Test system for determining origin of atlantic salmon products

Abstract

FIELD: biotechnology.SUBSTANCE: test system for identifying the origin of Atlantic salmon individuals or products has been proposed. The test system consists of three sets of DNA primers: WA1 set consisting of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3; WA2 set consisting of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6; WA3 set consisting of SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9. After performing an analysis using the proposed invention, it becomes possible to determine whether the analysed sample of Atlantic salmon belongs to industrial aquaculture or was removed from the wild population during poaching.EFFECT: identifying the origin of both whole fish samples and marketed Atlantic salmon products.1 cl, 4 dwg, 4 ex

Description

[0001] Field of technology to which the invention relates

[0002] The invention relates to the field of molecular biology. Three sets of oligonucleotide primers are proposed for determining whether Atlantic salmon belong to industrial aquaculture or to a natural (wild) population from which the individuals were removed during poaching.

[0003] Technology Level

[0004] Modern Atlantic salmon aquaculture emerged in Norway in the first half of the 1970s. During this time, aquaculture salmon have undergone such significant genetic changes compared to wild salmon through selective breeding that some authors propose classifying them as a new species, Salmo domesticus (Gross MR, 1998. One species with two biologies: Atlantic salmon (Salmo salar) in the wild and in aquaculture. Canadian Journal of Fisheries and Aquatic Sciences 55, https: / / doi.org / 10.1139 / d98-024).

[0005] Integrated DNA Technologies, Inc. (Coralville, Iowa, USA) has patented the KASP technology in the United States (US Patent No. 20170145486. May 25, 2017. US Patent No. 20170253925. Sep 7, 2017. and US Patent No. 20170260583. Sep 14, 2017), which is similar in molecular mechanism of action to the present invention.

[0006] A cod fish identification system using real-time PCR exists, similar in molecular mechanism to the present invention (patent RU 2 748 058 C1, expired June 9, 2023). However, it is used, firstly, for species identification (rather than population identification, as with the present invention), and, secondly, the dye binds to double-stranded DNA (while the present invention uses probes carrying a fluorescent particle). The principle of high-quality staining, based on the use of pre-prepared probes with a fluorescent label, is used in a test system for the identification of DNA from the tissue of the Far Eastern sardine in fish products (patent RU 2 823 069 C1) and similar test systems for Japanese mackerel (patent RU 2 816 210 C1) and Pacific saury (patent RU 2 822 748 C1).However, these methods are used to obtain a "yes" or "no" result regarding the presence of DNA of one species, while the described invention makes it possible to determine the pedigree of an individual whose DNA has been identified.

[0007] A method based on KASP technology has been successfully applied for species identification of closely related accessions. For example, a test system based on 50 loci has been described that can potentially be used to identify six yam species (Agre et al., 2024. Identification of diagnostic KASP-SNP markers for routine breeding activities in yam (Dioscorea spp.). Plant Genome 17(2):e20419. doi: 10.1002 / tpg2.20419).

[0008] Disclosure of the essence of the invention

[0009] The technical objective of the claimed invention is to create a method for identifying the poached or aquaculture origin of samples of commercial Atlantic salmon products. This objective is achieved using three sets of oligonucleotide primers. To obtain the most accurate result, the sample must be treated with each of the three sets of primers (selected based on the Atlantic salmon reference genome Salmo salarRefSeq GCF_905237065.1):

[0010] Locus WA1 (by polymorphism at position NC_059451.1:70769986):

[0011] Direct primers

[0012] WA1_t(GAAGGTGACCAAGTTCATGCTGCCTGATCTGGCTCGTTCATTAATT),

[0013] WA1_g (GAAGGTCGGAGTCAACGGATTCCTGATCTGGCTCGTTCATTAATG)

[0014] and reverse primer

[0015] WA1_R (CATTGGACTTTGGCAGGATTTTT);

[0016] WA2 locus (by polymorphism at position NC_059442.1:131879677):

[0017] Direct primers

[0018] WA2_ag(GAAGGTGACCAAGTTCATGCTGATACGTTTATTTTGATATTGATTGGCTAG),

[0019] WA2_gg (GAAGGTCGGAGTCAACGGATTCGTTTATTTTGATATTGATTGGCTGG)

[0020] and reverse primer

[0021] WA2_R (GCTTCCTTCACGTTTACTTTC);

[0022] Locus WA3 (by polymorphism at position NC_059451.1:37660924:

[0023] Direct primers

[0024] WA3_ac (GAAGGTGACCAAGTTCATGCTGCCGCCTATTATCTACATAGTGCAC),

[0025] WA3_cc (GAAGGTCGGAGTCAACGGATTCCGCCTATTATCTACATAGTGCCC)

[0026] and reverse primer

[0027] WA3_R (GGTGTCCCAAATGAAACCC).

[0028] Based on the results of genotyping at three loci, which is provided by the use of three sets of oligonucleotide primers, it becomes possible to classify a sample as an aquaculture or wild line.

[0029] For each of the three loci used in the described invention, the sample is characterized by one of two genotypes, determined by the fluorescence of one of the two dyes in the test system—FAM or HEX. The dye probes are attached to the terminal regions of the primers in the test system. These regions do not interact with the DNA of the test sample and are needed specifically for binding to the dye probe.

[0030] The KASP method for identification of the origin of Atlantic salmon products includes the following steps:

[0031] 1) Isolation of DNA from biological material;

[0032] 2) Carrying out KASP-type PCR reaction;

[0033] 3) Measurement of fluorescence on a spectrophotometer with fluorescence measurement function;

[0034] 4) Analysis of individuals by endpoint genotyping method based on the obtained fluorescence values ​​using specialized software (SW).

[0035] A drawback of the proposed test system is that the primer design was based on differences found between the wild Atlantic salmon line from the Russian North and the Aquagen aquaculture line. When determining the origin of Atlantic salmon from other regions or other aquaculture lines, the method may perform less well due to natural genetic differences between populations. However, during internal testing of the test system's effectiveness, this drawback did not significantly affect the quality of the final result or the accuracy of sample origin identification.

[0036] Furthermore, there are isolated cases where the number of "aquaculture" and "natural" alleles in a sample matches, in which case the test system cannot reliably determine the sample's origin. In our studies, only 5 fish out of 120 samples were unidentified. Therefore, the effectiveness of the proposed test system is 95.8%. No false positives were detected during the study. This occurs because absolute fixation of a particular allele at any of the loci used in the test system is not observed in either aquaculture or wild populations.

[0037] Brief description of figures and tables

[0038] Figure 1. Genotype distribution of wild (left) and aquacultured (right) Atlantic salmon at the WA1 locus using the WA1_t, WA1_g, and WA1_R primer set. Wild-type homozygotes are shown in green, mutant (aquacultured) homozygotes are shown in blue, and heterozygotes are shown in red.

[0039] Figure 2. Genotype distribution of wild (left) and aquacultured (right) Atlantic salmon at the WA2 locus using the WA2_ag, WA2_gg, and WA2_R primer set. Wild-type homozygotes are shown in blue, mutant (aquacultured) homozygotes are shown in green, and heterozygotes are shown in red.

[0040] Figure 3. Genotype distribution of wild (left) and aquacultured (right) Atlantic salmon at the WA3 locus using the WA3_ac, WA3_cc, and WA3_R primer set. Wild-type homozygotes are shown in green, mutant (aquacultured) homozygotes are shown in blue, and heterozygotes are shown in red.

[0041] Figure 4. Results of analysis of 120 Atlantic salmon individuals at three loci in the Structure program. The probability of an individual having wild ancestry is indicated in green, and that of aquaculture is indicated in red. The number in parentheses after the sample number indicates the actual origin of the individual determined before the analysis: 1 - wild population (individuals 1-47 and 95-110), 2 - aquaculture (individuals 48-94 and 111-120).

[0042] Implementation of the invention

[0043] This invention provides a method for identifying the natural or aquaculture origin of fish and market product samples of Atlantic salmon.

[0044] Tissue samples for analysis. Various tissues from Atlantic salmon can be used as material for analysis, but pectoral fins are preferred because they are easy to prepare and provide sufficient DNA for analysis.

[0045] DNA extraction.DNA extraction can be carried out by any conventional method. In our work, we mainly used the salt extraction method (Aljanabi S M & Martinez I 1997. Universal and rapid salt-extraction of high quality gnomic DNA for PCR-based techniques. Nucleic Acids Research. 25 (20): 4692-4693) and extraction using the phenol method (Maniatis T., Fritsch E., Sambrook J. Molecular cloning. Moscow: Mir, 1984. 480 p.), as well as sorbent-containing columns (Sigma).

[0046] Selection of specific primersPrimers for the test system were selected based on analysis performed by the authors of the present invention. Single nucleotide polymorphisms (SNPs) were identified that contribute most to the genetic differences between the wild Atlantic salmon strain and its aquacultured strain, AquaGen. Primers were selected for these polymorphisms and included in the WA1, WA2, and WA3 kits. The primer selection process involved selecting two forward primers—one specific to the wild strain and one specific to the aquaculture strain—and a common reverse primer. This ensures that only one forward primer from each pair will be active for at least one locus in the individual being analyzed.

[0047] Conducting PCR (polymerase chain reaction)All PCR reactions for subsequent fluorescence genotyping are carried out in a volume of 10 μl under the following conditions: 5 μl of KASP buffer (LGC Ltd., UK) or 2x HiGeno Probe Mix A buffer (JasonGen Biotech Co., Ltd., China), 0.14 μl of a mixture of three primers (the composition of the mixture per 100 μl: 12 μl of forward primer with FAM probe, 12 μl of forward primer with HEX probe, 30 μl of total reverse primer, 46 μl of mQ water; primers manufactured by Evrogen, Russia) and 2 μl of DNA extract, 3 μl of mQ water.

[0048] Fluorescence measurementFluorescence is measured using a Roche LightCycler 480 (F. Hoffmann-La Roche Ltd., Switzerland) or equivalent real-time PCR (RT-PCR) instrument. The instrument must be equipped with a device for the emission and absorption of light with a wavelength of 450-600 nm. Samples with a fluorescent FAM dye label are irradiated with light at a wavelength of 465 nm, after which fluorescence is measured at a wavelength of 510 nm. Samples with a fluorescent HEX dye label are irradiated with light at a wavelength of 533 nm, after which fluorescence is measured at a wavelength of 580 nm.

[0049] Endpoint genotyping The analysis is performed by mapping each sample on a dual-axis graph. During testing for this patent, the analysis was performed using LightCycler 480 Software SP3, but the resulting fluorescence values ​​can be mapped using any other software that supports dual-axis graphing.

[0050] The X-axis of the graph displays the fluorescence values ​​of the FAM dye, and the Y-axis displays the fluorescence values ​​of the HEX dye. When analyzing a group of samples (three or more + negative control), the genotype of each sample is determined for each of the three loci: homozygous for the "natural" allele, homozygous for the "aquaculture" allele, or heterozygous.

[0051] The method for determining the origin of an individual is based on the fact that "aquaculture" primers are characteristic of the genome of aquacultured Atlantic salmon, but not of the genome of wild Atlantic salmon. Therefore, if a sample carries the "aquaculture" allele at the locus in question, it will not react with the "natural" primer, the corresponding dye will not work, and based on the fluorescence of the second, active dye, the genotype at the locus in question will be determined as aquacultured after analysis. The same is true in reverse—a reaction with the "natural" primer will determine the genotype at the locus in question as wild.

[0052] Determination of origin is performed at three loci: a homozygote for the "aquaculture" allele is assigned a value of 0, a heterozygote is assigned a value of 1, and a homozygote for the "natural" allele is assigned a value of 2. The values ​​for the three loci are then summed. If this sum is less than 3, the sample is of aquaculture origin; if it is greater than 3, the sample is of natural origin. A sum of 3 does not reliably determine the sample's origin, but such cases are rare (during internal testing, the number of such samples was 5 out of a total sample of 120).

[0053] Example 1. Sample preparation and DNA extraction. The right pectoral fin of each of the 120 analyzed individuals was cut off, placed in lysis solution, and DNA extraction was performed using the salt method according to Aljanabi and Martinez, 1997.

[0054] Example 2. PCR setup. Before PCR, use a multichannel pipette to aspirate 2 µl of each DNA sample and transfer it to a new plastic semi-skirted PCR plate. Then, prepare a master mix of PCR solution as follows: each component of the master mix is ​​taken in quantities equal to 94 (the number of samples) + 4 (correction for pipette error). Thus, the master mix described in this example will consist of 500 µl of 2x HiGeno Probe Mix A buffer (JasonGen Biotech Co., Ltd., China), 14 µl of a three-primer mix (mixture composition per 100 µl: 12 µl of forward primer with FAM probe, 12 µl of forward primer with HEX probe, 30 µl of total reverse primer, 46 µl of mQ water; primers manufactured by Evrogen, Russia) and 300 µl of mQ water. This master mix is ​​added to each well of a semi-skirted PCR plate (i.e., to each DNA sample and / or control) in an amount of 8 µl.The plate with samples and the master mix added to them is placed in a Bio-Rad C1000 Touch thermocycler (Bio-Rad Laboratories, Inc., California, USA) or similar according to the following temperature protocol:.

[0055] Pre-annealing at 94°C - 15 min.

[0056] 10 cycles:

[0057] Denaturation 94°C - 20 sec.

[0058] Annealing / elongation 61-55°C (decreases by 0.6°C each cycle) - 1 min.

[0059] 35 cycles:

[0060] Denaturation 94°C - 20 sec.

[0061] Annealing / elongation 55°C - 1 min.

[0062] Total 45 cycles.

[0063] Example 3. Fluorescence Measurement. The PCR plate containing the samples and master mix is ​​placed in a Roche LightCycler 480 real-time PCR instrument (F. Hoffmann-La Roche Ltd., Switzerland) or equivalent. The plate is incubated at 37°C to bring the samples to a suitable temperature for fluorescence measurement. The plate is then sequentially irradiated with light at 465 nm, recording the fluorescence value at 510 nm, and with light at 533 nm, recording the fluorescence value at 580 nm.

[0064] Example 4. Endpoint genotyping. The obtained fluorescence values ​​are plotted on a graph, with the FAM dye fluorescence values ​​distributed along the X-axis and the HEX dye fluorescence values ​​along the Y-axis. Based on the ratio of these values, the genotype is determined for each sample at each locus: two graphs are obtained (one for the wild-type form, one for the aquaculture form) for each of the three loci of the test system. (See Figures 1-3).

[0065] Based on the analysis of the obtained results, the origin of the individual is determined as described in the "Embodiment of the Invention" section. It is also possible to separate samples into natural and aquaculture populations using specialized software. In this example, we present an analysis of the same individuals (see Figure 4), performed using genotyping based on dye pair fluorescence data in the Structure program (Pritchard, JK, Stephens, M., and Donnelly, P. (2000). Inference of population structure using multilocus genotype data. Genetics, 155:945-959).

[0066] --->

[0067] <?xml version="1.0" encoding="UTF-8"?>

[0068] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0069] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0070] <ST26SequenceListing originalFreeTextLanguageCode="en"

[0071] nonEnglishFreeTextLanguageCode="en" dtdVersion="V1_3"

[0072] fileName="Test system for determining the origin of products from

[0073] Atlantic salmon.xml" softwareName="WIPO Sequence"

[0074] softwareVersion="2.3.0" productionDate="2025-07-21">

[0075] <applicationidentification>

[0076] <ipofficecode> RU< / ipofficecode>

[0077] <applicationnumbertext> 2024139248 / 20(086927)< / applicationnumbertext>

[0078] <filingdate> 2024-12-24< / filingdate>

[0079] < / applicationidentification>

[0080] <earliestpriorityapplicationidentification>

[0081] <ipofficecode> RU< / ipofficecode>

[0082] <applicationnumbertext> 2024139248 / 20(086927)< / applicationnumbertext>

[0083] <filingdate> 2024-12-24< / filingdate>

[0084] < / earliestpriorityapplicationidentification>

[0085] <applicantname languagecode="ru">Nicholas Muege

[0086] Sergeevich< / applicantname>

[0087] <applicantnamelatin> Mugue Nikolai Sergeevich< / applicantnamelatin>

[0088] <inventiontitle languagecode="ru">Test system for determination

[0089] Origin of Atlantic salmon products< / inventiontitle>

[0090] <sequencetotalquantity> 9< / sequencetotalquantity>

[0091] <sequencedata sequenceidnumber="1">

[0092] <insdseq>

[0093] <INSDSeq_length>46< / INSDSeq_length>

[0094] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0095] <INSDSeq_division>PAT< / INSDSeq_division>

[0096] <INSDSeq_feature-table>

[0097] <insdfeature>

[0098] <INSDFeature_key>source< / INSDFeature_key>

[0099] <INSDFeature_location>1..46< / INSDFeature_location>

[0100] <INSDFeature_quals>

[0101] <insdqualifier>

[0102] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0103] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0104] < / insdqualifier>

[0105] <insdqualifier id="q19">

[0106] <INSDQualifier_name>note< / INSDQualifier_name>

[0107] <INSDQualifier_value>WA1_t< / INSDQualifier_value>

[0108] < / insdqualifier>

[0109] <insdqualifier id="q2">

[0110] <INSDQualifier_name>organism< / INSDQualifier_name>

[0111] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0112] < / insdqualifier>

[0113] < / INSDFeature_quals>

[0114] < / insdfeature>

[0115] < / INSDSeq_feature-table>

[0116] <INSDSeq_sequence>gaaggtgaccaagttcatgctgcctgatctggctcgttcattaatt

[0117] NSDSeq_sequence>

[0118] < / insdseq>

[0119] < / sequencedata>

[0120] <sequencedata sequenceidnumber="2">

[0121] <insdseq>

[0122] <INSDSeq_length>45< / INSDSeq_length>

[0123] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0124] <INSDSeq_division>PAT< / INSDSeq_division>

[0125] <INSDSeq_feature-table>

[0126] <insdfeature>

[0127] <INSDFeature_key>source< / INSDFeature_key>

[0128] <INSDFeature_location>1..45< / INSDFeature_location>

[0129] <INSDFeature_quals>

[0130] <insdqualifier>

[0131] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0132] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0133] < / insdqualifier>

[0134] <insdqualifier id="q20">

[0135] <INSDQualifier_name>note< / INSDQualifier_name>

[0136] <INSDQualifier_value>WA1_g< / INSDQualifier_value>

[0137] < / insdqualifier>

[0138] <insdqualifier id="q4">

[0139] <INSDQualifier_name>organism< / INSDQualifier_name>

[0140] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0141] < / insdqualifier>

[0142] < / INSDFeature_quals>

[0143] < / insdfeature>

[0144] < / INSDSeq_feature-table>

[0145] <INSDSeq_sequence>gaaggtcggagtcaacggattcctgatctggctcgttcattaatg< / IN

[0146] SDSeq_sequence>

[0147] < / insdseq>

[0148] < / sequencedata>

[0149] <sequencedata sequenceidnumber="3">

[0150] <insdseq>

[0151] <INSDSeq_length> 22< / INSDSeq_length>

[0152] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0153] <INSDSeq_division> PAT< / INSDSeq_division>

[0154] <INSDSeq_feature-table>

[0155] <insdfeature>

[0156] <INSDFeature_key>source< / INSDFeature_key>

[0157] <INSDFeature_location>1..22< / INSDFeature_location>

[0158] <INSDFeature_quals>

[0159] <insdqualifier>

[0160] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0161] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0162] < / insdqualifier>

[0163] <insdqualifier id="q21">

[0164] <INSDQualifier_name>note< / INSDQualifier_name>

[0165] <INSDQualifier_value>WA1_R< / INSDQualifier_value>

[0166] < / insdqualifier>

[0167] <insdqualifier id="q6">

[0168] <INSDQualifier_name>organism< / INSDQualifier_name>

[0169] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0170] < / insdqualifier>

[0171] < / INSDFeature_quals>

[0172] < / insdfeature>

[0173] < / INSDSeq_feature-table>

[0174] <INSDSeq_sequence> cattggactttggcaggatttt< / INSDSeq_sequence>

[0175] < / insdseq>

[0176] < / sequencedata>

[0177] <sequencedata sequenceidnumber="4">

[0178] <insdseq>

[0179] <INSDSeq_length>52< / INSDSeq_length>

[0180] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0181] <INSDSeq_division>PAT< / INSDSeq_division>

[0182] <INSDSeq_feature-table>

[0183] <insdfeature>

[0184] <INSDFeature_key>source< / INSDFeature_key>

[0185] <INSDFeature_location>1..52< / INSDFeature_location>

[0186] <INSDFeature_quals>

[0187] <insdqualifier>

[0188] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0189] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0190] < / insdqualifier>

[0191] <insdqualifier id="q22">

[0192] <INSDQualifier_name>note< / INSDQualifier_name>

[0193] <INSDQualifier_value>WA2_ag< / INSDQualifier_value>

[0194] < / insdqualifier>

[0195] <insdqualifier id="q8">

[0196] <INSDQualifier_name>organism< / INSDQualifier_name>

[0197] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0198] < / insdqualifier>

[0199] < / INSDFeature_quals>

[0200] < / insdfeature>

[0201] < / INSDSeq_feature-table>

[0202] <INSDSeq_sequence>gaaggtgaccaagttcatgctgatacgtttattttgatatttgattggc

[0203] tag< / INSDSeq_sequence>

[0204] < / insdseq>

[0205] < / sequencedata>

[0206] <sequencedata sequenceidnumber="5">

[0207] <insdseq>

[0208] <INSDSeq_length>48< / INSDSeq_length>

[0209] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0210] <INSDSeq_division>PAT< / INSDSeq_division>

[0211] <INSDSeq_feature-table>

[0212] <insdfeature>

[0213] <INSDFeature_key>source< / INSDFeature_key>

[0214] <INSDFeature_location>1..48< / INSDFeature_location>

[0215] <INSDFeature_quals>

[0216] <insdqualifier>

[0217] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0218] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0219] < / insdqualifier>

[0220] <insdqualifier id="q23">

[0221] <INSDQualifier_name>note< / INSDQualifier_name>

[0222] <INSDQualifier_value>WA2_gg< / INSDQualifier_value>

[0223] < / insdqualifier>

[0224] <insdqualifier id="q10">

[0225] <INSDQualifier_name>organism< / INSDQualifier_name>

[0226] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0227] < / insdqualifier>

[0228] < / INSDFeature_quals>

[0229] < / insdfeature>

[0230] < / INSDSeq_feature-table>

[0231] <INSDSeq_sequence>gaaggtcggagtcaacggattcgtttattttgatatttgattggctgg<

[0232] / INSDSeq_sequence>

[0233] < / insdseq>

[0234] < / sequencedata>

[0235] <sequencedata sequenceidnumber="6">

[0236] <insdseq>

[0237] <INSDSeq_length>22< / INSDSeq_length>

[0238] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0239] <INSDSeq_division>PAT< / INSDSeq_division>

[0240] <INSDSeq_feature-table>

[0241] <insdfeature>

[0242] <INSDFeature_key>source< / INSDFeature_key>

[0243] <INSDFeature_location>1..22< / INSDFeature_location>

[0244] <INSDFeature_quals>

[0245] <insdqualifier>

[0246] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0247] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0248] < / insdqualifier>

[0249] <insdqualifier id="q24">

[0250] <INSDQualifier_name>note< / INSDQualifier_name>

[0251] <INSDQualifier_value>WA2_R< / INSDQualifier_value>

[0252] < / insdqualifier>

[0253] <insdqualifier id="q12">

[0254] <INSDQualifier_name>organism< / INSDQualifier_name>

[0255] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0256] < / insdqualifier>

[0257] < / INSDFeature_quals>

[0258] < / insdfeature>

[0259] < / INSDSeq_feature-table>

[0260] <INSDSeq_sequence>gcttcccttcacgtttactttc< / INSDSeq_sequence>

[0261] < / insdseq>

[0262] < / sequencedata>

[0263] <sequencedata sequenceidnumber="7">

[0264] <insdseq>

[0265] <INSDSeq_length>46< / INSDSeq_length>

[0266] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0267] <INSDSeq_division>PAT< / INSDSeq_division>

[0268] <INSDSeq_feature-table>

[0269] <insdfeature>

[0270] <INSDFeature_key>source< / INSDFeature_key>

[0271] <INSDFeature_location>1..46< / INSDFeature_location>

[0272] <INSDFeature_quals>

[0273] <insdqualifier>

[0274] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0275] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0276] < / insdqualifier>

[0277] <insdqualifier id="q25">

[0278] <INSDQualifier_name> note< / INSDQualifier_name>

[0279] <INSDQualifier_value> WA3_ac< / INSDQualifier_value>

[0280] < / insdqualifier>

[0281] <insdqualifier id="q14">

[0282] <INSDQualifier_name>organism< / INSDQualifier_name>

[0283] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0284] < / insdqualifier>

[0285] < / INSDFeature_quals>

[0286] < / insdfeature>

[0287] < / INSDSeq_feature-table>

[0288] <INSDSeq_sequence>gaaggtgaccaagttcatgctgccgcctattatctacatagtgcac

[0289] NSDSeq_sequence>

[0290] < / insdseq>

[0291] < / sequencedata>

[0292] <sequencedata sequenceidnumber="8">

[0293] <insdseq>

[0294] <INSDSeq_length>45< / INSDSeq_length>

[0295] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0296] <INSDSeq_division>PAT< / INSDSeq_division>

[0297] <INSDSeq_feature-table>

[0298] <insdfeature>

[0299] <INSDFeature_key>source< / INSDFeature_key>

[0300] <INSDFeature_location>1..45< / INSDFeature_location>

[0301] <INSDFeature_quals>

[0302] <insdqualifier>

[0303] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0304] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0305] < / insdqualifier>

[0306] <insdqualifier id="q26">

[0307] <INSDQualifier_name> note< / INSDQualifier_name>

[0308] <INSDQualifier_value> WA3_cc< / INSDQualifier_value>

[0309] < / insdqualifier>

[0310] <insdqualifier id="q16">

[0311] <INSDQualifier_name>organism< / INSDQualifier_name>

[0312] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0313] < / insdqualifier>

[0314] < / INSDFeature_quals>

[0315] < / insdfeature>

[0316] < / INSDSeq_feature-table>

[0317] <INSDSeq_sequence>gaaggtcggagtcaacggattccgcctattatctacatagtgccc< / IN

[0318] SDSeq_sequence>

[0319] < / insdseq>

[0320] < / sequencedata>

[0321] <sequencedata sequenceidnumber="9">

[0322] <insdseq>

[0323] <INSDSeq_length> 19< / INSDSeq_length>

[0324] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0325] <INSDSeq_division> PAT< / INSDSeq_division>

[0326] <INSDSeq_feature-table>

[0327] <insdfeature>

[0328] <INSDFeature_key>source< / INSDFeature_key>

[0329] <INSDFeature_location>1..19< / INSDFeature_location>

[0330] <INSDFeature_quals>

[0331] <insdqualifier>

[0332] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0333] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0334] < / insdqualifier>

[0335] <insdqualifier id="q27">

[0336] <INSDQualifier_name> note< / INSDQualifier_name>

[0337] <INSDQualifier_value> WA3_R< / INSDQualifier_value>

[0338] < / insdqualifier>

[0339] <insdqualifier id="q18">

[0340] <INSDQualifier_name>organism< / INSDQualifier_name>

[0341] <INSDQualifier_value>Salmo salar< / INSDQualifier_value>

[0342] < / insdqualifier>

[0343] < / INSDFeature_quals>

[0344] < / insdfeature>

[0345] < / INSDSeq_feature-table>

[0346] <INSDSeq_sequence> ggtgtcccaaatgaaaccc< / INSDSeq_sequence>

[0347] < / insdseq>

[0348] < / sequencedata>

[0349]

[0350] <---

Images