residues, and a second cationic domain comprising histidine, beta-alanine and optionally arginine residues.

[0106] In one embodiment, the peptide comprises a first cationic domain comprising arginine and beta-alanine residues and a second cationic domain comprising histidine and beta-alanine residues.

[0107] In one embodiment, the peptide comprises a first cationic domain comprising arginine and beta-alanine residues and a second cationic domain comprising arginine and beta-alanine residues.

[0108] In one embodiment, the peptide comprises a first cationic domain comprising arginine and beta-alanine residues and a second cationic domain comprising arginine, histidine and beta-alanine residues.

[0109] Preferably, the peptide comprises at least two cationic domains, preferably these cationic domains form arms of the peptide. Preferably, the cationic domains are located at the N- and C-termini of the peptide. Thus, the cationic domains can preferably be referred to as cationic arm domains.

[0110] In one embodiment of the invention, the peptide comprises two cationic domains, one located at the N-terminus of the peptide and one located at the C-terminus of the peptide. Preferably, at either end of the peptide. Preferably, no other amino acids or domains are present at the N-terminus and C-terminus of the peptide except for other groups, such as a terminal modification, a linker, and / or a therapeutic moiety. For the avoidance of doubt, such other groups may be present in addition to the "peptide" specified in the description and claims. Thus, preferably, each cationic peptide forms the end of the peptide. Preferably, this does not preclude the presence of an additional linker group as specified herein.

[0111] Preferably, the peptide may contain up to four cationic domains. Preferably, the peptide contains two cationic domains.

[0112] In one embodiment of the invention, the peptide comprises two cationic domains that are both rich in arginine.

[0113] In one embodiment of the invention, the peptide comprises one cationic domain that is rich in arginine.

[0114] In one embodiment of the invention, the peptide comprises two cationic domains that are both rich in arginine and histidine.

[0115] In one embodiment of the invention, the peptide comprises one cationic domain that is rich in arginine and one cationic domain that is rich in histidine.

[0116] Preferably, the cationic domains comprise amino acid units selected from: R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH or any combination thereof.

[0117] Preferably, the cationic domain may also include serine, proline and / or hydroxyproline residues. Preferably, the cationic domains may also contain amino acid units selected from: RP, PR, RPR, RRP, PRR, PRP, Hyp; R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS or any combination thereof, or any combination with the above-mentioned amino acid units.

[0118] Preferably, each cationic domain comprises any one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), R[Hyp]RR[Hyp]R (SEQ ID NO: 19), or any combination thereof.

[0119] Preferably, each cationic domain consists of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO: 19) or any combination thereof.

[0120] Preferably, each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9).

[0121] Preferably, all cationic domains in a peptide may be the same or different from one another. Preferably, each cationic domain in a peptide is different from the other.

[0122] Hydrophobic domain

[0123] The present invention relates to conjugates that comprise a short peptide carrier having a specific structure in which at least one hydrophobic domain of a specific length is present.

[0124] Preferably, the peptide contains up to 3 hydrophobic domains, up to 2 hydrophobic domains.

[0125] Preferably, the peptide contains 1 hydrophobic domain.

[0126] As indicated above, the peptide contains one or more hydrophobic domains, each of which consists of at least 3 amino acid residues.

[0127] Preferably, each hydrophobic domain consists of 3 to 6 amino acid residues. Preferably, each hydrophobic domain consists of 5 amino acid residues.

[0128] Preferably, each hydrophobic domain may contain non-polar, polar, and hydrophobic amino acid residues.

[0129] Hydrophobic amino acid residues can be selected from: alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine and tryptophan.

[0130] Non-polar amino acid residues can be selected from: proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, methionine.

[0131] Polar amino acid residues can be selected from: serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine.

[0132] Preferably, hydrophobic domains do not contain hydrophilic amino acid residues.

[0133] Preferably, each hydrophobic domain comprises predominantly hydrophobic amino acid residues. Preferably, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids. Preferably, each hydrophobic domain consists of hydrophobic amino acid residues.

[0134] Preferably, each hydrophobic domain has a degree of hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3.

[0135] Preferably, each hydrophobic domain has a degree of hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45. Preferably, each hydrophobic domain has a degree of hydrophobicity of at least 1.2, at least 1.25, at least 1.3, at least 1.35.

[0136] Preferably, each hydrophobic domain has a degree of hydrophobicity of 0.4 to 1.4

[0137] In one embodiment of the invention, each hydrophobic domain has a degree of hydrophobicity from 0.45 to 0.48.

[0138] In one embodiment of the invention, each hydrophobic domain has a degree of hydrophobicity from 1.27 to 1.39.

[0139] Preferably, the degree of hydrophobicity is measured by the method described by White and Wimley: WC Wimley and SH White, “Experimentally determined hydrophobicity scale for proteins at membrane interfaces)”, Nature Struct Biol 3, 1996, p. 842.

[0140] Preferably, each hydrophobic domain comprises at least 3, at least 4 hydrophobic residues.

[0141] Preferably, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and glutamine residues. Preferably, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues.

[0142] In one embodiment of the invention, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine and / or glutamine residues.

[0143] In one embodiment of the invention, each hydrophobic domain consists of tryptophan and / or proline residues.

[0144] The peptide preferably comprises one hydrophobic domain. Preferably, one or each hydrophobic domain is located in the center of the peptide. Thus, a preferred hydrophobic domain can be referred to as a core hydrophobic domain. Preferably, one or each hydrophobic core domain is flanked on either side by an arm domain. Preferably, the arm domains may comprise one or more cationic domains and one or more additional hydrophobic domains. Preferably, each arm domain comprises a cationic domain.

[0145] In one embodiment of the invention, the peptide comprises two arm domains flanking a hydrophobic core domain, wherein each arm domain comprises a cationic domain.

[0146] In one embodiment, the peptide consists of two cationic arm domains flanking a hydrophobic core domain.

[0147] Preferably, one or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26), or any combination thereof.

[0148] Preferably, one or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26), or any combination thereof.

[0149] Preferably, the or each hydrophobic domain consists of one of the following sequences: FQILY (SEQ ID NO: 21), WWW, WWPWW (SEQ ID NO: 24).

[0150] Preferably, one or each hydrophobic domain consists of FQILY (SEQ ID NO: 21).

[0151] Preferably, all hydrophobic domains in a peptide may have the same sequence or different sequences.

[0152] Peptide carrier

[0153] The present invention relates to conjugates that comprise a peptide carrier intended for use in transporting therapeutic nucleic acids formed from trinucleotide repeats for the treatment of medical conditions.

[0154] The peptide has a sequence that represents a continuous single molecule, so the peptide domains are contiguous. Preferably, the peptide comprises several linearly arranged domains between the N-terminus and the C-terminus. Preferably, the domains are selected from the cationic domains and hydrophobic domains described above. Preferably, the peptide consists of cationic domains and hydrophobic domains, which are the domains described above.

[0155] Each domain has general sequence characteristics, which are described above in the relevant sections, but the exact sequence of each domain can be varied and modified. Thus, each domain can have a spectrum of sequences. Combining each possible domain sequence allows for a spectrum of peptide structures, each of which is part of the present invention. The features of the peptide structures are presented below.

[0156] Preferably, a hydrophobic domain separates any two cationic domains. Preferably, each hydrophobic domain is flanked by cationic domains on either side.

[0157] Preferably, no cationic domain is adjacent to another cationic domain.

[0158] In one embodiment of the invention, the peptide comprises one hydrophobic domain flanked by two cationic domains in the following order:

[0159] [cationic domain] - [hydrophobic domain] - [cationic domain].

[0160] Thus, preferably, the hydrophobic domain can be designated as a core domain, and each of the cationic domains can be designated as a shoulder domain.

[0161] Preferably hydrophobic arm domains flank the cationic core domain on each side.

[0162] In one embodiment of the invention, the peptide consists of two cationic domains and one hydrophobic domain.

[0163] In one embodiment of the invention, the peptide consists of one hydrophobic core domain flanked by two cationic arm domains.

[0164] In one embodiment of the invention, the peptide consists of one hydrophobic core domain that comprises a sequence selected from: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25) and WWPW (SEQ ID NO: 26), flanked by two arm cationic domains, each of which comprises a sequence selected from: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18) and R[Hyp]RR[Hyp]R (SEQ ID NO: 19).

[0165] In one embodiment of the invention, the peptide consists of one hydrophobic core domain that comprises a sequence selected from: FQILY (SEQ ID NO: 21), WWW and WWPWW (SEQ ID NO: 24), flanked by two cationic arm domains that comprise a sequence selected from: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7) and RBHBH (SEQ ID NO: 8).

[0166] In one embodiment of the invention, the peptide consists of one hydrophobic core domain that contains the sequence: FQILY (SEQ ID NO: 21), flanked by two cationic arm domains that contain a sequence selected from: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8).

[0167] In any of the embodiments of the invention, additional groups may be present, such as a linker, a terminal modification, and / or a therapeutic molecule.

[0168] Preferably, the peptide is modified at the N-terminus.

[0169] Preferably, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated, or N-methylsulfonylated. Preferably, the peptide is N-acetylated.

[0170] Optionally, the N-terminus of the peptide may remain unmodified.

[0171] In one embodiment of the invention, the peptide is N-acetylated.

[0172] Preferably, the peptide comprises a C-terminal modification selected from: a carboxyl group, a thioacid group, an aminooxy group, a hydrazino group, a thioether group, an azido group, a straight-chain alkyne group, a straight-chain alkylene group, an aldehyde group, a thiol group, or a haloacetyl group.

[0173] Preferably, the C-terminal or N-terminal modification can provide the linkage of the peptide to the therapeutic molecule.

[0174] Thus, a C-terminal modification or N-terminal modification may comprise a linker and vice versa. Preferably, a C-terminal modification or N-terminal modification may consist of a linker or vice versa. Suitable linkers are further described herein.

[0175] Preferably, the peptide contains a C-terminal carboxyl group.

[0176] Preferably, the C-terminal carboxyl group is a carboxyl group of a glycine residue, beta-alanine, glutamic acid, or gamma-aminobutyric acid.

[0177] In one embodiment, the C-terminal carboxyl group is a carboxyl group of a beta-alanine residue.

[0178] Preferably, the C-terminal residue is a linker. Preferably, the C-terminal beta-alanine residue is a linker.

[0179] In this case, each cationic domain may preferably additionally comprise an N- or C-terminal modification. Preferably, the cationic domain at the C-terminus comprises a C-terminal modification.

[0180] Preferably, the cationic domain at the N-terminus comprises an N-terminal modification. Preferably, the cationic domain at the C-terminus comprises a linker group, preferably, the cationic domain at the C-terminus comprises a C-terminal beta-alanine. Preferably, the cationic domain at the N-terminus is N-acetylated.

[0181] The peptide according to the present invention is characterized by a total length of 40 or fewer amino acid residues. Thus, the peptide can be considered an oligopeptide.

[0182] Preferably, the peptide has a total length of 3 to 30 amino acid residues, preferably 5 to 25 amino acid residues, 10 to 25 amino acid residues, 13 to 23 amino acid residues, 15 to 20 amino acid residues.

[0183] Preferably, the peptide has a total length consisting of at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 amino acid residues.

[0184] The peptide preferably has the ability to penetrate cells. Therefore, the peptide can be considered a cell-penetrating peptide.

[0185] Preferably, the peptide is designed to attach a therapeutic molecule. Preferably, the peptide is designed to transport the therapeutic molecule to the target cell. Preferably, the peptide is designed to deliver the therapeutic molecule to the target cell. Thus, the peptide can be considered a peptide carrier.

[0186] Preferably, the peptide carrier has the ability to penetrate cells and tissues, preferably the cell nuclei. Preferably, muscle tissue.

[0187] Preferably, the peptide carrier can be selected from any of the following sequences:

[0188] RBRRBRRFQILYRBRBR (SEQ ID NO: 27)

[0189] RBRRBRRFQILYRBRR (SEQ ID NO: 28)

[0190] RBRRBRFQILYRRBRBR (SEQ ID NO: 29)

[0191] RBRBRFQILYRBRRBRR (SEQ ID NO: 30)

[0192] RBRRBRRYQFLIRBRBR (SEQ ID NO: 31)

[0193] RBRRBRRILFQYRBRBR (SEQ ID NO: 32)

[0194] RBRRBRFQILYRBRBR (SEQ ID NO: 33)

[0195] RBRRBFQILYRBRRBR (SEQ ID NO: 34)

[0196] RBRRBRFQILYBRBR (SEQ ID NO: 35)

[0197] RBRRBFQILYRBRBR (SEQ ID NO: 36)

[0198] RBRRBRRFQILYRBHBH (SEQ ID NO: 37)

[0199] RBRRBRRFQILYHBHBR (SEQ ID NO: 38)

[0200] RBRRBRRFQILYHBRBH (SEQ ID NO: 39)

[0201] RBRRBRRYQFLIRBHBH (SEQ ID NO: 40)

[0202] RBRRBRRILFQYRBHBH (SEQ ID NO: 41)

[0203] RBRHBHRFQILYRBRBR (SEQ ID NO: 42)

[0204] RBRBBBHRFQILYRBHBH (SEQ ID NO: 43)

[0205] RBRRBRFQILYRBHBH (SEQ ID NO: 44)

[0206] RBRRBRFQILYHBHBH (SEQ ID NO: 45)

[0207] RBRRBHFQILYRBHBH (SEQ ID NO: 46)

[0208] HBRRBRFQILYRBHBH (SEQ ID NO: 47)

[0209] RBRRBFQILYRBHBH (SEQ ID NO: 48)

[0210] RBRRBRFQILYBHBH (SEQ ID NO: 49)

[0211] RBRRBRYQFLIHBHBH (SEQ ID NO: 50)

[0212] RBRRBRILFQYHBHBH (SEQ ID NO: 51)

[0213] RBRRBRRFQILYHBHBH (SEQ ID NO: 52)

[0214] Preferably, the peptide can be selected from any of the following additional sequences:

[0215] RBRRBRFQILYBRBS (SEQ ID NO: 53)

[0216] RBRRBRFQILYBRB[Hyp] (SEQ ID NO: 54)

[0217] RBRRBRFQILYBR[Hyp]R (SEQ ID NO: 55)

[0218] RRBRRBRFQILYBRBR (SEQ ID NO: 56)

[0219] BRRBRRFQILYBRBR (SEQ ID NO: 57)

[0220] RBRRBRWWWBRBR (SEQ ID NO: 58)

[0221] RBRRBRWWPWWBRBR (SEQ ID NO: 59)

[0222] RBRRBRWPWWBRBR (SEQ ID NO: 60)

[0223] RBRRBRWWPWBRBR (SEQ ID NO: 61)

[0224] RBRRBRRWWWRBRBR (SEQ ID NO: 62)

[0225] RBRRBRRWWPWWRBRBR (SEQ ID NO: 63)

[0226] RBRRBRRWPWWRBRBR (SEQ ID NO: 64)

[0227] RBRRBRRWWPWRBRBR (SEQ ID NO: 65)

[0228] RBRRBRRFQILYBRBR (SEQ ID NO: 66)

[0229] RBRRBRRFQILYRBR (SEQ ID NO: 67)

[0230] BRBRBWWPWWRBRRBR (SEQ ID NO: 68)

[0231] RBRRBRRFQILYBHBH (SEQ ID NO: 69)

[0232] RBRRBRRFQIYRBHBH (SEQ ID NO: 70)

[0233] RBRRBRFQILYBRBH (SEQ ID NO: 71)

[0234] RBRRBRFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 72)

[0235] R[Hyp]RR[Hyp]RFQILYRBHBH (SEQ ID NO: 73)

[0236] R[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 74)

[0237] RBRRBRWWWRBHBH (SEQ ID NO: 75)

[0238] RBRRBRWWPRBHBH (SEQ ID NO: 76)

[0239] RBRRBRPWWRBHBH (SEQ ID NO: 77)

[0240] RBRRBRWWPWWRBHBH (SEQ ID NO: 78)

[0241] RBRRBRWWPWRBHBH (SEQ ID NO: 79)

[0242] RBRRBRWPWWRBHBH (SEQ ID NO: 80)

[0243] RBRRBRRWWWRBHBH (SEQ ID NO: 81)

[0244] RBRRBRRWWPWWRBHBH (SEQ ID NO: 82)

[0245] RBRRBRRWPWWRBHBH (SEQ ID NO: 83)

[0246] RBRRBRRWWPWRBHBH (SEQ ID NO: 84)

[0247] RRBRRBRFQILYRBHBH (SEQ ID NO: 85)

[0248] BRRBRRFQILYRBHBH (SEQ ID NO: 86)

[0249] RRBRRBRFQILYBHBH (SEQ ID NO: 87)

[0250] BRRBRRFQILYBHBH (SEQ ID NO: 88)

[0251] RBRRBHRFQILYRBHBH (SEQ ID NO: 89)

[0252] RBRRBRFQILY[Hyp]R[Hyp]R (SEQ ID NO: 90)

[0253] R[Hyp]RR[Hyp]RFQILYBRBR (SEQ ID NO: 91)

[0254] R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R (SEQ ID NO: 92)

[0255] RBRRBRWWWBRBR (SEQ ID NO: 93)

[0256] RBRRBRWWPWWBRBR (SEQ ID NO: 94).

[0257] More More:

[0258] RBRRBRRFQILYRBRBR (SEQ ID NO: 27)

[0259] RBRRBRRYQFLIRBRBR (SEQ ID NO: 31)

[0260] RBRRBRRILFQYRBRBR (SEQ ID NO: 32)

[0261] RBRRBRFQILYBRBR (SEQ ID NO: 35)

[0262] RBRRBRRFQILYRBHBH (SEQ ID NO: 37)

[0263] RBRRBRRFQILYHBHBR (SEQ ID NO: 38)

[0264] RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0265] In one embodiment of the invention, the peptide consists of the following sequence: RBRRBRFQILYBRBR (SEQ ID NO: 35).

[0266] In one embodiment of the invention, the peptide consists of the following sequence: RBRRBRRFQILYRBHBH (SEQ ID NO: 37).

[0267] In one embodiment of the invention, the peptide consists of the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0268] Therapeutic Molecule

[0269] A peptide carrier is covalently linked to a therapeutic molecule to produce a conjugate according to the invention, wherein the therapeutic molecule is a nucleic acid containing a plurality of trinucleotide repeats.

[0270] Preferably, the nucleic acid can be selected from: an antisense oligonucleotide (such as PNA, PMO), mRNA, gRNA (guide RNA) (such as that used in CRISPR / Cas9 technology), short interfering RNA, microRNA, and anti-miRNA (antagomiRNA).

[0271] Preferably, the nucleic acid is an antisense oligonucleotide.

[0272] Preferably, the antisense oligonucleotide is a phosphorodiamidate morpholine oligonucleotide (PMO).

[0273] Alternatively, the antisense oligonucleotide may be a modified PMO or any other charge-neutral antisense oligonucleotide, such as a peptide nucleic acid (PNA), a chemically modified PNA such as gamma-PNA (Banal, Nat. Comm. 2016), an oligonucleotide phosphoramidate (in which the non-bridged oxygen of the phosphate is replaced by an amine or alkylamine, as described in WO 2016 / 028187A1), or any other partially or completely charge-neutralized oligonucleotide.

[0274] Preferably, the nucleic acid consists of multiple trinucleotide repeats.

[0275] Preferably, the nucleic acid comprises any trinucleotide repeat. Preferably, the nucleic acid comprises trinucleotide repeats selected from the following repeats: GTC, CAG, GCC, GGC, CTT, and CCG. Preferably, the nucleic acid consists of trinucleotide repeats selected from the following repeats: GTC, CAG, GCC, GGC, CTT, and CCG.

[0276] Preferably, the nucleic acid comprises CAG repeats. Preferably, the nucleic acid consists of CAG repeats.

[0277] In one embodiment of the invention, the nucleic acid is an antisense oligonucleotide containing CAG repeats. In one embodiment of the invention, the nucleic acid is an antisense oligonucleotide consisting of CAG repeats.

[0278] Preferably, the nucleic acid comprises or consists of a plurality of trinucleotide repeats. Preferably, the nucleic acid comprises or consists of at least 2 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5-50 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5-40 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5-30 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5-20 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 5-10 trinucleotide repeats. Preferably, the nucleic acid comprises or consists of 7 trinucleotide repeats.

[0279] In one embodiment of the invention, the nucleic acid is an antisense oligonucleotide comprising 7 CAG repeats. In one embodiment of the invention, the nucleic acid is an antisense oligonucleotide consisting of 7 CAG repeats. Preferably, in said embodiment, the nucleic acid is an antisense oligonucleotide consisting of [CAG]7.

[0280] Preferably, the nucleic acid is complementary to a microsatellite region, preferably a repeat expansion region, preferably a trinucleotide repeat expansion region.

[0281] Preferably, the nucleic acid targets and binds to microsatellite regions. Preferably, the microsatellite regions contain repeat expansions, preferably they contain trinucleotide repeat expansions.

[0282] In some embodiments of the invention, repeat expansions may include expansions of longer repeats, such as expansions of tetra-, penta-, hexa-, hepta-, octo-, nona-, or deca-, etc., repeats comprising four, five, six, eight, nine, or ten nucleotides per repeat, respectively.

[0283] Thus, in some embodiments of the invention, the therapeutic molecule is a nucleic acid comprising a plurality of tetra-, penta-, hexa-, hepta-, octo-, nona-, or deca-nucleotide repeats. Thus, in some embodiments of the invention, the therapeutic molecule is a nucleic acid consisting of a plurality of tetra-, penta-, hexa-, hepta-, octo-, nona-, or deca-nucleotide repeats.

[0284] In the present description, any statements regarding nucleic acids that contain trinucleotide repeats apply equally to nucleic acids containing longer nucleotide repeats.

[0285] Preferably, the nucleic acid binds to a complementary microsatellite region, preferably to a complementary repeat expansion region, preferably to a complementary trinucleotide repeat expansion region.

[0286] Microsatellite regions are preferably present in DNA or RNA. Microsatellite regions are preferably present in RNA.

[0287] Preferably, microsatellite regions may be present in coding or non-coding sequences. Preferably, microsatellite regions are present in non-coding sequences, such as the 3' or 5' UTR. Preferably, microsatellite regions are present in the 3' UTR.

[0288] Preferably, the nucleic acid may be formed by a trinucleotide repeat that binds to a complementary region of a trinucleotide repeat expansion.

[0289] Preferably, the nucleic acid may be formed by a trinucleotide repeat that binds to a complementary region of a trinucleotide repeat expansion in RNA.

[0290] Preferably, the nucleic acid may be formed by a trinucleotide repeat that binds to a complementary trinucleotide repeat expansion region in a non-coding sequence of RNA.

[0291] Preferably, the nucleic acid may be formed by a trinucleotide repeat that binds to a complementary trinucleotide repeat expansion site in the untranslated region of RNA.

[0292] In one embodiment of the invention, the nucleic acid may be formed by a trinucleotide repeat that binds to a complementary region of a trinucleotide repeat expansion in the 3'UTR of RNA.

[0293] Optionally, lysine residues can be added to one or both ends of the nucleic acid (such as PMO or PNA) prior to attachment to the peptide carrier to enhance aqueous solubility.

[0294] Trinucleotide repeat disorder The conjugate of the present invention is intended for use as a medicine, preferably for the prevention or treatment of trinucleotide repeat disorders.

[0295] Preferably, the trinucleotide repeat disorder is a genetic disorder associated with an expansion of trinucleotide repeats, which may also be referred to as a triplet repeat expansion.

[0296] Preferably, the trinucleotide repeat expansion is present in a gene. Preferably, the trinucleotide repeat expansion is present in a gene selected from: ATN1, HTT, AR, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, FMR1, AFF2, FXN, DMPK, SCA8, JPH3, and PPP2R2B.

[0297] Preferably, the trinucleotide repeat expansion is present in the AR, SCA8, or DMP gene.

[0298] In one embodiment of the invention, the trinucleotide repeat expansion is present in the DMPK gene.

[0299] Preferably, the trinucleotide repeat expansion is formed by repeats selected from: CAG, CTG, CGG, CCG, GAA, TTC, and GGC.

[0300] Preferably, the expansion of trinucleotide repeats is formed by CAG or CTG repeats.

[0301] In one embodiment of the invention, the trinucleotide repeat expansion is formed by CTG repeats.

[0302] Typically, trinucleotide repeat disorders result from the expansion of a specific trinucleotide repeat within a specific gene. Typically, the number of trinucleotide repeats present in a gene is higher than the number of trinucleotide repeats present in the same gene in a healthy individual.

[0303] Preferably, the trinucleotide repeat expansion is a CAG repeat expansion in a gene selected from: ATN1, HTT, AR, ATXN1, ATXN, ATXN3, CACNA1A, ATXN7, JPH3 and TBP.

[0304] Preferably, trinucleotide repeat disorders associated with CAG repeats are referred to as "polyglutamine disorders." Thus, preferably, a trinucleotide repeat disorder may be a polyglutamine disorder. Preferably, the polyglutamine disorder can be selected from: DRPLA (dentatorubropallidolus atrophy), HD (Huntington's disease), HDL2 (Huntington's disease syndrome type 2), SBMA (spinal and bulbar muscle atrophy), SCA1 (spinocerebral ataxia type 1), SCA2 (spinocerebral ataxia type 2), SCA3 (spinocerebral ataxia type 3 or Machado-Joseph disease), SCA6 (spinocerebral ataxia type 6), SCA7 (spinocerebral ataxia type 7) and SCA17 (spinocerebral ataxia type 17).

[0305] Preferably, the trinucleotide repeat expansion is a CGG repeat expansion in a gene selected from: FMR1.

[0306] Preferably, the trinucleotide repeat expansion is a CCG repeat expansion in a gene selected from: AFF2.

[0307] Preferably, the trinucleotide repeat expansion is a GAA repeat expansion in a gene selected from FXN.

[0308] Preferably, the trinucleotide repeat expansion is a CTG repeat expansion in a gene selected from DMPK and ATXN8.

[0309] Preferably, the trinucleotide repeat expansion is a GTC repeat expansion in a gene selected from JPH3.

[0310] Preferably, the trinucleotide repeat disorders are associated with trinucleotide repeats other than the CAG repeat, referred to as "non-polyglutamine diseases." Thus, preferably, the trinucleotide repeat disorders may be a non-polyglutamine disorder. Preferably, the non-polyglutamine disorder can be selected from: HDL2 (Huntington's disease syndrome type 2), FRAXA (fragile X syndrome), FXTAS (fragile X-associated tremor / ataxia syndrome), FRAXE (fragile XE-associated mental retardation), FRDA (Friedreich's ataxia), DM1 (myotonic dystrophy type 1), SCA8 (spinocerebral ataxia type 8), and SCA12 (spinocerebral ataxia type 12).

[0311] Preferably, the trinucleotide repeat disorder results from an expansion of the trinucleotide repeats compared to a healthy individual. Preferably, it results from an expansion of the trinucleotide repeats in a gene compared to the same gene in a healthy individual. Preferably, the number of trinucleotide repeats in the trinucleotide repeat expansion is increased compared to the number of trinucleotide repeats in a healthy individual.

[0312] Preferably, the number of repeats in the trinucleotide repeat expansion is at least 1.5 times (1.5x) the number of repeats in a healthy individual. Preferably, the number of repeats in the trinucleotide repeat expansion is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 times the number of repeats in a healthy individual.

[0313] A preferentially trinucleotide repeat disorder results from an increase in the number of repeats in a trinucleotide repeat expansion by at least 1.5 times the number of repeats in a healthy individual.

[0314] A preferentially trinucleotide repeat disorder results from at least a 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 15-, 20-, 25-, 30-, 35-, 40-, 45-, or 50-fold increase in the number of repeats in a trinucleotide repeat expansion relative to the number of repeats in a healthy individual.

[0315] Preferably, the number of repeats in the expansion of trinucleotide repeats is 1.5-15 times higher than the number of repeats in a healthy individual.

[0316] A preferentially trinucleotide repeat disorder results from at least a 1.5- to 15-fold increase in the number of repeats in a trinucleotide repeat expansion relative to the number of repeats present in a healthy individual.

[0317] The repeat number in the trinucleotide expansion is preferably more than 50, more than 75, more than 100, more than 125, more than 150, more than 175, more than 200, more than 225, more than 250.

[0318] The disorder caused by a predominance of trinucleotide repeats results from an expansion of trinucleotide repeats in which the number of repeats is more than 50, more than 75, more than 100, more than 125, more than 150, more than 175, more than 200, more than 225, more than 250 repeats.

[0319] The number of repeats in trinucleotide expansion is preferably more than 50.

[0320] Preferential trinucleotide repeat disorder is a disorder resulting from an expansion of trinucleotide repeats in which the number of repeats is greater than 50.

[0321] The preferred repeat number for trinucleotide expansion is 50 to 250.

[0322] Preferential trinucleotide repeat disorder results from an expansion of trinucleotide repeats, with the number of repeats ranging from 50 to 250.

[0323] Preferential trinucleotide repeat disorder is a non-polyglutamine disorder.

[0324] The trinucleotide repeat disorder is predominantly DM1 or SCA8.

[0325] In one embodiment of the invention, the trinucleotide repeat disorder is DM1.

[0326] In one embodiment of the invention, the trinucleotide repeat disorder is DM1, the number of repeats in the trinucleotide expansion is more than 50. In one embodiment of the invention, when the trinucleotide repeat disorder is DM1, the number of CTG repeats in the trinucleotide expansion is more than 50. In one embodiment of the invention, when the trinucleotide repeat disorder is DM1, the number of CTG repeats in the trinucleotide expansion in the DMPK gene is more than 50.

[0327] In one embodiment of the invention, when the trinucleotide repeat disorder is SCA8, the number of repeats in the trinucleotide expansion is from 110 to 250. In one embodiment of the invention, when the trinucleotide repeat disorder is SCA8, the number of CTG repeats in the trinucleotide expansion is from 110 to 250. In one embodiment of the invention, when the trinucleotide repeat disorder is SCA8, the number of CTG repeats in the trinucleotide expansion in the ATXN8 gene is from 110 to 250.

[0328] In some embodiments, the conjugate of the present invention is for use as a medicine, preferably for the prevention or treatment of nucleotide repeat disorders.

[0329] Preferably, the nucleotide repeat disorder is a genetic disorder associated with an expansion of nucleotide repeats, which may also be referred to as a repeat expansion or a microsatellite repeat expansion.

[0330] Preferably, the nucleotide repeat disorder may be caused by expansion of repeats consisting of four, five, six, seven, eight, nine, or ten nucleotides.

[0331] Preferably, the expansion of nucleotide repeats may be an expansion of the above-mentioned longer nucleotides, for example, an expansion of penta-, hexa-, hepta-, octa-, nona-, or decanucleotide repeats.

[0332] Thus, preferably the conjugate according to the present invention is intended for use as a medicine, preferably for the prevention or treatment of disorders caused by penta-, hexa-, hepta-, octa-, nona- or decanucleotide repeats.

[0333] Preferably, the nucleotide repeat expansion is a tetranucleotide repeat expansion, preferably the tetranucleotide repeat is a CCTG repeat.

[0334] Thus, preferably the conjugate provided in the present invention is for use as a medicine, preferably for the prevention or treatment of DM2 (myotonic dystrophy type 2).

[0335] Preferably, the nucleotide repeat expansion is a pentanucleotide repeat expansion, preferably the pentanucleotide repeat is an ATTCT repeat.

[0336] Thus, preferably the conjugate provided in the present invention is for use as a medicine, preferably for the prevention or treatment of SCA10 (spinocerebral ataxia type 10).

[0337] Thus, preferably the conjugate provided in the present invention is for use as a medicine, preferably for the prevention or treatment of SCA31 (spinocerebral ataxia type 31).

[0338] Preferably, the nucleotide repeat expansion is a hexanucleotide repeat expansion, preferably the hexanucleotide repeat is a GGCCTG repeat or a GGGGCC repeat.

[0339] Thus, preferably the conjugate provided in the present invention is for use as a medicine, preferably for the prevention or treatment of SCA36 (spinocerebral ataxia type 36).

[0340] Thus, preferably the conjugate provided in the present invention is for use as a medicine, preferably for the prevention or treatment of C90RF72-ALS (amyotrophic lateral sclerosis).

[0341] In this description, any provisions regarding the treatment of disorders caused by trinucleotide repeats apply equally to the treatment of disorders caused by longer nucleotide repeats, such as disorders caused by penta-, hexa-, hepta-, octa-, nona-, or decanucleotide repeats.

[0342] Covalent bond

[0343] The peptide carrier present in the conjugate of the invention is covalently linked to the therapeutic molecule.

[0344] Preferably, the peptide carrier is covalently linked to the therapeutic molecule at the C-terminus or N-terminus. Preferably, the peptide carrier is covalently linked to the therapeutic molecule at the C-terminus.

[0345] Preferably, if necessary, the peptide carrier is covalently linked to the therapeutic molecule via a linker. The linker can act as a spacer, separating the peptide sequence from the therapeutic molecule.

[0346] The linker can be selected from any acceptable sequence.

[0347] Preferably, a linker is present between the peptide and the therapeutic molecule. Preferably, the linker is a group different from the peptide and the therapeutic molecule. Thus, the linker may contain artificial amino acids.

[0348] In one embodiment of the invention, the conjugate comprises a peptide carrier covalently linked via a linker to a therapeutic molecule.

[0349] In one embodiment of the invention, the conjugate comprises the following structure:

[0350] [peptide]-[linker]-[therapeutic molecule].

[0351] In one embodiment of the invention, the conjugate consists of the following structure:

[0352] [peptide]-[linker]-[therapeutic molecule].

[0353] Preferably, any of the peptides described herein can be used in the conjugate of the invention. In one embodiment of the invention, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), and RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0354] Preferably, in any case, the peptide carrier may further comprise the N-terminal modifications described above.

[0355] Suitable linkers include, for example, a C-terminal cysteine ​​residue that allows for the formation of a disulfide, thioester, or thiolmaleimide bond, a C-terminal aldehyde for the formation of an oxime, modular elements for a click reaction or the formation of a morpholine bond with a basic amino acid on a peptide, or a carboxylic acid residue on a peptide covalently conjugated to an amino group to form a carboxamide bond.

[0356] Preferably, the linker is from 1 to 5 amino acids in length. Preferably, the linker can be any linker known in the art.

[0357] Preferably, the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, XB, succinic acid, GABA and E. Preferably, X is 6-aminocaproic acid.

[0358] Preferably, the linker may be a polymer, such as PEG.

[0359] Preferably, the linker is selected from: beta-alanine (B), succinic acid (Succ), GABA (Ab), and glutamic acid (E).

[0360] In one embodiment of the invention, the linker is beta-alanine (B).

[0361] In one embodiment of the invention, the peptide carrier is conjugated to the therapeutic molecule via a carboxamide bond.

[0362] The linker included in the conjugate may form part of the therapeutic molecule to which the peptide is attached. Alternatively, the therapeutic molecule may be attached by direct linkage to the C-terminus or N-terminus of the peptide carrier. Preferably, in these embodiments, a linker is not required.

[0363] Alternatively, the peptide carrier can be chemically conjugated to the therapeutic molecule. Chemical linkages that can be used include, for example, disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphates, or thiol-maleimide linkages.

[0364] Optionally, cysteine ​​can be added to the N-terminus of the therapeutic molecule to allow for disulfide bond formation with the peptide carrier, or the N-terminus can be bromoacetylated to allow thioester conjugation with the peptide carrier.

[0365] In one embodiment of the invention, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), covalently linked via a linker to an antisense oligonucleotide containing CAG repeats, in which the linker is selected from: beta-alanine (B), GABA (Ab) and glutamic acid (E).

[0366] In one embodiment of the invention, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), covalently linked via a linker to an antisense oligonucleotide consisting of CAG repeats, in which the linker is selected from: beta-alanine (B), GABA (Ab) and glutamic acid (E).

[0367] In one embodiment of the invention, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), covalently linked via a linker to an antisense oligonucleotide consisting of seven CAG repeats, in which the linker is selected from: beta-alanine (B), GABA (Ab) and glutamic acid (E).

[0368] In one embodiment of the invention, the conjugate comprises a peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked via beta-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP1.9)

[0369] In one embodiment, the conjugate comprises a peptide carrier RBRRB RFQILYBRBR (SEQ ID NO: 35) covalently linked via glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP1.9b). In one embodiment, said conjugate has enhanced penetration into diaphragm tissue. Preferably, enhanced penetration into diaphragm tissue is valuable for the treatment of muscle disorders that affect the respiratory system, such as myotonic dystrophy.

[0370] In one embodiment, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked via beta-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP3.1). In one embodiment, said conjugate has enhanced muscle penetration. Preferably, enhanced muscle penetration is valuable for the treatment of muscle disorders.

[0371] In one embodiment, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked via glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP3.1b). In one embodiment, said conjugate has enhanced muscle penetration. Preferably, enhanced muscle penetration is valuable for the treatment of muscle disorders.

[0372] In one embodiment of the invention, the conjugate comprises a peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked via GABA (Ab) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP3.1a)

[0373] In one embodiment, the conjugate comprises a peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked via beta-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP3.8). In one embodiment, said conjugate has enhanced muscle penetration. Preferably, enhanced muscle penetration is valuable for the treatment of muscle disorders.

[0374] In one embodiment, the conjugate comprises a peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked via glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP.3.8b). In one embodiment, said conjugate has enhanced penetration into diaphragm tissue. Preferably, enhanced penetration into diaphragm tissue is valuable for the treatment of muscle disorders that affect the respiratory system, such as myotonic dystrophy.

[0375] Any of the above conjugates can be acetylated at the N-terminus.

[0376] Pharmaceutical composition and administration

[0377] The conjugate according to the invention can be prepared in the form of the above-mentioned pharmaceutical composition.

[0378] According to a sixth aspect of the present invention, a pharmaceutical composition comprises a conjugate according to the invention.

[0379] Preferably, the pharmaceutical composition may also contain one or more pharmaceutically acceptable components, such as one or more diluents, adjuvants or carriers.

[0380] Suitable pharmaceutically acceptable diluents, adjuvants or carriers are well known in the art.

[0381] As used herein, the phrase "pharmaceutically acceptable" refers to those ligands, materials, compositions, and / or dosage forms that, within the scope of acceptable medical practice, are suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic reaction, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0382] The phrase "pharmaceutically acceptable carrier" as used herein refers to a pharmaceutically acceptable material, composition, or carrier, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, that is involved in the transfer or transport of the conjugate from one organ or body part to another organ or body part. Each peptide must be "acceptable" in terms of compatibility with other components of the composition, for example, the peptide and the therapeutic molecule, and not be hazardous to the individual.

[0383] Lyophilized compositions that can be reconstituted and then administered also fall within the scope of the composition in the context of the present description.

[0384] Pharmaceutically acceptable carriers may be, for example, excipients, fillers, diluents, and combinations thereof. For example, if the compositions are intended for oral use, they can be prepared in the form of tablets, capsules, granules, powders, or syrups; or if they are intended for parenteral administration, they can be prepared in the form of injections, drip infusions, or suppositories. These compositions can be prepared by conventional methods, and, if necessary, the active substance (i.e., the conjugate) can be mixed with any conventional additive, such as an excipient, a binder, a disintegrating agent, a lubricant, a flavoring agent, a solubilizing agent, a suspending agent, an emulsifier, a coating agent, or a combination thereof.

[0385] As should be obvious, the pharmaceutical compositions provided herein may also include additional known therapeutic agents, drugs, modifications of compounds in the form of prodrugs, etc. for the alleviation, promotion, prevention and treatment of the diseases, disorders and conditions indicated herein, when used medically.

[0386] Preferably, the pharmaceutical composition is intended for use as a medicine. Preferably, it is intended for use as a medicine by the same route as described herein for the conjugate. All features described herein regarding medical treatment using the conjugate apply to the pharmaceutical composition.

[0387] Thus, a further object of the invention is a pharmaceutical composition as specified in the sixth aspect of the invention, intended for use as a medicine. A further object of the invention is a method for preventing or treating a disease state in an individual, comprising administering to the individual an effective amount of the pharmaceutical composition as specified in the sixth aspect of the invention.

[0388] Preferably, the pharmaceutical composition is for use in preventing or treating a trinucleotide-mediated disorder, and preferably, the method for preventing or treating comprises preventing or treating a trinucleotide-mediated disorder in an individual.

[0389] Prevention or treatment

[0390] The conjugate according to the invention can be used as a medicine for preventing or treating a disease, preferably a disorder caused by trinucleotide repeats.

[0391] The medicinal product may be in the form of the pharmaceutical composition described above.

[0392] Also provided is a method for preventing or treating an individual in need of treatment for a disease state, wherein the method comprises the step of administering to the individual a therapeutically effective amount of the conjugate.

[0393] Preferably, the conjugate is intended for the prevention or treatment of disorders caused by trinucleotide repeats.

[0394] In the present description, the relevant genes containing trinucleotide repeat expansions and details regarding the details of trinucleotide repeat disorders that arise as a result of the expansion are indicated above.

[0395] Alternatively, the conjugate can be used to prevent or treat other nucleotide repeat disorders. The relevant details regarding expansions of such longer repeats and the resulting nucleotide repeat disorders are described in detail above.

[0396] The specific mechanisms by which a nucleic acid derived from trinucleotide repeats may exert its effect in treating a trinucleotide repeat disorder may vary depending on the trinucleotide repeat disorder in question. Preferably, the nucleic acid binds to the site of a trinucleotide repeat expansion in a gene or transcript. Preferably, the nucleic acid reduces the number of transcripts with trinucleotide repeat expansion. Preferably, the nucleic acid prevents the pathological effects of the trinucleotide repeat expansion and, consequently, the trinucleotide repeat disorder. This also applies to other nucleotide repeat disorders.

[0397] Thus, the conjugate preferably improves the physiological condition of individuals.

[0398] For example, the function of a therapeutic nucleic acid conjugate may be to correct splicing defects caused by a trinucleotide repeat disorder. Preferably, the function of the therapeutic nucleic acid conjugate may be to normalize splicing in an individual with a trinucleotide repeat disorder.

[0399] Preferably, the function of the therapeutic nucleic acid conjugate may be binding to the transcript of the DMPK gene.

[0400] Preferably, the therapeutic nucleic acid conjugate binds to repeat expansion sites present in the DMPK gene transcript. Preferably, the therapeutic nucleic acid conjugate binds to CUG repeat expansion sites present in the DMPK gene transcript.

[0401] Thus, the conjugate preferably reduces the number of DMPK transcripts. Thus, the conjugate preferably reduces the number of DMPK transcripts with repeat expansions. Thus, the conjugate preferably reduces the number of DMPK transcripts with CUG repeat expansions.

[0402] Thus, the conjugate preferably reduces the number of nuclear foci. Preferably, the conjugate interferes with the interaction of nuclear foci with the cellular splicing machinery. Preferably, the conjugate interferes with the interaction of nuclear foci with MBNL1. Preferably, the conjugate interferes with the sequestration of MBNL1 by nuclear foci.

[0403] The actions indicated are preferably intended for use in the prevention or treatment of DM1.

[0404] Preferably, the conjugate reduces myotonia in an individual with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100% (where 100% corresponds to the state of healthy individuals). Preferably, the conjugate reduces myotonia in an individual with DM1 by at least 50%. Preferably, the conjugate reduces myotonia in an individual with DM1 by 50-100%.

[0405] Preferably, the conjugate reduces the number of nuclear foci in myoblasts in an individual with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%. Preferably, the conjugate reduces the number of nuclear foci in myoblasts in an individual with DM1 by at least 50%. Preferably, the conjugate reduces the number of nuclear foci in myoblasts in an individual with DM1 by 50-90%.

[0406] Preferably, the conjugate corrects cardiac conduction in an individual with DM 1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Preferably, the conjugate improves cardiac conduction in an individual with DM1 by at least 10%. Preferably, the conjugate improves cardiac conduction in an individual with DM1 by 10-50%.

[0407] Preferably, the conjugate improves the motor function in an individual with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Preferably, the conjugate improves the motor function in an individual with DM1 by at least 10%. Preferably, the conjugate improves the motor function in an individual with DM1 by 10-50%.

[0408] Preferably, the conjugate increases the muscle strength to body weight ratio of an individual with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Preferably, the conjugate increases the muscle strength to body weight ratio of an individual with DM1 by at least 10%. Preferably, the conjugate increases the muscle strength to body weight ratio of an individual with DM1 by 10-50%.

[0409] Preferably, the individual to be treated may be any animal or human. Preferably, the individual may be a non-human mammal. Preferably, the individual may be a male or female individual.

[0410] Preferably, the individual to be treated may be of any age. Preferably, the individual to be treated is aged from 0 to 40 years, preferably from 0 to 30 years, preferably from 0 to 25 years, preferably from 0 to 20 years.

[0411] Preferably, the conjugate is for administration to an individual systemically, such as by intramedullary, intrathecal, intraventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumor, subcutaneous, oral or nasal routes.

[0412] In one embodiment, the conjugate is for intravenous administration to an individual.

[0413] In one embodiment, the conjugate is for administration to an individual intravenously by injection.

[0414] Preferably, the conjugate is intended to be administered to an individual in a "therapeutically effective amount," defined as an amount sufficient to produce a beneficial effect on the individual. The actual amount administered and the rate and schedule of administration should depend on the nature and severity of the disorder being treated. Dosing decisions are within the discretion of ordinary practitioners and other healthcare professionals. Examples of techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th edition, 2000, published by Lippincott, Williams & Wilkins.

[0415] The exemplary doses may be 0.01mg / kg to 50mg / kg, 0.05mg / kg to 40mg / kg, 0.1mg / kg to 30mg / kg, 0.5mg / kg to 18mg / kg, 1mg / kg to 16mg / kg, 2mg / kg to 15mg / kg, 5mg / kg to 10mg / kg, 10mg / kg to 20mg / kg, 12mg / kg to 18mg / kg, 13mg / kg to 17mg / kg.

[0416] It is important to note that the dose of the conjugate proposed in the present invention is an order of magnitude or several times lower than the dose required to achieve any effect when using the therapeutic nucleic acid individually.

[0417] Preferably, after administration of the conjugate of the present invention, the level of one or more toxicity markers is significantly reduced compared to conjugates obtained using currently known peptide carriers.

[0418] Acceptable markers of toxicity may include markers of nephrotoxicity.

[0419] Serum levels of KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine aminotransferase, and aspartate aminotransferase can be used as acceptable markers of toxicity.

[0420] Urinary levels of sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein may be used as additional acceptable markers of toxicity.

[0421] Preferably, the level of at least one of KIM-1, NGAL and BUN is reduced to a greater extent after administration of the conjugate provided in the present invention, compared to conjugates obtained using currently known peptide carriers.

[0422] Preferably, the levels of each of KIM-1, NGAL and BUN are reduced to a greater extent after administration of the conjugate provided in the present invention, compared to conjugates obtained using currently known peptide carriers.

[0423] Preferably, the levels of one or each marker(s) are substantially reduced compared to conjugates prepared using currently known peptide carriers.

[0424] Preferably, the levels of one or each marker marker(s) are reduced to a greater extent, up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, after administration of the conjugates provided in the present invention, compared to conjugates obtained using currently known peptide carriers.

[0425] It is important to note that the toxicity of the conjugates is significantly reduced compared to the situation before the administration of the peptides and conjugates. In particular, KIM-1 and NGAL-1 are toxicity markers, and their levels are significantly reduced to a greater extent, up to 120-fold, compared to conjugates obtained using currently known peptide carriers.

[0426] Preferably, the chronic toxicity of the conjugate is extremely low. Preferably, there are no manifestations of chronic toxicity of the conjugate.

[0427] Preferably, the conjugate does not significantly affect gene expression in an individual other than the desired target effect on trinucleotide repeat expansion. Preferably, the conjugate does not have any adverse effects on gene expression in an individual.

[0428] Preferably, after administration of the conjugate according to the present invention, the viability of cells is increased to a significantly greater extent compared to conjugates obtained using currently known peptide carriers.

[0429] Preferably, after administration of the conjugate proposed in the present invention, the viability of myoblasts and hepatocytes is increased to a significantly greater extent compared to conjugates obtained using currently known peptide carriers.

[0430] Preferably, after administration of the conjugate proposed in the present invention, the viability of myoblasts and hepatocytes increases to a greater extent up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, compared to conjugates obtained using currently known peptide carriers.

[0431] Preferably, after administration of the conjugate according to the present invention, the viability of cells is increased to a significantly greater extent compared to conjugates obtained using currently known peptide carriers.

[0432] Preferably, after administration of the conjugate proposed in the present invention, the recovery period is reduced to a greater extent up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% compared to conjugates obtained using currently known peptide carriers.

[0433] Preferably, after administration of the conjugate according to the present invention, the recovery period is less than 60 min, less than 50 min, less than 40 min, less than 30 min, less than 20 min, less than 10 min, or less than 5 min.

[0434] Preferably, after administration of the conjugate of the present invention, there is no recovery period (zero).

[0435] Nucleic acids and hosts

[0436] The peptide carriers provided in the invention can be obtained using a standard peptide synthesis method, such as chemical synthesis, semi-chemical synthesis, or using expression systems.

[0437] Thus, the present invention also relates to nucleotide sequences that comprise or consist of DNA encoding conjugates, expression systems, such as vectors, containing said sequences in combination with sequences necessary for expression and expression control, and host cells and host organisms transformed with said expression systems.

[0438] Thus, a nucleic acid encoding the conjugate proposed in the present invention is also provided.

[0439] Preferably, the nucleic acids can be obtained in isolated or purified form.

[0440] Also provided is an expression vector comprising a nucleic acid that encodes the conjugate proposed in the present invention.

[0441] Preferably, the vector is a plasmid.

[0442] Preferably, the vector comprises a regulatory sequence, such as a promoter, operably linked to a nucleic acid encoding the conjugate of the present invention. Preferably, the expression vector is capable of expressing the conjugate upon transfection of a suitable cell, such as a mammalian cell, a bacterium, or a fungus.

[0443] Also provided is a host cell containing the expression vector of the invention.

[0444] Expression vectors can be selected depending on the host cell into which the nucleic acids according to the invention can be introduced. Said host cell transformation involves the use of generally accepted techniques, for example, those described by Sambrook et al. [Sambrook J., Russell D. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA, 2001]. The selection of suitable vectors is within the competence of those skilled in the art. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.

[0445] The resulting conjugates can be isolated from the host cells and purified by any suitable method, such as precipitation or chromatographic separation, such as affinity chromatography.

[0446] Suitable vectors, hosts, and recombination methods are well known in the art.

[0447] As used herein, the term "functionally linked" may include any situation in which the selected nucleotide sequence and the regulatory nucleotide sequence are covalently linked in such a way as to place the expression of the coding nucleotide sequence under the control of the regulatory sequence, so that the regulatory sequence can influence the transcription of the coding nucleotide sequence that forms part or all of the selected nucleotide sequence. The resulting transcript can then be translated into the desired conjugate, if desired.

[0448] The invention is described below with reference to the accompanying drawings and examples. The drawings show:

[0449] Fig. 1 - Reduction of the number of pathogenic nuclear foci and redistribution of MBNL in myoblasts containing 2600 CTG repeats from a patient with DM1. The results were obtained 48 h after transfection with various DPEP1 / 3-[CAG]7PMO conjugates at doses that did not reduce the viability of cells such as myoblasts or hepatocytes (the results shown were obtained using a concentration of 10 μM);

[0450] in Fig. 2A, B, C, D and E and Fig. 3A, B, C and D results demonstrating the ability of different DPEP1 / 3-[CAG]7PMO conjugates to correct splicing defects of Mbn1-dependent transcripts in DM1 patient myoblasts obtained from DM1 patients with a 2600 repeat content of the DMPK gene, when used at different concentrations, compared to conjugates created using the state-of-the-art peptide carriers Pip6a and Pip9b2;

[0451] Fig. 4 - Results demonstrating that systemic delivery of various DPEP 1 / 3-[CAG]7PMO conjugates at a dose of 30 mg / kg (IV, tail vein) corrected splicing defects of Mbn1-dependent transcripts in the gastrocnemius (gast.) and quadriceps (quad.) muscles of HSA-LR mice. RT-PCR analyses of clcn1 exon 7a, serca exon 22, and mbnl1 exon 5 splicing (the most widely used DM1 biomarkers) demonstrated normalization of splicing to wild-type levels when using DPEP1- and 3-based conjugates. Data from six HSA-LR mice per PMO-peptide assay were analyzed by ANOVA and Tukey's post hoc test compared to untreated HSA-LR mice. Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns - not significant);

[0452] Fig. 5 - percentage of myoblast cell viability after transfection for 48 hours of myoblasts from a patient with DM1 containing 2600 CTG repeats with various DPEP1 / 3-[CAG]7PMO conjugates at different doses. It was found that the concentrations of DPEP1 / 3-[CAG]7PMO conjugates can be increased several times relative to therapeutic levels without causing cell death of myoblasts, in contrast to conjugates created using the peptide carriers Pip6a and Pip9b2 known from the existing state of the art;

[0453] in Fig. 6 - the percentage of hepatocyte cell viability after transfection for 48 hours of myoblasts from a patient with DM1 containing 2600 CTG repeats with various DPEP1 / 3-[CAG]7 conjugates and the conjugates used for comparison. It was found that the concentrations of DPEP1 / 3-[CAG]7PMO conjugates can be increased several times relative to therapeutic levels without causing cell death of hepatocytes, in contrast to conjugates created using the peptide carriers Pip6a and Pip9b2 known from the existing state of the art;

[0454] Figures 7 and 9 show the results of electromyographic measurements of myotonia performed in the gastrocnemius muscles of HSA-LR mice 2 weeks after single-dose administration of different DPEP1 / 3-[CAG]7PMO conjugates (30 mg / kg, n=6, IV, tail vein). Data were analyzed by ANOVA and Tukey's post hoc test compared with untreated HSA-LR mice and the reference DPEP5.7 conjugate. Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns - not significant);

[0455] in Fig. 10 - data concerning individual test parameters;

[0456] Fig. 8 shows the results of myotonia measurements, corresponding to the data shown in Figs. 8 and 10, in HSA-LR mice 2 weeks after single dose administration of different DPEP1 / 3-[CAG]7PMO conjugates (30 mg / kg, n=6, IV, tail vein). Data were analyzed by unpaired Student's t-test compared with untreated HSA-LR mice and the reference DPEP5.7 conjugate. Data are presented as mean ± SEM;

[0457] Fig. 10A, B and C show serum ALP, ALT and AST levels collected 7 days after injection from female C57BL6 mice (8-10 weeks old, n=5 per group) administered various DPEP1 / 3-[CAG]7PMO conjugates by bolus IV injection (tail vein) compared to saline. ALP, ALT and AST levels were similar to those after control saline injections, in contrast to the fold increases induced by the Pip series peptide carriers known from the prior art;

[0458] Fig. 11A shows the levels of KIM-1 detected in urine 2 days and 7 days after injection of various DPEP1 / 3-[CAG]7PMO conjugates into female C57BL6 mice, measured by ELISA (R&D, catalog #MKM100), using samples diluted to match a standard curve. Values ​​were normalized to urinary creatinine levels (Harwell) to calculate urine protein concentration. KIM-1 levels were similar to those detected after control injections of saline, in contrast to the fold increases induced by the prior art Pip series peptide carriers;

[0459] Fig. 11B and C show serum BUN and creatinine levels 7 days after injection of various DPEP1 / 3-[CAG]7PMO conjugates into female C57BL6 (Harwell) mice compared to saline. BUN and creatinine levels were similar to those after control saline injections, in contrast to the fold increases induced by the Pip series peptide carriers known from the prior art;

[0460] Fig. 12 and 13 show the KIM-1 / creatinine ratio data detected in urine 2, 7, and 14 days after injection of DPEP3.8-[CAG]7PMO conjugate to female C57BL6 mice at a dose of 30 mg / kg or 6 doses of 5 mg / kg compared to saline. Creatinine and KIM-1 levels were similar to those detected after control injections of saline, in contrast to the fold increases induced by the Pip series peptide carriers known from the prior art;

[0461] Fig. 14A, B, C, and D show urinary sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein levels following injection of various DPEP1 / 3-[CAG]7PMO conjugates into female C57BL6 mice (8-12 weeks old, n=5 per group) at doses of 5, 7.5, and 30 mg / kg compared with saline. Whiskers indicate SEM;

[0462] Fig. 15 shows the body weight data of HSA-LR mice after treatment with DPEP3.8-[CAG]7PMO conjugate. Long-term evaluation of the body weight of 5 HSA-LR mice injected with a single dose of 30 mg / kg showed no significant decrease compared with the weight of 5 HSA-LR mice injected with saline;

[0463] Figure 16 shows delivery assay data based on the biodistribution of various DPEP1 / 3-[CAG]7PMO conjugates, obtained by ELISA 2 weeks after IV administration of 30 mg / kg conjugate or 3 x 200 mg / kg naked, unconjugated PMO to HSA-LR mice. Biodistribution assessment of DPEP1.9 and DPEP3.8 conjugates demonstrated optimal delivery to tissues most susceptible to damage in DM1. PMO was detected by a custom-made ELISA assay using digoxigenin- and biotin-labeled probes. At 2 weeks post-treatment, PMO concentrations in muscle tissue were still >1 nM compared to the low picomolar concentrations found after injections of naked PMO (despite a >20-fold difference in molarity between naked PMO and DPEP-PMO conjugate treatments) (n=4). Data are presented as mean ± SEM. Statistical analysis: one-way ANOVA with Tukey's post-hoc test;

[0464] Figure 17 shows the pharmacokinetic properties of various DPEP1 / 3-[CAG]7PMO conjugates as measured in serum following a single 5 mg / kg dose. Custom-made ELISAs were used to quantify serum concentrations, which reached 500-800 nM 5 min after IV injection of the compounds at a dose of 5 mg / kg, decreasing to 100 nM after 1 h and 10 nM after 3 h. At 6 h after administration, concentrations were ~1 nM, by which time most of the compounds had already been eliminated from the body or delivered to the tissues of interest;

[0465] Fig. 18A, B, C, and D demonstrate in more detail that systemic delivery of different DPEP1 / 3-[CAG]7PMO conjugates corrects splicing defects of Mbnl-dependent transcripts in the gastrocnemius muscles of HSA-LR mice. RT-PCR analysis of splicing of Clcn1 exon 7a, Mbnl1 exon 22, exon 5, and Ldb3 exon 11 revealed normalization of splicing to wild-type levels with DPEP1.9- and DPEP3.8-based conjugates at doses of 30 and 40 mg / kg. Splicing correction was maintained for at least 3 months after treatment and was also significant after single administration of lower doses (5 and 7.5 mg / kg) (boxes represent quartile distributions, highlights represent median values, whiskers represent variability outside the upper and lower quartiles, n=5 per group);

[0466] Fig. 19A, B, and C show that myotonia in HSA-LR mice is corrected to wild-type levels (from 4 to 0) following single administration of 30 or 40 mg / kg DPEP3.8 and DPEP1.9 conjugates. This correction was maintained for at least 3 months after treatment (A). Dividing the dose into four injections (4×7.5 mg / kg) reduced myotonia to 50% (B), while reducing the dose to 4×5 mg / kg resulted in a 20-25% reduction two weeks after the last injection (C) (whiskers indicate SEM); (n=6, IV, tail vein);

[0467] Fig. 20. Results of toxicology screening of serum and urine 2 days and 1 week after IV administration of different DPEP1 / 3-[CAG]7PMO conjugates to HSA-LR mice (8-12 weeks old, n=5 per group), demonstrating no significant changes at doses at which the conjugates are able to normalize the phenotype of HSA-LR mice. Only after treatment with DPEP1.9, DPEP3.8, DPEP3.1, and DPEP3.1b at 30 mg / kg or 40 mg / kg and only 2 days after treatment was a significant change in KIM1 levels detected compared to saline-treated HSA-LR mice, whiskers indicate SEM;

[0468] Fig. 21 shows the correction of the DM1 phenotype (myotonia) in HSA-LR mice over several weeks after the first injection using different dosing regimens including: 4 doses of 5 mg / kg DPEP3.8-[CAG]7PMO conjugate, 4 doses of 7.5 mg / kg DPEP3.8-[CAG]7PMO conjugate, a single dose of 7.5 mg / kg DPEP3.8-[CAG]7PMO conjugate, a single dose of 30 mg / kg DPEP3.8-[CAG]7PMO conjugate, or a single dose of 40 mg / kg DPEP3.8-[CAG]7PMO conjugate. A reduction in myotonia was achieved after treatment with the DPEP3.8-[CAG]7PMO conjugate in low doses (5-7.5 mg / kg), and this treatment did not lead to any toxicity;

[0469] Fig. 22 shows the correction of the DM1 phenotype (myotonia) in HSA-LR mice over several weeks after the first injection using different dosing regimens including: 4 doses of 5 mg / kg DPEP1.9-[CAG]7PMO conjugate, 4 doses of 7.5 mg / kg DPEP1.9-[CAG]7PMO conjugate, a single dose of 7.5 mg / kg DPEP1.9-[CAG]7PMO conjugate, or a single dose of 40 mg / kg DPEP1.9-[CAG]7PMO conjugate. A reduction in myotonia was achieved after treatment with the DPEP1.9-[CAG]7PMO conjugate in low doses (5-7.5 mg / kg), this treatment did not lead to any toxicity;

[0470] Fig. 23 - PMO concentrations (pM) in various tissues 2 weeks after IV administration of naked PMO (3 doses of 200 mg / kg), DPEP3.8-[CAG]7PMO conjugate at a dose of 30 mg / kg, DPEP3.8b-[CAG]7PMO conjugate at a dose of 30 mg / kg, DPEP3.8-[CAG]7PMO conjugate at a dose of 7.5 mg / kg and DPEP3.8-[CAG]7PMO conjugate at a dose of 40 mg / kg to HSA-LR mice. Both peptides (DPEP3.8 and DPEP3.8b) were able to successfully deliver PMO to muscles, with a concentration of >6 nM achieved in skeletal muscle;

[0471] Fig. 24 - PMO concentrations (pM) in various tissues 2 weeks after IV administration of naked PMO (3 doses of 200 mg / kg), DPEP1.9-[CAG]7PMO conjugate at a dose of 30 mg / kg, DPEP1.9b-[CAG]7PMO conjugate at a dose of 30 mg / kg, DPEP1.9-[CAG]7PMO conjugate at a dose of 7.5 mg / kg and DPEP1.9-[CAG]7PMO conjugate at a dose of 40 mg / kg to HSA-LR mice. Both peptides (DPEP1.9 and DPEP1.9b) were able to successfully deliver PMO to muscles, with the DPEP1.9b-[CAG]7PMO conjugate being most successful in reaching the diaphragm (>15 nM 2 weeks after a single IV injection at 30 mg / kg);

[0472] Fig. 25 - PMO concentrations (pM) in various tissues 2 weeks after IV administration of naked PMO (3 doses of 200 mg / kg), DPEP3.1-[CAG]7PMO conjugate at a dose of 30 mg / kg, DPEP3.1a-[CAG]7PMO conjugate at a dose of 30 mg / kg and DPEP3. 1b-[CAG]7PMO conjugate at a dose of 30 mg / kg to HSA-LR mice. Three peptides (DPEP3.1, DPEP3.1a and DPEP3.1b) had the ability to deliver PMO to both skeletal and cardiac muscles (>1 nM);

[0473] Fig. 26, 27 and 28 show the results of toxicological screening of KIM-1 levels relative to creatinine levels measured in urine at various time intervals following systemic IV administration to mice of various peptide-[CAG]7PMO conjugates according to the invention at various doses compared to saline, compared to naked PMO-[CAG]7, and compared to conjugates with the peptide Pip-[CAG]7PMO. The peptide DPEP-[CAG]7PMO conjugates according to the invention retained low toxicity even when administered at higher doses compared, in particular, to the conjugate Pip6a-[CAG]7PMO. DPEP conjugates did not affect toxicity biomarkers at dosing regimens that returned the DM1 phenotype to normal, healthy levels.As used in the present description and in the claims, the terms "consists of" and "comprises" and variations thereof mean "includes, but is not limited to," and are not intended (and are not intended) to exclude other portions, additives, components, integers, or steps. As used in the present description and in the claims, the singular does not exclude the plural unless the context otherwise requires. In particular, references to a term in the singular in the present description also imply references in the plural unless the context otherwise requires.

[0474] It is understood that features, integers, characteristics, compounds, chemical moieties, or groups mentioned in connection with a particular object, embodiment, or example of the invention are applicable to any other object, embodiment, or example specified in this description, unless incompatible. All features specified in this description (including any appended claims, abstract, and drawings) and / or all steps of any method or process described may be combined in any combination, except for combinations in which at least one of the specified features and / or steps is mutually exclusive.

[0475] The invention is not limited to the details of any of the above embodiments. The invention claims any new single feature or any new combination of features set forth in this description (including any appended claims, abstract and drawings), or any new single step or any new combination of steps of any method or process set forth in this description. The examiner is referred to all articles and documents related to this description that are filed concurrently with or preceding this application and that are publicly available in conjunction with this description, and the contents of all such articles and documents are incorporated herein by reference.

[0476] Examples

[0477] Materials and Methods

[0478] Synthesis and production of R-RMO

[0479] 9-Fluoroenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yloxytrispyrrolidinophosphonium (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc-β-Ala-OH preloaded Wang resin (0.19 or 0.46 mmol / g) were purchased from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was purchased from Sigma-Aldrich. HPLC-grade acetonitrile, methanol, and synthetic-grade N-methyl-2-pyrrolidone (NMP) were purchased from Scientific (Loughborough, UK). Peptide-grade N,N-dimethylformamide (DMF) and diethyl ether were purchased from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were purchased from Alfa Aesar (Heysham, UK). PMO was purchased from Gene Tools Inc. (Philomath, USA). All other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated.MALDI-TOF mass spectrometry was performed using a Voyager DE Pro Bio Spectrometry workstation. A stock solution containing 10 mg / mL of α-cyano-4-hydroxycinnamic acid or sinapic acid in 50% acetonitrile in water served as the matrix. The error limits were ±0.1%.

[0480] Synthesis and screening of peptides for R-RMO

[0481] a) Obtaining a library of peptide variants

[0482] Peptides were either prepared at 10 μmolar scale using an Intavis Parallel Peptide Synthesizer or at 100 μmolar scale using a CEM Liberty Blue™ peptide synthesizer (Buckingham, UK) with preloaded Fmoc-β-Ala-OH Wang resin (0.19 or 0.46 mmol / g, Merck Millipore) using standard Fmoc chemistry and following the manufacturer's recommendations. For syntheses using the Intavis Parallel Peptide Synthesizer, duplicate coupling steps were used with PyBOP / NMM coupling mix, followed by capping with acetic anhydride after each step. For synthesis using the CEM Liberty Bluer peptide synthesizer, single standard couplings were performed for all amino acids except arginine, for which double couplings were performed.The coupling was performed once at 75°C for 5 min at 60 W microwave power, except for arginine residues, which were coupled twice. Each deprotection reaction was performed twice at 75°C, once for 30 s and then for 3 min at 60 W microwave power. After completion of the synthesis, the resin was washed with DMF (3 × 50 mL), and the N-terminus of the solid-phase-bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room temperature. After N-terminus acetylation, the resin-bound peptide was washed with DMF (3 × 20 mL) and DCM (3 × 20 mL). Peptides were cleaved from the solid support by treatment with a cleavage mixture consisting of trifluoroacetic acid (TFA): H2O: triisopropylsilane (TIPS) (95%: 2.5%: 2.5%: 3-10 mL) for 3 h at room temperature. After the release of the peptides, excess TFA was removed by sparging with nitrogen.The crude peptide was precipitated by adding cold diethyl ether (15–40 mL depending on the scale of the synthesis) and centrifuged at 3200 rpm for 5 min. The crude peptide beads were washed three times with cold diethyl ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC scale-up module and a 440-LC fraction collector. Peptides were purified by semi-preparative HPLC on an RP-C18 column (10 × 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 mL / min. Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were pooled and lyophilized to yield the peptide as a white solid (see yields in Table 2).

[0483]

[0484] b) Synthesis of a library of peptide-RMO conjugates

[0485] The 21-mer antisense sequence of PMO was used as the triplet repeat sequence (CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 95)), which was also referred to as [CAG]7. The PMO sequence targeting the CUG / CTG repeats with an increased copy number (5'-CAGCAGCAGCAGCAGCAGCAG-3' (SEQ ID NO: 95)) was purchased from Gene Tools LLC. It was also referred to as [CAG]7PMO herein. The peptide was conjugated to the 3' end of PMO via the C-terminal carboxyl group. For this purpose, 2.5 and 2 equivalents of PyBOP and HOAt in NMP, respectively, were used in the presence of 2.5 equivalents of DIPEA and a 2.5-fold excess of the peptide relative to PMO dissolved in DMSO. In In general, PyBOP (19.2 μL, 0.3 M in NMP), HOAt (16.7 μL, 0.3 M in NMP), DIPEA (1.0 mL), and PMO (180 μL, 10 mM in DMSO) were added to a solution of the peptide (2500 nmol) in N-methylpyrrolidone (NMP, 80 μL). The mixture was allowed to stand for 2.5 h at 40°C, and the reaction was stopped by adding 0.1% TFA in H2O (300 μL).The above solution was purified by ion exchange chromatography using a Gilson HPLC conversion system. PMO-peptide conjugates were purified on an ion exchange column (Resource S 4 mL, GE Healthcare) using a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH3CN. Sodium chloride solution (1 M) was used to elute the conjugate from the column at a flow rate of either 4 mL / min or 6 mL / min. Fractions containing the desired compound were immediately desalted. Removal of excess salts from the peptide-PMO conjugate was accomplished by filtration of the fractions collected after ion exchange chromatography using an Amicon® ultra-15 3K centrifugal filter device. The conjugate was lyophilized and analyzed by MALDI-TOF. The conjugates were dissolved in sterile water and filtered through a 0.22-μm cellulose acetate membrane before use. The peptide-PMO conjugate concentration was determined by the molar absorbance of the conjugates at 265 nm in 0.1 N HCl.HCl solution (for yield data see Table 2).

[0486]

[0487] Animal model and injection of antisense oligonucleotides (ASOs).

[0488] The experiments were carried out at the University of Oxford or at the Centre fonctionnelles» (Faculty of Medicine, Sorbonne University) in accordance with the laws of the United Kingdom and France (approval of the Ethics Committee No. 1760-2015091512001083v6). Intravenous injections of HSA-LR or C57BL / 6 mice were performed using single or multiple administrations via the tail vein. Doses of 5, 7.5, 12.5, 30, or 40 mg / kg peptide-PMO-CAC7 conjugate and 12.5 or 200 mg / kg PMO were obtained by dilution in 0.9% saline and administered at a volume of 5-6 μl / g body weight. Multiple injections were performed at intervals of 2 weeks. Myotonia was assessed and tissues were collected 2 weeks after the final injection. For long-term experiments, tissues were collected 3 months after injection. For toxicology studies, tissues were collected 1 week later. Urine was analyzed using ELISA (R&D, catalog #MKM100), using samples diluted to match the standard curve.Data were standardized to urinary creatinine levels (Harwell) to determine urinary protein concentration.

[0489] In situ myotonia / muscle relaxation study. Isometric contractility of the gastrocnemius muscles was studied in situ. Mice were anesthetized with a ketamine / xylazine solution (80 mg / kg and 15 mg / kg, respectively). The knees and feet were fixed with clamps and pins. The distal gastrocnemius tendon was attached to the lever arm of a servomotor system (305 V, Dual-Mode Lever). Data were acquired and analyzed using a PowerLab system (4SP, ADInstruments) and software (Chart 4, ADInstruments). The sciatic nerve (crushed near its origin) was stimulated with a bipolar silver electrode using a supramaximal (10 V) rectangular pulse of 0.1 ms duration. Absolute maximal isometric tetanic force (P0) was measured during isometric contractions in response to electrical stimulation (frequency from 25 to 150 Hz, stimulation duration 500 ms).Myotonia was measured as the delay in muscle relaxation after P0 measurement.

[0490] Cell culture and treatment with peptide-PMO conjugate. Immortalized myoblasts from a healthy individual or a patient with DM1, which has 2600 CTG repeats, were cultured in a nutrient medium consisting of a mixture of M199:DMEM (ratio 1:4; Life technologies) supplemented with 20% FBS (Life technologies), 50 μg / ml gentamicin (Life technologies), 25 μg / ml fetuin, 0.5 ng / ml bFGF, 5 ng / ml EGF, and 0.2 μg / ml dexamethasone (Sigma-Aldrich). Myogenic differentiation was induced by transferring confluent cell cultures into DMEM myoblast medium supplemented with 5 μg / ml insulin (Sigma-Aldrich). Prior to treatment, WT or DM1 cells were differentiated for 4 days. The medium was then replaced with fresh differentiation medium containing peptide-PMO conjugates at concentrations of 1, 2.5, 10, 20, or 40 μM. Cells were harvested and analyzed 48 hours after treatment.Cell viability was assessed 2 days after transfection of human hepatocytes with 40 μM peptide-PMO conjugates or human myoblasts with 1, 2.5, 10, 20, or 40 μM using a fluorescence-based assay (Promega).

[0491] RNA extraction, RT-PCR and qPCR analysis. For mouse tissues, prior to RNA extraction, muscle was disrupted in TriReagent (Sigma-Aldrich) using the Fastprep system and Lysing Matrix D tubes (MP biomedicals). For human cells, prior to RNA extraction, cells were lysed in proteinase K buffer (500 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1.5 mM MgCl2, 10 mM EDTA, 2% SDS, and 0.5 mg / ml proteinase K) for 45 min at 55°C. Total RNA was isolated using TriReagent according to the manufacturer's protocol. Reverse transcription of 1 μg of RNA was performed using the first-strand synthesis system (Life Technologies) according to the manufacturer's instructions in a total volume of 20 μl. Then, 1 μl of the cDNA preparation was used for semiquantitative PCR analysis according to the standard protocol (ReddyMix, Thermo Scientific). Primers are presented below in Table 3:

[0492]

[0493]

[0494] PCR amplification was performed for 25-35 cycles within the linear amplification range of each gene. PCR products were separated on 1.5-2% agarose gels, stained with ethidium bromide, and quantified using ImageJ software. Exon inclusion levels were determined as the percentage of inclusion relative to the total isoform signal intensity. To quantify mRNA expression, real-time PCR was performed according to the manufacturer's instructions. PCR cycles included a 15-min denaturation step followed by 50 cycles of denaturation at 94°C for 15 s, annealing at 58°C for 20 s, and extension at 72°C for 20 s.

[0495] Fluorescence in situ hybridization / immunofluorescence.

[0496] Fluorescence in situ hybridization (FISH) experiments were performed as described previously (6) using the Cy3-labeled 2'OMe(CAG)7 probe (Eurogentec). For combined FISH-immunofluorescence experiments, immunofluorescence staining was performed after the last FISH wash using a rabbit polyclonal antibody to MBNL1, followed by a secondary Alexa Fluor 488-conjugated goat anti-rabbit antibody (1:500, Life technologies).

[0497] ELISA-based measurements of oligonucleotide concentrations in tissues. A specialized hybridization-based ELISA was developed to determine the concentration of PMO oligonucleotides using phosphorothioate probes with phosphorothioate linkages (sequence (5'->3')

[0498] [DIG]C*T*G*C*T*G*C*TGCTGCT*G*C*T*G*C*T*G[BIO] (SEQ ID NO: 96)), dual-labeled with digoxigenin and biotin. The assay had a linear detection range of 5-250 pM (R2>0.99) in mouse serum and tissue lysates. The probe was used to determine the concentrations of peptide-PMO conjugates or naked PMO in eight different tissues (brain, kidney, liver, lung, heart, diaphragm, gastrocnemius, and quadriceps) from HSA-LR mice.

[0499] Results

[0500] The present invention utilized an arginine-rich cell-penetrating peptide having a specific structure, and demonstrated that the peptide conjugated with [CAG]7-morpholinophosphorodiamidate oligomer (PMO) significantly enhanced the delivery of ASO to striated muscles in the DM1 HSA-LR mouse model after systemic administration, compared with unconjugated PMO and other peptide carriers used in the conjugate strategy. Thus, low-dose treatment with the [CAG]7PMO peptide conjugate proposed in the present invention, which targets pathological expansions, was sufficient to both reverse splicing defects and myotonia in DM1 mice (HSA-LR) and normalize the entire disease-causing transcriptome.Furthermore, using muscle cells (myoblasts) isolated from a treated patient with DM1, it was demonstrated that the peptide-[CAO]7PMO conjugates of the present invention specifically target mutant CUGexp-DMPK transcripts, eliminating the detrimental sequestration of the splicing factor MBNL1 by nuclear RNA foci and, as a result, the functional loss of MBNL1 responsible for splicing defects and muscle dysfunction. The results obtained in creating the invention demonstrate that the peptide-[CAO]7PMO conjugates of the present invention induce highly effective and long-lasting correction of DM1-associated phenotypes at both the molecular and functional levels and convincingly confirm the possibility of using these peptide conjugates for systemic corrective therapy of DM1.

[0501] In the creation of the invention, data were obtained for conjugates containing peptide carriers that do not contain artificial amino acids such as X residues, which have a wider therapeutic window and a safer toxicity profile compared to previously known cell-penetrating peptides and are therefore more promising candidates for study in patients with DM1. These new-generation peptides, designated "DPEP1 and DPEP3," demonstrated high efficacy in reducing the number of pathogenic foci (Fig. 1) and correcting splicing defects in vitro when conjugated to the CAG7-repeat-bearing antisense oligonucleotide PMO (Figs. 2, 3, 4, and 19).No decrease in the cellular viability of human hepatocytes was observed at any of the concentrations studied (1-40 μM), in contrast to similar comparative conjugates formed using known Pip carrier peptides, such as Pip6a-PMO and Pip9b2-PMO, which induced significant cell death (>50%) when applied at a concentration of 40 μM (Fig. 7). Many of the concentrations studied did not reduce the cellular viability of human myoblasts and provided better survival compared to similar comparative conjugates formed using known Pip carrier peptides, such as Pip6a-PMO and Pip9b2-PMO, which induced cell death when applied at lower doses (Figs. 5 and 6).

[0502] Thus, in creating the invention, it was also analyzed whether the said new peptides are active in terms of correcting myotonia and splicing changes when studied on HSA-LR mice. For this purpose, the leader peptide carriers of the DPEP 1 and 3 series, such as DPEP1.9 and DPEP3.8, were tested in comparison with the peptide carrier DPEP 5.70 known from the existing state of the art. It was demonstrated that splicing defects (Fig. 4) and myotonia (Figs. 8, 9 and 10) were corrected to a level corresponding to the wild type within 2 weeks after treatment at a dose of 30 mg / kg with conjugates formed using both DPEP3.8 and DPEP1.9.

[0503] The biodistribution of naked PMO compared to conjugates formed with the carrier peptides DPEP 1.9 and DPEP3.8 was studied using ELISA to quantify the delivery of the peptide-[CAO]7PMO conjugate. Detection of PMO in tissues most susceptible to damage in DM1, such as the heart and brain, is important for drug delivery studies. A single intravenous injection of the peptide-[CAO]7PMO conjugate at a dose of 30 mg / kg or three injections of 200 mg / kg naked PMO (a total of 600 mg / kg) were performed in HAS-LR mice. Two weeks after administration, PMO was detected in the gastrocnemius muscle, quadriceps muscle, diaphragm, heart, and brain. When unconjugated naked [CAG]7PMO was administered, low to undetectable levels were detected in all tissues studied, but when [CAG]7PMO was conjugated to the peptide carriers DPEP1.9 and DPEP3.8, higher levels were detected despite injection at lower doses (molarity >20-fold).Overall, peptide-[CAG]7PMO conjugates were detected in the quadriceps, gastrocnemius, and diaphragm at 1 nM–4 nM and in the heart at 1 nM 2 weeks after 30 mg / kg injections (Fig. 17).

[0504]

[0505]

[0506] In creating the invention, the pharmacokinetic properties of the peptide-[CAG]7PMO conjugates proposed in the invention were also studied by performing measurements in serum after the administration of low doses (5 mg / kg) of the peptide-[CAG]7PMO conjugates. It was found that serum concentrations, which reached 500-800 nM 5 min after IV administration, decreased to 100 nM after 1 hour and 10 nM after 3 hours. After 6 hours after treatment, the concentrations were ~1 nM, while the main part of the compound had already been eliminated from the body or delivered to the tissues of interest (Fig. 18).

[0507] Preliminary toxicology evaluation of conjugates formed with the DPEP3.8 and DPEP1.9 carrier peptides in wild-type mice demonstrated that ALP, ALT, AST, KIM-1, creatinine, BUN, and NGAL levels were similar to those observed after saline control injections, in contrast to the fold increases typically induced by currently known Pip series peptide carriers. Using these preliminary data, the invention demonstrated that [CAG]7PMO conjugates formed using DPEP peptides had similar in vivo activity to those obtained using Pip6a, but had a broader therapeutic window (Figs. 11, 12, and 21).

[0508] Furthermore, no significant trend (decrease) was found in the body weight of five HSA-LR mice injected with a single dose of 30 mg / kg of the DPEP3.8-[CAG]7-derived conjugate compared with five HSA-LR mice injected with saline (Fig. 16).

[0509] Furthermore, the recovery period of HSA-LR mice after injections of DPEP-based [CAG]7PMO conjugates was shorter than after injection of conjugates formed with known peptide carriers from the state of the art, such as Pip6a (Table 5).

[0510]

[0511] Upon closer evaluation of the efficacy of the conjugates proposed in the invention, it was also found that splicing defects and myotonia were corrected to levels corresponding to the wild type for at least 3 months (Figs. 19 and 20, respectively) after administration of the DPEP-[CAG]7PMO peptide conjugates. A 50% reduction in splicing errors and myotonia was also observed after administration of the conjugates at a dose of 7.5 mg / kg.

[0512] It is important to note that conjugates formed using prior art peptide carriers, such as Pip6a-[CAG]7PMO, could not be tested at doses >20 mg / kg due to high mouse mortality rates, in contrast to the conjugates of the invention, the concentrations of which can be increased more than 5-fold without any signs of mortality. Furthermore, toxicity screening conducted in the invention revealed changes in Kim1 levels relative to saline levels 2 days after treatment only at doses exceeding 30 mg / kg (Fig. 21).

[0513] Efficacy and toxicity data demonstrate that conjugates formed with the DPEP1 and DPEP3 series of carrier peptides proposed in the invention exhibited the most pronounced activity in blocking MBNL1 sequestration, which results from the expansion of CTG repeats in individuals suffering from DM1, and induced a low level of toxicity. These conjugates were able to completely correct the DM1 phenotype both at the molecular level by normalizing splicing and at the muscle level by correcting myotonia up to achieving levels corresponding to the wild-type. Furthermore, these new conjugates also had wider therapeutic windows compared to conjugates formed with previously known peptide carriers and, therefore, are more suitable for implementing their properties in a clinical setting.

[0514] In summary, the invention provides clear evidence that (1) the peptide-[CAG]7PMO conjugate blocks the pathological interactions of MBNL1 with the nuclear mutant CUGexp RNA and rescues the resulting effects on RNA splicing; (2) the antisense oligonucleotide-peptide conjugate approach enables delivery of therapy to inaccessible tissues such as the diaphragm heart; (3) the potent action of [CAG]7PMO in directly targeting the disease-causing mutation, combined with the highly efficient in vivo drug delivery properties of the peptide carrier technology, enables a marked reversion of the DM1 phenotype in mice (HSA-LR) to wild-type levels even months after treatment cessation.These pieces of evidence strongly support that peptide-[CAG]7 conjugates are likely to have potent disease-modifying effects against DM1.

[0515] In fact, experiments conducted during the development of this invention demonstrated that the effect observed in HSA-LR mice not only prevents the worsening of DM1 pathology, but also clearly reverses the disease phenotype. Expression of a large number of CUG transcripts occurs already in pups, and in HSA-LR mice, pronounced myotonia is present by 1 month of age. Animals used to obtain results confirming the concept of this application were treated at least 2 months and even 7 months of age, which is well beyond the age at which the molecular and functional DM1 phenotype develops.

[0516] 3. Conclusions

[0517] - Conjugates containing the carrier peptides DPEP and [CAG]7PMO (10 μM) can reduce the number of nuclear foci (at doses that do not result in decreased cell viability) in myoblasts from a patient with DM1 and in controls by >50%. None of the concentrations studied (1-40 μM) caused a decrease in cell viability, in contrast to comparator conjugates formed with other carrier peptides, which induced pronounced cell death (>50%) when used at concentrations of 20 μM or higher.

[0518] - Conjugates containing the carrier peptides DPEP and [CAG]7PMO exhibited positive pharmacokinetic properties, and biodistribution assessment confirmed optimal delivery to tissues most susceptible to damage in DM1.

[0519] - Conjugates containing DPEP and [CAG]7PMO carrier peptides induced 50%-90% splicing correction in HSA-LR mice for Clcn1 exon 7a, Serca exon 22, Mbnl1 exon 5, and Ldb3 exon 11 at a dose (30 mg / kg, IV) that was less toxic than the 12.5 mg / kg dose of the reference conjugates formed with other carrier peptides. RT-PCR analyses also demonstrated normalization of splicing to wild-type levels when DPEP 1.9 and DPEP3.8-containing conjugates were administered at doses of 30 and 40 mg / kg. Splicing correction was maintained for at least 3 months after treatment and was also significant after a single administration at low doses (5 and 7.5 mg / kg).

[0520] - Conjugates containing DPEP and [CAG]7PMO carrier peptides reduced myotonia to wild-type levels following a single (IV)b injection at a dose of 40 mg / kg or 30 mg / kg, as assessed by quantitative myotonia assessment and electromyographic measurements of myotonia. Moderate correction of myotonia was also observed after four injections at a dose of 7.5 mg / kg of conjugates containing DPEP3.8 or DPEP1.9.

[0521] - Conjugates containing the carrier peptides DPEP and [CAG]7PMO, when injected (IV) at a dose of 30 mg / kg, induced a shorter period of lethargy in wild-type mice compared to a single injection of the reference conjugates formed with other carrier peptides at a dose of 12.5 mg / kg (>1 h). Urine biochemistry to assess renal function and blood analysis showed no change compared to saline in wild-type mice and little change in the levels of Kim1 and urine protein in HSA-LR mice after administration at a dose of >30 mg / kg.

[0522] --->

[0523] SEQUENCE LISTING

[0524] <110> OXFORD UNIVERSITY INNOVATION LIMITED and others.

[0525] <120> CONJUGATES AND THEIR APPLICATIONS

[0526] <130> P266149GB

[0527] <160> 121

[0528] <170> PatentIn version 3.5

[0529] <210> 1

[0530] <211> 7

[0531] <212> PRT

[0532] <213> Artificial Sequence

[0533] <220>

[0534] <223> peptide

[0535] <220>

[0536] <221> MOD_RES

[0537] <222> (2)..(2)

[0538] <223> X is bAla

[0539] <220>

[0540] <221> MOD_RES

[0541] <222> (5)..(5)

[0542] <223> X is bAla

[0543] <400> 1

[0544] Arg Xaa Arg Arg Xaa Arg Arg

[0545] 1 5

[0546] <210> 2

[0547] <211> 5

[0548] <212> PRT

[0549] <213> Artificial Sequence

[0550] <220>

[0551] <223> peptide

[0552] <220>

[0553] <221> MOD_RES

[0554] <222> (2)..(2)

[0555] <223> X is bAla

[0556] <220>

[0557] <221> MOD_RES

[0558] <222> (4)..(4)

[0559] <223> X is bAla

[0560] <400> 2

[0561] Arg Xaa Arg Xaa Arg

[0562] 1 5

[0563] <210> 3

[0564] <211> 4

[0565] <212> PRT

[0566] <213> Artificial Sequence

[0567] <220>

[0568] <223> peptide

[0569] <220>

[0570] <221> MOD_RES

[0571] <222> (2)..(2)

[0572] <223> X is bAla

[0573] <400> 3

[0574] Arg Xaa Arg Arg

[0575] 1

[0576] <210> 4

[0577] <211> 6

[0578] <212> PRT

[0579] <213> Artificial Sequence

[0580] <220>

[0581] <223> peptide

[0582] <220>

[0583] <221> MOD_RES

[0584] <222> (2)..(2)

[0585] <223> X is bAla

[0586] <220>

[0587] <221> MOD_RES

[0588] <222> (5)..(5)

[0589] <223> X is bAla

[0590] <400> 4

[0591] Arg Xaa Arg Arg Xaa Arg

[0592] 1 5

[0593] <210> 5

[0594] <211> 6

[0595] <212> PRT

[0596] <213> Artificial Sequence

[0597] <220>

[0598] <223> peptide

[0599] <220>

[0600] <221> MOD_RES

[0601] <222> (3)..(3)

[0602] <223> x is bAla

[0603] <220>

[0604] <221> MOD_RES

[0605] <222> (5)..(5)

[0606] <223> x is bAla

[0607] <400> 5

[0608] Arg Arg Xaa Arg Xaa Arg

[0609] 1 5

[0610] <210> 6

[0611] <211> 5

[0612] <212> PRT

[0613] <213> Artificial Sequence

[0614] <220>

[0615] <223> peptide

[0616] <220>

[0617] <221> MOD_RES

[0618] <222> (2)..(2)

[0619] <223> x is bAla

[0620] <220>

[0621] <221> MOD_RES

[0622] <222> (5)..(5)

[0623] <223> x is bAla

[0624] <400> 6

[0625] Arg Xaa Arg Arg Xaa

[0626] 1 5

[0627] <210> 7

[0628] <211> 4

[0629] <212> PRT

[0630] <213> Artificial Sequence

[0631] <220>

[0632] <223> peptide

[0633] <220>

[0634] <221> MOD_RES

[0635] <222> (1)..(1)

[0636] <223> x is bAla

[0637] <220>

[0638] <221> MOD_RES

[0639] <222> (3)..(3)

[0640] <223> x is bAla

[0641] <400> 7

[0642] Xaa Arg Xaa Arg

[0643] 1

[0644] <210> 8

[0645] <211> 5

[0646] <212> PRT

[0647] <213> Artificial Sequence

[0648] <220>

[0649] <223> peptide

[0650] <220>

[0651] <221> MOD_RES

[0652] <222> (2)..(2)

[0653] <223> x is bAla

[0654] <220>

[0655] <221> MOD_RES

[0656] <222> (4)..(4)

[0657] <223> x is bAla

[0658] <400> 8

[0659] Arg Xaa His Xaa His

[0660] 1 5

[0661] <210> 9

[0662] <211> 5

[0663] <212> PRT

[0664] <213> Artificial Sequence

[0665] <220>

[0666] <223> peptide

[0667] <220>

[0668] <221> MOD_RES

[0669] <222> (2)..(2)

[0670] <223> x is bAla

[0671] <220>

[0672] <221> MOD_RES

[0673] <222> (4)..(4)

[0674] <223> x is bAla

[0675] <400> 9

[0676] His Xaa His Xaa Arg

[0677] 1 5

[0678] <210> 10

[0679] <211> 7

[0680] <212> PRT

[0681] <213> Artificial Sequence

[0682] <220>

[0683] <223> peptide

[0684] <220>

[0685] <221> MOD_RES

[0686] <222> (2)..(2)

[0687] <223> x is bAla

[0688] <220>

[0689] <221> MOD_RES

[0690] <222> (5)..(5)

[0691] <223> x is bAla

[0692] <400> 10

[0693] Arg Xaa Arg His Xaa His Arg

[0694] 1 5

[0695] <210> 11

[0696] <211> 7

[0697] <212> PRT

[0698] <213> Artificial Sequence

[0699] <220>

[0700] <223> peptide

[0701] <220>

[0702] <221> MOD_RES

[0703] <222> (2)..(2)

[0704] <223> x is bAla

[0705] <220>

[0706] <221> MOD_RES

[0707] <222> (4)..(5)

[0708] <223> x is bAla

[0709] <400> 11

[0710] Arg Xaa Arg Xaa Xaa His Arg

[0711] 1 5

[0712] <210> 12

[0713] <211> 6

[0714] <212> PRT

[0715] <213> Artificial Sequence

[0716] <220>

[0717] <223> peptide

[0718] <220>

[0719] <221> MOD_RES

[0720] <222> (2)..(2)

[0721] <223> x is bAla

[0722] <220>

[0723] <221> MOD_RES

[0724] <222> (5)..(5)

[0725] <223> x is bAla

[0726] <400> 12

[0727] Arg Xaa Arg Arg Xaa His

[0728] 1 5

[0729] <210> 13

[0730] <211> 6

[0731] <212> PRT

[0732] <213> Artificial Sequence

[0733] <220>

[0734] <223> peptide

[0735] <220>

[0736] <221> MOD_RES

[0737] <222> (2)..(2)

[0738] <223> x is bAla

[0739] <220>

[0740] <221> MOD_RES

[0741] <222> (5)..(5)

[0742] <223> x is bAla

[0743] <400> 13

[0744] His Xaa Arg Arg Xaa Arg

[0745] 1 5

[0746] <210> 14

[0747] <211> 5

[0748] <212> PRT

[0749] <213> Artificial Sequence

[0750] <220>

[0751] <223> peptide

[0752] <220>

[0753] <221> MOD_RES

[0754] <222> (2)..(2)

[0755] <223> x is bAla

[0756] <220>

[0757] <221> MOD_RES

[0758] <222> (4)..(4)

[0759] <223> x is bAla

[0760] <400> 14

[0761] His Xaa His Xaa His

[0762] 1 5

[0763] <210> 15

[0764] <211> 4

[0765] <212> PRT

[0766] <213> Artificial Sequence

[0767] <220>

[0768] <223> peptide

[0769] <220>

[0770] <221> MOD_RES

[0771] <222> (1)..(1)

[0772] <223> x is bAla

[0773] <220>

[0774] <221> MOD_RES

[0775] <222> (3)..(3)

[0776] <223> x is bAla

[0777] <400> 15

[0778] Xaa His Xaa His

[0779] 1

[0780] <210> 16

[0781] <211> 5

[0782] <212> PRT

[0783] <213> Artificial Sequence

[0784] <220>

[0785] <223> peptide

[0786] <220>

[0787] <221> MOD_RES

[0788] <222> (1)..(1)

[0789] <223> x is bAla

[0790] <220>

[0791] <221> MOD_RES

[0792] <222> (3)..(3)

[0793] <223> x is bAla

[0794] <220>

[0795] <221> MOD_RES

[0796] <222> (5)..(5)

[0797] <223> x is bAla

[0798] <400> 16

[0799] Xaa Arg Xaa Ser Xaa

[0800] 1 5

[0801] <210> 17

[0802] <211> 5

[0803] <212> PRT

[0804] <213> Artificial Sequence

[0805] <220>

[0806] <223> peptide

[0807] <220>

[0808] <221> MOD_RES

[0809] <222> (1)..(1)

[0810] <223> x is bAla

[0811] <220>

[0812] <221> MOD_RES

[0813] <222> (3)..(3)

[0814] <223> x is bAla

[0815] <220>

[0816] <221> MOD_RES

[0817] <222> (4)..(4)

[0818] <223> x is hydroxyproline

[0819] <220>

[0820] <221> MOD_RES

[0821] <222> (5)..(5)

[0822] <223> x is bAla

[0823] <400> 17

[0824] Xaa Arg Xaa Xaa Xaa

[0825] 1 5

[0826] <210> 18

[0827] <211> 6

[0828] <212> PRT

[0829] <213> Artificial Sequence

[0830] <220>

[0831] <223> peptide

[0832] <220>

[0833] <221> MOD_RES

[0834] <222> (2)..(2)

[0835] <223> x is hydroxyproline

[0836] <220>

[0837] <221> MOD_RES

[0838] <222> (4)..(4)

[0839] <223> x is hydroxyproline

[0840] <220>

[0841] <221> MOD_RES

[0842] <222> (6)..(6)

[0843] <223> x is bAla

[0844] <400> 18

[0845] Arg Xaa His Xaa His Xaa

[0846] 1 5

[0847] <210> 19

[0848] <211> 6

[0849] <212> PRT

[0850] <213> Artificial Sequence

[0851] <220>

[0852] <223> peptide

[0853] <220>

[0854] <221> MOD_RES

[0855] <222> (2)..(2)

[0856] <223> x is hydroxyproline

[0857] <220>

[0858] <221> MOD_RES

[0859] <222> (5)..(5)

[0860] <223> x is hydroxyproline

[0861] <400> 19

[0862] Arg Xaa Arg Arg Xaa Arg

[0863] 1 5

[0864] <210> 20

[0865] <211> 5

[0866] <212> PRT

[0867] <213> Artificial Sequence

[0868] <220>

[0869] <223> peptide

[0870] <400> 20

[0871] Tyr Gln Phe Leu Ile

[0872] 1 5

[0873] <210> 21

[0874] <211> 5

[0875] <212> PRT

[0876] <213> Artificial Sequence

[0877] <220>

[0878] <223> peptide

[0879] <400> 21

[0880] Phe Gln Ile Leu Tyr

[0881] 1 5

[0882] <210> 22

[0883] <211> 5

[0884] <212> PRT

[0885] <213> Artificial Sequence

[0886] <220>

[0887] <223> peptide

[0888] <400> 22

[0889] Ile Leu Phe Gln Tyr

[0890] 1 5

[0891] <210> 23

[0892] <211> 4

[0893] <212> PRT

[0894] <213> Artificial Sequence

[0895] <220>

[0896] <223> peptide

[0897] <400> 23

[0898] Phe Gln Ile Tyr

[0899] 1

[0900] <210> 24

[0901] <211> 5

[0902] <212> PRT

[0903] <213> Artificial Sequence

[0904] <220>

[0905] <223> peptide

[0906] <400> 24

[0907] Trp Trp Pro Trp Trp

[0908] 1 5

[0909] <210> 25

[0910] <211> 4

[0911] <212> PRT

[0912] <213> Artificial Sequence

[0913] <220>

[0914] <223> peptide

[0915] <400> 25

[0916] Trp Pro Trp Trp

[0917] 1

[0918] <210> 26

[0919] <211> 4

[0920] <212> PRT

[0921] <213> Artificial Sequence

[0922] <220>

[0923] <223> peptide

[0924] <400> 26

[0925] Trp Trp Pro Trp

[0926] 1

[0927] <210> 27

[0928] <211> 17

[0929] <212> PRT

[0930] <213> Artificial Sequence

[0931] <220>

[0932] <223> peptide

[0933] <220>

[0934] <221> MOD_RES

[0935] <222> (2)..(2)

[0936] <223> x is bAla

[0937] <220>

[0938] <221> MOD_RES

[0939] <222> (5)..(5)

[0940] <223> x is bAla

[0941] <220>

[0942] <221> MOD_RES

[0943] <222> (14)..(14)

[0944] <223> x is bAla

[0945] <220>

[0946] <221> MOD_RES

[0947] <222> (16)..(16)

[0948] <223> x is Child

[0949] <400> 27

[0950] Arg Arg Arg Arg Arg Arg Phe Gln Ile Tyr Arg Arg Arg Arg Arg Arg Arg Arg Arg Arg Arg Phe Gln

[0951] 1 5 10 15

[0952] Arg

[0953] <210> 28

[0954] <211> 16

[0955] <212> PRT

[0956] <213> Artificial Sequence

[0957] <220>

[0958] <223> peptide

[0959] <220>

[0960] <221> MOD_RES

[0961] <222> (2)…(2)

[0962] <223> x is Child

[0963] <220>

[0964] <221> MOD_RES

[0965] <222> (5)…(5)

[0966] <223> x is Child

[0967] <220>

[0968] <221> MOD_RES

[0969] <222> (14)..(14)

[0970] <223> x is Child

[0971] <400> 28

[0972] Arg Arg Arg Arg Arg Phe Gln Ile Leu Tyr Arg Arg Arg

[0973] 1 5 10 15

[0974] <210> 29

[0975] <211> 17

[0976] <212> PRT

[0977] <213> Artificial Sequence

[0978] <220>

[0979] <223> peptide

[0980] <220>

[0981] <221> MOD_RES

[0982] <222> (2)..(2)

[0983] <223> x is bAla

[0984] <220>

[0985] <221> MOD_RES

[0986] <222> (5)..(5)

[0987] <223> x is bAla

[0988] <220>

[0989] <221> MOD_RES

[0990] <222> (14)..(14)

[0991] <223> x is bAla

[0992] <220>

[0993] <221> MOD_RES

[0994] <222> (16)..(16)

[0995] <223> x is bAla

[0996] <400> 29

[0997] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Arg Xaa Arg Xaa

[0998] 1 5 10 15

[0999] Arg

[1000] <210> 30

[1001] <211> 17

[1002] <212> PRT

[1003] <213> Artificial Sequence

[1004] <220>

[1005] <223> peptide

[1006] <220>

[1007] <221> MOD_RES

[1008] <222> (2)..(2)

[1009] <223> x is bAla

[1010] <220>

[1011] <221> MOD_RES

[1012] <222> (4)..(4)

[1013] <223> x is bAla

[1014] <220>

[1015] <221> MOD_RES

[1016] <222> (12)..(12)

[1017] <223> x is bAla

[1018] <220>

[1019] <221> MOD_RES

[1020] <222> (15)..(15)

[1021] <223> x is bAla

[1022] <400> 30

[1023] Arg Xaa Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Arg Xaa Arg

[1024] 1 5 10 15

[1025] Arg

[1026] <210> 31

[1027] <211> 17

[1028] <212> PRT

[1029] <213> Artificial Sequence

[1030] <220>

[1031] <223> peptide

[1032] <220>

[1033] <221> MOD_RES

[1034] <222> (2)..(2)

[1035] <223> x is bAla

[1036] <220>

[1037] <221> MOD_RES

[1038] <222> (5)..(5)

[1039] <223> x is bAla

[1040] <220>

[1041] <221> MOD_RES

[1042] <222> (14)..(14)

[1043] <223> x is bAla

[1044] <220>

[1045] <221> MOD_RES

[1046] <222> (16)..(16)

[1047] <223> x is bAla

[1048] <400> 31

[1049] Arg Xaa Arg Arg Xaa Arg Arg Tyr Gln Phe Leu Ile Arg Xaa Arg Xaa

[1050] 1 5 10 15

[1051] Arg

[1052] <210> 32

[1053] <211> 17

[1054] <212> PRT

[1055] <213> Artificial Sequence

[1056] <220>

[1057] <223> peptide

[1058] <220>

[1059] <221> MOD_RES

[1060] <222> (2)..(2)

[1061] <223> x is bAla

[1062] <220>

[1063] <221> MOD_RES

[1064] <222> (5)..(5)

[1065] <223> x is bAla

[1066] <220>

[1067] <221> MOD_RES

[1068] <222> (14)..(14)

[1069] <223> x is bAla

[1070] <220>

[1071] <221> MOD_RES

[1072] <222> (16)..(16)

[1073] <223> x is bAla

[1074] <400> 32

[1075] Arg Xaa Arg Arg Xaa Arg Arg Ile Leu Phe Gln Tyr Arg Xaa Arg Xaa

[1076] 1 5 10 15

[1077] Arg

[1078] <210> 33

[1079] <211> 16

[1080] <212> PRT

[1081] <213> Artificial Sequence

[1082] <220>

[1083] <223> peptide

[1084] <220>

[1085] <221> MOD_RES

[1086] <222> (2)..(2)

[1087] <223> x is bAla

[1088] <220>

[1089] <221> MOD_RES

[1090] <222> (5)..(5)

[1091] <223> x is bAla

[1092] <220>

[1093] <221> MOD_RES

[1094] <222> (13)..(13)

[1095] <223> x is bAla

[1096] <220>

[1097] <221> MOD_RES

[1098] <222> (15)..(15)

[1099] <223> x is Child

[1100] <400> 33

[1101] Arg Arg Arg Arg Arg Phe Gln Ile Tyr Arg Arg Arg Arg Arg Arg Arg Arg

[1102] 1 5 10 15

[1103] <210> 34

[1104] <211> 16

[1105] <212> PRT

[1106] <213> Artificial Sequence

[1107] <220>

[1108] <223> peptide

[1109] <220>

[1110] <221> MOD_RES

[1111] <222> (2)…(2)

[1112] <223> x is Child

[1113] <220>

[1114] <221> MOD_RES

[1115] <222> (5)…(5)

[1116] <223> x is Child

[1117] <220>

[1118] <221> MOD_RES

[1119] <222> (12)..(12)

[1120] <223> x is Child

[1121] <220>

[1122] <221> MOD_RES

[1123] <222> (15)..(15)

[1124] <223> x is Child

[1125] <400> 34

[1126] Arg Arg Arg Phe Gln Ile Tyr Arg Arg Arg Arg Arg Arg Arg

[1127] 1 5 10 15

[1128] <210> 35

[1129] <211> 15

[1130] <212> PRT

[1131] <213> Artificial Sequence

[1132] <220>

[1133] <223> peptide

[1134] <220>

[1135] <221> MOD_RES

[1136] <222> (2)..(2)

[1137] <223> x is bAla

[1138] <220>

[1139] <221> MOD_RES

[1140] <222> (5)..(5)

[1141] <223> x is bAla

[1142] <220>

[1143] <221> MOD_RES

[1144] <222> (12)..(12)

[1145] <223> x is bAla

[1146] <220>

[1147] <221> MOD_RES

[1148] <222> (14)..(14)

[1149] <223> x is bAla

[1150] <400> 35

[1151] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg

[1152] 1 5 10 15

[1153] <210> 36

[1154] <211> 15

[1155] <212> PRT

[1156] <213> Artificial Sequence

[1157] <220>

[1158] <223> peptide

[1159] <220>

[1160] <221> MOD_RES

[1161] <222> (2)..(2)

[1162] <223> x is bAla

[1163] <220>

[1164] <221> MOD_RES

[1165] <222> (5)..(5)

[1166] <223> x is bAla

[1167] <220>

[1168] <221> MOD_RES

[1169] <222> (12)..(12)

[1170] <223> x is bAla

[1171] <220>

[1172] <221> MOD_RES

[1173] <222> (14)..(14)

[1174] <223> x is bAla

[1175] <400> 36

[1176] Arg Xaa Arg Arg Xaa Phe Gln Ile Leu Tyr Arg Xaa Arg Xaa Arg

[1177] 1 5 10 15

[1178] <210> 37

[1179] <211> 17

[1180] <212> PRT

[1181] <213> Artificial Sequence

[1182] <220>

[1183] <223> peptide

[1184] <220>

[1185] <221> MOD_RES

[1186] <222> (2)..(2)

[1187] <223> x is bAla

[1188] <220>

[1189] <221> MOD_RES

[1190] <222> (5)..(5)

[1191] <223> x is bAla

[1192] <220>

[1193] <221> MOD_RES

[1194] <222> (14)..(14)

[1195] <223> x is bAla

[1196] <220>

[1197] <221> MOD_RES

[1198] <222> (16)..(16)

[1199] <223> x is bAla

[1200] <400> 37

[1201] Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa

[1202] 1 5 10 15

[1203] His

[1204] <210> 38

[1205] <211> 17

[1206] <212> PRT

[1207] <213> Artificial Sequence

[1208] <220>

[1209] <223> peptide

[1210] <220>

[1211] <221> MOD_RES

[1212] <222> (2)..(2)

[1213] <223> x is bAla

[1214] <220>

[1215] <221> MOD_RES

[1216] <222> (5)..(5)

[1217] <223> x is bAla

[1218] <220>

[1219] <221> MOD_RES

[1220] <222> (14)..(14)

[1221] <223> x is bAla

[1222] <220>

[1223] <221> MOD_RES

[1224] <222> (16)..(16)

[1225] <223> x is bAla

[1226] <400> 38

[1227] Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr His Xaa His Xaa

[1228] 1 5 10 15

[1229] Arg

[1230] <210> 39

[1231] <211> 17

[1232] <212> PRT

[1233] <213> Artificial Sequence

[1234] <220>

[1235] <223> peptide

[1236] <220>

[1237] <221> MOD_RES

[1238] <222> (2)..(2)

[1239] <223> x is bAla

[1240] <220>

[1241] <221> MOD_RES

[1242] <222> (5)..(5)

[1243] <223> x is bAla

[1244] <220>

[1245] <221> MOD_RES

[1246] <222> (14)..(14)

[1247] <223> x is bAla

[1248] <220>

[1249] <221> MOD_RES

[1250] <222> (16)..(16)

[1251] <223> x is bAla

[1252] <400> 39

[1253] Arg Xaa Arg Xaa Arg Arg Phe Gln Ile Leu Tyr His Haa Arg Haa

[1254] 1 5 10 15

[1255] His

[1256] <210> 40

[1257] <211> 17

[1258] <212> PRT

[1259] <213> Artificial Sequence

[1260] <220>

[1261] <223> peptide

[1262] <220>

[1263] <221> MOD_RES

[1264] <222> (2)…(2)

[1265] <223> x is Child

[1266] <220>

[1267] <221> MOD_RES

[1268] <222> (5)…(5)

[1269] <223> x is Child

[1270] <220>

[1271] <221> MOD_RES

[1272] <222> (14)..(14)

[1273] <223> x is Child

[1274] <220>

[1275] <221> MOD_RES

[1276] <222> (16)..(16)

[1277] <223> x is Child

[1278] <400> 40

[1279] Arg Stone Arg Stone Arg Arg Tyr Gln Phe Leu Ile Arg Stone His Stone

[1280] 1 5 10 15

[1281] His

[1282] <210> 41

[1283] <211> 17

[1284] <212> PRT

[1285] <213> Artificial Sequence

[1286] <220>

[1287] <223> peptide

[1288] <220>

[1289] <221> MOD_RES

[1290] <222> (2)..(2)

[1291] <223> x is bAla

[1292] <220>

[1293] <221> MOD_RES

[1294] <222> (5)..(5)

[1295] <223> x is bAla

[1296] <220>

[1297] <221> MOD_RES

[1298] <222> (14)..(14)

[1299] <223> x is bAla

[1300] <220>

[1301] <221> MOD_RES

[1302] <222> (16)..(16)

[1303] <223> x is bAla

[1304] <400> 41

[1305] Arg Xaa Arg Arg Xaa Arg Arg Ile Leu Phe Gln Tyr Arg Xaa His Xaa

[1306] 1 5 10 15

[1307] His

[1308] <210> 42

[1309] <211> 17

[1310] <212> PRT

[1311] <213> Artificial Sequence

[1312] <220>

[1313] <223> peptide

[1314] <220>

[1315] <221> MOD_RES

[1316] <222> (2)..(2)

[1317] <223> x is bAla

[1318] <220>

[1319] <221> MOD_RES

[1320] <222> (5)..(5)

[1321] <223> x is bAla

[1322] <220>

[1323] <221> MOD_RES

[1324] <222> (14)..(14)

[1325] <223> x is bAla

[1326] <220>

[1327] <221> MOD_RES

[1328] <222> (16)..(16)

[1329] <223> x is bAla

[1330] <400> 42

[1331] Arg Xaa Arg His Xaa His Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Xaa

[1332] 1 5 10 15

[1333] Arg

[1334] <210> 43

[1335] <211> 17

[1336] <212> PRT

[1337] <213> Artificial Sequence

[1338] <220>

[1339] <223> peptide

[1340] <220>

[1341] <221> MOD_RES

[1342] <222> (2)..(2)

[1343] <223> x is bAla

[1344] <220>

[1345] <221> MOD_RES

[1346] <222> (4)..(4)

[1347] <223> x is bAla

[1348] <220>

[1349] <221> MOD_RES

[1350] <222> (5)..(5)

[1351] <223> x is bAla

[1352] <220>

[1353] <221> MOD_RES

[1354] <222> (14)..(14)

[1355] <223> x is bAla

[1356] <220>

[1357] <221> MOD_RES

[1358] <222> (16)..(16)

[1359] <223> x is bAla

[1360] <400> 43

[1361] Arg Xaa Arg Xaa Xaa His Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa

[1362] 1 5 10 15

[1363] His

[1364] <210> 44

[1365] <211> 16

[1366] <212> PRT

[1367] <213> Artificial Sequence

[1368] <220>

[1369] <223> peptide

[1370] <220>

[1371] <221> MOD_RES

[1372] <222> (2)..(2)

[1373] <223> x is bAla

[1374] <220>

[1375] <221> MOD_RES

[1376] <222> (5)..(5)

[1377] <223> x is bAla

[1378] <220>

[1379] <221> MOD_RES

[1380] <222> (13)..(13)

[1381] <223> x is bAla

[1382] <220>

[1383] <221> MOD_RES

[1384] <222> (15)..(15)

[1385] <223> x is bAla

[1386] <400> 44

[1387] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His

[1388] 1 5 10 15

[1389] <210> 45

[1390] <211> 16

[1391] <212> PRT

[1392] <213> Artificial Sequence

[1393] <220>

[1394] <223> peptide

[1395] <220>

[1396] <221> MOD_RES

[1397] <222> (2)..(2)

[1398] <223> x is bAla

[1399] <220>

[1400] <221> MOD_RES

[1401] <222> (5)..(5)

[1402] <223> x is bAla

[1403] <220>

[1404] <221> MOD_RES

[1405] <222> (13)..(13)

[1406] <223> x is bAla

[1407] <220>

[1408] <221> MOD_RES

[1409] <222> (15)..(15)

[1410] <223> x is bAla

[1411] <400> 45

[1412] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr His Xaa His Xaa His

[1413] 1 5 10 15

[1414] <210> 46

[1415] <211> 16

[1416] <212> PRT

[1417] <213> Artificial Sequence

[1418] <220>

[1419] <223> peptide

[1420] <220>

[1421] <221> MOD_RES

[1422] <222> (2)..(2)

[1423] <223> x is bAla

[1424] <220>

[1425] <221> MOD_RES

[1426] <222> (5)..(5)

[1427] <223> x is bAla

[1428] <220>

[1429] <221> MOD_RES

[1430] <222> (13)..(13)

[1431] <223> x is bAla

[1432] <220>

[1433] <221> MOD_RES

[1434] <222> (15)..(15)

[1435] <223> x is bAla

[1436] <400> 46

[1437] Arg Battery Arg Battery His Phe Gln Ile Leu Tyr Arg Battery His Battery

[1438] 1 5 10 15

[1439] <210> 47

[1440] <211> 16

[1441] <212> PRT

[1442] <213> Artificial Sequence

[1443] <220>

[1444] <223> peptide

[1445] <220>

[1446] <221> MOD_RES

[1447] <222> (2)…(2)

[1448] <223> x is Child

[1449] <220>

[1450] <221> MOD_RES

[1451] <222> (5)…(5)

[1452] <223> x is Child

[1453] <220>

[1454] <221> MOD_RES

[1455] <222> (13)..(13)

[1456] <223> x is Child

[1457] <220>

[1458] <221> MOD_RES

[1459] <222> (15)..(15)

[1460] <223> x is Child

[1461] <400> 47

[1462] His Arg Arg Arg Arg Phe Gln Ile Leu Tyr Arg Arg His His

[1463] 1 5 10 15

[1464] <210> 48

[1465] <211> 15

[1466] <212> PRT

[1467] <213> Artificial Sequence

[1468] <220>

[1469] <223> peptide

[1470] <220>

[1471] <221> MOD_RES

[1472] <222> (2)..(2)

[1473] <223> x is bAla

[1474] <220>

[1475] <221> MOD_RES

[1476] <222> (5)..(5)

[1477] <223> x is bAla

[1478] <220>

[1479] <221> MOD_RES

[1480] <222> (12)..(12)

[1481] <223> x is bAla

[1482] <220>

[1483] <221> MOD_RES

[1484] <222> (14)..(14)

[1485] <223> x is bAla

[1486] <400> 48

[1487] Arg Xaa Arg Arg Xaa Phe Gln Ile Leu Tyr Arg Xaa His Xaa His

[1488] 1 5 10 15

[1489] <210> 49

[1490] <211> 15

[1491] <212> PRT

[1492] <213> Artificial Sequence

[1493] <220>

[1494] <223> peptide

[1495] <220>

[1496] <221> MOD_RES

[1497] <222> (2)..(2)

[1498] <223> x is bAla

[1499] <220>

[1500] <221> MOD_RES

[1501] <222> (5)..(5)

[1502] <223> x is bAla

[1503] <220>

[1504] <221> MOD_RES

[1505] <222> (12)..(12)

[1506] <223> x is bAla

[1507] <220>

[1508] <221> MOD_RES

[1509] <222> (14)..(14)

[1510] <223> x is bAla

[1511] <400> 49

[1512] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa His Xaa His

[1513] 1 5 10 15

[1514] <210> 50

[1515] <211> 16

[1516] <212> PRT

[1517] <213> Artificial Sequence

[1518] <220>

[1519] <223> peptide

[1520] <220>

[1521] <221> MOD_RES

[1522] <222> (2)..(2)

[1523] <223> x is bAla

[1524] <220>

[1525] <221> MOD_RES

[1526] <222> (5)..(5)

[1527] <223> x is bAla

[1528] <220>

[1529] <221> MOD_RES

[1530] <222> (13)..(13)

[1531] <223> x is bAla

[1532] <220>

[1533] <221> MOD_RES

[1534] <222> (15)..(15)

[1535] <223> x is bAla

[1536] <400> 50

[1537] Arg Xaa Arg Arg Xaa Arg Tyr Gln Phe Leu Ile His Xaa His Xaa His

[1538] 1 5 10 15

[1539] <210> 51

[1540] <211> 16

[1541] <212> PRT

[1542] <213> Artificial Sequence

[1543] <220>

[1544] <223> peptide

[1545] <220>

[1546] <221> MOD_RES

[1547] <222> (2)..(2)

[1548] <223> x is bAla

[1549] <220>

[1550] <221> MOD_RES

[1551] <222> (5)..(5)

[1552] <223> x is bAla

[1553] <220>

[1554] <221> MOD_RES

[1555] <222> (13)..(13)

[1556] <223> x is bAla

[1557] <220>

[1558] <221> MOD_RES

[1559] <222> (15)..(15)

[1560] <223> x is Child

[1561] <400> 51

[1562] Arg Xaa Arg Arg Xaa Arg Ile Leu Phe Gln Tyr His Xaa His Xaa His

[1563] 1 5 10 15

[1564] <210> 52

[1565] <211> 17

[1566] <212> PRT

[1567] <213> Artificial Sequence

[1568] <220>

[1569] <223> peptide

[1570] <220>

[1571] <221> MOD_RES

[1572] <222> (2)…(2)

[1573] <223> x is Child

[1574] <220>

[1575] <221> MOD_RES

[1576] <222> (5)…(5)

[1577] <223> x is Child

[1578] <220>

[1579] <221> MOD_RES

[1580] <222> (14)..(14)

[1581] <223> x is Child

[1582] <220>

[1583] <221> MOD_RES

[1584] <222> (16)..(16)

[1585] <223> x is Child

[1586] <400> 52

[1587] Arg Haa Arg Haa Arg Haa Arg Phe Gln Ile Leu Tyr His Haa His Haa

[1588] 1 5 10 15

[1589] His

[1590] <210> 53

[1591] <211> 15

[1592] <212> PRT

[1593] <213> Artificial Sequence

[1594] <220>

[1595] <223> peptide

[1596] <220>

[1597] <221> MOD_RES

[1598] <222> (2)..(2)

[1599] <223> x is bAla

[1600] <220>

[1601] <221> MOD_RES

[1602] <222> (5)..(5)

[1603] <223> x is bAla

[1604] <220>

[1605] <221> MOD_RES

[1606] <222> (12)..(12)

[1607] <223> x is bAla

[1608] <220>

[1609] <221> MOD_RES

[1610] <222> (14)..(14)

[1611] <223> x is bAla

[1612] <400> 53

[1613] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Ser

[1614] 1 5 10 15

[1615] <210> 54

[1616] <211> 15

[1617] <212> PRT

[1618] <213> Artificial Sequence

[1619] <220>

[1620] <223> peptide

[1621] <220>

[1622] <221> MOD_RES

[1623] <222> (2)..(2)

[1624] <223> x is bAla

[1625] <220>

[1626] <221> MOD_RES

[1627] <222> (5)..(5)

[1628] <223> x is bAla

[1629] <220>

[1630] <221> MOD_RES

[1631] <222> (12)..(12)

[1632] <223> x is bAla

[1633] <220>

[1634] <221> MOD_RES

[1635] <222> (14)..(14)

[1636] <223> x is bAla

[1637] <220>

[1638] <221> MOD_RES

[1639] <222> (15)..(15)

[1640] <223> x hydroxyproline

[1641] <400> 54

[1642] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Xaa

[1643] 1 5 10 15

[1644] <210> 55

[1645] <211> 15

[1646] <212> PRT

[1647] <213> Artificial Sequence

[1648] <220>

[1649] <223> peptide

[1650] <220>

[1651] <221> MOD_RES

[1652] <222> (2)..(2)

[1653] <223> x is bAla

[1654] <220>

[1655] <221> MOD_RES

[1656] <222> (5)..(5)

[1657] <223> x is bAla

[1658] <220>

[1659] <221> MOD_RES

[1660] <222> (12)..(12)

[1661] <223> x is bAla

[1662] <220>

[1663] <221> MOD_RES

[1664] <222> (14)..(14)

[1665] <223> x is hydroxyproline

[1666] <400> 55

[1667] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg

[1668] 1 5 10 15

[1669] <210> 56

[1670] <211> 16

[1671] <212> PRT

[1672] <213> Artificial Sequence

[1673] <220>

[1674] <223> peptide

[1675] <220>

[1676] <221> MOD_RES

[1677] <222> (3)..(3)

[1678] <223> x is bAla

[1679] <220>

[1680] <221> MOD_RES

[1681] <222> (6)..(6)

[1682] <223> x is bAla

[1683] <220>

[1684] <221> MOD_RES

[1685] <222> (13)..(13)

[1686] <223> x is bAla

[1687] <220>

[1688] <221> MOD_RES

[1689] <222> (15)..(15)

[1690] <223> x is bAla

[1691] <400> 56

[1692] Arg Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg

[1693] 1 5 10 15

[1694] <210> 57

[1695] <211> 15

[1696] <212> PRT

[1697] <213> Artificial Sequence

[1698] <220>

[1699] <223> peptide

[1700] <220>

[1701] <221> MOD_RES

[1702] <222> (1)..(1)

[1703] <223> x is bAla

[1704] <220>

[1705] <221> MOD_RES

[1706] <222> (4)..(4)

[1707] <223> x is bAla

[1708] <220>

[1709] <221> MOD_RES

[1710] <222> (12)..(12)

[1711] <223> x is bAla

[1712] <220>

[1713] <221> MOD_RES

[1714] <222> (14)..(14)

[1715] <223> x is bAla

[1716] <400> 57

[1717] Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg

[1718] 1 5 10 15

[1719] <210> 58

[1720] <211> 13

[1721] <212> PRT

[1722] <213> Artificial Sequence

[1723] <220>

[1724] <223> peptide

[1725] <220>

[1726] <221> MOD_RES

[1727] <222> (2)..(2)

[1728] <223> x is bAla

[1729] <220>

[1730] <221> MOD_RES

[1731] <222> (5)..(5)

[1732] <223> x is bAla

[1733] <220>

[1734] <221> MOD_RES

[1735] <222> (10)..(10)

[1736] <223> x is bAla

[1737] <220>

[1738] <221> MOD_RES

[1739] <222> (12)..(12)

[1740] <223> x is bAla

[1741] <400> 58

[1742] Arg Arg Arg Arg Arg Trp Trp Trp Arg Arg Arg Arg

[1743] 1 5 10

[1744] <210> 59

[1745] <211> 15

[1746] <212> PRT

[1747] <213> Artificial Sequence

[1748] <220>

[1749] <223> peptide

[1750] <220>

[1751] <221> MOD_RES

[1752] <222> (2)…(2)

[1753] <223> x is Child

[1754] <220>

[1755] <221> MOD_RES

[1756] <222> (5)…(5)

[1757] <223> x is Child

[1758] <220>

[1759] <221> MOD_RES

[1760] <222> (12)..(12)

[1761] <223> x is Child

[1762] <220>

[1763] <221> MOD_RES

[1764] <222> (14)..(14)

[1765] <223> x is Child

[1766] <400> 59

[1767] Arg Arg Arg Arg Arg Arg Trp Trp Pro Trp Trp Arg Arg Arg Arg

[1768] 1 5 10 15

[1769] <210> 60

[1770] <211> 14

[1771] <212> PRT

[1772] <213> Artificial Sequence

[1773] <220>

[1774] <223> peptide

[1775] <220>

[1776] <221> MOD_RES

[1777] <222> (2)..(2)

[1778] <223> x is bAla

[1779] <220>

[1780] <221> MOD_RES

[1781] <222> (5)..(5)

[1782] <223> x is bAla

[1783] <220>

[1784] <221> MOD_RES

[1785] <222> (11)..(11)

[1786] <223> x is bAla

[1787] <220>

[1788] <221> MOD_RES

[1789] <222> (13)..(13)

[1790] <223> x is bAla

[1791] <400> 60

[1792] Arg Xaa Arg Arg Xaa Arg Trp Pro Trp Trp Xaa Arg Xaa Arg

[1793] 1 5 10

[1794] <210> 61

[1795] <211> 14

[1796] <212> PRT

[1797] <213> Artificial Sequence

[1798] <220>

[1799] <223> peptide

[1800] <220>

[1801] <221> MOD_RES

[1802] <222> (2)..(2)

[1803] <223> x is bAla

[1804] <220>

[1805] <221> MOD_RES

[1806] <222> (5)..(5)

[1807] <223> x is bAla

[1808] <220>

[1809] <221> MOD_RES

[1810] <222> (11)..(11)

[1811] <223> x is bAla

[1812] <220>

[1813] <221> MOD_RES

[1814] <222> (13)..(13)

[1815] <223> x is bAla

[1816] <400> 61

[1817] Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Xaa Arg Xaa Arg

[1818] 1 5 10

[1819] <210> 62

[1820] <211> 15

[1821] <212> PRT

[1822] <213> Artificial Sequence

[1823] <220>

[1824] <223> peptide

[1825] <220>

[1826] <221> MOD_RES

[1827] <222> (2)..(2)

[1828] <223> x is bAla

[1829] <220>

[1830] <221> MOD_RES

[1831] <222> (5)..(5)

[1832] <223> x is bAla

[1833] <220>

[1834] <221> MOD_RES

[1835] <222> (12)..(12)

[1836] <223> x is bAla

[1837] <220>

[1838] <221> MOD_RES

[1839] <222> (14)..(14)

[1840] <223> x is bAla

[1841] <400> 62

[1842] Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Trp Arg Xaa Arg Xaa Arg

[1843] 1 5 10 15

[1844] <210> 63

[1845] <211> 17

[1846] <212> PRT

[1847] <213> Artificial Sequence

[1848] <220>

[1849] <223> peptide

[1850] <220>

[1851] <221> MOD_RES

[1852] <222> (2)..(2)

[1853] <223> x is bAla

[1854] <220>

[1855] <221> MOD_RES

[1856] <222> (5)..(5)

[1857] <223> x is bAla

[1858] <220>

[1859] <221> MOD_RES

[1860] <222> (14)..(14)

[1861] <223> x is bAla

[1862] <220>

[1863] <221> MOD_RES

[1864] <222> (16)..(16)

[1865] <223> x is Child

[1866] <400> 63

[1867] Arg Shale Arg Shaft Arg Shaft Arg Trp Trp Pro Trp Trp Shaft Shaft Arg Shaft

[1868] 1 5 10 15

[1869] Arg

[1870] <210> 64

[1871] <211> 16

[1872] <212> PRT

[1873] <213> Artificial Sequence

[1874] <220>

[1875] <223> peptide

[1876] <220>

[1877] <221> MOD_RES

[1878] <222> (2)…(2)

[1879] <223> x is Child

[1880] <220>

[1881] <221> MOD_RES

[1882] <222> (5)…(5)

[1883] <223> x is Child

[1884] <220>

[1885] <221> MOD_RES

[1886] <222> (13)..(13)

[1887] <223> x is Child

[1888] <220>

[1889] <221> MOD_RES

[1890] <222> (15)..(15)

[1891] <223> x is Child

[1892] <400> 64

[1893] Arg Arg Arg Arg Arg Arg Arg Arg Trp Pro Trp Trp Arg Arg Arg Arg Arg Arg Arg

[1894] 1 5 10 15

[1895] <210> 65

[1896] <211> 16

[1897] <212> PRT

[1898] <213> Artificial Sequence

[1899] <220>

[1900] <223> peptide

[1901] <220>

[1902] <221> MOD_RES

[1903] <222> (2)..(2)

[1904] <223> x is bAla

[1905] <220>

[1906] <221> MOD_RES

[1907] <222> (5)..(5)

[1908] <223> x is bAla

[1909] <220>

[1910] <221> MOD_RES

[1911] <222> (13)..(13)

[1912] <223> x is bAla

[1913] <220>

[1914] <221> MOD_RES

[1915] <222> (15)..(15)

[1916] <223> x is bAla

[1917] <400> 65

[1918] Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Pro Trp Arg Xaa Arg Xaa Arg

[1919] 1 5 10 15

[1920] <210> 66

[1921] <211> 16

[1922] <212> PRT

[1923] <213> Artificial Sequence

[1924] <220>

[1925] <223> peptide

[1926] <220>

[1927] <221> MOD_RES

[1928] <222> (2)..(2)

[1929] <223> x is bAla

[1930] <220>

[1931] <221> MOD_RES

[1932] <222> (5)..(5)

[1933] <223> x is bAla

[1934] <220>

[1935] <221> MOD_RES

[1936] <222> (13)..(13)

[1937] <223> x is bAla

[1938] <220>

[1939] <221> MOD_RES

[1940] <222> (15)..(15)

[1941] <223> x is bAla

[1942] <400> 66

[1943] Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg

[1944] 1 5 10 15

[1945] <210> 67

[1946] <211> 15

[1947] <212> PRT

[1948] <213> Artificial Sequence

[1949] <220>

[1950] <223> peptide

[1951] <220>

[1952] <221> MOD_RES

[1953] <222> (2)..(2)

[1954] <223> x is bAla

[1955] <220>

[1956] <221> MOD_RES

[1957] <222> (5)..(5)

[1958] <223> x is bAla

[1959] <220>

[1960] <221> MOD_RES

[1961] <222> (14)..(14)

[1962] <223> x is bAla

[1963] <400> 67

[1964] Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa Arg

[1965] 1 5 10 15

[1966] <210> 68

[1967] <211> 16

[1968] <212> PRT

[1969] <213> Artificial Sequence

[1970] <220>

[1971] <223> peptide

[1972] <220>

[1973] <221> MOD_RES

[1974] <222> (1)..(1)

[1975] <223> x is bAla

[1976] <220>

[1977] <221> MOD_RES

[1978] <222> (3)..(3)

[1979] <223> x is bAla

[1980] <220>

[1981] <221> MOD_RES

[1982] <222> (5)..(5)

[1983] <223> x is bAla

[1984] <220>

[1985] <221> MOD_RES

[1986] <222> (12)..(12)

[1987] <223> x is bAla

[1988] <220>

[1989] <221> MOD_RES

[1990] <222> (15)..(15)

[1991] <223> x is Child

[1992] <400> 68

[1993] Arg Arg Arg Arg Trp Trp Pro Trp Trp Arg Arg Arg Arg Arg

[1994] 1 5 10 15

[1995] <210> 69

[1996] <211> 16

[1997] <212> PRT

[1998] <213> Artificial Sequence

[1999] <220>

[2000] <223> peptide

[2001] <220>

[2002] <221> MOD_RES

[2003] <222> (2)…(2)

[2004] <223> x is Child

[2005] <220>

[2006] <221> MOD_RES

[2007] <222> (5)…(5)

[2008] <223> x is Child

[2009] <220>

[2010] <221> MOD_RES

[2011] <222> (13)..(13)

[2012] <223> x is Child

[2013] <220>

[2014] <221> MOD_RES

[2015] <222> (15)..(15)

[2016] <223> x is Child

[2017] <400> 69

[2018] Arg Xaa Arg Xaa Arg Arg Phe Gln Ile Leu Tyr His Xaa His

[2019] 1 5 10 15

[2020] <210> 70

[2021] <211> 16

[2022] <212> PRT

[2023] <213> Artificial Sequence

[2024] <220>

[2025] <223> peptide

[2026] <220>

[2027] <221> MOD_RES

[2028] <222> (2)…(2)

[2029] <223> x is Child

[2030] <220>

[2031] <221> MOD_RES

[2032] <222> (5)…(5)

[2033] <223> x is Child

[2034] <220>

[2035] <221> MOD_RES

[2036] <222> (13)..(13)

[2037] <223> x is Child

[2038] <220>

[2039] <221> MOD_RES

[2040] <222> (15)..(15)

[2041] <223> x is Child

[2042] <400> 70

[2043] Arg Stock Arg Stock Arg Phe Gln With Tyr Arg Stock His Stock

[2044] 1 5 10 15

[2045] <210> 71

[2046] <211> 15

[2047] <212> PRT

[2048] <213> Artificial Sequence

[2049] <220>

[2050] <223> peptide

[2051] <220>

[2052] <221> MOD_RES

[2053] <222> (2)..(2)

[2054] <223> x is bAla

[2055] <220>

[2056] <221> MOD_RES

[2057] <222> (5)..(5)

[2058] <223> x is bAla

[2059] <220>

[2060] <221> MOD_RES

[2061] <222> (12)..(12)

[2062] <223> x is bAla

[2063] <220>

[2064] <221> MOD_RES

[2065] <222> (14)..(14)

[2066] <223> x is bAla

[2067] <400> 71

[2068] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa His

[2069] 1 5 10 15

[2070] <210> 72

[2071] <211> 16

[2072] <212> PRT

[2073] <213> Artificial Sequence

[2074] <220>

[2075] <223> peptide

[2076] <220>

[2077] <221> MOD_RES

[2078] <222> (2)..(2)

[2079] <223> x is bAla

[2080] <220>

[2081] <221> MOD_RES

[2082] <222> (5)..(5)

[2083] <223> x is bAla

[2084] <220>

[2085] <221> MOD_RES

[2086] <222> (13)..(13)

[2087] <223> x is hydroxyproline

[2088] <220>

[2089] <221> MOD_RES

[2090] <222> (15)..(15)

[2091] <223> x is hydroxyproline

[2092] <400> 72

[2093] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His

[2094] 1 5 10 15

[2095] <210> 73

[2096] <211> 16

[2097] <212> PRT

[2098] <213> Artificial Sequence

[2099] <220>

[2100] <223> peptide

[2101] <220>

[2102] <221> MOD_RES

[2103] <222> (2)..(2)

[2104] <223> x is hydroxyproline

[2105] <220>

[2106] <221> MOD_RES

[2107] <222> (5)..(5)

[2108] <223> x is hydroxyproline

[2109] <220>

[2110] <221> MOD_RES

[2111] <222> (13)..(13)

[2112] <223> x is bAla

[2113] <220>

[2114] <221> MOD_RES

[2115] <222> (15)..(15)

[2116] <223> x is bAla

[2117] <400> 73

[2118] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His

[2119] 1 5 10 15

[2120] <210> 74

[2121] <211> 16

[2122] <212> PRT

[2123] <213> Artificial Sequence

[2124] <220>

[2125] <223> peptide

[2126] <220>

[2127] <221> MOD_RES

[2128] <222> (2)..(2)

[2129] <223> x is hydroxyproline

[2130] <220>

[2131] <221> MOD_RES

[2132] <222> (5)..(5)

[2133] <223> x is hydroxyproline

[2134] <220>

[2135] <221> MOD_RES

[2136] <222> (13)..(13)

[2137] <223> x is hydroxyproline

[2138] <220>

[2139] <221> MOD_RES

[2140] <222> (15)..(15)

[2141] <223> x is hydroxyproline

[2142] <400> 74

[2143] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His

[2144] 1 5 10 15

[2145] <210> 75

[2146] <211> 14

[2147] <212> PRT

[2148] <213> Artificial Sequence

[2149] <220>

[2150] <223> peptide

[2151] <220>

[2152] <221> MOD_RES

[2153] <222> (2)..(2)

[2154] <223> x is bAla

[2155] <220>

[2156] <221> MOD_RES

[2157] <222> (5)..(5)

[2158] <223> x is bAla

[2159] <220>

[2160] <221> MOD_RES

[2161] <222> (11)..(11)

[2162] <223> x is bAla

[2163] <220>

[2164] <221> MOD_RES

[2165] <222> (13)..(13)

[2166] <223> x is bAla

[2167] <400> 75

[2168] Arg Stone Arg Stone Arg Trp Trp Trp Arg Stone His Stone His

[2169] 1 5 10

[2170] <210> 76

[2171] <211> 14

[2172] <212> PRT

[2173] <213> Artificial Sequence

[2174] <220>

[2175] <223> peptide

[2176] <220>

[2177] <221> MOD_RES

[2178] <222> (2)…(2)

[2179] <223> x is Child

[2180] <220>

[2181] <221> MOD_RES

[2182] <222> (5)…(5)

[2183] <223> x is Child

[2184] <220>

[2185] <221> MOD_RES

[2186] <222> (11)..(11)

[2187] <223> x is Child

[2188] <220>

[2189] <221> MOD_RES

[2190] <222> (13)..(13)

[2191] <223> x is Child

[2192] <400> 76

[2193] Arg Stone Arg Stone Arg Trp Trp Pro Arg Stone His Stone His

[2194] 1 5 10

[2195] <210> 77

[2196] <211> 14

[2197] <212> PRT

[2198] <213> Artificial Sequence

[2199] <220>

[2200] <223> peptide

[2201] <220>

[2202] <221> MOD_RES

[2203] <222> (2)..(2)

[2204] <223> x is bAla

[2205] <220>

[2206] <221> MOD_RES

[2207] <222> (5)..(5)

[2208] <223> x is bAla

[2209] <220>

[2210] <221> MOD_RES

[2211] <222> (11)..(11)

[2212] <223> x is bAla

[2213] <220>

[2214] <221> MOD_RES

[2215] <222> (13)..(13)

[2216] <223> x is bAla

[2217] <400> 77

[2218] Arg Xaa Arg Arg Xaa Arg Pro Trp Trp Arg Xaa His Xaa His

[2219] 1 5 10

[2220] <210> 78

[2221] <211> 16

[2222] <212> PRT

[2223] <213> Artificial Sequence

[2224] <220>

[2225] <223> peptide

[2226] <220>

[2227] <221> MOD_RES

[2228] <222> (2)..(2)

[2229] <223> x is bAla

[2230] <220>

[2231] <221> MOD_RES

[2232] <222> (5)..(5)

[2233] <223> x is bAla

[2234] <220>

[2235] <221> MOD_RES

[2236] <222> (13)..(13)

[2237] <223> x is bAla

[2238] <220>

[2239] <221> MOD_RES

[2240] <222> (15)..(15)

[2241] <223> x is bAla

[2242] <400> 78

[2243] Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Trp Arg Xaa His Xaa His

[2244] 1 5 10 15

[2245] <210> 79

[2246] <211> 15

[2247] <212> PRT

[2248] <213> Artificial Sequence

[2249] <220>

[2250] <223> peptide

[2251] <220>

[2252] <221> MOD_RES

[2253] <222> (2)..(2)

[2254] <223> x is bAla

[2255] <220>

[2256] <221> MOD_RES

[2257] <222> (5)..(5)

[2258] <223> x is bAla

[2259] <220>

[2260] <221> MOD_RES

[2261] <222> (12)..(12)

[2262] <223> x is bAla

[2263] <220>

[2264] <221> MOD_RES

[2265] <222> (14)..(14)

[2266] <223> x is bAla

[2267] <400> 79

[2268] Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Arg Xaa His Xaa His

[2269] 1 5 10 15

[2270] <210> 80

[2271] <211> 15

[2272] <212> PRT

[2273] <213> Artificial Sequence

[2274] <220>

[2275] <223> peptide

[2276] <220>

[2277] <221> MOD_RES

[2278] <222> (2)..(2)

[2279] <223> x is bAla

[2280] <220>

[2281] <221> MOD_RES

[2282] <222> (5)..(5)

[2283] <223> x is bAla

[2284] <220>

[2285] <221> MOD_RES

[2286] <222> (12)..(12)

[2287] <223> x is bAla

[2288] <220>

[2289] <221> MOD_RES

[2290] <222> (14)..(14)

[2291] <223> x is Child

[2292] <400> 80

[2293] Arg Stone Arg Stone Arg Trp Pro Trp Trp Arg Stone His Stone His

[2294] 1 5 10 15

[2295] <210> 81

[2296] <211> 15

[2297] <212> PRT

[2298] <213> Artificial Sequence

[2299] <220>

[2300] <223> peptide

[2301] <220>

[2302] <221> MOD_RES

[2303] <222> (2)…(2)

[2304] <223> x is Child

[2305] <220>

[2306] <221> MOD_RES

[2307] <222> (5)…(5)

[2308] <223> x is Child

[2309] <220>

[2310] <221> MOD_RES

[2311] <222> (12)..(12)

[2312] <223> x is Child

[2313] <220>

[2314] <221> MOD_RES

[2315] <222> (14)..(14)

[2316] <223> x is Child

[2317] <400> 81

[2318] Arg Stone Arg Stone Arg Arg Trp Trp Trp Arg Stone His Stone His

[2319] 1 5 10 15

[2320] <210> 82

[2321] <211> 17

[2322] <212> PRT

[2323] <213> Artificial Sequence

[2324] <220>

[2325] <223> peptide

[2326] <220>

[2327] <221> MOD_RES

[2328] <222> (2)..(2)

[2329] <223> x is bAla

[2330] <220>

[2331] <221> MOD_RES

[2332] <222> (5)..(5)

[2333] <223> x is bAla

[2334] <220>

[2335] <221> MOD_RES

[2336] <222> (14)..(14)

[2337] <223> x is bAla

[2338] <220>

[2339] <221> MOD_RES

[2340] <222> (16)..(16)

[2341] <223> x is bAla

[2342] <400> 82

[2343] Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Pro Trp Trp Arg Xaa His Xaa

[2344] 1 5 10 15

[2345] His

[2346] <210> 83

[2347] <211> 16

[2348] <212> PRT

[2349] <213> Artificial Sequence

[2350] <220>

[2351] <223> peptide

[2352] <220>

[2353] <221> MOD_RES

[2354] <222> (2)..(2)

[2355] <223> x is bAla

[2356] <220>

[2357] <221> MOD_RES

[2358] <222> (5)..(5)

[2359] <223> x is bAla

[2360] <220>

[2361] <221> MOD_RES

[2362] <222> (13)..(13)

[2363] <223> x is bAla

[2364] <220>

[2365] <221> MOD_RES

[2366] <222> (15)..(15)

[2367] <223> x is bAla

[2368] <400> 83

[2369] Arg Xaa Arg Arg Xaa Arg Arg Trp Pro Trp Trp Arg Xaa His Xaa His

[2370] 1 5 10 15

[2371] <210> 84

[2372] <211> 16

[2373] <212> PRT

[2374] <213> Artificial Sequence

[2375] <220>

[2376] <223> peptide

[2377] <220>

[2378] <221> MOD_RES

[2379] <222> (2)..(2)

[2380] <223> x is bAla

[2381] <220>

[2382] <221> MOD_RES

[2383] <222> (5)..(5)

[2384] <223> x is bAla

[2385] <220>

[2386] <221> MOD_RES

[2387] <222> (13)..(13)

[2388] <223> x is bAla

[2389] <220>

[2390] <221> MOD_RES

[2391] <222> (15)..(15)

[2392] <223> x is bAla

[2393] <400> 84

[2394] Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Pro Trp Arg Xaa His Xaa His

[2395] 1 5 10 15

[2396] <210> 85

[2397] <211> 17

[2398] <212> PRT

[2399] <213> Artificial Sequence

[2400] <220>

[2401] <223> peptide

[2402] <220>

[2403] <221> MOD_RES

[2404] <222> (3)..(3)

[2405] <223> x is bAla

[2406] <220>

[2407] <221> MOD_RES

[2408] <222> (6)..(6)

[2409] <223> x is bAla

[2410] <220>

[2411] <221> MOD_RES

[2412] <222> (14)..(14)

[2413] <223> x is bAla

[2414] <220>

[2415] <221> MOD_RES

[2416] <222> (16)..(16)

[2417] <223> x is bAla

[2418] <400> 85

[2419] Arg Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa

[2420] 1 5 10 15

[2421] His

[2422] <210> 86

[2423] <211> 16

[2424] <212> PRT

[2425] <213> Artificial Sequence

[2426] <220>

[2427] <223> peptide

[2428] <220>

[2429] <221> MOD_RES

[2430] <222> (1)..(1)

[2431] <223> x is bAla

[2432] <220>

[2433] <221> MOD_RES

[2434] <222> (4)..(4)

[2435] <223> x is bAla

[2436] <220>

[2437] <221> MOD_RES

[2438] <222> (13)..(13)

[2439] <223> x is bAla

[2440] <220>

[2441] <221> MOD_RES

[2442] <222> (15)..(15)

[2443] <223> x is bAla

[2444] <400> 86

[2445] Xaa Arg Arg Battery Arg Phe Gln With Tyr Arg Battery His Battery

[2446] 1 5 10 15

[2447] <210> 87

[2448] <211> 16

[2449] <212> PRT

[2450] <213> Artificial Sequence

[2451] <220>

[2452] <223> peptide

[2453] <220>

[2454] <221> MOD_RES

[2455] <222> (3)…(3)

[2456] <223> x is Child

[2457] <220>

[2458] <221> MOD_RES

[2459] <222> (6)…(6)

[2460] <223> x is Child

[2461] <220>

[2462] <221> MOD_RES

[2463] <222> (13)..(13)

[2464] <223> x is Child

[2465] <220>

[2466] <221> MOD_RES

[2467] <222> (15)..(15)

[2468] <223> x is Child

[2469] <400> 87

[2470] Arg Arg Xaa Arg Arg Xaa Arg Phe Gln With Leu Tyr His His

[2471] 1 5 10 15

[2472] <210> 88

[2473] <211> 15

[2474] <212> PRT

[2475] <213> Artificial Sequence

[2476] <220>

[2477] <223> peptide

[2478] <220>

[2479] <221> MOD_RES

[2480] <222> (1)..(1)

[2481] <223> x is bAla

[2482] <220>

[2483] <221> MOD_RES

[2484] <222> (4)..(4)

[2485] <223> x is bAla

[2486] <220>

[2487] <221> MOD_RES

[2488] <222> (12)..(12)

[2489] <223> x is bAla

[2490] <220>

[2491] <221> MOD_RES

[2492] <222> (14)..(14)

[2493] <223> x is bAla

[2494] <400> 88

[2495] Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Xaa His Xaa His

[2496] 1 5 10 15

[2497] <210> 89

[2498] <211> 17

[2499] <212> PRT

[2500] <213> Artificial Sequence

[2501] <220>

[2502] <223> peptide

[2503] <220>

[2504] <221> MOD_RES

[2505] <222> (2)..(2)

[2506] <223> x is bAla

[2507] <220>

[2508] <221> MOD_RES

[2509] <222> (5)..(5)

[2510] <223> x is bAla

[2511] <220>

[2512] <221> MOD_RES

[2513] <222> (14)..(14)

[2514] <223> x is bAla

[2515] <220>

[2516] <221> MOD_RES

[2517] <222> (16)..(16)

[2518] <223> x is bAla

[2519] <400> 89

[2520] Arg Xaa Arg Arg Xaa His Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa

[2521] 1 5 10 15

[2522] His

[2523] <210> 90

[2524] <211> 15

[2525] <212> PRT

[2526] <213> Artificial Sequence

[2527] <220>

[2528] <223> peptide

[2529] <220>

[2530] <221> MISC_FEATURE

[2531] <222> (2)..(2)

[2532] <223> x is bAla

[2533] <220>

[2534] <221> MISC_FEATURE

[2535] <222> (5)..(5)

[2536] <223> x is bAla

[2537] <220>

[2538] <221> MISC_FEATURE

[2539] <222> (12)..(12)

[2540] <223> x is hydroxyproline

[2541] <220>

[2542] <221> MISC_FEATURE

[2543] <222> (14)..(14)

[2544] <223> x is hydroxyproline

[2545] <400> 90

[2546] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg

[2547] 1 5 10 15

[2548] <210> 91

[2549] <211> 15

[2550] <212> PRT

[2551] <213> Artificial Sequence

[2552] <220>

[2553] <223> peptide

[2554] <220>

[2555] <221> MISC_FEATURE

[2556] <222> (2)..(2)

[2557] <223> x is hydroxyproline

[2558] <220>

[2559] <221> MISC_FEATURE

[2560] <222> (5)..(5)

[2561] <223> x is hydroxyproline

[2562] <220>

[2563] <221> MISC_FEATURE

[2564] <222> (12)..(12)

[2565] <223> x is bAla

[2566] <220>

[2567] <221> MISC_FEATURE

[2568] <222> (14)..(14)

[2569] <223> x is bAla

[2570] <400> 91

[2571] Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg

[2572] 1 5 10 15

[2573] <210> 92

[2574] <211> 15

[2575] <212> PRT

[2576] <213> Artificial Sequence

[2577] <220>

[2578] <223> peptide

[2579] <220>

[2580] <221> MISC_FEATURE

[2581] <222> (2)..(2)

[2582] <223> x is hydroxyproline

[2583] <220>

[2584] <221> MISC_FEATURE

[2585] <222> (5)..(5)

[2586] <223> x is hydroxyproline

[2587] <220>

[2588] <221> MISC_FEATURE

[2589] <222> (12)..(12)

[2590] <223> x is hydroxyproline

[2591] <220>

[2592] <221> MISC_FEATURE

[2593] <222> (14)..(14)

[2594] <223> x is hydroxyproline

[2595] <400> 92

[2596] Arg Share Arg Share Arg Share Phe Gln Ile Tyr Share

[2597] 1 5 10 15

[2598] <210> 93

[2599] <211> 13

[2600] <212> PRT

[2601] <213> Artificial Sequence

[2602] <220>

[2603] <223> peptide

[2604] <220>

[2605] <221> MISC_FEATURES

[2606] <222> (2)…(2)

[2607] <223> x is Child

[2608] <220>

[2609] <221> MISC_FEATURES

[2610] <222> (5)…(5)

[2611] <223> x is Child

[2612] <220>

[2613] <221> MISC_FEATURES

[2614] <222> (10)..(10)

[2615] <223> x is Child

[2616] <220>

[2617] <221> MISC_FEATURES

[2618] <222> (12)..(12)

[2619] <223> x is Child

[2620] <400> 93

[2621] Arg Arg Arg Arg Arg Arg Trp Trp Trp Arg Arg Arg Arg

[2622] 1 5 10

[2623] <210> 94

[2624] <211> 15

[2625] <212> PRT

[2626] <213> Artificial Sequence

[2627] <220>

[2628] <223> peptide

[2629] <220>

[2630] <221> MISC_FEATURE

[2631] <222> (2)..(2)

[2632] <223> x is bAla

[2633] <220>

[2634] <221> MISC_FEATURE

[2635] <222> (5)..(5)

[2636] <223> x is bAla

[2637] <220>

[2638] <221> MISC_FEATURE

[2639] <222> (12)..(12)

[2640] <223> x is bAla

[2641] <220>

[2642] <221> MISC_FEATURE

[2643] <222> (14)..(14)

[2644] <223> x is bAla

[2645] <400> 94

[2646] Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Trp Xaa Arg Xaa Arg

[2647] 1 5 10 15

[2648] <210> 95

[2649] <211> 21

[2650] <212> DNA

[2651] <213> Artificial Sequence

[2652] <220>

[2653] <223> 21-mer PMO antisense sequence

[2654] <400> 95

[2655] cagcagcagc agcagcagca g 21

[2656] <210> 96

[2657] <211> 21

[2658] <212> DNA

[2659] <213> Artificial Sequence

[2660] <220>

[2661] <223> phosphorothioate probe

[2662] <220>

[2663] <221> misc_feature

[2664] <222> (1)..(1)

[2665] <223> labelled with digoxigenin

[2666] <220>

[2667] <221> misc_feature

[2668] <222> (21)..(21)

[2669] <223> labelled with biotin

[2670] <400> 96

[2671] ctgctgctgc tgctgctgct g 21

[2672] <210> 97

[2673] <211> 11

[2674] <212> PRT

[2675] <213> Artificial Sequence

[2676] <220>

[2677] <223> D-PEP 5.70

[2678] <220>

[2679] <221> MISC_FEATURE

[2680] <222> (2)..(2)

[2681] <223> x is bAla

[2682] <220>

[2683] <221> MISC_FEATURE

[2684] <222> (4)..(4)

[2685] <223> x is bAla

[2686] <220>

[2687] <221> MISC_FEATURE

[2688] <222> (6)..(6)

[2689] <223> glucosylated serine residue

[2690] <220>

[2691] <221> MISC_FEATURE

[2692] <222> (8)..(8)

[2693] <223> x is bAla

[2694] <220>

[2695] <221> MISC_FEATURE

[2696] <222> (10)..(10)

[2697] <223> x is bAla

[2698] <400> 97

[2699] Arg Xaa Arg Xaa Arg Ser Arg Xaa Arg Xaa Arg

[2700] 1 5 10

[2701] <210> 98

[2702] <211> 21

[2703] <212> PRT

[2704] <213> Artificial Sequence

[2705] <220>

[2706] <223> Pip6a

[2707] <220>

[2708] <221> MISC_FEATURE

[2709] <222> (2)..(2)

[2710] <223> x is aminohexanoic acid

[2711] <220>

[2712] <221> MISC_FEATURE

[2713] <222> (5)..(5)

[2714] <223> x is bAla

[2715] <220>

[2716] <221> MISC_FEATURE

[2717] <222> (8)..(8)

[2718] <223> x is aminohexanoic acid

[2719] <220>

[2720] <221> MISC_FEATURE

[2721] <222> (16)..(16)

[2722] <223> x is aminohexanoic acid

[2723] <220>

[2724] <221> MISC_FEATURE

[2725] <222> (18)..(18)

[2726] <223> x is bAla

[2727] <220>

[2728] <221> MISC_FEATURE

[2729] <222> (20)..(20)

[2730] <223> x is aminohexanoic acid

[2731] <400> 98

[2732] Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Tyr Gln Phe Leu Ile Arg Xaa

[2733] 1 5 10 15

[2734] Arg Xaa Arg Xaa Arg

[2735] 20

[2736] <210> 99

[2737] <211> 17

[2738] <212> PRT

[2739] <213> Artificial Sequence

[2740] <220>

[2741] <223> Pip9b2

[2742] <220>

[2743] <221> MISC_FEATURE

[2744] <222> (2)..(2)

[2745] <223> x is aminohexanoic acid

[2746] <220>

[2747] <221> MISC_FEATURE

[2748] <222> (5)..(5)

[2749] <223> x is bAla

[2750] <220>

[2751] <221> MISC_FEATURE

[2752] <222> (14)..(14)

[2753] <223> x is bAla

[2754] <220>

[2755] <221> MISC_FEATURE

[2756] <222> (16)..(16)

[2757] <223> x is aminohexanoic acid

[2758] <400> 99

[2759] Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Xaa

[2760] 1 5 10 15

[2761] Arg

[2762] <210> 100

[2763] <211> 21

[2764] <212> DNA

[2765] <213> Artificial Sequence

[2766] <220>

[2767] <223> primer Mbnl1.F

[2768] <400> 100

[2769] gctgcccaat accaggtcaa c 21

[2770] <210> 101

[2771] <211> 22

[2772] <212> DNA

[2773] <213> Artificial Sequence

[2774] <220>

[2775] <223> primer Mbnl1.R

[2776] <400> 101

[2777] tggtgggaga aatgctgtat gc 22

[2778] <210> 102

[2779] <211> 22

[2780] <212> DNA

[2781] <213> Artificial Sequence

[2782] <220>

[2783] <223> primer Clcn1.F

[2784] <400> 102

[2785] ttcacatcgc cagcatctgt gc 22

[2786] <210> 103

[2787] <211> 25

[2788] <212> DNA

[2789] <213> Artificial Sequence

[2790] <220>

[2791] <223> primer Clcn1.R

[2792] <400> 103

[2793] cacggaacac aaaggcactg aatgt 25

[2794] <210> 104

[2795] <211> 23

[2796] <212> DNA

[2797] <213> Artificial Sequence

[2798] <220>

[2799] <223> Primer Serca.F

[2800] <400> 104

[2801] gctcatggtc ctcaagatct cac 23

[2802] <210> 105

[2803] <211> 20

[2804] <212> DNA

[2805] <213> Artificial Sequence

[2806] <220>

[2807] <223> primer Serca.R

[2808] <400> 105

[2809] gggtcagtgc ctcagctttg 20

[2810] <210> 106

[2811] <211> 22

[2812] <212> DNA

[2813] <213> Artificial Sequence

[2814] <220>

[2815] <223> primer Ldb3.F

[2816] <400> 106

[2817] ggaagatgag gctgatgagt gg 22

[2818] <210> 107

[2819] <211> 24

[2820] <212> DNA

[2821] <213> Artificial Sequence

[2822] <220>

[2823] <223> primer Ldb3.R

[2824] <400> 107

[2825] tgctgacagt ggtagtgctc tttc 24

[2826] <210> 108

[2827] <211> 21

[2828] <212> DNA

[2829] <213> Artificial Sequence

[2830] <220>

[2831] <223> primer BIN.F

[2832] <400> 108

[2833] agaacctcaa tgatgtgctg g 21

[2834] <210> 109

[2835] <211> 21

[2836] <212> DNA

[2837] <213> Artificial Sequence

[2838] <220>

[2839] <223> primer BIN.R

[2840] <400> 109

[2841] tcgtgttgac tctgatctcg g 21

[2842] <210> 110

[2843] <211> 20

[2844] <212> DNA

[2845] <213> Artificial Sequence

[2846] <220>

[2847] <223> primer DMD.F

[2848] <400> 110

[2849] ttagaggagg tgatggagca 20

[2850] <210> 111

[2851] <211> 20

[2852] <212> DNA

[2853] <213> Artificial Sequence

[2854] <220>

[2855] <223> primer DMD.R

[2856] <400> 111

[2857] gatactaagg actccatcgc 20

[2858] <210> 112

[2859] <211> 20

[2860] <212> DNA

[2861] <213> Artificial Sequence

[2862] <220>

[2863] <223> primer INSR.F

[2864] <400> 112

[2865] ccaaagacag actctcagat 20

[2866] <210> 113

[2867] <211> 20

[2868] <212> DNA

[2869] <213> Artificial Sequence

[2870] <220>

[2871] <223> primer INSR.R

[2872] <400> 113

[2873] aacatcgcca agggacctgc 20

[2874] <210> 114

[2875] <211> 23

[2876] <212> DNA

[2877] <213> Artificial Sequence

[2878] <220>

[2879] <223> primer LDB3.F

[2880] <400> 114

[2881] gcaagaccct gatgaagaag ctc 23

[2882] <210> 115

[2883] <211> 19

[2884] <212> DNA

[2885] <213> Artificial Sequence

[2886] <220>

[2887] <223> primer LDB3.R

[2888] <400> 115

[2889] gacagaaggc cggatgctg 19

[2890] <210> 116

[2891] <211> 20

[2892] <212> DNA

[2893] <213> Artificial Sequence

[2894] <220>

[2895] <223> primer SERCA.F

[2896] <400> 116

[2897] atcttcaagc tccgggccct 20

[2898] <210> 117

[2899] <211> 20

[2900] <212> DNA

[2901] <213> Artificial Sequence

[2902] <220>

[2903] <223> primer SERCA.R

[2904] <400> 117

[2905] cagctctgcc tgaagatgtg 20

[2906] <210> 118

[2907] <211> 23

[2908] <212> DNA

[2909] <213> Artificial Sequence

[2910] <220>

[2911] <223> primer SOS1.F

[2912] <400> 118

[2913] cagtaccaca gatgtttgca gtg 23

[2914] <210> 119

[2915] <211> 22

[2916] <212> DNA

[2917] <213> Artificial Sequence

[2918] <220>

[2919] <223> primer SOS1.R

[2920] <400> 119

[2921] tctggtcgtc ttcgtggagg aa 22

[2922] <210> 120

[2923] <211> 24

[2924] <212> DNA

[2925] <213> Artificial Sequence

[2926] <220>

[2927] <223> primer TNNT2.F

[2928] <400> 120

[2929] atagaagagg tggtggaaga gtac 24

[2930] <210> 121

[2931] <211> 24

[2932] <212> DNA

[2933] <213> Artificial Sequence

[2934] <220>

[2935] <223> primer TNNT2.R

[2936] <400> 121

[2937] gtctcagcct ctgcttcagc atcc 24

[2938] <---

Claims

1. A method for preventing or treating a trinucleotide repeat disorder in a subject in need thereof, comprising: administering to the subject a conjugate comprising a peptide carrier covalently linked to a therapeutic molecule; in which the peptide carrier contains two cationic domains and one hydrophobic domain, wherein the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises a plurality of trinucleotide repeats selected from the repeats CAG, CTG, CGG, GAA, GCC, GGC, CTT and CCG, wherein the nucleic acid comprises from 5 to 20 trinucleotide repeats, wherein each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), or any combination thereof; and wherein the hydrophobic domain consists of one of the following sequences: FQILY (SEQ ID NO: 21), WWW, WWPWW (SEQ ID NO: 24), or any combination thereof.

2. The method of claim 1, wherein the nucleic acid comprises a plurality of CAG repeats.

3. The method according to any one of the preceding claims, wherein the nucleic acid comprises from 5 to 10 trinucleotide repeats, preferably 7 trinucleotide repeats.

4. The method according to any one of the preceding claims, wherein each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8).

5. The method according to any one of the preceding claims, wherein each hydrophobic domain consists of 5 amino acids.

6. The method according to any one of the preceding claims, wherein the peptide consists of one hydrophobic core domain flanked by two cationic arm domains.

7. The method according to any one of the preceding claims, wherein the peptide carrier consists of one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), RBRRBRFQILYRBHBH (SEQ ID NO: 44), RBRRBRRFQILYRBRBR (SEQ ID NO: 27), RBRRBRFQILYRRBRBR (SEQ ID NO: 29), RBRBRFQILYRBRRBRR (SEQ ID NO: 30), RBRRBRRYQFLIRBRBR (SEQ ID NO: 31), RBRRBRRILFQYRBRBR (SEQ ID NO: 32), RBRRBRFQILYRBRBR (SEQ ID NO: 33), RBRRBFQILYRBRBR (SEQ ID NO: 36), RBRRBRRFQILYHBHBR (SEQ ID NO: 38) 52), RBRRBRWWWBRBR (SEQ ID NO: 58) and RBRRBRWWPWWBRBR (SEQ ID NO: 59).

8. The method according to any one of the preceding claims, wherein the peptide carrier is covalently linked to the therapeutic molecule via a linker.

9. The method of claim 8, wherein the linker is selected from G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, XB, E, GABA and succinic acid.

10. The method according to claim 8 or 9, wherein the linker is at the C-terminus of the peptide or at the N-terminus of the peptide.

11. The method according to any one of claims 8-10, wherein the C-terminus of the peptide carrier is linked to the nucleic acid via a linker.

12. The method according to any one of the preceding claims, wherein the nucleic acid is a phosphorodiamidate morpholine oligomer (PMO).

13. The method according to claim 12, wherein the 3'-end of the RMO is linked to the peptide carrier of the conjugate via a linker.

14. The method according to any one of the preceding claims, wherein the peptide comprises an N-terminal modification, preferably the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated or N-methylsulfonylated.

15. A method for preventing or treating a trinucleotide repeat disorder in a subject in need thereof, comprising administering to the subject a conjugate comprising: (a) a cell-permeable peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked by beta-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats; (b) a cell-permeable peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked by glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats; (c) a cell-penetrating peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked to GABA (Ab) with an antisense oligonucleotide consisting of seven CAG repeats; (d) a cell-permeable peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked by beta-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats; (d) a cell-permeable peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked by glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats; (e) a cell-permeable peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked to GABA (Ab) with an antisense oligonucleotide consisting of seven CAG repeats; (g) a cell-penetrating peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked by beta-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats; (z) a cell-permeable peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked by glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats; or (i) a cell-penetrating peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked to GABA (Ab) with an antisense oligonucleotide consisting of seven CAG repeats; optionally, wherein the cell-penetrating peptide of the conjugate is acetylated at the N-terminus.

16. The method according to claim 15, wherein the N-terminus of the peptide is modified, preferably wherein the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated or N-methylsulfonylated.

17. The method according to any one of claims 15 or 16, wherein the C-terminus of the peptide carrier is linked to the antisense oligonucleotide via a linker.

18. The method according to any one of claims 15-17, wherein the antisense oligonucleotide is a phosphorodiamidate morpholine oligomer (PMO).

19. The method according to claim 18, wherein the 3'-end of the PMO is linked to the peptide carrier of the conjugate via a linker.

20. The method according to any one of claims 1-19, wherein the disorder caused by trinucleotide repeats is selected from a polyglutamine disorder or a non-polyglutamine disorder.

21. The method of claim 20, wherein the trinucleotide repeat disorder is selected from: DRPLA (dentatorubropallidolus atrophy), HD (Huntington's disease), HDL2 (Huntington's disease syndrome type 2), SBMA (spinal and bulbar muscle atrophy), SCA1 (spinocerebral ataxia type 1), SCA2 (spinocerebral ataxia type 2), SCA3 (spinocerebral ataxia type 3 or Machado-Joseph disease), SCA6 (spinocerebral ataxia type 6), SCA7 (spinocerebral ataxia type 7) and SCA17 (spinocerebral ataxia type 17), FRAXA (fragile X syndrome), FXTAS (fragile X-associated tremor / ataxia syndrome) X-linked), FRAXE (fragile XE-associated mental retardation), FRDA (Friedreich's ataxia), DM1 (myotonic dystrophy type 1), SCA8 (spinocerebral ataxia type 8), and SCA12 (spinocerebral ataxia type 12).

22. The method of claim 20 or 21, wherein the trinucleotide repeat disorder is myotonic dystrophy type 1 (DM1).

Citation Information

Patent Citations

  • Method of introduction of PNA molecule conjugated with positive peptide, in cytosol and / or nucleus by photochemical internalisation (PCI)

    RU2435859C2

  • Cell-penetrating peptides having a central hydrophobic domain

    US9302014B2

  • Peptide-linked morpholino antisense oligonucleotides for treatment of myotonic dystrophy

    WO2014052276A1