Nanogel coated vaccine
A nanogel-coated vaccine antigen complex addresses the limitations of encapsulating larger molecules by coating rather than encapsulating, achieving a 10-fold enhancement in mucosal immune response and pathogen neutralization.
Patent Information
- Authority / Receiving Office
- RU · RU
- Patent Type
- Patents
- Current Assignee / Owner
- THE UNIV OF TOKYO
- Filing Date
- 2022-03-28
- Publication Date
- 2026-07-06
AI Technical Summary
Existing vaccines, particularly injectable ones, struggle to induce effective mucosal immunity at the site of viral infection, leading to challenges in inhibiting pathogenic infection and transmission, while mucosal vaccines face limitations in encapsulating larger antigen molecules like VLPs or inactivated viruses.
A nanogel-coated vaccine antigen complex is developed, where the antigen is coated with a nanogel rather than encapsulated, using a higher ratio of nanogel to antigen, effectively inducing mucosal immunity by attaching the nanogel to the surface of larger antigens such as VLPs.
The nanogel-coated antigen complex induces a mucosal immune response 10 times stronger than traditional methods, effectively neutralizing pathogens and preventing transmission, as demonstrated by increased antibody titers and neutralizing effects.
Smart Images

Figure 00000002 
Figure 00000003 
Figure 00000004
Abstract
Description
Field of invention
[0001] The present invention relates to a vaccine using a nanogel. More specifically, the present invention relates to a vaccine that is a complex of a vaccine antigen and a nanogel, in which the antigen is coated with the nanogel. Prior Art
[0002] Vaccines are typically administered by injection. This type of injection can induce immune responses, including antibody production in vivo. However, it is difficult to elicit a protective immune response at the site of viral infection and, as a result, to inhibit the pathogenic infection itself. In particular, viral infections are often transmitted to others after infection but before symptoms appear. Consequently, injectable vaccines cannot effectively inhibit viral transmission to others immediately after infection.Unlike such injectable vaccines, mucosal vaccines, such as nasal vaccines, can induce mucosal immunity (mucosal IgA) in the mucosal area infected by the pathogen and can neutralize the pathogen, thus suppressing infection by the pathogen and, furthermore, transmission of the pathogen to other people.
[0003] At present, in order to effectively induce mucosal immunity, the present inventors have used a self-aggregating nanoscale hydrogel composed of cholesterol-loaded cationic pullulan (cholesterol group-bearing cationic pullulan (cCHP)) as a delivery unit for nasal mucosal vaccines (Patent Literature 1 and Pe Patent Literature 1) and established a method capable of inducing effective mucosal immunity, which includes preparing an antigen complex in a form in which the vaccine antigen is encapsulated in a nanogel. When the cCHP nanogel encapsulates the antigen protein in its nanomatrix, it functions as an artificial chaperone, prevents the aggregation and degeneration of the antigen, and facilitates refolding after the antigen is released. This nanogel has the property of effectively adhering to the surface of the negatively charged mucosa.The nanogel releases antigens for a long time and delivers these antigens to antigen-presenting cells, thereby inducing an immune response (Non-patent Literature 2, Non-patent Literature 3, and Patent Literature 2). Furthermore, in the case of mice, although the cCHP nanogel, which carries [. 111 In]-labeled BoHc / A (C-terminal non-toxic region of the heavy chain of botulinum toxin type A) or pneumococcal surface antigen PspA is administered to mice through the nose, it does not accumulate in the central nervous system such as the olfactory bulb or the brain (Non-patent Literature 2), and its safety is confirmed (Non-patent Literature 4).
[0004] Meanwhile, the previously reported nanogel-antigen complex encapsulates the protein antigen within a nanogel composed of approximately 4 cCHP molecules, thereby preventing the aggregation and denaturation of the antigen, accelerating the refolding of the antigen released from the interior of the nanogel, and inducing an effective immune response (Non-Patent Literature 5). Therefore, it is impossible to encapsulate molecules with a molecular weight greater than that of the nanogel (approximately 1000 kDa) into the nanogel, and thus, it is believed that such large molecules cannot form a complex with the nanogel (Non-Patent Literature 5). In other words, with the traditional method of encapsulating antigen in a nanogel, a complex of antigen, such as viral antigen, VLP (virus-like particle) or inactivated virus, each of which is larger than the nanogel (diameter: approximately 30 nm), and the nanogel could not be formed.BibliographyPatent literature.
[0005] Patent Literature 1: WO 00 / 12564Patent Literature 2: JP Patent Publication (Kokai) No. 2010-105968 ANon-patent Literature
[0006] Non-patent Literature 1: Ayame et al., Bioconjug Chem 19: 882–890, 2008Non-patent Literature 2: Nochi et al., Nat Mater 9: 572–578, 2010Non-patent Literature 3: Yuki et al., Biotechnol Genet Eng Rev 29: 61–72, 2013Non-patent Literature 4: Kong et al., Infect Immun 81: 1625–1634, 2013Non-patent Literature 5: Yuki et al., Mol. Pharmaceutics, 18: 1582–1592, 2021Summary of the InventionTechnical Problem
[0007] Considering the above circumstances, an object of the present invention is to provide a complex of an antigen that is not encapsulated in a nanogel (namely, an antigen that is larger than the size that can be encapsulated in a nanogel) and a nanogel; and a vaccine preparation containing the above-mentioned complex. Solution to the problem
[0008] The present inventors have conducted extensive research on the method for forming a nanogel-antigen complex larger than the size that can be encapsulated in the nanogel. The present inventors attempted to obtain a complex in which the vaccine antigen is not encapsulated in a nanogel, but the nanogel is attached to the surface of the vaccine antigen, specifically, where the vaccine antigen is coated with a nanogel (hereinafter, the complex is also referred to as a "nanogel-coated complex"). As a result, the present inventors successfully obtained a nanogel-coated complex. The present inventors confirmed that the nanogel-coated antigen induces effective mucosal immunity.In particular, it was said that the optimal ratio of the mixture components, the antigen and the nanogel, which was used to obtain the standard complex of the nanogel and the encapsulated antigen (hereinafter also referred to as the "antigen-encapsulating complex"), is from 1 to 2.5 molecules (1-10 in CHPNH2 equivalent), preferably 1 molecule (4 in CHPNH2 equivalent) relative to 1 molecule of the antigen (Patent Literature 2). The inventors of the present invention significantly increased the mixing amount of the nanogel relative to 1 molecule of norovirus VLP (antigen) and treated the VLP (antigen) with 18 molecules (72 in CHPNH2 equivalent) or 180 molecules (720 in CHPNH2 equivalent) of the nanogel. As a result, the inventors of the present invention found for the first time that the VLP (antigen) can be relatively uniformly coated with the nanogel (see Fig. 8 and Fig. 9).The present inventors confirmed that intranasal administration of the obtained nanogel-coated VLPs to mice can induce a mucosal immune response that is 10 times or more stronger than the mucosal immune response obtained by administering only the VLPs. The particle diameter of norovirus VLPs is approximately 30 to 40 nm, and thus, the norovirus VLP is an antigen that is larger than the diameter of the nanogel particles (approximately 30 nm). In other words, the present inventors discovered for the first time that even an antigen that is larger than a nanogel, such as a VLP, can form a nanogel-antigen complex by coating the antigen with a nanogel (without encapsulating the antigen in the nanogel), and that this nanogel-antigen complex effectively induces a mucosal immune response, thus completing the present invention.
[0009] Specifically, the present invention includes the following (1) to (7).(1) A complex of a nanogel and a vaccine antigen, in which the vaccine antigen is coated with a nanogel.(2) The complex according to (1), characterized in that the particle diameter of the vaccine antigen is 20 nm or more.(3) The complex according to (1) or (2), characterized in that the vaccine antigen is a substance larger than the nanogel.(4) The complex according to any one of (1) to (3), characterized in that the vaccine antigen is a VLP (virus-like particle), an inactivated virus, a huge protein molecule of 20 nm or more, a polymer.(5) The complex according to any one of (1) to (4), characterized in that the vaccine antigen and the nanogel are complexed with each other at a molar ratio of 1:15 to 1:200.(6) The complex according to any one of (1)-(5), which is characterized in that it additionally contains an adjuvant.(7) A vaccine preparation containing a complex according to any of paragraphs (1)-(6).It should be noted that the preposition "up to" enclosed between numerical values is used in the present description to designate an interval of numerical values that includes numerical values located to the left and right of this preposition. Advantageous effects of the invention.
[0010] According to the present invention, since it is possible to form a complex of antigen and nanogel, although the antigen has a larger antigen molecule, the immune response can be effectively induced in the mucous membrane.Brief description of the graphic materials
[0011] [Figure 1] Figure 1 shows an overview of the experimental conditions for the nanogel-nanogel-coated antigen complex of Examples of the present invention.[Figure 2] Figure 2 shows the results of the immune response in the nasal cavity caused by the nanogel-coated VLP (GII.4 VLP or GII.17 VLP). Figure 2A shows the results obtained by measuring the antibody titers of IgG in serum, IgA in nasal lavage, and IgA in feces after nasal administration of GII.17 nanogel-coated VLP or GII.17 VLP alone to mice. Figure 2B shows the results obtained by measuring IgG in serum and IgA in nasal lavage after nasal administration of GII.4 nanogel-coated VLP or GII.4 VLP alone to mice. It was found that the ratio of the components of the mixture of VLP and nanogel (particles) was VLP: nanogel = 1:180 in molecular ratio. [Figure 3] Figure 3 shows the results of the immune response in the nasal cavity under the influence of VLP (VLP GII.17) with a nanogel coating. These are the results obtained by measuring the IgG in the serum and IgA in the nasal lavage fluid after nasal administration of GII.17 VLPs with a nanogel coating or GII.17 VLPs alone to mice. It was found that the mixture ratio of VLPs and nanogel (particles) components was VLP:nanogel=1:180 or 1:18 in molecular ratio.[Figure 4] Figure 4 shows the results obtained from studying the neutralizing effects of antibodies induced by nanogel-coated VLPs (GII.4 VLPs or GII.17 VLPs). Figure 4A shows the results obtained from studying the proliferation suppression effect of norovirus GII.17 by IgG in the serum and IgA in the nasal lavage fluid induced by nanogel-coated GII.17 VLPs. In Fig. 4B shows the results obtained by studying the effect of suppressing the proliferation of norovirus GII.4 under the action of IgG in serum and IgA in nasal lavage induced by GII.4 nanogel-coated VLPs. "Before" indicates the results obtained by treating the norovirus solution with mouse serum or nasal lavage before immunization inside the nasal cavity, then adding the treated norovirus solution to intestinal epithelial cells, and then measuring the copy number of viral genomes in the culture supernatant. "cCHP+VLP" indicates the results obtained by treating the norovirus solution with IgG in serum or IgA in nasal lavage induced by nanogel-coated VLPs, then adding the treated norovirus solution to intestinal epithelial cells, and then measuring the copy number of viral genomes in the culture supernatant.[Figure 5] In Fig. 5 shows the results of the immune response of the nasal cavity under the influence of VLP (VLP GII.2) with a nanogel coating.These are the results obtained by measuring the titers of IgG antibodies in serum, IgA in nasal lavage fluid, IgA in saliva, and IgA in intestinal lavage fluid after nasal administration of GII.2 nanogel-coated VLPs or GII.2 VLPs alone to mice. The ratio of the VLP and nanogel (particle) mixture components was found to be VLP:nanogel=1:180 in molecular ratio.[Figure 6] Figure 6 shows the results obtained by studying the neutralizing effects of IgG in serum induced by nanogel-coated VLPs (GII.2 VLPs).These are the results obtained by treating the norovirus solution with mouse serum before immunization inside the nasal cavity (no immunization), serum IgG induced by VLPs only (VLPs only) or serum IgG induced by nanogel-coated VLPs (nanogel-coated VLPs), then adding the treated norovirus solution to intestinal epithelial cells, and then measuring the copy number of viral genomes in the culture supernatant.[Figure 7] Figure 7 shows the results obtained by studying the neutralizing effects of IgA in intestinal lavage fluid induced by nanogel-coated VLPs (VLP GII.2).These are the results obtained by treating the norovirus solution with mouse intestinal lavage fluid before intranasal immunization (no immunization), the IgA in the intestinal lavage fluid induced by VLPs only (VLPs only), or the IgA in the intestinal lavage fluid induced by nanogel-coated VLPs (nanogel VLPs), then adding the treated norovirus solution to intestinal epithelial cells, and then measuring the copy number of viral genomes in the culture supernatant.[Figure 8] Figure 8 shows the electron microscopic images of the nanogel-coated VLPs (VLP GII.17). Figure 8A is an electron microscopic image of the VLP GII.17; Figure 8B is an electron microscopic image of the nanogel; and Figure 8C is an electron microscopic image of the nanogel-coated VLP GII.17.8C also shows enlarged images of the areas surrounded by squares in the observation image. [Figure 9] Figure 9 shows the electron microscopic images of the nanogel-coated VLP (VLP GII.2). Figures 9A and B are electron microscopic images of the VLP GII.2; Figures C and D are electron microscopic images of the nanogel-coated VLP GII.2; Figure 9E is an electron microscopic image of the nanogel (cCHP); and Figure 9F is an electron microscopic image of the nanogel-PspA complex encapsulating PspA. [Figure 10] Figure 10 shows the results of pharmacokinetic testing in mice involving nasal administration of indium-labeled nanogel (. 111 In).Description of incarnations
[0012] The first embodiment relates to a complex of a nanogel and a vaccine antigen (hereinafter also referred to as a "nanogel-vaccine antigen (or antigen)"), in which the vaccine antigen is coated with a nanogel (hereinafter also referred to as the "complex of the present embodiment"). In the present embodiment, the term "nanogel" is used to refer to a polymer gel nanoparticle consisting of a hydrophilic polysaccharide (e.g., pullulan) to which hydrophobic cholesterol is added as a side chain. Such a nanogel can be obtained according to a known method, such as the method described, for example, in International Publication WO 00 / 12564.Specifically, first, a hydrocarbon containing a hydroxyl group having from 12 to 50 carbon atoms or a sterol is allowed to react with a diisocyanate compound represented by OCN-R1NCO (where R1 represents a hydrocarbon group having from 1 to 50 carbon atoms) to obtain a hydrophobic compound containing an isocyanate group, with which a single molecule of a hydrocarbon containing a hydroxyl group having from 12 to 50 carbon atoms or a sterol reacts. The resulting hydrophobic compound containing an isocyanate group is allowed to react with a polysaccharide to obtain a polysaccharide containing a hydrophobic group containing a hydrocarbon group having from 12 to 50 carbon atoms or a sterol group. Then, the resulting product is purified in a ketone-based solvent to obtain a polysaccharide containing a hydrophobic group with high purity.As the polysaccharide used herein, pullulan, amylopectin, amylose, dextran, hydroxyethyldextran, mannan, levan, inulin, chitin, chitosan, xyloglucan, water-soluble cellulose, etc. can be used, and pullulan is particularly preferable.
[0013] Examples of the nanogel used in the present embodiment may include a cationic pullulan bearing a cholesteryl group (referred to as "cCHP") and a derivative thereof. cCHP has a structure in which 1 to 10 cholesterols, preferably 1 to 3 cholesterols, are replaced by 100 monosaccharides in pullulan having a molecular weight of 30,000 to 200,000, for example, having a molecular weight of 100,000. In addition, the cCHP used in the present invention can be replaced, as necessary, with respect to the number of replaced cholesterols, depending on the size of the antigen or the degree of hydrophobicity. Furthermore, to change the degree of hydrophobicity of CHP, an alkyl group (having about 10 to 30, preferably about 15 to 20 carbon atoms) can be added to CHP. The nanogel used in the present invention has a particle diameter of 10 to 50 nm, and preferably 20 to 30 nm.Nanogels are already widely available in the market, and such commercially available nanogel products can also be used.
[0014] The nanogel used in the present embodiment is a nanogel into which a functional group having a positive charge, such as an amino group, is introduced so that the vaccine can be delivered to the surface of the negatively charged nasal mucosa. A method for introducing an amino group into the nanogel can be used, using cholesterol-based pullulan with an added amino group (CHPNH2). Specifically, CHP dried under reduced pressure is dissolved in dimethyl sulfoxide (DMSO), and then 1,1'-carbonyldiimidazole is added to the resulting solution under a nitrogen air flow, followed by a reaction at room temperature for several hours. Next, ethylenediamine is gradually added to the reaction solution, and then the resulting mixture is stirred for several hours to several tens of hours.The resulting reaction solution is dialyzed against distilled water for several days. After dialysis, the reaction solution is lyophilized to yield an opalescent solid. The degree of ethylenediamine substitution can be assessed using elemental analysis, H-NMR (proton nuclear magnetic resonance), etc.
[0015] The nanogel-antigen complex reported previously has a form in which the antigen is encapsulated in a nanoparticle (nanogel) composed of about 4 molecules of cationic pullulan carrying a cholesterol group (Yuki et al., Molecular Pharmaceutics, https: / / dx.doi.org / 10.1021 / acs.molpharmaceut.0c01003 2021). In contrast, the complex of the present embodiment is a substance in which the size of the antigen is larger than the size that can be encapsulated in the nanogel. Therefore, the present complex is characterized in that it has a form in which the nanogel is added to the surface of the antigen without encapsulating the antigen in the nanogel (such a form is also referred to as a "form in which the antigen is coated with a nanogel") (see Fig. 1, Fig. 8 and Fig. 9). In this document, the phrase "an antigen that is not encapsulated in a nanogel" is used to refer to an antigen that is nearly the same size as the nanogel or an antigen that is larger than the nanogel.The size of the antigen and the size of the nanogel can be compared with each other, for example, according to a method that uses the particle diameter of the antigen (namely, the diameter when assuming that the antigen is a sphere) calculated by a light scattering method (e.g., dynamic light scattering (DLS)) etc. as an indicator, a method involving observing the nanogel and the antigen by observing with electron microscopy and then evaluating each size, and other methods. However, the comparison methods are not limited to these methods, and those skilled in the art can easily select different methods. More specifically, since the particle diameter of the nanogel is approximately 30 nm (DLS-based method) (Yuki et al., Molecular Pharmaceutics, https: / / dx.doi.org / 10.1021 / acs.molpharmaceut.0c01003 2021), the antigen according to the present embodiment is preferably an antigen in which the particle diameter, determined, for example, by the DLS method, is approximately 20 nm or more, which is slightly smaller than the particle diameter of the nanogel (for example, approximately 20 nm or more and 1000 nm or less, or approximately 30 nm or more and 600 nm or less). Examples of the antigen according to the present embodiment may include an inactivated virus, a VLP (virus-like particle), a jumbo protein molecule with a size of 20 nm or more, and a polymer (for example, a molecule having a molecular weight of 5000 kDa or more), but examples of the present antigen are not limited to them. In addition, the virus described above may be any virus, and however, examples of the virus may include sapovirus, rotavirus, seasonal influenza viruses (type A and B), novel (highly virulent) influenza viruses (e.g., H1N1, H5N1, and H7N9 influenza viruses), coronaviruses (e.g., SARS-CoV, SARS-CoV 2, MERS-CoV, etc.d.), RS viruses (type A and type B), rhinovirus, adenovirus, herpes virus, human papillomavirus, enterovirus, cytomegalovirus, Ebola virus, West Nile virus, Zika virus, Dengue virus, ATL (human adult T-cell virus), HIV (human immunodeficiency virus), hepatitis A virus and Chikungunya virus.
[0016] The complex according to the present embodiment can be obtained by allowing the nanogel and the vaccine antigen to coexist, allowing them to interact with each other and thereby attaching the nanogel to the surface of the antigen. Moreover, the mixing ratio of the nanogel and the vaccine antigen is not particularly limited and can be easily determined by those skilled in the art according to preliminary experiments. For example, with regard to the preferred mixing ratio of the vaccine antigen and the nanogel, the mixing ratio can be appropriately selected from a range of the vaccine antigen:nanogel ratio, for example, from about 1:10 (40 equivalent CHPNH2) to 1:400 (1600 equivalent CHPNH2), more preferably from about 1:15 (60 equivalent CHPNH2) to 1:200 (800 equivalent CHPNH2), at a molar ratio or a molecular ratio.The complex according to the present embodiment can be obtained by mixing the nanogel with the vaccine antigen and then leaving the resulting mixture to stand at 4°C to 50°C (e.g., 40°C) for 30 minutes to 48 hours (e.g., approximately 1 hour). The buffer used to form such a nanogel-vaccine antigen complex is not particularly limited, and, in any case, a Tris-HCl buffer or the like can be used.
[0017] Furthermore, the complex according to the present embodiment may contain an adjuvant and a nanogel-antigen vaccine complex (the complex according to the present invention is also included in the phrase "the complex according to the present embodiment"). Herein, the term "adjuvant" is synonymous with the term "antigen enhancer", "immunostimulant" or the like, and this adjuvant is used for the purpose of general use of these agents in the present field of the invention. The active substance of the adjuvant used in the present embodiment is not particularly limited, and examples of this active substance of the adjuvant according to the present invention may include STING ligands that activate STING (from Englishstimulator of interferon genes - stimulator of interferon genes) (e.g. cyclic dinucleotides such as cGAMP, cyclic di AMP, cyclic di GMP, cyclic di CMP, cyclic di UMP or cyclic di IMP, and xanthene derivatives such as DMXAA (5,6-dimethylXAA (xanthenone-4-acetic acid), Vadimezan or ASA404), polyIC and CpG ODN. The present adjuvant may additionally contain a pharmaceutically acceptable carrier and other components (e.g. stabilizer, pH regulator, preservative, antiseptic, buffering agent, etc.). Such pharmaceutically acceptable carrier and other components should be substances that do not affect the health of the animals to be vaccinated.
[0018] When the complex according to the present embodiment contains an adjuvant, the content of the adjuvant may be approximately 0.01% by weight to 99.99% by weight based on 100% by weight of the vaccine preparation (see the second embodiment), and may also be, for example, approximately 0.01% by weight to 10% by weight based on 1 weight of the vaccine antigen.
[0019] The complex of the present embodiment can be formed by mixing the nanogel and the vaccine antigen or mixing the nanogel, the vaccine antigen and the adjuvant and then leaving the mixture to stand at a temperature of 4°C to 50°C (for example, 40°C) for 30 minutes to 48 hours (for example, about 1 hour). The type of buffer used in the formation of the complex of the nanogel and the vaccine antigen or the complex of the nanogel, the vaccine antigen and the adjuvant is not particularly limited, and, in any case, a Tris-HCl buffer can be used, for example.
[0020] The second embodiment relates to a vaccine preparation comprising the complex according to the first embodiment, namely, a complex of a nanogel and a vaccine antigen, in which the vaccine antigen is coated with a nanogel (hereinafter also referred to as the "vaccine preparation according to the present embodiment"). When the vaccine preparation according to the present embodiment is used in the form of a composition (a vaccine composition according to the present embodiment), it may contain pharmaceutically acceptable additives. The vaccine preparation according to the present embodiment is suitable for nasal administration, and the dosage form of the present vaccine preparation is desirably a form that allows nasal administration. The vaccine preparation according to the present embodiment may, for example, be a liquid preparation (nasal drops, injection, etc.).When the vaccine preparation according to the present invention is a liquid preparation, the active substance can be dissolved in distilled water for preparations, as needed, together with a pH adjuster such as hydrochloric acid, sodium hydroxide, lactose, lactic acid, sodium, sodium monohydrogen phosphate or sodium dihydrogen phosphate, and a tonicity adjusting agent such as sodium chloride or glucose, and the resulting solution can be filtered under sterile conditions, and then the resulting solution can be filled into an ampoule. Alternatively, in addition, mannitol, dextrin, cyclodextrin, gelatin, or the like can be added to the resulting solution, followed by lyophilization, so as to obtain a preparation with extemporaneous dissolution. The present liquid preparation may contain pharmaceutically acceptable known stabilizers, antiseptics, antioxidants, etc. Examples of stabilizers may include gelatin, dextrin, and sorbitol.Examples of antiseptics include thimerosal and β-propiolactone. An example of an antioxidant is α-tocopherol.
[0021] The third embodiment relates to a method for preventing and / or treating a disease, wherein the method comprises administering to a patient through the nose a vaccine preparation according to the second embodiment, namely, a vaccine preparation comprising a complex of a nanogel and a vaccine antigen, in which the vaccine antigen is coated with a nanogel. The target disease to be treated or prevented according to the third embodiment is not particularly limited and depends on the type of vaccine antigen used. The target disease may include cancer diseases, as well as infections caused by pathogens. The vaccine preparation of the present invention can be administered to a patient through the mucous membrane of the nasal cavity. The administration method may be, for example, a method of administering the vaccine preparation into the nasal cavity by spraying, coating, instilling, or the like of the vaccine preparation onto the mucous membrane of the nasal cavity.
[0022] The applicable dose of the vaccine preparation according to the second embodiment can be determined, as necessary, depending on the age, body weight, etc. of the administration target. The vaccine preparation contains a pharmaceutically effective amount of the vaccine antigen. A pharmaceutically effective amount means an amount of the antigen required to elicit an immune response to the vaccine antigen. The vaccine preparation can be administered to the target, for example, in a single applicable dose of the vaccine antigen ranging from several micrograms to several tens of milligrams, from once to several times per day, at intervals of one week to several weeks, a total of several times, for example, 1 to 5 times.
[0023] The disclosures of all publications cited in this specification are incorporated herein by reference in their entirety. Furthermore, throughout this specification, when the description includes singular terms, these terms include not only single entities but also plural entities unless the context clearly dictates otherwise. Hereinafter, the present invention will be further described in the following examples. However, these examples are merely illustrative examples of embodiments of the present invention and, thus, are not intended to limit the scope of the present invention. Examples
[0024] 1. Materials and Methods 1-1. VLP Production Viruses were crudely purified from HuNoV (human norovirus)-containing feces supplied by the Osaka Institute of Public Health, Osaka, Japan, and the viral genome was then obtained. The primer was located outside the ORF (open reading frame) of VP1 GII.4, GII.17, or GII.2 on the obtained genome, and then each ORF region was amplified by PCR (polymerase chain reaction), and the nucleotide sequence of the amplified product was determined. The ORF of each VP1 was cloned into the dual expression vector pFastBac (Invitrogen). The amino acid sequence of VP1 GII.4 and the nucleic acid sequence encoding this sequence are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; amino acid sequence of VP1 GII.17 and the nucleic acid sequence encoding this sequence are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; and the amino acid sequence of VP1 GII.2 and the nucleic acid sequence encoding this sequence are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively. Each construct was used to produce recombinant baculoviruses with the Bac-to-Bac expression system (Invitrogen) after confirming that their sequence was correct. High Five cells (Invitrogen) were infected with each recombinant baculovirus at an MOI (multiplicity of infection) and 7 PFU (plaque-forming units) / cell. Six days after infection, the culture supernatant was collected and then centrifuged at 20,000 g for 1 hour. The resulting supernatant was ultracentrifuged at 100,000 g for 2 hours, and the precipitated VLPs were suspended in PBS.The concentrated VLPs were then purified by layering on a 10%–60% sucrose density gradient and then by ultracentrifugation at 100,000 g for 1 hour. The sucrose-gradient-passed VLPs were dialyzed three times against 2 L of PBS to remove sucrose from the sample. The VLPs were concentrated using an Amicon Ultra 30-kDa centrifugal filter (Millipore).
[0025] 1-2. Coating of norovirus VLPs with nanogelThe cCHP nanogel was prepared according to the method reported previously (Ayame et al., Bioconjugate Chem 19: 882–890, 2008). The resulting nanogel (various calculations were performed assuming that four cCHP molecules form one nanogel molecule; Kuroda et al., Langmuir 18, 3780–3786, 2002) was mixed with purified norovirus VLPs (virus-like particles) (various calculations were performed assuming that 180 VP1 molecules (60 kDa) form one VLP molecule; Glass et al., N. Engl. J. Med 361, 1776–1785, 2009) at a molar ratio (VLP: nanogel) of 1:18 or 1:180. The resulting mixture was then incubated in a heat block at 40°C for 1 hour and then left to stand at 4°C overnight.
[0026] 1-3. Intranasal Immunization of Mice with Nanogel-Coated Norovirus VLPs. The nanogel-VLP complex or VLP (namely, VLP that does not form a complex; such as below) was administered to 7-week-old female Balb / c mice via intranasal administration. The antigen administration amount was set to 5 μg VLP protein / animal / administration. Nasal immunization was performed three times in total at 1-week intervals. One week after the final immunization, serum, nasal lavage, intestinal lavage, and feces were collected from the mice. The feces were suspended in 100 mg / mL PBS, and the supernatant was used as a sample.
[0027] 1-4. Measurement of Anti-Norovirus VLP Antibody Titers The production of antigen-specific antibodies was analyzed using the enzyme-linked immunosorbent assay (ELISA) method (see Kong et al., Infect Immun 81: 1625–1634, 2013). VLPs at 1 μg / mL in PBS were coated onto a 96-well plate at 4°C overnight. After blocking with PBS-Tween containing 1% BSA (bovine serum albumin), the sample was added to the resulting mixture after 10-fold serial dilution, and then the resulting mixture was incubated at room temperature for 2 hours. After washing, goat anti-mouse IgG conjugated with HRP (horseradish peroxidase) (Southern Biotech) or goat anti-mouse IgA conjugated with HRP (Southern Biotech) were diluted 1:4000 and then added to the wells, followed by incubation at room temperature for 1 hour 30 minutes.After incubation, the sample was subjected to a chromogenic reaction using TMB (tetramethylbenzidine) in the Microwell Peroxidase Substrate System (XPL). The endpoint titer was expressed as a logarithmic titer (inverse log10) for the final dilution factor at which the OD450 value was 0.1 or higher than the negative control.
[0028] 1-5. Measurement of norovirus proliferation neutralization activity using human iPS cell-derived organoids or monolayers. The culture of human iPS cell line-derived intestinal organoids on Matrigel (Corning), the monolayer formation method, and the measurement of the neutralizing activity of anti-VLP antibodies against norovirus proliferation using them were carried out according to the methods described in the previous report (Sato et al., Cell Mol Gastroenterol Hepatol 7: 686-688, 2019). Norovirus stocks (GII.4_2012 Sydney, GII.17_2015 Kawasaki, and GII.2 OSN201926; supplied by Osaka Institute of Public Health) were prepared by diluting viruses in base medium (advanced DMEM / F12 (Gibco) supplemented with 10 mM HEPES (pH 7.3, Gibco), 2 mM Glutamax (Gibco), and 100 units / mL penicillin plus 100 μg / mL streptomycin (Gibco)) to 2×10 6genomic copies per 100 µl. Then, before infecting cells, each of the diluted virus solutions was mixed with appropriately diluted mouse antiserum or nasal lavage fluid, or not mixed with mouse antiserum or nasal lavage fluid, and then incubated at 37°C for 90 minutes. Each of the resulting virus solutions was used to infect intestinal epithelial cells.
[0029] The diluted virus solution (100 μl) was added to the intestinal epithelial cell monolayer so that the intestinal epithelial cells were infected with the virus, and then the resulting cells were incubated at 37°C under 5% CO2 for 1 hour or 3 hours. Next, the virus solution was removed, and the cells were washed twice with 150 μl of the basal medium. A solution prepared by adding 0.03% bile to the differentiation medium (basic medium supplemented with 1x B-27 basal medium, 1.25% fetal bovine serum (Biosera), 50 ng / ml mouse EGF, 375 ng / ml mouse R-Spondin 1 (R & D Systems), 50 ng / ml mouse Noggin (Peprotech), and 500 nM A83-01) was added to the wells after washing, and then the supernatant was immediately isolated. The culture supernatant obtained at 1 h or 3 h post-infection was used as the 1 hpi or 3 hpi sample, respectively.
[0030] Next, 100 μl of differentiation medium and 0.03% bile were added to the wells after the supernatant was isolated, and these wells were then incubated at 37°C under 5% CO2 for 48 hours. Next, this supernatant was isolated as a sample at 48 hpi (48 hours post-infection; 48 hours post-infection). For quantification of viral genome copies, RNA was obtained from the diluted virus solution and from the sample isolated at 1 hour (the above-mentioned 1 hpi), 3 hours (the above-mentioned 3 hpi), or 48 hours (the above-mentioned 48 hpi) post-infection using the High Pure Viral RNA Isolation Kit (Roche). RT-qPCR (quantitative reverse transcription PCR) was performed using the qPCR (GI / GII) Typing Kit (TakaRa) and the StepOne Plus real-time PCR system (Applied Biosystems).
[0031] 1- 6. Electron microscopic observation of nanogel-coated norovirus VLPs by negative staining. GII.17 VLPs and cCHP were nanogelated at a molar ratio of 1:18, or GII.2 VLPs and cCHP were nanogelated at a molar ratio of 1:180, and the resulting products were used as observation samples. In addition, PspA and cCHP were nanogelated at a molar ratio of 1:1, so as to obtain the nanogel-antigen complex of the previously reported nanogel encapsulation type. GII.17 VLPs were diluted with PBS(-) to 0.5 mg / mL, while GII.2 VLPs were diluted with PBS(-) to 0.1 mg / mL. As with cCHP, 1% cCHP was used undiluted. The sample (5 µl) was placed on a grid (MAXTAFORM HF36 Cu grid; 400 mesh) with an adhered carbon and hydrophilized formvar backing film and then stained for 1 minute.The sample solution was removed and negatively stained with 1% uranyl acetate solution (dissolved in distilled water) and then observed using a transmission electron microscope (JEM-1400; JEOL Ltd.).
[0032] 2. Results 2-1. Description of the present example Effective immunity can be induced by encapsulating an antigen in a nanogel and then immunizing it inside the nasal cavity according to the previously reported method. In this case, the optimal mixture ratio of the antigen and cCHP, which is a monomer, is approximately 1:2 to 1:8 in molecular ratio (antigen:cCHP). When this ratio can be converted into the ratio of antigen to spherical nanogel (one nanogel molecule is formed from four cCHP molecules: Kuroda et al., Langmuir 18: 3780-3786, 2002), it becomes 1:0.5 to 1:2 (antigen: nanogel). Accordingly, one nanogel molecule encapsulates approximately one or two molecules of protein antigens (Yuki et al., Molecular Pharmaceutics, https: / / dx.doi.org / 10.1021 / acs.molpharmaceut.0c01003 2021).
[0033] With reference to the above-mentioned results, the present inventors examined whether the usefulness of a nanogel for intranasal immunization can be demonstrated by coating an antigen with a nanogel (namely, by attaching the nanogel to the surface of the antigen) when the antigen is larger than the nanogel (namely, when the antigen cannot be encapsulated in the nanogel). Specifically, norovirus VLPs (GII.17 and GII.4), which form VLPs having a spherical structure with a size of 30 to 40 nm, were used as antigens, and it was found that the molecular ratio of the nanogel to the VLP (VLP:nanogel) was approximately 1:180 and 1:18. The ratio of the nanogel to the VLP was significantly increased, compared with the conventional method, so as to obtain a nanogel-VLP complex (see Fig. 1).
[0034] 2-2. Nasal Immune Response in Mice to Nanogel-Coated VLPs (GII.17 and GII.4)The number of nanogel molecules relative to the antigen molecules was found to be in great excess, namely, the molecular ratio of nanogel to norovirus VLPs was established at 1:180, and a complex was formed between norovirus VLPs (GII.17 and GII.4) and the nanogel. Mice were immunized intranasally three times with GII.17 VLPs alone or with the nanogel-GII.17 VLP complex once every two weeks. The antibody titers of antigen-specific serum IgG, IgA in nasal lavage fluid, and IgA in feces 1 week after completion of immunization are shown in Fig. 2A. The antibody titers induced in all mice immunized with the GII.17 nanogel-VLP complex were approximately 10-fold higher than the antibody titers induced by immunization with VLP alone. Figure 2B shows the results of intranasal immunization with GII.4 VLP alone or with the GII.4 nanogel-VLP complex under similar conditions.The antibody titers induced in all mice immunized with the GII.4 nanogel-VLP complex were approximately 10-fold higher than the antibody titers induced by immunization with VLP alone.
[0035] 2-3. Nasal Immune Response in Mice to Nanogel-Coated VLPs (GII.17)Then, the mixing ratio of the nanogel and VLPs was found to be 1 / 10 of the mixing ratio in the above 2-2, namely, the mixing ratio of the nanogel and antigen (VLP) (VLP:nanogel) was found to be 1:18, and then a complex of norovirus VLPs (GII.17) and nanogel was formed. Mice were immunized intranasally with only GII.17 VLPs or with the nanogel-VLP GII.17 complex three times every two weeks. The antibody titers of antigen-specific serum IgG and IgA in the nasal lavage fluid 1 week after the completion of immunization are shown in Fig. 3. Even when the ratio of the nanogel and VLP mixture components was reduced, the titers of antigen-specific serum IgG and IgA antibodies in the nasal lavage fluid of all mice immunized with the nanogel-VLP GII complex.17, were 10-fold higher than the antibody titers induced by immunization with VLP alone.
[0036] 2-4. Studies on the neutralizing activity of antibodies induced by nanogel-coated VLPs (VLP GII.17 and VLP GII.4). Next, studies were conducted to determine whether the antibodies induced by nanogel-coated VLPs (VLP GII.17 and VLP GII.4) have neutralizing activity, namely, the activity of suppressing the proliferation of noroviruses in intestinal epithelial cells. The proliferation of noroviruses was assessed using the copy number of viral genomes in the culture supernatant as an indicator. The results are shown in Fig. 4. It was confirmed that nasal lavage serum IgG and IgA induced by nasal administration of nanogel-coated VLPs suppressed the proliferation of norovirus GII.17 and norovirus GII.4 in cellular epithelial cells, in both cases where the VLP was VLP GII.17 (Fig. 4A) or VLP GII.4 (Fig. 4B).In other words, antibodies induced by intranasal immunization with nanogel-coated VLPs were found to have significant neutralizing activity.
[0037] 2-5. Nasal Immune Response in Mice to Nanogel-Coated VLPs (GII.2 VLPs)The mixing ratio of nanogel and GII.2 VLPs was found to be 1:180, and a complex was formed between GII.2 VLPs and the nanogel. Mice were immunized intranasally three times with either GII.2 VLPs alone or with the nanogel-GII.2 VLP complex every two weeks. The antibody titers of antigen-specific serum IgG, nasal lavage IgA, saliva IgA, and intestinal lavage IgA 1 week after completion of immunization are shown in Fig. 5. Antibody titers in all mice immunized with the GII.2 nanogel-VLP complex were approximately 10- to 100-fold or more higher than antibody titers induced by immunization with VLP alone. In particular, the increase in antibody titers in intestinal lavage fluid was significant.
[0038] 2-6. Studies on the neutralizing activity of serum IgG antibody induced by nanogel-coated VLP (VLP GII.2) confirmed that serum IgG induced by nasal administration of nanogel-coated VLP had a stronger inhibitory effect on the proliferation of norovirus (HuNoV GII.2) in intestinal epithelial cells than serum IgG induced by nasal administration of VLP alone (Fig. 6).
[0039] 2-7. Studies on the neutralizing activity of IgA antibody in intestinal lavage fluid induced by nanogel-coated VLP (VLP GII.2)Further, it was confirmed that the serum IgG induced by nasal administration of nanogel-coated VLP more strongly suppressed the proliferation of norovirus (HuNoV GII. 2) in intestinal epithelial cells than the serum IgA induced by nasal administration of VLP alone (Fig. 7). It should be noted that in the present example, it was possible to demonstrate that intranasal immunization with nanogel-coated VLP GII.2 induced HuNoV GII.2-specific IgA antibodies in intestinal lavage fluid in an amount that was 100 times higher than that in the case of intranasal immunization with VLP GII.2 alone, and thus the proliferation of HuNoV GII.2 was highly effectively suppressed. These results demonstrate that the clinical application of a nasal norovirus vaccine is very promising.In other words, it has been previously reported that an adjuvant is necessary for such a VLP-based nasal vaccine to be effective against norovirus (Atma et al., N. Eng. J. Med. 365: 2187-87, 2011). However, given the results shown in this example, it is believed that it is quite feasible to produce an adjuvant-free nasal vaccine against norovirus by coating the antigen with a nanogel, which is a pharmaceutical additive.
[0040] 2-6. Electron microscopy observation of nanogel-coated VLPs by negative staining Fig. 8A shows an image of the GII.17 VLP sample alone taken by electron microscopy. The VLP was observed to be an icosahedral hollow particle with a particle diameter of about 38 nm. On the other hand, the size (particle diameter) of the nanogel in the 1% cCHP sample alone was about 20 - 40 nm, and the nanogel was observed as white outlined particles with slightly weak contrast (Fig. 8B). In the image of the nanogel-coated VLPs taken by electron microscopy, VLPs and nanogels were observed, and VLPs complexed with the nanogels were also observed (shown by arrows in the enlarged images in Fig. 8C). Such VLPs complexed with nanogels appeared exclusively as white discs because their surfaces were coated with cCHP (nanogels).In addition, the center of the VLP was concave in accordance with the observation under vacuum conditions, and as a result, the VLPs were observed as spherical particles whose contents appeared transparent and slightly dark.
[0041] In addition, Fig. 9A and B show the observation images of the GII.2 VLP sample alone. The GII.2 VLP was observed to be an icosahedral hollow particle with a particle diameter of approximately 30-40 nm. In fact, this GII.2 VLP is formed by 180 VP1 molecules with a molecular weight of 60,000, and the GII.2 VLP has a molecular weight of approximately 10,000,000. In the observed images of the GII.2 VLP with nanogel (Fig. 9C and D), VLPs without nanogel and cCHP are observed, and particles that seemed to contain nanogel are observed solely as white-light gray three-dimensional spheres because their surfaces are covered with cCHP (arrows in the figures). The object whose size is slightly larger than the VLP size was considered to be the coating nanogel. This observation is considered to be similar to the above-mentioned nanogel-coated GII.17 VLP, which was concave in center as observed under vacuum conditions and was observed as spherical particles whose cavities appeared transparent and slightly dark.On the other hand, the size of the 1% cCHP sample (Fig. 9E) was approximately 15-40 nm, which showed slight variation, and this sample was observed as a white, outlined particle. Since it was difficult to confirm PspA alone by transmission electron microscopy, PspA with the nanogel was observed. As a result, the observed image showed almost no significant change (approximately 20-40 nm), compared with cCHP alone. The above-mentioned electron microscopy results indicate that cCHP (nanogel) adheres to the VLP such that it covers the circumference of the VLP and thus covers the VLP.
[0042] 2-7. Measurement of particle diameter of nanogel-coated VLPs according to the DLS (dynamic light scattering) methodIn addition to observation under an electron microscope, the particle diameters of cCHP nanogel, GII.2 VLPs, and nanogel-coated GII.2 VLPs were measured according to the DLS method, and the measured particle diameters were then compared with each other (Table 1).[Table 1] As a result, the cCHP nanogel had a particle diameter (DH) of 52 nm and a polydispersity index (PDI) of 0.394. On the other hand, the GII.2 VLPs, which had a particle diameter of 70 nm and a PDI value of 0.345, were larger than their TEM image. Since the PDI value was slightly larger, it was believed that the values in both cases increased due to the influence of a small amount of aggregates, etc. The nanogel-coated VLPs had a particle diameter of 109 nm and a PDI value of 0.308, indicating that the nanogel coating resulted in an increase in particle diameter. Meanwhile, the particle diameter and PDI of PspA encapsulated in the nanogel were almost the same as those of the cCHP nanogel.Based on the above results, it was found that the particle diameter of the nanogel-coated VLP-based antigen was increased compared with the nanogel-encapsulated PspA antigen (nanogel-encapsulated PspA antigen), and the results of the above electron microscope observation (Fig. 8 and Fig. 9) could also be confirmed based on the DLS measurement results.
[0043] 2-8. Studies Concerning the Safety of Nanogel (Comparative) The nanogel-coated antigen according to the present embodiment (namely, a complex formed by coating a macromolecular antigen with a nanogel) can be clinically used as a nasal vaccine without adding an adjuvant. These results are related to the initial problem regarding the failure of nasal vaccine development due to intracerebral migration of the nasal vaccine against E. coli heat-labile toxin group and adjuvant (Mutsch et al., N. Enlg. J Med 350: 896-903, 2004), and thus these results are considered to be very important. To date, regarding nanogel-based nasal vaccines, the present inventors have reported the results of pharmacokinetic tests that refute the migration of the antigen portion of the nanogel-based nasal vaccine to the brain (Yuki et al., J. Immunol. 185: 5436–5443 2010; Fukuyama et al., Mucosal Immunol. 8: 1144–1153 2015).In addition to these results, new data obtained through a study of the effect of nasal administration of the nanogel itself on pharmacokinetics, in particular on intracerebral migration, are shown below. The results shown in Fig. 10 can be considered the results of a pharmacokinetic study of the nanogel itself (as a pharmaceutical additive), as well as the results of a pharmacokinetic study of the safety of the lipid-based nanoparticles themselves, which represent the DDS of the mRNA-based vaccine (a pharmaceutical additive) administered by intramuscular injection. To study the pharmacokinetics of the nanogel, the nanogel was first labeled. 111 In. 111 The In-labeled nanogel was separated from the unreacted 111 In using a DEAE-Sepharose (diethylaminoethyl Sepharose) column, and then 111 The In-labeled nanogel was purified. The purified 111In-labeled nanogel (0.1 mg nanogel) was administered to mice (n=3) via nasal administration. Then, at 0.25 hours, 1 hour, 3 hours, 6 hours, 12 hours, 24 hours, 48 hours, and 72 hours after nasal administration, radioactivity 111 In was measured in different types of organs (Fig. 10). As a result, it becomes clear that the cCHP nanogel as a pharmaceutical additive does not migrate to the olfactory bulb and brain, and the safety of the nanogel itself can be confirmed. It should be noted that 111 In-labeling was performed based on a previous report (Yuki et al., J. Immunol 185: 5436–5443, 2010). Industrial applicability
[0044] According to the present invention, a nanogel-based vaccine preparation containing a large antigen molecule, the preparation of which has been difficult until recently, is provided, and thus, the preparation is expected to be used in the medical field.--->SEQUENCE LISTING <110> The University of TokyoHanaVax Inc. <120> Nasal vaccine with nanogel coating <130> TPC0428UVT <150> JP2021- 56392 <151> 2021-03-30 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 540 <212> PRT <213> Human norovirus <400> 1Met Lys Met Ala Ser Ser Asp Ala Asn Pro Ser Asp Gly Ser Ala Ala1 5 10 15Asn Leu Val Pro Glu Val Asn Asn Glu Val Met Ala Leu Glu Pro Val20 25 30Val Gly Ala Ala Ile Ala Ala Pro Val Ala Gly Gln Gln Asn Val Ile35 40 45Asp Pro Trp Ile Arg Asn Asn Phe Val Gln Ala Pro Gly Gly Glu Phe50 55 60Thr Val Ser Pro Arg Asn Ala Pro Gly Glu Ile Leu Trp Ser Ala Pro65 70 75 80Leu Gly Pro Asp Leu Asn Pro Tyr Leu Ser His Leu Ala Arg Met Tyr85 90 95Asn Gly Tyr Ala Gly Gly Phe Glu ValGln Val Ile Leu Ala Gly Asn100 105 110Ala Phe Thr Ala Gly Lys Val Ile Phe Ala Ala Val Pro Pro Asn Phe115 120 125Pro Thr Glu Gly Leu Ser Pro Ser Gln Val Thr Met Phe Pro His Ile130 135 140Val Val Asp Val Arg Gln Leu Glu Pro Val Leu Ile Pro Leu Pro Asp145 150 155 160Val Arg Asn Asn Phe Tyr His Tyr Asn Gln Ser Asn Asp Pro Thr Ile165 170 175Lys Leu Ile Ala Met Leu Tyr Thr Pro Leu Arg Ala Asn Asn Ala Gly180 185 190Asp Asp Val Phe Thr Val Ser Cys Arg Val Leu Thr Arg Pro Ser Pro195 200 205Asp Phe Asp Phe Ile Phe Leu Val Pro Pro Thr Val Glu Ser Arg Thr210 215 220Lys Pro Phe Ser Val Pro Val Leu Thr Val Asp Glu Met Thr Asn Ser225 230 235 240Arg Phe Pro Ile Pro Leu Glu Lys Leu Phe Thr Gly Pro Ser Ser Ala245 250 255Phe Val Val Gln Pro Gln Asn Gly Arg Cys Thr Thr Asp Gly Val Leu260 265 270Leu Gly Thr Thr Gln Leu Ser Pro Val Asn Ile Cys Thr Phe Arg Gly275 280 285Asp Val Thr His Ile Thr Gly Ser His Asn Tyr Thr Met Asn Leu Ala290 295 300Ser Gln Asn Trp Ser Asn Tyr Asp Pro Thr Glu Glu Ile Pro Ala Pro305310 315 320Leu Gly Thr Pro Asp Phe Val Gly Lys Ile Gln Gly Met Leu Thr Gln325 330 335Thr Thr Arg Thr Asp Gly Ser Thr Arg Gly His Lys Ala Thr Val Tyr340 345 350Thr Gly Ser Ala Asp Phe Ala Pro Lys Leu Gly Arg Val Gln Phe Glu355 360 365Thr Asp Thr Asn Asn Asp Phe Glu Ala Asn Gln Asn Thr Lys Phe Thr370 375 380Pro Val Gly Val Ile Gln Asp Gly Gly Thr Thr His Arg Asn Glu Pro385 390 395 400Gln Gln Trp Val Leu Pro Ser Tyr Ser Gly Arg Asn Thr Pro Asn Val405 410 415His Leu Ala Pro Ala Val Ala Pro Thr Phe Pro Gly Glu Gln Leu Leu420 425 430Phe Phe Arg Ser Thr Met Pro Gly Cys Ser Gly Tyr Pro Asn Met Asp435 440 445Leu Asp Cys Leu Leu Pro Gln Glu Trp Val Gln Tyr Phe Tyr Gln Glu450 455 460Ala Ala Pro Ala Gln Ser Asp Val Ala Leu Leu Arg Phe Val Asn Pro465 470 475 480Asp Thr Gly Arg Val Leu Phe Glu Cys Lys Leu His Lys Ser Gly Tyr485 490 495Val Thr Val Ala His Thr Gly Gln His Asp Leu Val Ile Pro Pro Asn500 505 510Gly Tyr Phe Arg Phe Asp Ser Trp Val Asn Gln Phe Tyr Thr Leu Ala515 520 525Pro Met Gly Asn GlyGly Ala Arg Arg Arg Ala Leu530 535 540 <210> 2 <211> 1623 <212> DNA <213> Human norovirus <400> 2atgaagatgg cgtcgagtga cgccaaccca tctgatgggt ccgcagccaa cctcgtccca 60gaggtcaaca atgaggttat ggctctggag cccgttgttg gtgccgccat tgcggcacct 120gtagcgggcc aacaaaatgt aattgaccaccatt acagttat acacct 180ggtggagagt ttacagtatc ccctagaaac gctccaggtg aatactatg gagcgcgccc 240ttgggccctg atctaaatcc ctacttatct cacttggcca gaatgtacaa tggttatgca 300ggtggttttg aagtgcaggt aattctcccgcgcgcgcgcgcgcgc 360tttgcagcag tcccaccaaa ttttccaact gaaggcttga gccccagcca ggtcactatg 420ttcccccata tagtagtaga tgttaggcaa ctagaacctg tgttgattcc cttacccgat 480gttaggaata atttctatca ttacaatcaa tcaaatgattgattcattgcaattgcaattgcaattgcaattc540 caccacttag ggctaataat gctggggatg atgtcttcac agttctcttgc 600cgagttctca cgagaccatc ccccgatttt gatttcatat ttctagtgcc acccacagtt 660gagtcaagaa ctaaaccatt ctctgtccca gttttaactg ttgatgattcagattc7 aaagttgttc acgggtccca gcagtgcctt tgttgtccaa780ccacaaaacg gtaggtgcac gactgatggc gtgctcctag gcaccaccca actgtctcct 840gtcaacatct gcaccttcag aggagatgtc acccatatca caggtagtca taactacaca 900atgaatttgg cttctcaaaa ttggagcaat tacgacccaa cagaagaaat cccagcccct 960ctagggactc cagactttgt ggggaagatt caaggcatgc ttacccaaac cacaaggaca 1020gatggttcaa cacgcggcca caaagccaca gtgtacactg ggagcgccga ctttgctcca 1080aaactgggta gagttcaatt tgaaactgac acaaacaatg attttgaagc taaccaaaac 1140acaaagttca ccccagttgg tgtcatccaa gatggtggca ccacccaccg aaatgaaccc 1200caacagtggg tgctcccaag ttactcaggc aggaacactc ctaatgtgca tctggccccc 1260gctgtggccc ccacttttcc gggtgagcaa ctcctcttct tcagatccac catgcccgga 1320tgcagcgggt accccaacat ggatttggat tgtctgctcc cccaggaatg ggtgcagtac 1380ttctaccaag aggcagcccc agcacaatct gatgtggctc tgctaagatt tgtgaatcca 1440gacacaggta gggttttgtt tgaatgtaag cttcataaat caggctatgt tacagtggct 1500cacactggcc aacatgattt ggttatcccc cccaatggtt attttaggtt tgattcctgg 1560gtcaaccagt tttacacgct tgcccccatg ggaaatggag cggggcgtag acgtgcactg 1620taa <210> 3 <211>540 <212> PRT <213> Human norovirus <400> 3Met Lys Met Ala Ser Asn Asp Ala Ala Pro Ser Asn Asp Gly Ala Ala1 5 10 15Gly Leu Val Pro Glu Gly Asn Asn Glu Thr Leu Pro Leu Glu Pro Val20 25 30Ala Gly Ala Ala Ile Ala Ala Pro Val Thr Gly Gln Asn Asn Ile Ile35 40 45Asp Pro Trp Ile Arg Asn Phe Val Gln Ala Pro Asn Gly Glu Phe50 55 60Thr Val Ser Pro Arg Asn Ser Pro Gly Glu Ile Leu Leu Asn Leu Glu65 70 75 80Leu Gly Pro Asp Leu Asn Pro Tyr Leu Ala His Leu Ser Arg Met Tyr85 90 95Asn Gly Tyr Ala Gly Gly Val Glu Val Gln Val Leu Leu Ala Gly Asn100 105 110Ala Phe Thr Ala Gly Lys Ile Leu Phe Ala Ala Val Pro Pro Asn Phe115 120 125Pro Val Glu Phe Leu Ser Pro Ala Gln Ile Thr Met Leu Pro His Leu130 135 140Ile Val Asp Val Arg Thr Leu Glu Pro Ile Met Ile Pro Leu Pro Asp145 150 155 160Val Arg Asn Thr Phe Phe His Tyr Ser Asn Gln Pro Asn Ser Arg Met165 170 175Arg Leu Val Ala Met Leu Tyr Thr Pro Leu Arg Ser Asn Gly Ser Gly180 185 190Asp Asp Val Phe Thr Val Ser Cys Arg Val Leu Thr Arg Pro Thr Pro195 200 205AspPhe Glu Phe Thr Tyr Leu Val Pro Pro Ser Val Glu Ser Lys Thr210 215 220Lys Pro Phe Ser Leu Pro Ile Leu Thr Leu Ser Glu Leu Thr Asn Ser225 230 235 240Arg Phe Pro Val Pro Ile Asp Ser Leu Phe Thr Ala Gln Asn Asn Val245 250 255Leu Gln Val Gln Cys Gln Asn Gly Arg Cys Thr Leu Asp Gly Glu Leu260 265 270Gln Gly Thr Thr Gln Leu Leu Pro Thr Gly Ile Cys Ala Phe Arg Gly275 280 285Arg Val Thr Ala Gln Ile Asn Gln Arg Asp Arg Trp His Met Gln Leu290 295 300Gln Asn Leu Asn Gly Thr Thr Tyr Asp Pro Thr Asp Asp Val Pro Ala305 310 315 320Pro Leu Gly Thr Pro Asp Phe Lys Gly Val Val Phe Gly Met Val Ser325 330 335Gln Arg Asn Val Gly Asn Asp Ala Pro Gly Ser Thr Arg Ala Gln Gln340 345 350Ala Trp Val Ser Thr Tyr Ser Pro Gln Phe Val Pro Lys Leu Gly Ser355 360 365Val Asn Leu Arg Ile Ser Asp Asn Asp Asp Phe Gln Phe Gln Pro Thr370 375 380Lys Phe Thr Pro Val Gly Val Asn Asp Asp Asp Asp Gly His Pro Phe385 390 395 400Arg Gln Trp Glu Leu Pro Asn Tyr Ser Gly Glu Leu Thr Leu Asn Met405 410 415Asn Leu Ala Pro Pro Val AlaPro Asn Phe Pro Gly Glu Gln Leu Leu420 425 430Phe Phe Arg Ser Phe Val Pro Cys Ser Gly Gly Tyr Asn Gln Gly Ile435 440 445Ile Asp Cys Leu Ile Pro Gln Glu Trp Ala Gln Pron Gl04 Glu4 Tyr Ser Gln Ser Asp Val Ala Leu Ile Arg Tyr Val Asn Pro465 470 475 480Asp Thr Gly Arg Thr Leu Phe Glu Ala Lys Leu His Arg Ser Gly Tyr485 490 495Ile Thr Val Ala His Ser Gly 5 Asp Pro He Val P05 As Leu Val Arg Phe Asp Ser Trp Val Asn Gln Phe Tyr Ser Leu Ala515 520 525Pro Met Gly Thr Gly Asn Gly Arg Arg Arg Ala Gln530 535 540 <210> 4 <211> 1623 <212> DNA <213> Human norovirus <400> 4atgaagatgg cgtcgaatga cgccgctcca tctaatgatg gtgctgctgg tctcgtacca 60gagggcaaca acgagaccct tccctagaa ccagcgg gcgcagctat agccgcaccc 120gtcactggcc aaaaccacat gcaccattagacct 180aatggagt tcacagtgtc acccagaaac tctcctggag aaattttatt aaatttagag 240ttggggccg atttgaaccc ttatttgct catttgtcaa ggatgtacaa tggtgct 300ggtggagtgg aagttcaggt gctgaccgtgttcactgccgg aaagatcctc 360ttcgccgccg tcccgccaaa tttcccagtg gaattcttaa gcccagccca gatcacaatg 420ctcccacatt taatagtaga tgttaggact cttgaaccaa ttatgatccc actccctgat 480gttaggaata cattcttcca ttatagtaac cagcctaaca gccgcatgag attagtggct 540atgctctata ccccactcag atctaatggc tcaggtgatg atgtctttac tgtctcttgc 600agggtcttga ctaggcctac tcctgatttt gagttcactt atttagtgcc accttctgtt 660gaatctaaaa ctaagccttt ttccttacct attttaaccc tttctgagct cacaaattcg 720aggtttccag tccccatcga ttcgcttttc accgcccaga ataatgtgtt gcaggtgcag 780tgtcaaaatg gcaggtgtac acttgatggt gagttacaag gcacaaccca gttgctccca 840actggcatct gtgcattcag aggacgggtg acagcacaaa ttaaccaacg tgacaggtgg 900cacatgcaac tgcaaaacct caatggtaca acatatgacc caactgatga tgtgccagcc 960ccgctgggta cacctgactt caagggcgtc gtgtttggga tggtaagcca aagaaatgtg 1020ggtaatgatg cgcctggctc aaccagagcc caacaggcgt gggtttcaac ctatagcccc 1080caatttgtcc ccaaattagg ttctgtcaat cttaggatta gtgataatga tgatttccaa 1140ttccagccga caaaattcac accagtgggc gtcaatgatg acgatgatgg ccacccgttc1200agacaatggg aactaccaaa ctattcaggg gagcttacct tgaatatgaa tcttgccccc 1260ccagttgctc caaattttcc tggtgaacaa ttgttattct tcagatcttt cgtgccatgc 1320tcaggaggtt acaaccaagggat tccac 1380ttctatcagg aatcagcacc ctcccagtca gacgtggccc taatcaggta tgtcaacccc 1440gatacgggac gtacactgtt tgaagcaaaa ttgcacagat ctggttacat cactgtggct 1500cactctggag actatcctct tgttaattggcg gcctc 1560gtaaatcagt tttactcact cgccccaatg ggaactggga atgggcgaag gagggctcag 1620taa 1623 <210> 5 <211> 542 <212> PRT <213> Homo sapiens <400> 5Met Lys Met Ala Ser Asn Asp Ala Ala Pro Ser Thr Asp Gly Ala Ala1 5 10 15Gly Leu Val Pro Glu Ser Asn Asn Glu Val Met Ala Leu Glu Pro Val20 25 30Ala Gly Ala Ala Leu Ala Ala Pro Val Thr Gly Gln Thr Asn Ile Ile35 45 45 Plep 40 Plep T Arsp IA Pro Ser Val Gln Ala Pro Asn Gly Glu Phe50 55 60Thr Val Ser Pro Arg Asn Ala Pro Gly Glu Val Leu Leu Asn Leu Glu65 70 75 80Leu Gly Pro Glu Leu Asn Pro Tyr Leu Ala His Leu Ala Arg Met Tyr85 90 95Asn Tyr Gly AlaGly Gly Met Glu Val Gln Val Met Leu Ala Gly Asn100 105 110Ala Phe Thr Ala Gly Lys Leu Val Phe Ala Ala Val Pro Pro His Phe115 120 125Pro Ile Glu Asn Leu Ser Pro Gln Gln Ile Thr Met Phe Pro His Val130 135 140Ile Ile Asp Val Arg Thr Leu Glu Pro Val Leu Leu Pro Leu Pro Asp145 150 155 160Val Arg Asn Asn Phe Phe His Tyr Asn Gln Lys Asp Asp Pro Lys Met165 170 175Arg Ile Val Ala Met Leu Tyr Thr Pro Leu Arg Ser Asn Gly Ser Gly180 185 190Asp Asp Val Phe Thr Val Ser Cys Arg Val Leu Thr Arg Pro Ser Pro195 200 205Asp Phe Asp Phe Thr Tyr Leu Val Pro Pro Thr Val Glu Ser Lys Thr210 215 220Lys Pro Phe Thr Leu Pro Ile Leu Thr Leu Gly Glu Leu Ser Asn Ser225 230 235 240Arg Phe Pro Val Ser Ile Asp Gln Met Tyr Thr Ser Pro Asn Glu Ile245 250 255Ile Ser Val Gln Cys Gln Asn Gly Arg Cys Thr Leu Asp Gly Glu Leu260 265 270Gln Gly Thr Thr Gln Leu Gln Val Ser Gly Ile Cys Ala Phe Lys Gly275 280 285Glu Val Thr Ala His Leu His Asp Asn Asp His Leu Tyr Asn Val Thr290 295 300Ile Thr Asn Leu Asn Gly Ser Pro Phe Asp ProSer Glu Asp Ile Pro305 310 315 320Ala Pro Leu Gly Val Pro Asp Phe Gln Gly Arg Val Phe Gly Ile Ile325 330 335Ser Gln Arg Asp Lys His Asn Ser Pro Gly His Asn Glu Pro Ala Asn340 345 350Arg Gly His Asp Ala Val Val Pro Thr Tyr Thr Ala Gln Tyr Thr Pro355 360 365Lys Leu Gly Gln Ile Gln Ile Gly Thr Trp Gln Thr Asp Asp Leu Thr370 375 380Val Asn Gln Pro Val Lys Phe Thr Pro Val Gly Leu Asn Asp Thr Glu385 390 395 400His Phe Asn Gln Trp Val Val Pro Arg Tyr Ala Gly Ala Leu Asn Leu405 410 415Asn Thr Asn Leu Ala Pro Ser Val Ala Pro Val Phe Pro Gly Glu Arg420 425 430Leu Leu Phe Phe Arg Ser Tyr Ile Pro Leu Lys Gly Gly Tyr Gly Asn435 440 445Pro Ala Ile Asp Cys Leu Leu Pro Gln Glu Trp Val Gln His Phe Tyr450 455 460Gln Glu Ala Ala Pro Ser Met Ser Glu Val Ala Leu Val Arg Tyr Ile465 470 475 480Asn Pro Asp Thr Gly Arg Ala Leu Phe Glu Ala Lys Leu His Arg Ala485 490 495Gly Phe Met Thr Val Ser Ser Asn Thr Ser Ala Pro Val Val Val Pro500 505 510Ala Asn Gly Tyr Phe Arg Phe Asp Ser Trp Val Asn Gln Phe Tyr Ser515 520525Leu Ala Pro Met Gly Thr Gly Asn Gly Arg Arg Arg Val Gln530 535 540 <210> 6 <211> 1629 <212> DNA <213> Homo sapiens <400> 6atgaagatgg cgtcgaatga cgccgctcca tctactgatg gtgcagccgg cctcgtgcca 60gaaagtaaca atgaggtcat ggctcttgaa cccgtggctg gtgccgcctt ggcagccccg 120gtcaccggtc aaacaatatc tatagaatctta tgaacctt cagggattc 180aatggtgaat ttacagtctc tccccgaaat gcccctggtg aagtgctact gaatcttagag 240ttgggtccag aattaaatcc ttatctggca catttagcaa gaatgtacaa tgggtatgcc 300ggtgggatgg aggtgcaggt catgttggct gggaacgcgcgcgcg tcag 360ttcgccgccg tgccacccca cttcccgatt gaaaacctta gcccacagca aatcaccatg 420ttccctcatg tgattataga tgtgagaacc ttggaacctg ttttattacc actccctgat 480gttaggaata acttcttcca ttataaccag aaagatgatc ccagagatctcttagtagta4 cccccctcag gtctaatggt tcaggtgatg atgtgtttac agtctcctgt 600agagtgttga ctagaccttc ccctgacttt gacttcacat acctggtgcc accaacagtg 660gagtctaaaa caaagccatt caccctccca atcctcacac ttggatct cccaggtt cc720g tgtctataga ccagatgtac accagccctaatgaaattat atcagtgcag 780tgtcaaaatg gtaggtgcac actggacggg gagctccaag ggacaacaca actccaagtc 840agtggcattt gtgctttcaa aggtgaagtg accgcccact tacatgacaa tgatcaccta 900tataatgtca ccatcacaaa cttgaatggg tccccttttg atccctccga ggatatccct 960gcccctctgg gtgtgcctga cttccaggga agggtttttg gtatcatctc ccaaagagat 1020aaacacaata gtcctgggca taatgaacca gcaaacaggg gacacgacgc tgtggtccct 1080acttacacag cacagtacac tccaaaactt ggacaaattc aaattggcac atggcaaact 1140gacgacctta cagtcaacca accagtcaaa ttcaccccag ttggactcaa tgacactgaa 1200cactttaacc aatgggtggtccctaggtat gctggtgccc taaacctcaa tacaaacctt 1260gccccttctg ttgctccagt atttccggga gagcgcctgc tcttcttcag atcatacatt 1320cccctcaagg gcggttatgg aaacccagcc attgattgcc tactgccaca agagtgggtg 1380caacacttct atcaggaagc agccccttca atgagtgagg tggccctcgt cagatacatc 1440aacccggaca ctggtcgggc actgtttgag gccaagctcc acagagctgg tttcatgaca 1500gtctcgagca acaccagtgc cccggtggtt gtgcctgcca acgggtactt cagatttgat 1560tcttgggtga accaatttta ttctctcgcc cccatgggaa ctgggaatgg gcgtagaagg1620gtccaataa 1629<---
Claims
1. A vaccine preparation for administration through the nose, comprising a complex of a nanogel and a vaccine antigen, in which the vaccine antigen is coated with a nanogel, which is characterized in that the diameter of the vaccine antigen particles is 30 nm or more or 600 nm or less.
2. A vaccine preparation according to paragraph 1, which is characterized in that the vaccine antigen is a substance of a larger size than the nanogel particle.
3. A vaccine preparation according to claim 1 or 2, which is characterized in that the vaccine antigen is a VLP (virus-like particle), an inactivated virus, a protein molecule or polymer.
4. A vaccine preparation according to any one of paragraphs 1-3, which is characterized in that the vaccine antigen and the nanogel are in a complex with each other in a molar ratio of 1:15 to 1:
200.
5. A vaccine preparation according to any one of paragraphs 1-4, which is characterized in that it additionally contains an adjuvant.